Collagenase preparations and their uses

A collagenase from Lysinibacillus fusiformis addresses safety and stability issues by producing CTP and tenderizing meat efficiently, with high thermal and alkaline stability.

JP7719766B2Active Publication Date: 2025-08-06AMANO ENZYME INC

Patent Information

Application Number
JP2022512545
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-31
Filing Date
2021-03-30
Publication Date
2025-08-06
Estimated Expiration
2041-03-30

AI Technical Summary

Technical Problem

Existing collagenases are not suitable for producing collagen tripeptides (CTP) due to safety concerns and stability issues, particularly those derived from biosafety level 2 bacteria, and there is a need for a collagenase that is safe, effective, and stable for food and medical applications.

Method used

A collagenase derived from Lysinibacillus fusiformis with a specific amino acid sequence (SEQ ID NO: 1) is identified, exhibiting high thermal stability and alkaline activity, suitable for producing CTP and tenderizing meat.

Benefits of technology

The collagenase from Lysinibacillus fusiformis effectively produces CTP and tenderizes meat, maintaining activity across a wide pH range and temperature, making it suitable for industrial use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007719766000002
    Figure 0007719766000002
  • Figure 0007719766000003
    Figure 0007719766000003
  • Figure 0007719766000004
    Figure 0007719766000004
Patent Text Reader

Abstract

The present invention address the problem of providing a highly safe collagenase useful for food or medical application, and a use application of the collagenase. The present invention provides an enzyme agent containing a collagenase as an active ingredient and having an amino acid sequence that has an identity of 90% or more with respect to the amino acid sequence of SEQ ID NO: 1. The enzyme agent is useful for producing collagen tripeptides and for softening meat.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to an enzyme preparation containing collagenase as an active ingredient (collagenase preparation) and uses thereof. [Background technology]

[0002] The global market for collagen peptides, known as functional peptides, is predicted to grow. Among collagen peptides, the tripeptide Gly-XY (collagen tripeptide, hereafter sometimes abbreviated as "CTP"), the smallest unit of collagen, is highly absorbable in the body and has various functionalities, making it highly useful.

[0003] For efficient production of CTP, proteases (collagenase) that can specifically cleave collagen or gelatin at Gly residues and degrade it to tripeptides are useful. Examples of collagenases include collagenases derived from the genera Clostridium and Vibrio, and Bacillus cereus collagenase (belonging to the microbial collagenase (EC.3.4.24.3)). However, collagenase-producing bacteria are biosafety level 2 (BSL2), raising safety concerns, and therefore these are not suitable for the production of CTP for food or medical applications.

[0004] Collagenase derived from the genus Streptomyces is known as a collagenase that can be used in food applications (Patent Document 1), but it is unknown whether it can be used to produce CTP. Furthermore, existing collagenases generally have stability problems. Collagenase derived from Vibrio hollisae (collagenase derived from the Vibrio sp. 1706B strain in Patent Document 2) is known as a microbial collagenase that is considered to have excellent stability and high specific activity (Patent Documents 2 and 3). However, the thermal stability of collagenase derived from Vibrio hollisae is below 30°C, which is insufficient for practical use.

[0005] It is also known that various collagenases with different properties exist. For example, two different collagenase types (I and II) are known to be derived from the genus Clostridium histolyticum. Collagenase I has higher activity toward collagen and gelatin than collagenase II, but lower activity toward short-chain peptides (Patent Document 4). Furthermore, collagenase derived from Clostridium histolyticum is known to have a low degradation rate for excising CTP from collagen-like sequences (Patent Document 5).

[0006] Collagenase suitable for producing food-usable CTP from collagen requires that the collagenase-producing bacteria be safe, that it has the ability to decompose collagen or gelatin, and that it has the ability to produce CTP. Preferably, it also requires high stability; however, no collagenase that satisfies these conditions and has been put to practical use is known.

[0007] On the other hand, collagenase suitable for meat tenderization must be produced from safe bacteria, be collagen-specific (do not act on red meat), and preferably be highly stable. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Special Publication No. 5-16832 [Patent Document 2] Japanese Patent Application Publication No. 8-70853 [Patent Document 3] Japanese Patent Application Laid-Open No. 2010-263880 [Patent Document 4] Special Publication No. 2001-510331 [Patent Document 5] Japanese Patent Application Publication No. 2018-183106 Summary of the Invention [Problem to be solved by the invention]

[0009] Under the above circumstances, an object of the present invention is to provide a highly safe protease (collagenase) that is useful for food or medical applications, such as the production of CTP, and uses thereof. [Means for solving the problem]

[0010] The present inventors conducted extensive screening of microbial enzymes in an effort to identify a collagenase with high CTP production and high safety. As a result, they found that a specific strain of Lysinibacillus fusiformis produced a collagenase suitable for the purpose. This collagenase exhibited collagenolytic and gelatinolytic abilities and CTP production, and was expected to act specifically on collagen and gelatin, making it highly valuable for industrial use. Further investigations led to the successful identification and isolation of the gene encoding this collagenase, and the properties of this collagenase were clarified. Notably, it exhibited relatively high thermal stability and relatively stable activity in the alkaline range, making it suitable for use as a meat tenderizer containing alkaline pH adjusters such as sodium bicarbonate. [1] An enzyme preparation containing collagenase as an active ingredient, the active ingredient being an amino acid sequence having 90% or more identity with the amino acid sequence of SEQ ID NO: 1. [2] The enzyme preparation according to [1], wherein the collagenase is derived from Lysinibacillus fusiformis. [3] The enzyme preparation according to [1] or [2], which is used for producing collagen tripeptides. [4] The enzyme preparation according to [1] or [2], which is used for tenderizing meat. [5] A method for producing collagen tripeptide, characterized by allowing the enzyme preparation according to [3] to act on collagen or gelatin. [6] A method for tenderizing meat, characterized by applying the enzyme preparation described in [4] to meat. [7] A collagenase having an amino acid sequence having 99% or more identity with the amino acid sequence of SEQ ID NO: 1. [8] A gene encoding the collagenase described in [7]. [9] The gene according to [8], which consists of the base sequence of SEQ ID NO: 3 or 4. [Brief explanation of the drawings]

