Interleukin-2 superantagonists, partial agonists, and antagonists
Novel IL-2 muteins with altered receptor binding affinities address the limitations of current IL-2 receptor therapies by inhibiting IL-2 and IL-15 signaling, offering therapeutic benefits in graft-versus-host disease and adult T-cell leukemia.
Patent Information
- Application Number
- JP2024088571
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2014-04-24
- Filing Date
- 2024-05-31
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2035-04-24
AI Technical Summary
Current therapies targeting interleukin-2 (IL-2) receptors, such as monoclonal antibodies, are ineffective in blocking IL-2 and IL-15 signaling through the high-affinity heterotrimeric receptor complex, leading to uncontrolled immune responses in conditions like graft-versus-host disease and adult T-cell leukemia.
Development of novel IL-2 muteins with altered binding affinities to IL-2Rβ and IL-2Rγ receptors, acting as partial agonists and antagonists to inhibit IL-2 and IL-15 signaling, thereby reducing unwanted immune responses.
The IL-2 muteins effectively inhibit IL-2-dependent T cell activation and proliferation, providing therapeutic benefits in conditions like graft-versus-host disease and adult T-cell leukemia by attenuating receptor signaling and reducing adverse effects.
Smart Images

Figure 0007729570000050 
Figure 0007729570000051 
Figure 0007729570000052
Abstract
Description
[Technical Field]
[0001] This invention was made with U.S. government support under Grant Nos. AI051321 and DK094541 awarded by the National Institutes of Health. The U.S. government has certain rights in this invention. [Background technology]
[0002] Interleukin-2 (IL-2) plays an important role in effecting a normal immune response, activating CD4 + IL-2 is a pluripotent cytokine produced primarily by T cells. IL-2 promotes the proliferation and expansion of activated T lymphocytes, enhances the growth of B cells, and activates monocytes and natural killer cells. It is because of these activities that IL-2 has been tested and is used as an approved treatment for cancer (aldesleukin, Proleukin®).
[0003] In eukaryotic cells, human IL-2 is synthesized as a 153-amino acid precursor polypeptide, from which 20 amino acids are removed to yield the mature secreted form of IL-2 (Taniguchi 1983). Recombinant human IL-2 has been produced in E. coli (Rosenberg 1984), insect cells (Smith 1985), and mammalian COS cells (Taniguchi 1983).
[0004] Interleukin-2 (IL-2) is a four alpha-helical bundle type I cytokine that was first identified as a growth factor for T cells (Morgan et al., Science 193: 1007 (1976)) and has subsequently been shown to have a wide range of actions. IL-2 promotes T helper differentiation (Zhu et al., Annual review of immunology 28:445 (2010); Liao et al., Nat Immunol 9:1288 (2008); and Liao et al., Nat Immunol 12:551 (2011)) and the development of regulatory T (Treg) cells (Cheng et al., Immunol Rev 241:63 (2011)), induces natural killer and lymphokine-activated killer activity (Liao et al., Immunity 38:13 (2013)), and mediates activation-induced cell death (AICD) (Lenardo et al., Nature 353:858 (1991)).
[0005] IL-2 functions by interacting with three distinct receptors: interleukin-2 receptor alpha (IL-2Rα; CD25), interleukin-2 receptor beta (IL-2Rβ; CD122), and interleukin-2 receptor gamma (IL-2Rγ; CD132; common gamma chain). The first receptor to be identified was IL-2Rα, a 55 kD polypeptide (p55) that appears upon T cell activation and was originally called the Tac antigen (for T activation). IL-2Rα is responsible for approximately 10 -8 K of M d IL-2 binds to the IL-2Rα receptor, which is also known as the "low affinity" IL-2 receptor. Binding of IL-2 to cells expressing only IL-2Rα does not result in any detectable biological response.
[0006] IL-2 is expressed by the IL-2Rβ and the common cytokine receptor γ chain, γ c Interleukin-2 receptor (IL-2Rγ) is an intermediate affinity receptor (K) on resting T cells and NK cells. d about 10 -9M) or via the high affinity receptor (K) on activated lymphocytes and Treg cells that also express IL-2Rα (CD25). d about 10 -11 M) to send a signal (Lenar do et al., Nature 353:858(1991), and Yuan et al. al., Immunol Rev 259:103(2014)). γ c is shared by the receptors for IL-4, IL-7, IL-9, IL-15, and IL-21 (Leonard et al., Nature Reviews Immunology 1:200 (2001)) and is encoded by a gene mutated in humans with X-linked severe combined immunodeficiency (Noguchi et al., Cell 73:147 (Apr 9, 1993)), whereas IL-2Rβ is shared by the receptor for IL-15 (Waldmann, Nature Reviews Immunology 6:595 (2006)), and IL-15 is expressed by NK cells and memory CD8 + It is a cytokine that is important for the normal development of T cells (Waldmann, Nature Reviews Immunology 6:595 (2006)).
[0007] The three-dimensional structures of receptor-bound IL-2 and IL-15 provide insight into receptor assembly and signaling (Wang et al., Science 310:1159 (2005), and Ring et al., Nat Immunol 13:1187 (2012)). In addition to their physiological roles in normal immune responses, IL-2 and IL-15 can promote pathological responses, and the goal of therapy is to maintain the desired action of these cytokines while blocking inappropriate autoimmune or immunosuppressive responses. Two monoclonal antibodies (mAbs) against human IL-2Rα, daclizumab and basiliximab, are FDA-approved and have been used to treat renal transplant rejection (Vincentivis et al., 2012). et al., N Engl J Med 338:161(1998)), heart transplantation (Hershberger et al., N Engl J Med 352:2705(2005)), multiple sclerosis (Gold et al., Lancet 381:2167(2013)), and asthma (Bielekova et al., Proc Natl Acad Sci USA 101:8705(2004); and Busse et al., Am J Respir Crit Care Med 178:1002(2008)), which show efficacy in NK cells and memory CD8 + Intermediate-affinity IL-2Rβ-γ expressed on cells c It does not block receptor-mediated IL-2 signaling, but it cannot block IL-15 signaling (Tkaczuk et al. al., Am J Transplant 2:31(2002)). Anti-human IL-2Rβ mAb Mikβ1 inhibits IL-2 and IL-15, IL-2Rβ-γ c Trans-presentation to cells expressing the receptor can be blocked (Morris et al., Proc Natl Acad Sci USA 103:401 (2006)), but it is relatively ineffective at blocking cis-signaling by IL-2 or IL-15 through the high-affinity heterotrimeric receptor complex (Morris et al., Proc Natl Acad Sci USA 103:401 (2006) and Waldmann et al., Blood 121:476 (2013)). Therefore, there is a need for new IL-2 muteins that can block one or more functions of IL-2 and / or IL-15. The present disclosure provides novel IL-2 muteins that function as IL-2 partial agonists and antagonists. Summary of the Invention
[0008] IL-2 exerts a wide range of effects on the immune system and plays an important role in regulating both immune activation and immune homeostasis. As an immune system stimulator, IL-2 has found use in the treatment of cancer and chronic viral infections. The stimulatory effects of IL-2 may also be perturbed, mediating autoimmunity and transplant rejection. Due to its beneficial role in immune regulation and immune diseases, the identification of new IL-2 molecules, such as IL-2 partial agonists and antagonists, remains an active area of research.
[0009] A novel approach based on new insights into how IL-2 interacts with its cognate receptor IL-2 compositions are provided herein. In most circumstances, IL-2 functions through three distinct receptors: IL-2Rα, IL-2Rβ, and IL-2Rγ. Most cells, such as resting T cells, do not respond to IL-2 because they express only IL-2Rβ, which has low affinity for IL-2, and IL-2Rγ. Upon stimulation, resting T cells express the relatively high-affinity IL-2 receptor, IL-2Rα. Binding of IL-2 to IL-2Rα sequentially engages this receptor with IL-2Rβ and IL-2Rγ, resulting in T cell activation.
[0010] An IL-2 "superkine" was previously developed that exhibits enhanced binding affinity to IL-2Rβ, resulting in enhanced activity (Levin et al., Nature 484:529 (2012)). It was hypothesized that this high-affinity superkine / IL-2Rβ complex could serve as a dominant-negative scaffold to generate a "receptor signaling clamp" that blocks endogenous signaling. IL-2Rγ c Directed mutations of these super IL-2 "full agonists" that reduce binding to IL-2Rβ-γ cThese molecules may represent a new class of mechanism-based IL-2 partial agonists and non-signaling (neutral) molecules that functionally act as antagonists by attenuating heterodimerization of IL-2, blocking endogenous cytokines, and not exerting their own effects (see schematic diagram in Figure 1).
[0011] Novel human interleukin-2 (IL-2) muteins or variants thereof are provided herein. In particular, they have increased binding ability to the IL-2Rβ receptor and increased binding ability to the IL-2Rγ receptor. c IL-2 muteins are provided that have a reduced ability to bind to their receptors. Such IL-2 muteins find use as IL-2 partial agonists and antagonists, for example, in applications where reducing or inhibiting one or more of the functions of IL-2 and / or IL-15 is useful, for example, in the treatment of graft-versus-host disease (GVHD) and adult T-cell leukemia. Nucleic acids encoding such IL-2 muteins, methods for making such IL-2 muteins, pharmaceutical compositions containing such IL-2 muteins, and therapeutic methods using such IL-2 muteins are also provided.