[0011] [Figure 1] Figure 1 shows the amino acid sequence of collagenase derived from Lysinibacillus fusiformis strain 57413. The predicted signal sequence is boxed, and the pro-sequence is underlined. [Figure 2] FIG. 2 shows the optimum temperature of collagenase derived from Lysinibacillus fusiformis strain 57413. [Figure 3] FIG. 3 shows the temperature stability of collagenase derived from Lysinibacillus fusiformis strain 57413. [Figure 4] FIG. 4 shows the optimum pH of collagenase derived from Lysinibacillus fusiformis strain 57413. [Figure 5] FIG. 5 shows the pH stability of collagenase derived from Lysinibacillus fusiformis strain 57413. [Figure 6] FIG. 6 shows the low-temperature reactivity of collagenase. [Figure 7]FIG. 7 shows the results of confirming the ability to produce the collagen tripeptide Gly-Glu-Arg. [Figure 8] FIG. 8 shows the results of confirming the ability to produce Gly-Pro-Hyp, a collagen tripeptide. [Figure 9] FIG. 9 shows the results of confirming the ability to produce the collagen tripeptide Gly-Pro-Ala. [Figure 10] FIG. 10 shows the results of measuring the softening effect on pork belly. [Figure 11] FIG. 11 shows the results of measuring the tenderizing effect on beef shoulder roast. DETAILED DESCRIPTION OF THE INVENTION

[0012] 1. Collagenase preparations and their active ingredients (collagenase) The first aspect of the present invention relates to an enzyme preparation (collagenase preparation). The enzyme preparation of the present invention (hereinafter also referred to as "the enzyme preparation") contains collagenase (hereinafter also referred to as "the enzyme") as an active ingredient. The enzyme preparation of the present invention is useful for producing collagen tripeptides, tenderizing meat, and the like (details will be described later). The collagenase as the active ingredient, i.e., the enzyme, consists of the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence equivalent to said amino acid sequence. Here, "equivalent amino acid sequence" refers to an amino acid sequence that differs in part from the reference amino acid sequence (the amino acid sequence of SEQ ID NO: 1), but the difference does not substantially affect the function of the protein (here, collagen degradation ability). Therefore, an enzyme having an equivalent amino acid sequence catalyzes the collagen degradation reaction. The level of activity is not particularly limited as long as it can function as a collagenase. However, it is preferable that the activity is the same as or higher than that of an enzyme consisting of the reference amino acid sequence (having the amino acid sequence of SEQ ID NO: 1).

[0013] The amino acid sequence of SEQ ID NO: 1 is the amino acid sequence (mature form) of collagenase derived from Lysinibacillus fusiformis. The amino acid sequence of collagenase derived from Lysinibacillus fusiformis, which also has a signal peptide and pro-sequence, is shown in SEQ ID NO: 2.

[0014] A "partial difference in the amino acid sequence" can be caused, for example, by the deletion or substitution of one or more amino acids among the amino acids constituting the amino acid sequence, the addition or insertion of one or more amino acids to the amino acid sequence, or any combination thereof. A partial difference in the amino acid sequence is permissible as long as collagenolytic activity is maintained (although some variation in activity is acceptable). As long as this condition is met, the position of the difference in the amino acid sequence is not particularly limited. Furthermore, differences in the amino acid sequence can occur at multiple positions (locations).

[0015] The number of amino acids that cause a partial difference in the amino acid sequence is, for example, a number corresponding to less than about 10% of all amino acids constituting the amino acid sequence, preferably a number corresponding to less than about 8%, more preferably a number corresponding to less than about 6%, even more preferably a number corresponding to less than about 4%, even more preferably a number corresponding to less than about 2%, and most preferably a number corresponding to less than about 1%. Thus, an equivalent protein has, for example, about 90% or more, preferably about 92% or more, more preferably about 94% or more, even more preferably about 96% or more, even more preferably about 98% or more, and most preferably about 99% or more identity with the reference amino acid sequence.

[0016] A typical example of a "partial difference in the amino acid sequence" is a mutation (change) in the amino acid sequence caused by deletion or substitution of 1 to 40 (preferably 1 to 30, more preferably 1 to 10, even more preferably 1 to 7, even more preferably 1 to 5, and even more preferably 1 to 3) amino acids among the amino acids constituting the amino acid sequence, or addition or insertion of 1 to 40 (preferably 1 to 30, more preferably 1 to 10, even more preferably 1 to 7, even more preferably 1 to 5, and even more preferably 1 to 3) amino acids to the amino acid sequence, or a combination thereof.

[0017] Preferably, an equivalent amino acid sequence is obtained by conservative amino acid substitution of an amino acid residue that is not essential for collagen degradation. Here, "conservative amino acid substitution" refers to the substitution of an amino acid residue with an amino acid residue having a side chain with similar properties. Amino acid residues are classified into several families based on their side chains, such as basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions are preferably substitutions between amino acid residues within the same family.

[0018] The percent identity (%) of two amino acid sequences can be determined, for example, by the following procedure. First, the two sequences are aligned to enable optimal comparison (for example, gaps may be introduced into the first sequence to optimize alignment with the second sequence). When a molecule (amino acid residue) at a specific position in the first sequence is the same as a molecule at the corresponding position in the second sequence, the molecules at that position are said to be identical. The identity of two sequences is a function of the number of identical positions shared by the two sequences (i.e., percent identity = number of identical positions / total number of positions × 100), and preferably, the number and size of gaps required for optimal alignment are also taken into account.

[0019] Comparison of two sequences and determination of identity can be achieved using a mathematical algorithm. An example of a mathematical algorithm that can be used for sequence comparison includes, but is not limited to, the algorithm described in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68 and modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the NBLAST program and XBLAST program (version 2.0) described in Altschul et al. (1990) J. Mol. Biol. 215:403-10. To obtain an amino acid sequence equivalent to a reference amino acid sequence, for example, a BLAST polypeptide search can be performed using the XBLAST program with a score of 50 and a word length of 3. To obtain gapped alignments for comparison, Gapped BLAST, as described in Altschul et al. (1997) Amino Acids Research 25(17):3389-3402, can be used. When using BLAST and Gapped BLAST, the default parameters of the corresponding programs (e.g., XBLAST and NBLAST) can be used. For details, see http: / / www.ncbi.nlm.nih.gov. An example of another mathematical algorithm that can be used for sequence comparison is the algorithm described by Myers and Miller (1988) Comput Appl Biosci. 4:11-17. Such an algorithm is incorporated into the ALIGN program, available, for example, on the GENESTREAM network server (IGH Montpellier, France) or the ISREC server. When using the ALIGN program for comparing amino acid sequences, for example, the PAM120 residue mass table can be used, with a gap length penalty of 12 and a gap penalty of 4.