[0012] In one aspect, the human IL-2 (hIL-2) has a greater binding affinity to IL-2Rβ and a greater binding affinity to IL-2Rγ compared to wild-type human IL-2 (hIL-2). c Provided herein are IL-2 muteins that have reduced binding affinity to the receptor. In some embodiments, the IL-2 mutein comprises: (a) one or more amino acid substitutions selected from amino acid positions 24, 65, 74, 80, 81, 85, 86, 89, 92, and / or 93, numbered according to wild-type hIL-2, that increase IL-2Rβ binding affinity; and (b) IL-2Rγ c It reduces the binding affinity of the receptor and comprises one or more amino acid substitutions selected from amino acid positions 18, 22, 126, and / or 130, numbered according to wild-type hIL-2.
[0013] In various embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, Q74H, Q74S, L80F, L80V, R81D, R81T, L85V, I86V, I89V, and / or I93, or a combination thereof. In certain embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include N74Q, L80F, R81D, L85V, I86V, I89V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80V, R81T, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74H, L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, I Amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, R81T, L85V, and I92F.
[0014] In some embodiments, IL-2Rγ c The amino acid substitutions that decrease the binding affinity of the receptor include amino acid substitutions L18R, Q22E, A126T, and / or S130R, or a combination thereof. c The amino acid substitution that decreases the binding affinity of the receptor includes Q126T. c Amino acid substitutions that decrease the binding affinity of the receptor include L18R and Q22E. c Amino acid substitutions that decrease the binding affinity of the receptor include L18R, Q22E, and Q126T. cAmino acid substitutions that decrease receptor binding affinity include L18R, Q22E, Q126T, and S130R.
[0015] In one embodiment, the IL-2 mutein has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2, comprising the amino acid substitutions L80F, R81D, L85V, I86V, I92F, and Q126T. c IL-2 muteins with lower binding affinity to the receptor.
[0016] In one embodiment, the IL-2 mutein has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2, comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, and I92F. c IL-2 muteins with lower binding affinity to the receptor.
[0017] In one embodiment, the IL-2 mutein has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2, comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, Q126T, and I92F. c IL-2 muteins with lower binding affinity to the receptor.
[0018] In one embodiment, the IL-2 mutein has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2, comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. c IL-2 muteins with lower binding affinity to the receptor.
[0019] In certain embodiments, a subject IL-2 mutein has a reduced ability to stimulate STAT5 phosphorylation in IL-2Rβ+ T cells compared to wild-type hIL-2. In some embodiments, the T cells are CD8+ T cells.
[0020] In some embodiments, the ability of a subject IL-2 mutein to stimulate pERK1 / ERK2 signaling in IL-2Rβ+ cells is reduced compared to wild-type hIL-2.
[0021] In certain embodiments, the subject IL-2 muteins are IL-2 and / or IL-15 antagonists. In some embodiments, the IL-2 muteins are inhibitors of IL-2 and / or IL-15 STAT5 phosphorylation in CD8+ T cells. In some embodiments, the IL-2 muteins are inhibitors of IL-2 and / or IL-15-induced proliferation of CD8+ T cells. In some embodiments, the IL-2 muteins are inhibitors of IL-2-dependent TCR-induced cell proliferation. In one embodiment, the IL-2 muteins are inhibitors of IL-2-dependent Th1, Th9, and / or Treg differentiation. In certain embodiments, the IL-2 muteins are inhibitors of IL-2-dependent Th1, Th9, and / or Treg differentiation. The IL-2 mutein is a promoter of Th17 differentiation. In some embodiments, the mutein is an inhibitor of IL-2-dependent activation of NK cells.
[0022] In another aspect, provided herein is an IL-2 mutein fusion protein comprising any one of the IL-muteins described herein linked to a human Fc antibody fragment.
[0023] In another aspect, provided herein is a pharmaceutical composition comprising any one of the IL-2 muteins or IL-2 mutein fusion proteins described herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises an IL-2 mutein having the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R.
[0024] In yet another aspect, provided herein are methods for treating a subject suffering from graft-versus-host disease (GVHD). In various embodiments, the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising any one of the IL-2 muteins disclosed herein. In some embodiments, the pharmaceutical composition comprises an IL-2 mutein having the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R.
[0025] In another aspect, provided herein are methods for treating a subject suffering from adult T-cell leukemia. In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising any one of the IL-2 muteins disclosed herein. In some embodiments, the pharmaceutical composition comprises an IL-2 mutein having the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. Item 1 An IL-2 mutein that has greater binding affinity for the IL-2Rβ and less binding affinity for the IL-2Rγc receptor compared to wild-type human IL-2 (hIL-2). Section 2 (a) one or more amino acid substitutions selected from amino acid positions 24, 65, 74, 80, 81, 85, 86, 89, 92, and / or 93, numbered according to wild-type hIL-2, that increase IL-2Rβ binding affinity; and (b) an IL-2 mutein according to paragraph 1, which reduces the binding affinity of the IL-2Rγc receptor and comprises one or more amino acid substitutions selected from amino acid positions 18, 22, 126, and / or 130 numbered according to wild-type hIL-2. Section 3 3. The IL-2 mutein of item 2, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, Q74H, Q74S, L80F, L80V, R81D, R81T, L85V, I86V, I89V, and / or I93, or a combination thereof. Section 4 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include L80F, R81D, L85V, I86V, and I92F. Section 5 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include N74Q, L80F, R1D, L85V, I86V, I89V, and I92F. Section 6 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80V, R81T, L85V, I86V, and I92F. Section 7 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74H, L80F, R81D, L85V, I86V, and I92F. Section 8 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, L80F, R81D, L85V, I86V, and I92F. Section 9 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80F, R81D, L85V, I86V, and I92F. Section 10 Item 4. The IL-2 mutein of item 3, wherein the amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, R81T, L85V, and I92F. Section 11 Item 10. The IL-2 mutein of any one of the preceding items, wherein the amino acid substitutions that decrease IL-2Rγc receptor binding affinity comprise amino acid substitutions L18R, Q22E, A126T, and / or S130R or a combination thereof. Section 12 12. The IL-2 mutein of paragraph 11, wherein the amino acid substitution that decreases IL-2Rγc receptor binding affinity comprises Q126T. Section 13 12. The IL-2 mutein of paragraph 11, wherein the amino acid substitutions that decrease IL-2Rγc receptor binding affinity include L18R and Q22E. Section 14 12. The IL-2 mutein of paragraph 11, wherein the amino acid substitutions that decrease IL-2Rγc receptor binding affinity include L18R, Q22E, and Q126T. Section 15 Item 12. The IL-2 mutein of Item 11, wherein the amino acid substitutions that increase IL-2γc receptor binding affinity include L18R, Q22E, Q126T, and S130R. Section 16 1. An IL-2 mutein having greater binding affinity to the IL-2Rβ receptor and less binding affinity to the IL-2Rγc receptor compared to wild-type human IL-2, the IL-2 mutein comprising the amino acid substitutions L80F, R81D, L85V, I86V, I92F, and Q126T. Section 17 1. An IL-2 mutein having greater binding affinity to the IL-2Rβ receptor and less binding affinity to the IL-2Rγc receptor compared to wild-type human IL-2, the IL-2 mutein comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, and I92F. Section 18 1. An IL-2 mutein having greater binding affinity to the IL-2Rβ receptor and less binding affinity to the IL-2Rγc receptor compared to wild-type human IL-2, the IL-2 mutein comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, Q126T, and I92F. Section 19 1. An IL-2 mutein having greater binding affinity to the IL-2Rβ receptor and less binding affinity to the IL-2Rγc receptor compared to wild-type human IL-2, the IL-2 mutein comprising the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. Section 20 20. The IL-2 mutein according to any one of items 1 to 19, which has a reduced ability to stimulate STAT5 phosphorylation in IL-2Rβ + T cells compared to wild-type hIL-2. Section 21 21. The IL-2 mutein of paragraph 20, wherein the T cells are CD8+ T cells. Section 22 Item 20. The IL-2 mutein according to any one of Items 1 to 19, which has a reduced ability to stimulate pERK1 / ERK2 signaling in IL-2Rβ+ cells compared to wild-type hIL-2. Section 23 20. The IL-2 mutein according to any one of Items 1 to 19, which is an IL-2 and / or IL-15 antagonist. Section 24 24. The IL-2 mutein of clause 23, which is an inhibitor of IL-2 and / or IL-15 STAT5 phosphorylation in CD8+ T cells. Section 25 24. The IL-2 mutein of clause 23, which is an inhibitor of IL-2 and / or IL-15 induced proliferation of CD8+ T cells. Section 26 24. The IL-2 mutein of paragraph 23, which is an inhibitor of IL-2-dependent TCR-induced cell proliferation. Section 27 24. The IL-2 mutein of paragraph 23, which is an inhibitor of IL-2-dependent Th1, Th9, and / or Treg differentiation. Section 28 24. The IL-2 mutein of paragraph 23, which is a promoter of Th17 differentiation. Section 29 24. The IL-2 mutein of paragraph 23, which is an inhibitor of IL-2-dependent activation of NK cells. Item 30 20. An IL-2 mutein fusion protein comprising any one of the IL-muteins of paragraphs 1 to 19 linked to a human Fc antibody fragment. Item 31 A pharmaceutical composition comprising any one of the IL-2 muteins according to Items 1 to 19 or the IL-2 mutein fusion protein according to Item 30, and a pharmaceutically acceptable carrier. Section 32 Item 32. The pharmaceutical composition according to Item 31, comprising the IL-2 mutein according to Item 19. Item 33 A method for treating a subject suffering from graft-versus-host disease (GVHD), comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the IL-2 mutein according to any one of items 1 to 19. Section 34 Item 34. The method of Item 33, wherein the pharmaceutical composition comprises the IL-2 mutein of Item 19. Section 35 A method for treating a subject suffering from adult T-cell leukemia, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the IL-2 mutein according to any one of Items 1 to 19. Section 36 The method of claim 35, wherein the pharmaceutical composition comprises the IL-2 mutein of claim 19. [Brief explanation of the drawings]
[0026] [Figure 1] 1 shows a schematic diagram for producing IL-2 muteins of the presently provided subject matter. On the left, the green areas in IL-2 indicate previously reported alterations that result in H9 "super-IL-2" with high-affinity binding to IL-2Rβ, thereby blocking endogenous IL-2 binding. The red circles indicate alterations in IL-2 that reduce binding to IL-2Rγc and IL-2Rβ-γc heterodimerization. On the right, depending on the level of disruption of IL-2Rγc binding, different levels of activity and function should be produced as shown. [Figure 2] Figure 1 shows the FACS profile of an IL-2 mutein library as described herein. Products of error-prone PCR of the human IL-2 gene were subjected to selection. The first-generation IL-2 library was generated through six rounds of selection. The first round was performed using tetrameric IL-2Rβ linked to phycoerythrin (PE), which binds yeast expressing IL-2 muteins (A). Subsequent rounds of selection were achieved using PE-labeled monomeric IL-2Rβ. (B) Results from a second-generation IL-2 library. [Figure 3] The altered amino acid residues in the IL-2 muteins with high affinity IL-2Rβ binding are shown relative to the wild-type IL-2 sequence. The binding affinity of each mutein and IL-2 to IL-2Rβ is also shown. [Figure 4]Figure 1 shows the stimulatory effects of IL-2 muteins with high affinity binding to IL-2Rβ on CD25- and CD25+ natural killer (NK) cells. The dose-response relationship of wild-type IL-2 and IL-2 muteins 6-6, D10, and H9 on STAT5 phosphorylation was observed in treated (A) CD25- and (B) CD25+ YT-1 NK cells. Circles represent wild-type IL-2, squares represent 6-6, up-pointing triangles represent H9, and down-pointing triangles represent D10. [Figure 5] CD25 independence of IL-2 mutein binding is shown. Dose-response curves of STAT5 phosphorylation for CD25- and CD25+ YT-1 NK cells. (A) IL-2 and IL-2(F42A) (circles, solid lines are wild-type IL-2, CD25+ cells); squares, solid lines are IL-2 F42A, CD25+ cells; up-pointing triangles, dashed lines are wild-type IL-2, CD25- cells; down-pointing triangles, dashed lines are IL-2 F42A, CD25- cells.) (B) H9 and H9(F42A) (circles, solid lines are wild-type H9, CD25+ cells); squares, solid lines are H9 F42A, CD25+ cells; up-pointing triangles, dashed lines are H9, CD25- cells; down-pointing triangles, dashed lines are H9 F42A, CD25- cells. ) The F42A mutation right-shifted the dose-response curve of wild-type IL-2 on CD25+ cells but had no observable effect on CD25− cells, and the dose-response curves for H9 and H9 F42A were virtually overlapping, regardless of CD25 expression. [Figure 6] This figure shows the ability of several IL-2 mutein "superagonists" (i.e., muteins with high-affinity binding to IL-2Rβ) to stimulate T cells in the absence of IL-2Rα. T cells isolated from CD25 knockout mice were stimulated with IL-2 muteins or wild-type IL-2. Dose-response curves and respective EC50s for the IL-2 muteins are presented. As shown, all of the IL-2 muteins tested resulted in a relative increase in T cell stimulation in the absence of IL-2Rα compared to wild-type IL-2. [Figure 7]FACS analysis comparing the relative abilities of IL-2 mutein "superagonists" to induce experienced T cell stimulation. T cells were stimulated with two concentrations (10 ng / ml or 1 ng / ml) of IL-2 muteins or wild-type IL-2. The percentage of stimulated T cells is shown in each FACS profile. [Figure 8] The effect of the IL-2 "superagonist" mutein D10 on natural killer (NK) cell function, specifically, spontaneous and antibody-dependent cell-mediated cytotoxicity, is shown. Natural killer cells (effectors) and Cr51-labeled tumor cells (targets) were incubated together for 5 hours in the presence of wild-type IL-2 or the IL-2 mutein D10, with or without the anti-EGFR antibody cetuximab. Stimulation of spontaneous NK cell cytotoxicity by D10 exceeded that of high-dose IL-2 (*p=0.008, **p=0.001), with minimal spontaneous cytotoxicity without stimulation by IL-2 or D10. Furthermore, the addition of D10 enhanced ADCC of the cetuximab antibody. [Figure 9] The crystal structure of D10 is shown. The initial hydrophobic core mutation, L85V, resulted in a second-generation IL-2 library that targets multiple hydrophobic core residues and a high-affinity consensus sequence. The crystal structure of D10 contained clear electron density in the loop region preceding helix C. [Figure 10] An IL-2 "superagonist" mutein with high affinity binding to IL-2Rβ exhibits enhanced stimulation of CD8+ T cells but not Tregs compared to IL-2. (A) Total numbers of host CD3+CD8+CD44high memory phenotype (MP) T cells and (B) host CD3+CD4+CD25high T cells (regulatory T cells) were measured in the spleens of mice receiving either PBS, 20 μg IL-2, 20 μg H9, or 1.5 μg IL-2 / anti-IL-2 monoclonal antibody complex (IL-2 / mAb). [Figure 11]IL-2 mutein agonists with high-affinity binding to IL-2Rβ exhibit enhanced antitumor responses with reduced adverse effects compared to IL-2. Pulmonary edema (wet lung weight) serves as a measure of adverse toxic effects after IL-2 treatment and was determined by weighing lungs before and after desiccation (A). P values indicate comparisons between treatments. *, p<0.05; **, p<0.01. (B) The antitumor properties of IL-2 muteins were tested in vivo using B16F10 melanoma cells. C57Bl / 6 mice (n = 3-4 mice / group) were subcutaneously injected with 10 B16F10 melanoma cells followed by daily injections of either PBS, 20 μg IL-2, 20 μg H9, or 1.5 μg IL-2 / anti-IL-2 monoclonal antibody complex (IL-2 / mAb) for 5 days after tumor nodules became visible and palpable, usually 4-5 days after tumor cell injection or corresponding to a tumor size of approximately 15 mm. Mean tumor area in mm (±SD) versus time from tumor inoculation is shown. P values indicate comparisons with other treatments for IL-2. [Figure 12] Generation of mechanism-based IL-2 muteins by disrupting γc binding. (A) Structure of the H9-IL-2Rβ-γc complex (H9 is green; IL-2Rβ is blue; γc is gold). Mutations (L18R, Q22E, Q126T, and S130R) engineered into H9-RETR to disrupt IL-2 interaction with γc are shown in deep blue (right part of panel). (B, C) Surface plasmon resonance analysis of binding of H9-IL-2Rβ (C) and H9-RET-IL-2Rβ (D) complexes to γc. [Figure 13-1] Figure 1 shows attenuated signaling of IL-2 muteins with reduced binding affinity for IL2Rγc. (A, B) Wild-type IL-2 or various H9 variants were assayed for their ability to induce STAT5 phosphorylation in CD25- (A) and CD25+ (B) YT-1 human NK-like cells. (C, D) Kinetics of internalization of IL-2Rβ (C) and IL-2Rγ (D) relative to maximal surface expression in CD25- YT-1 cells following cytokine stimulation. [Figure 13-2](E) Freshly isolated (upper panel) or preactivated (lower panel) CD8+ T cells were left unstimulated or stimulated with 1 μg / ml IL-2, H9-RE, H9-T, H9-RET, or H9-RETR for 30 minutes. CD25 expression (left panel) or pSTAT5 expression (right panel) was assayed by flow cytometry. (F) Cells were treated with IL-2, H9, H9-RET, or H9-RETR, as indicated, lysed, and Western blotted with antibodies against pSTAT5 or total STAT5. (G) Dose-response curves for pSTAT5 induction by wild-type IL-2, H9, H9-RE, H9-T, H9-RET, and H9-RETR. (H) Dose-response curves for phospho-S6 ribosomal protein (pS6) induction by wild-type IL-2, H9, H9-RET, and H9-RETR. MFI is mean fluorescence intensity. For dose-response experiments (A, B, G, H), the horizontal axis indicates the logarithm of cytokine concentration in ng / ml. MFI is mean fluorescence intensity. Data are representative of at least two experiments per panel (error bars, standard error of the mean of triplicate determinations). [Figure 14] Two separate assays demonstrate attenuated signaling of IL-2 muteins with reduced binding affinity for IL2Rγc. (A) Dose-response curves of phospho-ERK1 / ERK2 protein on CD25-YT1 human NK-like cells. (B) Comparison of IL-2Rβ and IL-2Rγ expression on freshly isolated (upper panel) or pre-activated (lower panel) human CD8+ T cells. Data are representative of at least two experiments per panel. Error bars represent the standard error of the mean of triplicate