[0020] The identity of two amino acid sequences can be determined using the GAP program in the GCG software package, using a Blossom 62 matrix or a PAM250 matrix, with gap weight=12, 10, 8, 6, or 4, and gap length weight=2, 3, or 4.

[0021] The collagenase, which is the active ingredient of the present enzyme preparation, i.e., the present enzyme, may be part of a larger protein (e.g., a fusion protein). Additional sequences in the fusion protein include sequences that aid in purification, such as multiple histidine residues, and additional sequences that ensure stability during recombinant production.

[0022] The enzyme can be obtained by culturing a microorganism that produces the collagenase (a collagenase-producing strain), such as Lysinibacillus fusiformis. The collagenase-producing strain may be a wild-type strain or a mutant strain (e.g., a mutant strain obtained by ultraviolet irradiation). An example of a collagenase-producing strain is Lysinibacillus fusiformis IFO 3528 (NBRC 15717). Lysinibacillus fusiformis IFO 3528 (NBRC 15717) is a strain stored at the NBRC (National Institute of Technology and Evaluation, Biotechnology Center) and can be purchased by following the appropriate procedures.

[0023] The present enzyme can be prepared from the culture medium and / or cells of a microorganism that produces the present enzyme. The culture conditions and method are not particularly limited as long as the present enzyme is produced. That is, a method and conditions suitable for culturing the microorganism to be used can be appropriately selected, provided that the present enzyme is produced. The culture method may be either liquid culture or solid culture, but liquid culture is preferred. The culture conditions will be explained using liquid culture as an example.

[0024] The medium is not particularly limited as long as it allows the growth of the microorganisms used. For example, it may contain carbon sources such as glucose, sucrose, gentiobiose, soluble starch, glycerin, dextrin, molasses, and organic acids; nitrogen sources such as ammonium sulfate, ammonium carbonate, ammonium phosphate, and ammonium acetate; or gelatin, peptone, yeast extract, corn steep liquor, casein hydrolysate, bran, and meat extract; and inorganic salts such as potassium salts, magnesium salts, sodium salts, phosphate salts, manganese salts, iron salts, and zinc salts. Vitamins, amino acids, and the like may be added to the medium to promote the growth of the microorganisms used. The pH of the medium is adjusted to, for example, about 3 to 8, preferably about 4 to 7, and the culture temperature is usually about 20 to 40°C, preferably about 25 to 35°C, under aerobic conditions for 1 to 20 days, preferably about 3 to 10 days. Examples of culture methods that can be used include shaking culture and aerobic submerged culture using a jar fermenter.

[0025] After culturing under the above conditions, the target enzyme is recovered from the culture medium or bacterial cells. When recovering from the culture medium, for example, the culture supernatant is filtered, centrifuged, or the like to remove insoluble matter, and then the enzyme can be obtained by separating and purifying the enzyme using an appropriate combination of methods, such as concentration using an ultrafiltration membrane, salting out using ammonium sulfate precipitation, dialysis, and various types of chromatography using ion exchange resins. On the other hand, when recovering from bacterial cells, the enzyme can be obtained by disrupting the bacterial cells, for example, by pressure treatment or ultrasonic treatment, and then separating and purifying the enzyme in the same manner as above. Note that the bacterial cells may be recovered from the culture medium in advance by filtration, centrifugation, or the like, and then the above series of steps (disruption, separation, and purification of the bacterial cells) may be carried out.

[0026] The present enzyme can also be easily prepared by genetic engineering techniques. For example, it can be prepared by transforming a suitable host cell (e.g., Escherichia coli) with DNA encoding the present enzyme and recovering the protein expressed in the transformant. The recovered protein is then purified as appropriate depending on the purpose. Obtaining the desired enzyme as a recombinant protein in this way allows for various modifications. For example, by inserting the DNA encoding the present enzyme and other appropriate DNA into the same vector and producing a recombinant protein using the vector, it is possible to obtain the present enzyme as a recombinant protein to which any peptide or protein is linked. Furthermore, modifications such as the addition of sugar chains and / or lipids, or modifications that cause N- or C-terminal processing, may also be performed. These modifications make it possible to simplify the extraction and purification of the recombinant protein, or to impart biological functions to the protein.

[0027] Typically, gene expression and recovery of the expression product (the present enzyme) are carried out using an appropriate host-vector system as described above. However, cell-free synthesis systems can also be used. Here, "cell-free synthesis systems (cell-free transcription systems, cell-free transcription / translation systems)" refer to in vitro synthesis of mRNA and proteins encoded by template nucleic acids (DNA and mRNA) using ribosomes and transcription / translation factors derived from living cells (or obtained by genetic engineering techniques), rather than using living cells. Cell-free synthesis systems generally use cell extracts obtained by purifying cell lysates as needed. Cell extracts generally contain ribosomes, various factors such as initiation factors, and various enzymes such as tRNA, all of which are necessary for protein synthesis. During protein synthesis, various amino acids, energy sources such as ATP and GTP, and other substances necessary for protein synthesis, such as creatine phosphate, are added to the cell extract. Of course, separately prepared ribosomes, various factors, and / or various enzymes may be supplemented as needed during protein synthesis.

[0028] The development of a transcription / translation system in which each molecule (factor) required for protein synthesis is reconstituted has also been reported (Shimizu, Y. et al.: Nature Biotech., 19, 751-755, 2001). In this synthesis system, the genes for 31 factors that make up the bacterial protein synthesis system, including three initiation factors, three elongation factors, four factors involved in termination, 20 aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and methionyl-tRNA formyltransferase, were amplified from the Escherichia coli genome, and the protein synthesis system was reconstituted in vitro using these genes. Such a reconstituted synthesis system may be used in the present invention.

[0029] The term "cell-free transcription / translation system" is used interchangeably with cell-free protein synthesis system, in vitro translation system, or in vitro transcription / translation system. In an in vitro translation system, RNA is used as a template to synthesize proteins. The template RNA can be total RNA, mRNA, or an in vitro transcription product. In contrast, in an in vitro transcription / translation system, DNA is used as a template. The template DNA should contain a ribosome binding domain and preferably contains an appropriate terminator sequence. In an in vitro transcription / translation system, conditions are established in which factors required for each reaction are added so that the transcription and translation reactions proceed sequentially.

[0030] The purified enzyme obtained as described above can be provided as a powder by, for example, freeze-drying, vacuum drying, or spray-drying. In this case, the purified enzyme may be dissolved in advance in acetate buffer, phosphate buffer, triethanolamine buffer, Tris-HCl buffer, or Good's buffer. Preferably, acetate buffer, phosphate buffer, or triethanolamine buffer can be used. Examples of Good's buffer include PIPES, MES, and MOPS.