determinations. [Figure 15] Figure 1 shows proliferation and CD25 expression in response to IL-2, H9, H9-RE, H9-T, H9-RET, and H9-RETR. IL-2 and H9, but not H9-RET or H9-RETR, induce proliferation of freshly isolated human CD8+ T cells (H9-T has a moderate effect). Cells were labeled with CFSE and stimulated with the indicated IL-2 variants, and CFSE dilutions were assessed by flow cytometry 5 days later. [Figure 16-1]The effects of H9-RET and RETR on proliferation, STAT5 binding, and gene expression are shown. (A) Freshly isolated, pre-activated human CD8+ T cells were cultured in 96-well plates with various concentrations of the indicated IL-2 variants for 2 days, and [H]thymidine incorporation was measured. Bars represent the mean ± standard error of the mean. Cells from two individual donors were combined. Data are representative of at least two independent experiments. (B) RNA-Seq heat map analysis of pre-activated CD8+ T cells treated with IL-2, H9, H9-RET, and H9-RETR (1 μg / ml) for 24 hours. Genes whose expression was either up- or down-regulated by IL-2 compared to control are shown (expression of each gene is normalized between -1.00 and 1.00 according to the color scale). mRNAs that were preferentially up-regulated (red) or down-regulated (green) by more than two-fold are shown. [Figure 16-2] (C) The number of mRNAs up-regulated (open bars) or down-regulated (filled bars) after stimulation with the indicated cytokines. IL-2, H9, H9-RET, and H9-RETR induced 731, 742, 65, and 23 mRNAs, respectively, and repressed 437, 397, 13, and 46 mRNAs (fold change ≥ 2; p-value < 1e-10). (D) The number of STAT5B binding sites and their genome-wide distribution based on ChIP-Seq in pre-activated CD8+ T cells treated with IL-2 variants. The 5' untranslated region (5'UTR), exons, introns, and 3' untranslated region (3'UTR) as defined in the human RefSeq database are indicated (assembly GRCh37.p9). The 5 kb upstream of the TSS was designated as the promoter region. [Figure 16-3](E) Heatmap clustering was performed using the IL-2-induced STAT5B peak, centered approximately 1 kb upstream and 1 kb downstream of the STAT 'peak apex' (indicated by position "0"). The intensity of binding induced by IL-2, H9, H9-RET, and H9-RETR is indicated by the intensity of red color. (F) Expression of IL2RA, LTA, CISH, IL7RA, and BCL6 RNA relative to RPL7 in pre-activated cells left unstimulated or stimulated with IL-2, H9, H9-RET, and H9-RETR for 24 h. Data are representative of at least two experiments, except for RNA-Seq experiments where select genes were confirmed by RT-PCR (see text). [Figure 17] Figure 1 shows CD25 expression in pre-activated CD8+ T cells treated with IL-2, H9, H9-RE, H9-T, H9-RET, or H9-RETR. Data are representative of three independent experiments. [Figure 18-1] Figure 1 shows that H9-RETR inhibits IL-2R-mediated signaling. (A and B) H9-RET and H9-RETR are competitive inhibitors of IL-2 and IL-15. Preactivated human CD8+ T cells were incubated with the indicated concentrations of IL-2 or IL-15 in the absence or presence of 1 μg / ml of H9-RET or H9-RETR. (C and D) H9-RETR more potently blocks IL-2- and IL-15-induced STAT5 phosphorylation in preactivated CD8+ T cells than anti-Tac or Mikβ1 mAb. (E and F) H9-RETR more potently inhibits IL-2- or IL-15-induced proliferation than anti-Tac or Mikβ1. Mean ± standard error of the mean is shown. Data are representative of three independent experiments. [Figure 18-2](G) H9-RETR inhibits IL-2-induced (upper panel) and IL-15-induced (lower panel) STAT5 phosphorylation in vivo. C57BL / 6 mice were intraperitoneally injected with Fc4 or Fc4-H9-RETR 60 minutes before injection with IL-2 or IL-15. pSTAT5 was measured in splenic CD4+CD25+FoxP3+ T cells 30 minutes later. MFI is shown. Data are representative of three independent experiments. (H) Fc4-H9-RETR attenuates GVHD. BALB / c mice were irradiated (950 cGy) and transplanted with 10 million T-depleted bone marrow (BM) cells without or with 2 million Treg-depleted pan-T cells from C57BL / 6 mice. Mice receiving pan-T cells were treated with Fc4 or Fc4-H9-RETR fusion protein by intraperitoneal injection twice daily at 100 μg / dose for 10 days. Data represent pooled survival curves from three independent experiments and were analyzed using the Kaplan-Meier method and log-rank test. p=0.0001 for Fc4 vs. H9-RETR-Fc4. [Figure 18-3] (I) Blockade of proliferation of ED40515(+) T cells cultured with 50 U / ml IL-2 for 3 days in the presence or absence of UPC10, daclizumab, Mikβ1, or H9-RETR as indicated. Data are representative of two experiments, each performed in triplicate. (J) Six-day spontaneous proliferation assay of cells from patients with smoldering ATL treated with UPC10, daclizumab, Mikβ1, or H9-RETR. Assays were performed in triplicate. [Figure 19]Figure 1 shows the effects of the IL-2 muteins H9-RET and h9-RETR on CD8+ T cells. (A) H9-RET and H9-RETR inhibited IL-2-induced CD25 expression on preactivated CD8+ T cells. (B) IL2RA mRNA levels (normalized to RPL7 expression) in preactivated human CD8+ T cells stimulated with IL-2 in the presence or absence of H9-RET or H9-RETR. Data are representative of three independent experiments. (C) Inhibition of IL-2- and IL-15-induced T cell proliferation by H9-RETR. Freshly isolated CD8+ T cells were CFSE-labeled and stimulated with IL-2 or IL-15 (1 μg / ml) in the presence or absence of 1 μg / ml of H9-RET or H9-RETR, and CFSE dilution was assessed. Data are representative of three independent experiments (A and C) or pooled from two independent experiments performed in triplicate (B). [Figure 20] The effects of the IL-2 muteins H9-RET and h9-RETR on CD8+ T cells are shown. (A) Both H9-RET and H9-RETR suppress TCR-induced proliferation of freshly isolated CD8+ T cells. Cells were labeled with CFSE and stimulated with plate-bound anti-CD3 (2 μg / ml) and soluble anti-CD28 (1 μg / ml) for 4 days with or without 1 μg / ml of H9-RET or H9-RETR, and CFSE dilution was assessed by flow cytometry. (B) Either 1 μg / ml of H9-RET or H9-RETR inhibited TCR-induced CD25 expression in peripheral blood CD8+ T cells stimulated with 2 μg / ml of anti-CD3 and 1 μg / ml of anti-CD28 for 4 days. Data are representative of three independent experiments. [Figure 21] We show that H9-RET and H9-RETR inhibit Th1, Th9, and Treg differentiation but promote Th17 differentiation. Cells were differentiated under various T helper polarization conditions in the presence or absence of H9-RET or H9-RETR. Data are representative of at least two independent experiments for each cell type. [Figure 22]These results show that H9-RETR blocks IL-2-induced NK cell activation and cytotoxicity. (A) Unlike IL-2, neither H9-RET nor H9-RETR (1 μg / ml) stimulated CD69 expression in primary human NK cells after 24 hours of incubation, whereas H9-RETR inhibited IL-2 (100 ng / ml)-induced CD69 expression. Experiments were performed in duplicate. (B, C) Neither H9-RET nor H9-RETR stimulated cytotoxicity in primary human NK cells, and 103 ng / ml of H9-RETR inhibited IL-2-induced NK cell cytotoxicity of HER18 (B) and K562 (C) target cells. NK cells and target cells were incubated at a 10:1 ratio for 4 hours in the presence of the indicated cytokines. HER18 cytolysis was determined by 51Cr release and was performed in triplicate. Lysis of K562 cells was assessed by flow cytometry. Four independent experiments were performed. [Figure 23] FIG. 18B is a schematic diagram of the protocol used for the experiment in FIG. 18G. DETAILED DESCRIPTION OF THE INVENTION
[0027] In order that the present disclosure may be more readily understood, certain terms and phrases are defined below and throughout the specification.
[0028] definition All references cited herein are incorporated by reference in their entirety as if fully set forth. Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons (New York, NY 2001); March, Advanced Organic Chemistry Reactions, Mech and Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2001), provide those of skill in the art with a general guide to many of the terms used in this disclosure. Where appropriate, procedures involving the use of commercially available kits and reagents are generally performed according to manufacturer-defined protocols and / or parameters unless otherwise noted.
[0029] As used herein, "IL-2" refers to wild-type IL-2, whether natural or recombinant. Mature human IL-2 occurs as a 133 amino acid sequence (excluding a signal peptide consisting of an additional 20 N-terminal amino acids) as described in Fujita et al., PNAS USA, 80, 7437-7441 (1983). The amino acid sequence of human IL-2 (SEQ ID NO: 1) is found under Genbank accession locator: NP_000577.2. The amino acid sequence of mature human IL-2 is set forth in SEQ ID NO: 2. The amino acid sequence of mouse (Mus musculus) IL-2 is found under Genbank accession locator: SEQ ID NO: 3. The amino acid sequence of mature mouse IL-2 is set forth in SEQ ID NO: 4. SEQ ID NO: 1 [ka] SEQ ID NO: 2 [ka] SEQ ID NO: 3 [ka] SEQ ID NO:4 [ka]
[0030] As used herein, "IL-2 mutein" refers to an IL-2 polypeptide that has specific substitutions relative to the interleukin-2 protein. IL-2 muteins are characterized by amino acid insertions, deletions, substitutions, and modifications at one or more sites or other residues in the native IL-2 polypeptide chain. In accordance with the present disclosure, any such insertions, deletions, substitutions, and modifications result in an IL-2 mutein that retains IL-2Rβ binding activity. Exemplary muteins can include substitutions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acids.
[0031] Muteins also include conservative modifications and substitutions at other positions of IL-2 (i.e., those that have minimal effect on the secondary or tertiary structure of the mutein). Such conservative substitutions include those described by Dayhoff in The Atlas of Protein Sequence and Structure 5 (1978) and by Argos in Conservative modifications include those described in EMBO J., 8:779-785 (1989). For example, amino acids belonging to one of the following groups: Group I: ala, pro, gly, gln, asn, ser, thr; Group II: cys, ser, tyr, thr; Group III: val, ile, leu, met, ala, phe; Group IV: lys, arg, his; Group V: phe, tyr, trp, his; and Group VI: asp, glu correspond to conservative modifications.
[0032] "Numbered according to IL-2" means that the selected amino acid is identified with reference to the position where it normally occurs in the mature sequence of wild-type IL-2; for example, R81 refers to the 81st amino acid, arginine, present in SEQ ID NO:2.
[0033] The term "cell type bearing the IL-2Rαβγ receptor" refers to cells known to have this receptor type, i.e., T cells, activated T cells, B cells, activated monocytes, and activated NK cells. The term "cell type bearing the IL-2Rβγ receptor" refers to cells known to have that receptor type, i.e., B cells, resting monocytes, and resting NK cells.
[0034] The term "identity," as used herein with respect to polypeptide or DNA sequences, refers to the identity of the subunit sequences between two molecules. When a subunit position in both molecules is occupied by the same monomeric subunit (i.e., the same amino acid residue or nucleotide), then the molecules are identical at that position. The similarity between two amino acid sequences or between two nucleotide sequences is a direct function of the number of identical positions. Generally, sequences are aligned to obtain the highest degree of match. Where appropriate, identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, or FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990). Sequence identity can be measured using sequence analysis software with default parameters, for example, the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705).
[0035] The terms "polypeptide," "protein," or "peptide" refer to any chain of amino acid residues, regardless of length or post-translational modification (eg, glycosylation or phosphorylation).
[0036] When variant IL-2 polypeptides of the disclosure are "substantially pure," they can be at least about 60% by weight (dry weight) of the polypeptide of interest, e.g., a polypeptide containing a variant IL-2 amino acid sequence. For example, the polypeptide can be at least about 75%, 80%, 85%, 90%, 95%, or 99% by weight of the polypeptide of interest. Purity can be measured by any appropriate standard method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
[0037] An "agonist" is a compound that interacts with a target to cause or promote an increase in the activation of the target.
[0038] A "partial agonist" interacts with the same target as an agonist, but increasing the dosage of the partial agonist produces biochemical effects as great as those of an agonist. and / or compounds that do not produce the magnitude of physiological effects.
[0039] A "superagonist" is a type of agonist that can produce a maximal response that is greater than the endogenous agonist for the target receptor, thereby having an efficacy greater than 100%.
[0040] An "antagonist" is a compound that opposes the action of an agonist, e.g., by preventing, reducing, inhibiting, or neutralizing the activity of the agonist. An "antagonist" can also prevent, inhibit, or reduce the constitutive activity of a target, e.g., a target receptor, even in the absence of an identified agonist.
[0041] "Operably linked" is intended to mean that the nucleotide sequence of interest (i.e., the sequence encoding the IL-2 mutein) is linked to a control sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). "Control sequence" includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). See, e.g., Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, Calif.). Control sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific control sequences). It will be understood by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression constructs of the present invention can be introduced into host cells to thereby produce the human IL-2 muteins disclosed herein, or to produce biologically active variants thereof.
[0042] The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in subsequent generations, either due to mutation or environmental influences, such progeny may not be effectively identical to the parent cell, but are still included within the scope of the terms as used herein.
[0043] As used herein, the terms "transformation" and "transfection" refer to various art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, particle gun, or electroporation.
[0044] As used herein, the term "pharmaceutically acceptable carrier" includes, but is not limited to, saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., that are compatible with pharmaceutical administration. Supplementary active compounds (e.g., antibiotics) can also be incorporated into the compositions.
[0045] As used herein, the terms "cancer" (or "cancerous"), "hyperproliferative," and "neoplastic" refer to cells that have the capacity for autonomous growth (i.e., an abnormal state or condition characterized by rapidly proliferating cell growth). Hyperproliferative and neoplastic disease states may be classified pathologically (i.e., characterizing or constituting a disease state), or they may be classified non-pathologically (i.e., as a deviation from normal, but not associated with a disease state). The terms refer to all types of cancer growth or oncogenic processes, metastatic tissue, regardless of histopathological type or invasive stage. "Pathological hyperproliferative" refers to the proliferation of cells, tissues, or organs that are either malignant, refractory, or malignantly transformed. "Pathological hyperproliferative" cells are found in disease states characterized by malignant tumor growth. Examples of non-pathological hyperproliferative cells include proliferation of cells associated with wound repair. The term "cancer" or "neoplasm" is used to refer to malignant tumors of various organ systems, including those affecting the lung, breast, thyroid, lymph glands and lymphatic tissue, gastrointestinal organs, and genitourinary tract, as well as malignant tumors in general, e.g., adenocarcinomas, which are considered to include most colon, renal cell, prostate, and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus.
[0046] The term "carcinoma" is art-recognized and refers to malignant tumors of epithelial or endocrine tissue, including cancers of the respiratory system, gastrointestinal system, genitourinary system, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma. "Adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
[0047] As used herein, the term "hematopoietic neoplastic disorder" refers to a disease involving hyperplastic / neoplastic cells, or their precursor cells, derived from the hematopoietic system, e.g., myeloid, lymphoid, or erythroid lineages. Preferably, the disease arises from poorly differentiated acute leukemias (e.g., erythroblastic leukemia and acute megakaryoblastic leukemia). Further exemplary bone marrow disorders include, but are not limited to, acute promyelocytic leukemia (APML), acute myeloid leukemia (AML), and chronic myeloid leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol. / Hemotol. 11:267-97); lymphoid malignancies include, but are not limited to, acute lymphoblastic leukemia (ALL), including B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia (HLL), and Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphoma include, but are not limited to, non-Hodgkin's lymphoma and its variants, peripheral T-cell lymphoma, adult T-cell leukemia / lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's disease, and Reed-Sternberg disease.
[0048] IL-2 mutein IL-2 mutein partial agonists and antagonists In one aspect, provided herein are IL-2 muteins that are partial agonists and antagonists. In certain embodiments, the IL-2 muteins have a reduced IL-2Rγ binding activity compared to wild-type IL-2 (e.g., human IL-2, SEQ ID NO: 2). cProvided herein are IL-2 muteins containing one or more mutations that reduce binding affinity to the receptor. As used herein, "common gamma chain," "gamma c ", IL-2Rγ c The terms "," "Yc," "IL-2Rγ," "IL-2 receptor subunit γ," and "IL-2RG" (Genbank accession numbers: NM_000206 and NP_000197 (human) and NM_013563 and NP_038591 (mouse)) all refer to members of the type I cytokine receptor family that are cytokine receptor subunits for receptor complexes for at least six different interleukin receptors, including, but not limited to, the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors. IL-2Rγ c interacts with IL-2Rβ to form the intermediate affinity IL-2 receptor primarily on memory T cells and natural killer (NK) cells, and with IL-2Rα and IL-2Rβ to form the high affinity IL-2 receptor on activated T cells and regulatory T cells (Tregs). Without being bound by a particular theory of action, such muteins are thought to be IL-2Rβ / IL-2Rγ c IL-2β / IL-2γ upon binding to IL-2Rβ on + cells (e.g., resting T cells and natural killer (NK) cells) c It is believed that by attenuating or inhibiting heterodimerization and signaling, it may function as an IL-2 partial agonist or antagonist.
[0049] Exemplary subject IL-2 muteins are at least about 50%, at least about 65%, at least about 70%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to wild-type IL-2. Mutations can consist of changes in the number or content of amino acid residues. For example, a mutant IL-2 can have a greater or lesser number of amino acid residues than wild-type IL-2. Alternatively or additionally, exemplary mutant polypeptides can contain substitutions of one or more amino acid residues present in wild-type IL-2. In various embodiments, a mutant IL-2 polypeptide can differ from wild-type IL-2 by the addition, deletion, or substitution of a single amino acid residue.
[0050] As an illustration, an IL-2 mutein comprising an amino acid sequence at least 95% identical to the reference amino acid sequence SEQ ID NO: 2 is a polypeptide comprising a sequence identical to the reference sequence except for containing at most five alterations of the reference amino acid sequence of SEQ ID NO: 2. For example, at most 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid or number of amino acids, and up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence can occur at the amino (N--)-terminal position or the carboxy (C--)-terminal position of the reference amino acid sequence, or anywhere between these terminal positions, and are scattered either individually among the residues of the reference sequence or in one or more contiguous groups within the reference sequence.
[0051] In certain embodiments, the IL-2 mutein binds to IL-2Rγ with at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% less affinity than wild-type IL-2. cThe binding affinity of the IL-2 muteins is also higher than that of wild-type IL-2. c The affinity of the subject IL-2 muteins for IL-2γ can be expressed as 1.2, 1.4, 1.5, 2, 5, 10, 15, 20, 25, 50, 100, 200, 250, or more times lower than that for IL-2γ. c The binding affinity to IL-2Rγ can be measured using any suitable method known in the art. c Suitable methods for measuring binding include, but are not limited to, radioactive ligand binding assays (e.g., saturation binding, Scatchard plots, non-linear curve fitting programs, and competitive binding assays); non-radioactive ligand binding assays (e.g., fluorescence polarization (FP), fluorescence resonance energy transfer (FRET), and surface plasmon resonance assays (see, e.g., Drescher et al., Methods Mol Biol 493:323-343 (2009))); solution-phase ligand binding assays (e.g., real-time polymerase chain reaction (RT-qPCR) and immunoprecipitation); and solid-phase ligand binding assays (e.g., multiwell plate assays, ligand-binding assays on beads, ligand-binding assays on columns, and filter assays).