[0031] The degree of purification of the enzyme is not particularly limited, but it can be purified to a state in which the Pz-peptide decomposition activity is 2 to 20 (U / g), for example, and the final form may be liquid or solid (including powder).

[0032] Through studies by the present inventors, the properties of the collagenase derived from Lysinibacillus fusiformis, which has the amino acid sequence of SEQ ID NO: 1, have been determined as follows (see the Examples below for details). Therefore, this enzyme can also be characterized by the following enzymatic properties. Details of the measurement conditions and procedures for collagenase activity when evaluating each enzymatic property are provided in the Examples below.

[0033] (1) Effect This enzyme is a collagenase that acts on collagen and gelatin to produce collagen tripeptides.

[0034] (2) Optimum temperature The optimum temperature for this enzyme is 40°C.

[0035] (3) Temperature stability The activity of this enzyme does not substantially decrease even when treated in a Tris-HCl buffer solution at pH 7 and at temperatures below 40°C (0°C to 40°C) for 30 minutes.

[0036] (4) Optimal pH The optimum pH of this enzyme is approximately 7. The optimum pH is determined based on the results of measurements, for example, in acetate buffer in the pH range of 4 to 6, in PIPES buffer in the pH range of 6 to 7, and in Tris-hydrochloric acid buffer (Tris-HCl) in the pH range of 7 to 9.

[0037] (5)pH stability This enzyme exhibits stable activity in the pH range of 5 to 9.5. For example, if the pH of the enzyme solution used for treatment is within this range, it exhibits 85% or more of its maximum activity after 30 minutes of treatment at 30°C. pH stability is determined based on the results of measurements in acetate buffer in the pH range of 4 to 6, PIPES buffer in the pH range of 6 to 7, Tris-hydrochloric acid buffer (Tris-HCl) in the pH range of 7 to 9, and glycine buffer in the pH range of 9 to 11, for example.

[0038] (6) Low-temperature reactivity When the enzyme activity of this enzyme at a reaction temperature of 40°C is taken as 100%, the relative activity of this enzyme at a reaction temperature of 30°C is 40% or more, and the relative activity of this enzyme at a reaction temperature of 20°C is 10% or more.

[0039] By allowing this enzyme to act on collagen or gelatin, collagen tripeptides Gly-XY (CTP) can be obtained, each of which has an N-terminal Gly (glycine), such as Gly-Glu-Arg, Gly-Pro-Hyp, Gly-Pro-Ala, or Gly-Ala-Hyp (Pro: proline, Hyp: hydroxyproline, Ala: alanine). This enzyme is characterized by the particularly high production of the functional peptide Gly-Glu-Arg when acting on collagen or gelatin.

[0040] The content of the active ingredient (the present enzyme) in the present enzyme preparation is not particularly limited. For example, the content of the active ingredient can be set or adjusted so that the Pz-peptide decomposition activity per gram of the present enzyme preparation is 1 U to 500 U, preferably 10 U to 300 U. The enzyme preparation of the present invention is usually provided in a solid form (e.g., granules, powder, or an immobilized enzyme in which the enzyme is immobilized on the surface or interior of a material capable of immobilizing the enzyme, such as silica or a porous polymer) or a liquid form. In addition to the active ingredient (the present enzyme), the present enzyme preparation may contain excipients, buffers, suspending agents, stabilizers, preservatives, antiseptics, physiological saline, etc. Examples of excipients that can be used include lactose, sorbitol, D-mannitol, maltodextrin, and sucrose. Examples of buffers that can be used include phosphates, citrates, and acetates. Examples of stabilizers that can be used include propylene glycol and ascorbic acid. Examples of preservatives that can be used include phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, and methylparaben. Preservatives that can be used include benzalkonium chloride, parahydroxybenzoic acid, chlorobutanol, and the like.

[0041] 2. Genes A second aspect of the present invention provides nucleic acids related to the present enzyme. Specifically, the present invention provides a gene encoding the present enzyme, a nucleic acid that can be used as a probe for identifying the nucleic acid encoding the present enzyme, and a nucleic acid that can be used as a primer for amplifying or mutating the nucleic acid encoding the present enzyme. In one embodiment, the gene of the present invention consists of DNA encoding the amino acid sequence of SEQ ID NO: 1. Specific examples of this embodiment are DNA consisting of the nucleotide sequence shown in SEQ ID NO: 3 and DNA consisting of the nucleotide sequence shown in SEQ ID NO: 4. The former DNA (SEQ ID NO: 3) encodes only the mature amino acid sequence (SEQ ID NO: 1), while the latter DNA (SEQ ID NO: 4) encodes a signal peptide and a pro-sequence in addition to the mature amino acid sequence (amino acid sequence of SEQ ID NO: 1).

[0042] The gene encoding the present enzyme is typically used to prepare the present enzyme. A genetic engineering preparation method using the gene encoding the present enzyme makes it possible to obtain the present enzyme in a more homogeneous state. This method is also suitable for preparing large quantities of the present enzyme. The use of the gene encoding the present enzyme is not limited to preparing the present enzyme. For example, the nucleic acid can also be used as an experimental tool for elucidating the mechanism of action of the present enzyme, or as a tool for designing or creating mutants (modified forms) of the present enzyme.

[0043] As used herein, the term "gene encoding the present enzyme" refers to a nucleic acid that, when expressed, gives the present enzyme, and includes not only a nucleic acid having a base sequence corresponding to the amino acid sequence of the present enzyme, but also a nucleic acid in which a sequence that does not encode an amino acid sequence is added to such a nucleic acid. Codon degeneracy is also taken into consideration.

[0044] The nucleic acids of the present invention can be prepared in an isolated state by standard genetic engineering techniques, molecular biological techniques, biochemical techniques, chemical synthesis, PCR (e.g., overlap PCR), or a combination thereof, with reference to the sequence information disclosed in this specification or the attached sequence listing.