[0052] In certain embodiments, the IL-2 mutein is an IL-2Rγ mutein of IL-2Rβ. c disrupts the association of IL-2Rβ / IL-2Rγ with c The interaction is reduced by about 2%, about 5%, about 10%, about 15%, about 20%, about 50%, about 75%, about 90%, about 95%, or more compared to wild-type IL-2.
[0053] In some embodiments, the IL-2 mutein IL-2Rγ c The one or more mutations that reduce binding affinity to the receptor are amino acid substitutions. In some embodiments, a subject IL-2 mutein has 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions compared to wild-type IL-2 (SEQ ID NO: 2). , 8, 9, 10, 11, 12, 13, 14, or 15 amino acid substitutions. The substituted amino acid residue(s) may be, but are not necessarily, conservative substitutions, typically including substitutions within the following groups: glycine, alanine, valine; isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In certain embodiments, the substitutions are c This is a substitution of amino acid residues in IL-2 that contact the binding interface.
[0054] In certain embodiments, the amino acid substitutions are at one or more amino acid positions of wild-type IL-2 selected from positions 18, 22, 126, and / or 130, numbered according to wild-type hIL-2 (e.g., SEQ ID NO: 2). c Amino acid substitutions that decrease receptor binding affinity include amino acid substitutions L18R, Q22E, A126T, and / or S130R, or combinations thereof.
[0055] In some embodiments, IL-2Rγ c The amino acid substitution that decreases the binding affinity of the receptor includes Q126T. c Amino acid substitutions that decrease the binding affinity of the receptor include L18R and Q22E. c Amino acid substitutions that decrease receptor binding affinity include L18R, Q22E, and Q126T. c Amino acid substitutions that decrease receptor binding affinity include L18R, Q22E, Q126T, and S130R.
[0056] In some embodiments, the IL-2 mutein that has reduced binding affinity to the IL-2Rβ receptor further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more mutations that increase IL-2Rβ binding affinity. As used herein, both the terms "IL-2Rβ" and "CD122" (Genbank Accession Nos. NM_000878 and NP_000869 (human)) refer to the IL-2Rγ receptor. c interacts with IL-2Rα and IL-2Rγ to form the intermediate affinity IL-2 receptor, primarily on memory T cells and natural killer (NK) cells. c IL-2Rβ and IL-2Rγ are members of the type I cytokine receptor family that interact with IL-2Rβ to form the high-affinity IL-2 receptor on activated T cells and regulatory T cells (Tregs). Without being bound by any particular theory of operation, IL-2Rβ and IL-2Rγ are members of the type I cytokine receptor family that interact with IL-2Rβ to form the high-affinity IL-2 receptor on activated T cells and regulatory T cells (Tregs). c Such IL-2 muteins, which have weak binding affinity to IL-2Rβ-γ, are thought to serve as dominant-negative scaffolds that generate a "receptor signaling clamp" that blocks endogenous signaling. c This results in attenuation of heterodimerization, representing a new class of mechanism-based IL-2 partial agonists and non-signaling (neutral) molecules that functionally act as antagonists by blocking endogenous cytokines and exerting no effects of their own (see schematic diagram in Figure 1).
[0057] In certain embodiments, a subject IL-2 mutein contains at least one mutation (e.g., deletion, addition, or substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues) compared to wild-type IL-2 (e.g., SEQ ID NO: 2) and binds to IL-2Rβ with greater affinity than wild-type IL-2.
[0058] In certain embodiments, an IL-2 mutein binds to IL-2Rβ with an affinity that is at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% greater than wild-type IL-2. The binding affinity of an IL-2 mutein can also be expressed as 1.2, 1.4, 1.5, 2, 5, 10, 15, 20, 25, 50, 100, 200, 250, or more times greater than the affinity of wild-type IL-2 for IL-2Rβ. Binding to 2Rβ can be assessed by any suitable method known to those of skill in the art, including but not limited to those described above.
[0059] In some embodiments, at least one mutation that increases IL-2Rβ binding affinity is an amino acid substitution. In some embodiments, the amino acid substitution that increases IL-2Rβ binding affinity comprises a substitution at amino acid position 124, P65, Q74, L80, R81, L85, I86, I89, I92, and / or V93, numbered according to wild-type hIL-2 (SEQ ID NO: 2): in certain embodiments, the substitution comprises I24V, P65H, Q74R, Q74H, Q74N, Q74S, L80F, L80V, R81I, R81T, R81D, L85V, I86V, I89V, I92F, and / or V93I, or a combination thereof. In certain embodiments, substitutions include Q74N, Q74H, Q74S, L80F, L80V, R81D, R81T, L85V, I86V, I89V, and / or I93V, or combinations thereof.
[0060] In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80F, R81D, L85V, I86V, I89V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80V, R81T, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74H, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74N, L80F, R81D, L85V, I86V, and I92F. In some embodiments, amino acid substitutions that increase IL-2Rβ binding affinity include Q74S, R81T, L85V, and I92F.
[0061] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0062] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0063] In an exemplary embodiment, the binding affinity of a human IL-2Rβ to the IL-2Rβ gene is increased compared to wild-type human IL-2. The affinity is greater and IL-2Rγ c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0064] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0065] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions Q74N, L80F, R81D, L85V, I86V, I89V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0066] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, I89V, and I92F. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0067] In an exemplary embodiment, the IL-2Rβ receptor has greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, include the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, I89V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0068] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, I89V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0069] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions Q74N, L80V, R81T, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0070] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22E, Q74N, L80V, R81T, L85V, I86V, and I92F. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0071] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, include the amino acid substitutions L18R, Q22E, Q74N, L80V, R81T, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0072] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80V, R81T, L85V, I86V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0073] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions Q74H, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0074] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22E, Q74H, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0075] In an exemplary embodiment, the IL-2Rβ receptor has greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74H, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0076] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74H, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0077] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions Q74S, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0078] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74S, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0079] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74S, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0080] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74S, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0081] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions Q74N, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0082] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, and I92F. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0083] In various embodiments, the human IL-2 has greater binding affinity to IL-2Rβ and IL-2Rγ compared to wild-type human IL-2. c The subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0084] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22E, Q74N, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0085] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions Q74S, R81T, L85V, I92F, and Q126T. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0086] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22E, Q74S, R81T, L85V, and I92F. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0087] In certain embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rγ as compared to wild-type human IL-2. cThe subject IL-2 muteins, which have lower binding affinity for the receptor, contain the amino acid substitutions L18R, Q22S, Q74H, R81T, L85V, I92F, and Q126T. In certain embodiments, the IL-2 muteins have the amino acid sequence: [ka] It has.
[0088] In some embodiments, the IL-2Rβ receptor has a greater binding affinity to IL-2Rβ than wild-type human IL-2. c A subject IL-2 mutein having reduced binding affinity for the receptor comprises the amino acid substitutions L18R, Q22S, Q74H, R81T, L85V, I92F, Q126T, and S130R. In certain embodiments, the IL-2 mutein has the amino acid sequence: [ka] It has.
[0089] In various embodiments, a subject IL-2 mutein has an amino acid sequence according to the following formula:
[0090] APTSSSTKKTQLQLEHL-(X 1 ) n -LDL-(X 2 ) n --M-(X 3 ) n --LNGINNYKNPKLTRMLTFKFY-MPKKATELKHLQCLEEELK-(X 4 ) n - - LEEVLNLA-(X 5 ) n - - SKNFH-(X 6 ) n -(X 7 ) n--PRD-(X 8 ) n --(X 9 ) n --SN-(X 10 ) n --NV-(X 11 ) n --(X 12 ) n --LELKGSETTFMCEYADETATI-VEFLN-RW-ITFC-(X 13 ) n --SII-(X 14 ) n --TLT, wherein each n is independently selected from 0 or 1; X 1 is L (wild type) or R; X 2 is Q (wild type) or E; X 3 is I (wild type) or V; X 4 is P (wild type) or H; X 5 is Q (wild type), R, H, N, or S; X 6 is L (wild type), F, or V; X 7 is R (wild type), I, T, or D; X 8 is L (wild type) or V; X 9 is I (wild type) or V; X 10 is I (wild type) or V; X 11 is I (wild type) or F; X 12 is V (wild type) or I; X 13 is A (wild type) or T; X 14 is S (wild type) or R (SEQ ID NO: 50).
[0091] In certain embodiments of an IL-2 mutein according to SEQ ID NO: 50, X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , X 8 , X 9 , X 10 , X 11 , X 12 , X 13 , or X 14 In some embodiments, the amino acid in at least one of X is not a wild-type amino acid. 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , X 8 , X 9 , X 10 , X 11 , X 12 , X 13 , or X 14 wherein at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the amino acids are not wild-type amino acids. In some embodiments, the IL-2 mutein has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% homology to the IL-2 mutein of SEQ ID NO:50.
[0092] In some embodiments, a subject IL-2 mutein that is a partial agonist has one or more reduced functions compared to wild-type IL-2.