[0045] In another aspect of the present invention, there is provided a nucleic acid that, when compared with the nucleotide sequence of the gene encoding the present enzyme, encodes a protein that is functionally equivalent but has a partial nucleotide sequence that differs (hereinafter also referred to as an "equivalent nucleic acid"; a nucleotide sequence specifying an equivalent nucleic acid is also referred to as an "equivalent nucleotide sequence"). Examples of equivalent nucleic acids include DNAs that have a nucleotide sequence containing one or more nucleotide substitutions, deletions, insertions, additions, or inversions based on the nucleotide sequence of the nucleic acid encoding the present enzyme of the present invention, and that encode a protein that has the enzymatic activity characteristic of the present enzyme (i.e., collagenase activity). Base substitutions or deletions may occur at multiple sites. Here, "multiple" refers to, for example, 2 to 40 nucleotides, preferably 2 to 20 nucleotides, and more preferably 2 to 10 nucleotides, although this varies depending on the position and type of amino acid residues in the three-dimensional structure of the protein encoded by the nucleic acid. An equivalent nucleic acid has, for example, 90% or more, preferably 92% or more, more preferably 94% or more, even more preferably 96% or more, even more preferably about 98% or more, and most preferably 99% or more identity to the reference base sequence (SEQ ID NO: 3 or SEQ ID NO: 4).

[0046] Such equivalent nucleic acids can be obtained, for example, by restriction enzyme treatment, treatment with exonuclease or DNA ligase, or by introducing mutations using site-directed mutagenesis (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York) or random mutagenesis (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York). Equivalent nucleic acids can also be obtained by other methods such as ultraviolet irradiation.

[0047] Another aspect of the present invention relates to a nucleic acid having a nucleotide sequence complementary to the nucleotide sequence of the gene encoding the present enzyme. Yet another aspect of the present invention provides a nucleic acid having a nucleotide sequence at least about 90%, 92%, 94%, 96%, 98%, or 99% identical to the nucleotide sequence of the gene encoding the present enzyme or a nucleotide sequence complementary thereto.

[0048] Another aspect of the present invention relates to a nucleic acid having a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence of a gene encoding the present enzyme or an equivalent nucleotide sequence. Here, "stringent conditions" refers to conditions under which a specific hybrid is formed and a nonspecific hybrid is not formed. Such stringent conditions are well known to those skilled in the art and can be determined with reference to, for example, Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York) or Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987). An example of stringent conditions includes incubation at approximately 50°C using a hybridization solution (50% formamide, 10x SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 5x Denhardt's solution, 1% SDS, 10% dextran sulfate, 10 μg / ml denatured salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)), followed by washing at approximately 65°C using 0.1x SSC and 0.1% SDS. An even more preferred stringent condition is, for example, a hybridization solution containing 50% formamide, 5x SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 1x Denhardt's solution, 1% SDS, 10% dextran sulfate, 10 μg / ml denatured salmon sperm DNA, and 50 mM phosphate buffer (pH 7.5).

[0049] Yet another aspect of the present invention provides a nucleic acid (nucleic acid fragment) having a portion of the nucleotide sequence of a gene encoding the present enzyme of the present invention, or a portion of a nucleotide sequence complementary thereto. Such a nucleic acid fragment can be used to detect, identify, and / or amplify a nucleic acid having the nucleotide sequence of a gene encoding the present enzyme of the present invention. The nucleic acid fragment is designed, for example, to contain at least a portion that hybridizes to a continuous nucleotide portion (e.g., about 10 to about 100 bases in length, preferably about 20 to about 100 bases in length, and more preferably about 30 to about 100 bases in length) in the nucleotide sequence of a gene encoding the present enzyme of the present invention. When used as a probe, the nucleic acid fragment can be labeled. For example, a fluorescent substance, an enzyme, or a radioisotope can be used for labeling.

[0050] Yet another aspect of the present invention relates to a recombinant DNA containing the gene of the present invention (a gene encoding the present enzyme). The recombinant DNA of the present invention is provided, for example, in the form of a vector. As used herein, the term "vector" refers to a nucleic acid molecule that can transport a nucleic acid inserted therein into a target such as a cell.

[0051] An appropriate vector is selected depending on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors using E. coli as a host include M13 phage or its modified forms, λ phage or its modified forms, and pBR322 or its modified forms (pB325, pAT153, pUC8, etc.), vectors using yeast as a host include pYepSec1, pMFa, pYES2, etc., vectors using insect cells as a host include pAc and pVL, and vectors using mammalian cells as a host include pCDM8 and pMT2PC.

[0052] The vector of the present invention is preferably an expression vector. An "expression vector" refers to a vector that can introduce a nucleic acid inserted therein into a target cell (host cell) and express it in the cell. An expression vector usually contains a promoter sequence necessary for the expression of the inserted nucleic acid, an enhancer sequence that promotes expression, and the like. Expression vectors containing a selection marker can also be used. When such an expression vector is used, the presence or absence (and the degree of introduction) of the expression vector can be confirmed using the selection marker.

[0053] Insertion of the nucleic acid of the present invention into a vector, insertion of a selectable marker gene (if necessary), insertion of a promoter (if necessary), etc. can be carried out using standard recombinant DNA techniques (for example, see Molecular Cloning, Third Edition, 1.84, Cold Spring Harbor Laboratory Press, New York; well-known methods using restriction enzymes and DNA ligases).

[0054] For ease of handling, microorganisms such as Escherichia coli, Bacillus subtilis, and Saccharomyces cerevisiae are preferred as host cells. However, any host cell capable of replicating recombinant DNA and expressing the gene for this enzyme can be used. Examples of E. coli include E. coli BL21(DE3)pLysS when using a T7 promoter, and E. coli JM109 when not. Examples of budding yeast include SHY2, AH22, and INVSc1 (Invitrogen).

[0055] Another aspect of the present invention relates to a microorganism (i.e., a transformant) harboring the recombinant DNA of the present invention. The microorganism of the present invention can be obtained by transfection or transformation using the above-mentioned vector of the present invention. For example, calcium chloride method (J. Mol. Biol., Vol. 53, p. 159 (1970)), Hanahan method (J. Molecular Biology, Vol. 166, p. 557 (1983)), SEM method (Gene, Vol. 96, p. 23 (1990)), Chung et al.'s method (Proceedings of the National Academy of Sciences of the USA, Vol. 86, p. 2172 (1989)), calcium phosphate coprecipitation method, electroporation (Potter, H. et al., Proc. Natl. Acad. Sci. USA 81, 7161-7165 (1984)), lipofection (Felgner, P. L. et al., Proc. Natl. Acad. Sci. USA 84, 7413-7417 (1984)) etc. The microorganism of the present invention can be used to produce the present enzyme of the present invention.

[0056] 3. Uses of this enzyme preparation Another aspect of the present invention relates to uses of the present enzyme preparation. As a first use, a method for producing collagen tripeptide (CTP) (hereinafter referred to as the "CTP production method") is provided. In the CTP production method of the present invention, the present enzyme preparation is allowed to act on collagen or gelatin (denatured collagen). For example, the present enzyme preparation is added to a collagen or gelatin solution and reacted for a predetermined period of time (e.g., 1 to 12 hours) at 20 to 50°C, preferably 30 to 40°C. Collagen tripeptides are produced as a result of the degradation reaction catalyzed by collagenase, the active ingredient of the present enzyme preparation. While the composition and ratio of CTP in the product may vary depending on the type and origin of the substrate (collagen or gelatin) used, the production method of the present invention produces a composition containing tripeptides with Gly at the N-terminus (e.g., Gly-Glu-Arg, Gly-Pro-Hyp, Gly-Pro-Ala, Gly-Ala-Hyp), i.e., a CTP-containing product. One of the features of the present invention is that CTP can be produced by using the present enzyme preparation alone. However, it is also possible to use other collagenases, proteases, or peptidases in combination to improve production efficiency.

[0057] The origin of the collagen / gelatin used is not particularly limited, and examples include fish, pig, cow, and chicken. Commercially available collagen or gelatin may also be used. The method for preparing collagen or gelatin is also not particularly limited. For example, raw materials (animal skin, bones, tendons, fish scales, etc.) are washed with water and dried, and then decalcified using hydrochloric acid or the like as needed. After washing, crude collagen is obtained by treatment with caustic soda or hydrochloric acid. Gelatin can also be extracted by heat-treating crude collagen.

[0058] After the enzymatic reaction with the present enzyme preparation, purification treatment (for example, filtration, ion exchange, activated carbon treatment) is carried out as necessary to remove insoluble components, improve purity, or to decolorize or deodorize the product.

[0059] A second use of the present enzyme preparation is to improve the quality of meat. More specifically, the enzyme preparation of the present invention is used to tenderize meat. In other words, a meat tenderization method is provided. The enzyme preparation of the present invention can specifically cleave collagen in meat, resulting in meat with improved texture (typically, meat with a soft texture and reduced dryness). While there is no particular limitation on the meat to be treated with the enzyme, collagen-rich meat (e.g., shank meat and tendon meat) is a preferred target for treatment. As shown in the examples below, the present enzyme preparation does not tenderize lean pork belly, but has been confirmed to tenderize collagen-rich fatty meat and even tendon meat from beef shoulder roast. The term "meat" is used to include processed meat products. Therefore, the meat tenderization method of the present invention can also be applied to improve the texture of processed meats, hams, sausages, and other products. In the meat tenderization method of the present invention, the present enzyme preparation is applied to meat. The enzyme agent may be allowed to act on meat by methods such as immersing meat in an enzyme solution (a solution of the enzyme agent), pressurizing the meat to allow the enzyme solution to penetrate the meat, injecting the enzyme solution into the meat, or injecting the enzyme solution into the meat and then tumbling (a process to mechanically penetrate the enzyme solution), etc. The temperature conditions for the action are, for example, 4 to 40°C, preferably 4 to 30°C, more preferably 4 to 25°C, and even more preferably 4 to 20°C, and the time for action (reaction time) is, for example, 1 hour to 1 day. [Example]

[0060] 1. Screening of collagenase-producing strains To find collagenase suitable for food use, we first screened the library of Amano Enzyme Inc. using collagenase activity as an indicator, and selected 113 strains of biosafety level 1 (BSL1) producing bacteria that showed high activity.

[0061] In the second screening step, the culture supernatants of the 113 selected producers were reacted with gelatin, and the content of peptides with Gly at the N-terminus in the reaction products was evaluated. 19 producers were selected. The total amount of peptides was quantified using ninhydrin reagent. Meanwhile, the amount of peptides with Gly at the N-terminus was quantified using a collagen quantification kit (Cosmo Bio).

[0062] In the third screening, tripeptides were partially purified from the culture supernatants and gelatin reaction products of 19 producers by gel filtration chromatography and then analyzed by reversed-phase chromatography. The culture supernatants of the producers that appeared promising were partially purified, and the collagenase-producing ability of the collagenase was evaluated. Finally, the collagenase-producing bacterium Lysinibacillus fusiformis strain 57413 was selected.

[0063] 2. Preparation and purification of crude collagenase from strain 57413 Strain 57413 was cultured in a gelatin-containing medium (5% fish gelatin, 0.5% yeast extract, 2% NaCl) at 30°C for 2 days with aeration and agitation. The resulting culture was centrifuged, and the supernatant was filtered through diatomaceous earth to obtain a crude enzyme solution. The enzyme was further purified using hydrophobic chromatography (Pheny HP, GE Healthcare Life Sciences) and anion exchange chromatography (DEAE FF, GE Healthcare Life Sciences).

[0064] Confirmation of the gene sequence of collagenase strain 3.57413 After culturing strain 57413 in SCD liquid medium overnight at 30°C, the cells were collected by centrifugation. The collected cells were suspended in TE buffer, and DNA was extracted using NucleoSpin® Microbial DNA (manufactured by Takara Bio Inc.). Using the extracted DNA as a template, PCR was performed using the following upstream and downstream primers and PrimeSTAR® Max DNA Polymerase (manufactured by Takara Bio Inc.). The amplified PCR product was sequenced by performing nucleotide sequence analysis using primers homologous to the inside and outside of the structural gene (Figure 1). Upstream: Forward primer: GGAAACAATCTAAATGTGTCT (SEQ ID NO: 5) Downstream: Reverse primer: CCGCCTTTAAAGGCTCTCCGA (SEQ ID NO: 6)

[0065] 4. Recombinant expression of collagenase An expression plasmid was constructed by introducing the 57413 strain collagenase gene (SEQ ID NO: 2) into pColdIII (manufactured by Takara Bio Inc.). Using the constructed expression plasmid, Escherichia coli BL21 was transformed by a conventional method. After culturing the transformant overnight at 37°C in LB medium (supplemented with ampicillin), the culture broth was inoculated at 1% volume into LB medium (supplemented with ampicillin), cultured at 37°C for 2 hours, IPTG was added, and the culture was continued overnight at 15°C. The cells were collected from this culture broth by centrifugation, the cells were disrupted by ultrasonic disruption, and then the supernatant was collected by centrifugation to obtain a crude recombinant enzyme solution. When the enzyme activity of this crude enzyme solution was confirmed by the following measurement method, it was found to have collagenolytic activity, pz-peptide degrading activity, and CTP generating ability. Furthermore, it did not have caseinolytic activity and was highly likely to act specifically on collagen and gelatin.