[0093] In certain embodiments, the IL-2 mutein is IL-2Rβ / IL-2Rγ cThe subject IL-2 muteins have a reduced ability to stimulate one or more signal transduction pathways that depend on heterodimerization. In some embodiments, the subject IL-2 muteins have a reduced ability to stimulate STAT5 phosphorylation in IL-2Rβ+ cells compared to wild-type hIL-2. In some embodiments, the IL-2 muteins stimulate STAT5 phosphorylation in IL-2Rβ+ cells at 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the level at which wild-type IL-2 stimulates STAT5 phosphorylation in the same cells. In some embodiments, the IL-2Rβ+ cells are T cells. In certain embodiments, the T cells are CD8+ T cells. In some embodiments, the CD8+ T cells are freshly isolated CD8+ T cells. In another embodiment, the CD8+ T cells are activated CD8+ T cells. In another embodiment, the IL-2Rβ+ cells are natural killer (NK) cells.
[0094] In some embodiments, the mutein has a reduced ability to stimulate ERK1 / ERK2 signaling in IL-2Rβ+ cells compared to wild-type hIL-2. In some embodiments, the IL-2 mutein stimulates pERK1 / ERK2 signaling in IL-2Rβ+ cells at 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the level at which wild-type IL-2 stimulates pERK1 / ERK2 signaling in the same cells ... The cells are T cells. In certain embodiments, the T cells are CD8+ T cells. In some embodiments, the CD8+ T cells are freshly isolated CD8+ T cells. In other embodiments, the CD8+ T cells are activated CD8+ T cells. In other embodiments, the IL-2Rβ+ cells are natural killer (NK) cells.
[0095] STAT5 and ERK1 / 2 signaling can be measured, for example, by phosphorylation of STAT5 and ERK1 / 2 using any suitable method known in the art. For example, STAT5 and ERK1 / 2 phosphorylation can be measured using antibodies specific for phosphorylated versions of these molecules in combination with flow cytometry analysis, as described herein.
[0096] In some embodiments, the mutein has a reduced ability to stimulate PI3 kinase signaling in IL-2Rβ+ cells compared to wild-type hIL-2. In some embodiments, the IL-2 mutein stimulates PI3 kinase signaling in IL-2Rβ+ cells at 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the level at which wild-type IL-2 stimulates PI3 kinase signaling in the same cells. In some embodiments, the IL-2Rβ+ cells are T cells. In specific embodiments, the T cells are CD8+ T cells. In some embodiments, the CD8+ T cells are activated CD8+ T cells. In other embodiments, the IL-2Rβ+ cells are natural killer (NK) cells.
[0097] PI3 kinase signaling can be measured using any suitable method known in the art, for example, PI3 kinase signaling can be measured using an antibody specific for phospho-S6 ribosomal protein in conjunction with flow cytometry analysis, as described herein.
[0098] In certain embodiments, the mutein has a reduced ability to induce lymphocyte proliferation compared to wild-type IL-2. In some embodiments, the lymphocytes are T cells. In certain embodiments, the lymphocytes are primary CD8+ T cells. In other embodiments, the lymphocytes are activated CD8+ T cells. Cell proliferation can be measured using any suitable method known in the art. For example, lymphocyte proliferation can be measured using a carboxyfluorescein diacetate succinimidyl diester (CFSE) dilution assay, as described herein, or by [ 3 In some embodiments, the IL-2 mutein induces lymphocyte proliferation at 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or less of the level at which wild-type IL-2 induces lymphocyte proliferation.
[0099] In some embodiments, the IL-2 mutein has a reduced ability to activate IL-2Rα expression in lymphocytes compared to wild-type IL-2. In some embodiments, the IL-2 mutein activates IL-2Rα expression in lymphocytes at 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the level at which wild-type IL-2 activates IL-2Rα expression in the same cells. In some embodiments, the lymphocytes are CD8+ T cells. In some embodiments, the CD8+ T cells are freshly isolated CD8+ T cells. In other embodiments, the CD8+ T cells are activated CD8+ T cells.
[0100] Without being bound to a particular theory of operation, it is believed that the enhancement of IL-2Rβ binding and IL-2R gamma cIt is thought that IL-2 muteins that exhibit reduced activity may function as dominant-negative IL-2 antagonists, interfering with one or more IL-2-dependent functions. Such antagonists may prevent IL-2 from binding to IL-2Rβ, while inhibiting IL-2Rβ / IL-2Rγ binding. c Furthermore, IL-15 signaling also functions by inhibiting IL-2Rβ / IL-2Rγ heterodimerization. c Because they function through receptor binding, it is believed that such IL-2 muteins can also function as IL-15 antagonists. In certain embodiments, the IL-2 muteins inhibit one or more functions of IL-2 and / or IL-15.
[0101] In some embodiments, the IL-2 mutein that inhibits one or more functions of IL-2 and / or IL-15 comprises amino acid substitutions at amino acid positions 18, 22, and 126, numbered according to wild-type hIL-2. In some embodiments, the amino acid substitutions in the IL-2 mutein comprise L18R, Q22E, and Q126T, numbered according to wild-type hIL-2.
[0102] In some embodiments, the IL-2 mutein that inhibits one or more functions of IL-2 and / or IL-15 comprises amino acid substitutions at amino acid positions 18, 22, 126, and 130, numbered according to wild-type hIL-2. In some embodiments, the amino acid substitutions in the IL-2 mutein comprise L18R, Q22E, Q126T, and S130R, numbered according to wild-type hIL-2.
[0103] In certain embodiments, the mutein is an inhibitor of IL-2 and / or IL-15 STAT5 phosphorylation in CD8+ T cells. In some embodiments, the mutein is an inhibitor of IL-2 and / or IL-15-induced proliferation of CD8+ T cells. In some embodiments, the mutein is an inhibitor of IL-2-dependent TCR-induced cell proliferation.
[0104] IL-2 promotes Th1, Th9, and Treg T cell differentiation and inhibits Th17 differentiation. Therefore, without being bound by a particular theory of operation, it is believed that IL-2 muteins that function as IL-2 antagonists can inhibit Th1, Th9, and / or Treg cell differentiation or promote Th17 cell differentiation. In some embodiments, the IL-2 mutein is an inhibitor of IL-2-dependent Th1, Th9, and / or Treg differentiation. In certain embodiments, the mutein is a promoter of Th17 differentiation.
[0105] In certain embodiments, the mutein is an inhibitor of IL-2-dependent activation of natural killer (NK) cells. IL-2 activation of NK cells can be measured by any suitable method known in the art, for example, by measuring IL-2-induced CD69 expression and / or cytotoxicity, as described herein.
[0106] Recombinant expression of IL-2 muteins, expression vectors, and host cells In various embodiments, the polypeptides used in the practice of the invention are synthetic polypeptides or are produced by expression of recombinant nucleic acid molecules. When a polypeptide is chimeric (e.g., a fusion protein containing at least a mutant IL-2 polypeptide and a heterologous polypeptide), it can be encoded by a hybrid nucleic acid molecule containing one sequence encoding all or a portion of a mutant IL-2 and another sequence encoding all or a portion of a heterologous polypeptide. For example, the subject IL-2 muteins described herein may be fused to a hexahistidine tag to facilitate purification of bacterially expressed proteins, or to a hemagglutinin tag to facilitate purification of eukaryotically expressed proteins.
[0107] Methods for constructing DNA sequences encoding IL-2 muteins and for expressing these sequences in an appropriately transformed host include, but are not limited to, the use of PCR-assisted mutagenesis techniques. Mutations consisting of deletions or additions of amino acid residues to an IL-2 polypeptide can also be performed using standard recombinant techniques. For deletions or additions, the nucleic acid molecule encoding IL-2 is optionally digested with an appropriate restriction endonuclease. The resulting fragments can be either directly expressed or further manipulated, for example, by ligation to another fragment. Ligation can be facilitated if the two ends of the nucleic acid molecule contain overlapping complementary nucleotides, although blunt-ended fragments can also be ligated. PCR-generated nucleic acids can also be used to generate various mutant sequences.
[0108] The complete amino acid sequence can be used to construct a reverse-translated gene. DNA oligomers containing nucleotide sequences encoding IL-2 muteins can be synthesized. For example, several small oligonucleotides encoding portions of the desired polypeptide can be synthesized and then ligated. Individual oligonucleotides usually contain 5' or 3' overhangs for complementary assembly.
[0109] In addition to producing mutant polypeptides through expression of nucleic acid molecules that have been altered by recombinant molecular biology techniques, the subject IL-2 muteins can be chemically synthesized. Chemically synthesized polypeptides are routinely produced by those of skill in the art.
[0110] Once assembled (by synthesis, site-directed mutagenesis, or otherwise), the DNA sequence encoding the IL-2 mutein will be inserted into an expression vector and operably linked to appropriate expression control sequences for expression of the IL-2 mutein in the desired transformed host. Proper assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As is well known in the art, to obtain high expression levels of a transfected gene in a host, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host.
[0111] The DNA sequence encoding the IL-2 mutein can also include a DNA sequence encoding a signal sequence, whether prepared by site-directed mutagenesis, chemical synthesis, or other methods. If present, such a signal sequence must be recognized by the cell selected for expression of the IL-2 mutein. It can be prokaryotic, eukaryotic, or a combination of the two. It can also be the native IL-2 signal sequence. The inclusion of a signal sequence depends on whether secretion of the IL-2 mutein is desired in the recombinant cell in which it is incorporated. If the selected cell is a prokaryotic cell, it is generally preferred that the DNA sequence does not encode a signal sequence. If the selected cell is a eukaryotic cell, it is generally preferred that a signal sequence be encoded, with the wild-type IL-2 signal sequence being most preferably used.