[0066] <Pz-peptide degrading activity> The reaction was initiated by adding 100 μL of enzyme solution to 900 μL of 1 mg / mL Pz-peptide (Pz-Pro-Leu-Gly-Pro-D-Arg-OH, BACHEM) in 20 mM CaCl2 and 200 mM Tris-HCl buffer at 37°C. At 10 and 20 minutes after the start of the reaction, 100 μL of the reaction solution was sampled and added to 200 μL of 25 mM citric acid solution to stop the reaction. 1 mL of ethyl acetate was added to the reaction solution, stirred for 10 seconds, and centrifuged (12,000 × g for 10 minutes) to collect the supernatant. The amount of Pz-Pro-Leu liberated by collagenase was determined by measuring the absorbance at 320 nm. Enzyme activity was assessed by calculating the Pz-Pro-Leu production rate per minute from the amount of Pz-Pro-Leu produced after 10 and 20 minutes. The amount of enzyme that decomposes 1 μmol of Pz peptide (liberates 1 μmol of Pz-Pro-Leu) in 1 minute was defined as 1 U.

[0067] <Collagenase activity> Collagenase activity was measured using PROTAZYME OL TABLETS (Megazyme). For each OL tablet, 300 μL of substrate solution suspended in 10 mM CaCl2 (200 mM Tris buffer) was dispensed into a 1.5 mL tube while stirring and placed on ice. 100 μL of enzyme solution was added to the dispensed substrate solution, mixed, and stirred for 30 minutes in a bioshaker set to 40°C. After 30 minutes of reaction, the enzyme reaction was stopped by adding 1 mL of 2% trisodium phosphate solution and centrifuged (13,000 g, 10 minutes). 200 μL of the supernatant was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The increase in 590 nm value over 30 minutes was used to determine the strength of collagenase activity.

[0068] <Casein degradation activity> The caseinolytic activity was measured using PROTAZYME AK TABLETS (manufactured by Megazyme). The substrate solution, which was suspended in 200 mM Tris buffer containing 10 mM CaCl2 for 1 tablet of AK, was dispensed at 300 μL per 1.5 mL tube while stirring and placed on ice. 100 μL of the enzyme solution was added to the dispensed substrate solution, mixed, and reacted by stirring in a bioshaker adjusted to 40 °C for 30 minutes. After 30 minutes of the reaction, 1 mL of 2% trisodium phosphate solution was added to stop the enzyme reaction, and centrifugation (13,000 g, 10 minutes) was performed. 200 μL of the supernatant was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The intensity of the caseinolytic activity was determined by the value of the increase in absorbance at 590 nm over 30 minutes.

[0069] <Confirmation of CTP production ability> After reacting the serially diluted enzyme solution with gelatin (final concentration 2% gelatin) for 12 hours, the reaction was stopped by boiling for 10 minutes. After diluting this reaction stop solution 10-fold with ultrapure water, the CTP production amount was confirmed by performing gel filtration analysis using Superdex peptide 7.5 / 300. The conditions for gel filtration are as follows. Superdex_peptide7.5 / 300 Buffer: 0.02 M phosphate buffer containing 0.25 M NaCl, pH 7 Flow rate: 0.28 mL / min Application volume: 100 μL Detection: 214 nm System: AKTA / Cryogenic storage

[0070] Enzymatic properties of 5.57413 strain collagenase (1) Optimal temperature The effect of temperature on the reactivity of this enzyme was confirmed. Using the measurement method with Pz-peptide as the substrate, the activity was measured while changing the reaction temperature from 30 °C to 60 °C. It was evaluated in terms of relative activity with the maximum activity (the highest value of activity) set as 100%. As shown in Figure 2, the optimal temperature was around 40 °C.

[0071] (2) Temperature stability The temperature stability of this enzyme was investigated. The enzyme solution was diluted 5-fold with 20 mM CaCl2, 200 mM Tris-HCl buffer, and the sample was treated at various temperatures (0°C, 30°C, 40°C, 50°C, and 60°C) for 30 minutes. The activity was then measured using Pz-peptide as a substrate. As shown in Figure 3, there was no decrease in activity from treatment at 0°C (on ice) to treatment at 40°C, indicating that the enzyme was stable up to 40°C.

[0072] (3) Optimal pH The effect of pH on the reactivity of this enzyme was investigated. The buffer used to dissolve the Pz-peptide was changed from 20 mM CaCl2, 200 mM Tris-HCl buffer to 20 mM CaCl2, 200 mM buffers (acetate buffer for pH 4, 5, and 6, PIPES buffer for pH 6 and 7, Tris-HCl buffer for pH 7, 8, and 9, and glycine buffer for pH 9, 10, and 11), and activity was measured. The maximum activity was evaluated as 100%, and the relative activity was evaluated. As shown in Figure 4, the optimal pH was found to be around pH 7.

[0073] (4)pH stability The pH stability of this enzyme was investigated. The enzyme solution was diluted 5-fold with 20 mM CaCl2, 200 mM buffer (acetate buffer for pH 4, 5, and 6, PIPES buffer for pH 6 and 7, Tris-HCl buffer for pH 7, 8, and 9, and glycine buffer for pH 9, 10, and 11), incubated at 30°C for 30 minutes, and then assayed using Pz-peptide as a substrate. The enzyme activity was evaluated relative to the activity measured after dilution 5-fold with 20 mM CaCl2, 200 mM Tris-HCl buffer, pH 7, and storage at 0°C (on ice), with the activity measured as 100%. As shown in Figure 5, the enzyme maintained high activity (over 85%) over the pH range of approximately 5 to approximately 9.5, demonstrating its stability over this pH range.

[0074] 6. Low-temperature reactivity of collagenase <Method> The low-temperature reactivity of the above-mentioned collagenase from strain 57413 (the enzyme of the present invention) and a comparative Streptomyces-derived collagenase was measured. Collagenase activity was measured using PROTAZYME OL TABLETS (Megazyme, Inc., substrate AZCL-collagen). For each OL tablet, 150 μL of substrate solution suspended in 10 mM CaCl2 and 200 mM Tris buffer was dispensed into a 1.5 mL tube while stirring and placed on ice. 50 μL of enzyme solution was added to the dispensed substrate solution, mixed, and reacted while stirring in a bioshaker set at the desired temperature. The reaction was terminated by adding 500 μL of 2% trisodium phosphate solution, followed by centrifugation (13,000 g, 10 minutes). 200 μL of the supernatant was transferred to a microtiter plate, and the absorbance at 590 nm was measured. The increase in absorbance at 590 nm was used to evaluate the strength of collagenase activity.

[0075] <Result> The results are shown in Table 1 and Figure 6. The collagenase of the present invention had a higher relative activity at 20 to 30°C than the comparative enzyme.

[0076] [Table 1]

[0077] 7. Confirmation of collagen tripeptide production ability <Method> The following experiment was carried out using the collagenase of strain 57413 (the enzyme of the present invention) and a collagenase derived from Streptomyces for comparison. (Natural collagen decomposition activity measurement method) 0.1 mL of enzyme solution was added to 5 mL of 50 mM TES buffer, pH 7.4, containing 25 mg of insoluble type I collagen derived from bovine Achilles tendon (Sigma) and 0.36 mM CaCl2. The reaction mixture was incubated at 37°C for 5 hours and then filtered. 1 mL of ninhydrin reagent containing 0.1 M citric acid, pH 5.0, was added to 100 μL of the filtrate, and the mixture was heated at 100°C for 20 minutes. After cooling, 5 mL of 50% 1-propanol was added, and the increase in absorbance at 570 nm was measured. One collagenolytic unit (CDU) was defined as the amount of enzyme liberating a peptide equivalent to 1.0 μmol of leucine from collagen after 5 hours of incubation at 37°C, pH 7.4 in the presence of Ca ions.

[0078] (Collagen tripeptide production confirmed) The serially diluted enzyme solution was reacted with 5% fish gelatin type A (Nitta Gelatin Co., Ltd.) for 20 hours, then boiled for 10 minutes to terminate the reaction. The reaction-stopping solution was diluted 4-fold with ethanol, centrifuged to remove the precipitate, and the supernatant was diluted with ultrapure water to 50 ppm gelatin equivalent. After MF (0.45 μm), the peak areas of Gly-Pro-Hyp, Gly-Pro-Ala, and Gly-Glu-Arg CTPs were evaluated by LC-MS analysis. The CTP-producing ability of this enzyme was compared with that of Streptomyces-derived collagenase.

[0079] (LC-MS analysis) Column: TSK gel ODS-80TM 150mm Solvent: Ultrapure + 0.1% formic acid Flow rate: 1mL / min Injection volume: 1μL Detection: Positive ion mode, SIM method

[0080] <Result> The results are shown in Figures 7 to 9. This enzyme produced Gly-Pro-Hyp and Gly-Pro-Ala in amounts equivalent to those of Streptomyces-derived collagenase, and was found to be superior to Streptomyces-derived collagenase in its ability to produce Gly-Glu-Arg.

[0081] 8. Confirmation of meat tenderizing effect The following experiment was carried out using the collagenase of strain 57413 (the enzyme of the present invention) and a collagenase derived from Streptomyces for comparison. 8-1. Tenderizing effect of pork belly <Method> 13.5 mL of pickling solution (1.5 w / v salt, 1.5 w / v sodium bicarbonate, 0.7 w / v calcium lactate) containing 30 CDU / mL collagenase was randomly injected into 140 g of pork belly, which was then kneaded by hand and stored in a low-temperature cabinet (approximately 5°C) for three days. The pork belly was then divided into four pieces and simmered in a hot water bath for 10 minutes. The fat and lean parts were then separated and their physical properties were evaluated using a rheometer (Sun Scientific). The load was measured at a depth of 3 mm and the results are shown below. The lower the load value, the softer the meat.

[0082] <Result> The results are shown in Figure 10. Unlike collagenase derived from Streptomyces, this enzyme was found to have the effect of softening fatty meat without softening lean meat.

[0083] 8-2. Tenderizing effect of beef shoulder loin <Method> The tendon portion of beef shoulder loin was cut into 1cm cubes, then immersed in 30mL of enzyme solution (30CDU / mL) and stored in a low-temperature cabinet (approximately 5°C) for 3 days. After the treatment, the physical properties (breaking strength and load at a depth of 3mm) were evaluated using a rheometer without heating. Both breaking strength and load are used as indicators of the degree of softening, with lower values indicating softer meat.

[0084] <Result> The results are shown in Figure 11. This enzyme had lower breaking strength and load than Streptomyces-derived collagenase, and was found to have the effect of making the tendon part of beef shoulder loin easier to chew and tender. [Industrial Applicability]

[0085] The enzyme preparation of the present invention contains collagenase derived from a highly safe microorganism as an active ingredient, and is therefore suitable for use in the fields of food and medical applications, and has great industrial value.

[0086] The present invention is not limited to the above-described embodiments and examples. Various modifications within the scope of the claims and within the scope that can be easily conceived by a person skilled in the art are also included in the present invention. The contents of papers, published patent applications, patent publications, and other publications explicitly stated in this specification are incorporated herein by reference in their entirety. [Sequence List Free Text]

[0087] SEQ ID NO: 5: Description of artificial sequence: Forward primer SEQ ID NO: 6: Description of artificial sequence: Reverse primer

Claims

1. An enzyme preparation for producing Gly-Glu-Arg, which contains as an active ingredient collagenase consisting of an amino acid sequence having 94% or more identity with the amino acid sequence of SEQ ID NO:

1.

2. The enzyme preparation for producing Gly-Glu-Arg according to claim 1, wherein the collagenase is derived from Lysinibacillus fusiformis.

3. The enzyme preparation for producing Gly-Glu-Arg according to claim 1 or 2, which is used for tenderizing meat.

4. A method for producing Gly-Glu-Arg, which comprises allowing the enzyme preparation according to claim 1 to act on collagen or gelatin.

5. A method for tenderizing meat, comprising applying the enzyme preparation according to claim 1 to meat.

6. A gene encoding the collagenase of claim 1.

7. The gene according to claim 6, which consists of the base sequence of SEQ ID NO: 3.

Citation Information

Patent Citations

  • Improvement of meat quality

    JP1993007476A

  • Twist beam type rear suspension with steering mechanism

    JP1993016832A

  • New microorganism belonging to genus vibrio, new collagenase produced by the microorganism and its application

    JP1996070853A

  • Enzyme liquid, its production, enzyme agent, protease agent and protease-producing bacterium

    JP2001037474A

  • Recombinant collagenase type i from Clostridium histolyticum and its use for isolation of cells and cell populations.

    JP2001510331A

Cited By

  • JPWO2023054315A1