[0112] IL-2 mutein fusion protein As previously mentioned, exemplary subject IL-2 muteins can be prepared as fusion or chimeric polypeptides comprising a subject IL-2 mutein and a heterologous polypeptide (i.e., a polypeptide that is not IL-2 or a variant thereof) (see, e.g., U.S. Pat. No. 6,451,308). Exemplary heterologous polypeptides can increase the circulating half-life of the chimeric polypeptide in vivo, and thus may further enhance the properties of the mutant IL-2 polypeptide. In various embodiments, the polypeptide that increases circulating half-life is a serum albumin, such as human serum albumin, or a polypeptide lacking the heavy chain variable region of IgG. The Fc region may be an Fc region of an IgG subclass antibody. Exemplary Fc regions may contain mutations that inhibit complement fixation and Fc receptor binding, or may be lytic, i.e., capable of binding complement or lysing cells by another mechanism, such as antibody-dependent complement lysis (ADCC; U.S. Ser. No. 08 / 355,502, filed Dec. 12, 1994).
[0113] The "Fc region" can be a natural or synthetic polypeptide homologous to the C-terminal domain of IgG, produced by digesting IgG with papain. The molecular weight of the Fc region of IgG is approximately 50 kDa. A mutant IL-2 polypeptide can include the entire Fc region or a small portion that retains the ability to extend the circulating half-life of the chimeric polypeptide of which it is a part. In addition, full-length or fragmented Fc regions can be variants of the wild-type molecule; that is, they can contain mutations that may or may not affect the function of the polypeptide. As described further below, native activity may not be required or desired in all cases. In certain embodiments, an IL-2 mutein fusion protein (e.g., an IL-2 partial agonist or antagonist as described herein) comprises an IgG1, IgG2, IgG3, or IgG4 Fc region.
[0114] Fc regions can be "lytic" or "nonlytic," but are usually nonlytic. Nonlytic Fc regions usually lack the high-affinity Fc receptor binding site and the C'1q binding site. The high-affinity Fc receptor binding site of mouse IgG Fc contains a Leu residue at position 235 of the IgG Fc. Therefore, the Fc receptor binding site can be disrupted by mutating or deleting Leu235. For example, substituting Glu for Leu235 inhibits the ability of the Fc region to bind to the high-affinity Fc receptor. The mouse C'1q binding site can be functionally disrupted by mutating or deleting IgG residues Glu318, Lys320, and Lys322. For example, substituting Ala residues for Glu318, Lys320, and Lys322 disables the IgG Fc from directing antibody-dependent complement lysis. In contrast, the Fc region of soluble IgG has a high-affinity Fc receptor binding site and a C'1q binding site. The high-affinity Fc receptor binding site contains a Leu residue at position 235 of the IgG Fc, and the C'1q binding site contains Glu318, Lys320, and Lys322 residues of IgG1. The Fc of soluble IgG has wild-type residues or conservative amino acid substitutions at these sites. The Fc of soluble IgG can target cells for antibody-dependent cellular cytotoxicity or complement-dependent cytotoxicity (CDC). Mutations suitable for human IgG are also known (see, e.g., Morrison et al., The Immunologist 2:119-124, 1994; and Brekke et al., The Immunologist 2:125, 1994).
[0115] In other embodiments, the chimeric polypeptide can comprise a subject IL-2 mutein and a polypeptide that functions as an antigenic tag, such as a FLAG sequence, which is recognized by a biotinylated, highly specific anti-FLAG antibody, as described herein (see also Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992). In some embodiments, the chimeric polypeptide further comprises a C-terminal c-myc epitope tag.
[0116] In other embodiments, the chimeric polypeptide comprises a heterologous polypeptide that functions to enhance expression or direct the subcellular localization of a mutant IL-2 polypeptide, such as a mutant IL-2 polypeptide and an Aga2p agglutinin subunit (see, e.g., Boder and Wittrup, Nature Biotechnol. 15:553-7, 1997).
[0117] In other embodiments, chimeric polypeptides can be generated that include a mutant IL-2 and an antibody or antigen-binding portion thereof. The antibody or antigen-binding component of the chimeric protein can function as a targeting moiety. For example, it can be used to localize the chimeric protein to a specific subset of cells or target molecules. Methods for generating cytokine-antibody chimeric polypeptides are described, for example, in U.S. Patent No. 6,617,135.
[0118] Nucleic acid molecules encoding mutant IL-2 In some embodiments, the subject IL-2 muteins can be obtained by expression of nucleic acid molecules, either alone or as part of a chimeric polypeptide as described above. Just as IL-2 muteins can be described in terms of their identity to a wild-type IL-2 polypeptide, the nucleic acid molecules encoding them will necessarily have a certain degree of identity to those encoding wild-type IL-2. For example, a nucleic acid molecule encoding a subject IL-2 mutein can be at least 50%, at least 65%, preferably at least 75%, more preferably at least 85%, and most preferably at least 95% (e.g., 99%) identical to a nucleic acid encoding wild-type IL-2 (e.g., SEQ ID NO: 2).
[0119] The provided nucleic acid molecules can include natural sequences or sequences that are different from those occurring in nature, but encode the same polypeptide due to the degeneracy of the genetic code. These nucleic acid molecules can be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, e.g., produced by phosphoramidite-based synthesis), or a combination or modification of nucleotides in these types of nucleic acids. In addition, the nucleic acid molecules can be double-stranded or single-stranded (i.e., sense or antisense strand).
[0120] A nucleic acid molecule is not limited to a sequence encoding a polypeptide, but can also include some or all of the non-coding sequences upstream or downstream of the coding sequence (e.g., the coding sequence for IL-2). Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can be produced, for example, by treating genomic DNA with restriction endonucleases or by performing polymerase chain reaction (PCR). When the nucleic acid molecule is ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.
[0121] Exemplary isolated nucleic acid molecules of the present disclosure can include fragments not found by themselves in nature. Thus, the present disclosure includes recombinant molecules, e.g., those in which a nucleic acid sequence (e.g., a sequence encoding a variant IL-2) is incorporated into a vector (e.g., a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell at a location other than the natural chromosomal location).
[0122] As described above, a subject IL-2 mutein may be present as part of a chimeric polypeptide. In addition to, or instead of, the heterologous polypeptides described above, a subject nucleic acid molecule can contain a sequence encoding a "marker" or "reporter." Examples of marker or reporter genes include β-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo), and the like. r , G418 r ), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacz (encoding β-galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT). Those skilled in the art will know of additional useful reagents, for example, additional sequences that can serve as markers or reporters.
[0123] The subject nucleic acid molecules can be obtained by introducing mutations into DNA encoding IL-2 obtained from any biological cell, such as a mammalian cell. Thus, the subject nucleic acids (and the polypeptides they encode) can be from a mouse, rat, guinea pig, cow, sheep, horse, pig, rabbit, monkey, baboon, dog, or cat. In one embodiment, the nucleic acid molecule is human.
[0124] Expression of mutant IL-2 gene products The nucleic acid molecules can be contained within a vector that is capable of directing expression of the nucleic acid molecule, for example, in a cell that the vector is transduced in. Thus, expression vectors that contain, in addition to the subject IL-2 muteins, nucleic acid molecules encoding the subject IL-2 muteins, and cells transfected with these vectors, are among the preferred embodiments.
[0125] It should be understood, of course, that not all vectors and expression control sequences function equally well to express the DNA sequences described herein. Not all hosts function equally well in the same expression system. However, one of skill in the art may select among these vectors, expression control sequences, and hosts without undue experimentation. For example, in selecting a vector, the host must be considered, since the vector must replicate within it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. For example, vectors that can be used include those that amplify DNA encoding an IL-2 mutein in copy number. Such amplifiable vectors are well known in the art. These include vectors that can be amplified, for example, by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461; Kaufman and Sharp, "Construction of a Modular Dihydrafolate Reductase cDNA Gene: Analysis of Signals Utilized for Efficient Expression," Mol. Cell. Biol., 2, pp. 1304-19 (1982)) or glutamine synthetase ("GS") amplification (see, e.g., U.S. Pat. No. 5,122,464 and European Patent Application Publication No. 338,841).
[0126] In some embodiments, the human IL-2 muteins of the present disclosure will be expressed from a vector, preferably an expression vector. Vectors are useful for autonomous replication in a host cell or may be integrated into the genome of the host cell upon introduction into the host cell, thereby replicating along with the host genome (e.g., non-episomal mammalian vectors). Expression vectors are capable of directing the expression of coding sequences to which they are operably linked. In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids (vectors). However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), are also included.
[0127] Exemplary recombinant expression vectors are selected based on the host cell to be used for expression and can include one or more control sequences operably linked to the nucleic acid sequence to be expressed.
[0128] Expression constructs or vectors can be designed for expression of an IL-2 mutein or variant thereof in prokaryotic or eukaryotic host cells.
[0129] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Preferred methods for transforming or transfecting host cells can be found in Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY, and other standard molecular biology laboratory manuals.
[0130] Protein expression in prokaryotes is often carried out in Escherichia coli with vectors containing constitutive or inducible promoters. Strategies for maximizing recombinant protein expression in E. coli are described, for example, in Gottesman (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, Calif.), pp. 119-128 and Wada et al. (1992) Nucleic Acids Res. 20:2111-2118. Processes for growing, harvesting, disrupting, or extracting IL-2 muteins or variants thereof from cells are substantially as described, for example, in U.S. Patent Nos. 4,604,377; 4,738,927; 4,656,132; 4,569,790; 4,748,234; 4,530,787; 4,572,798; 4,748,234; and 4,931,543, which are incorporated by reference in their entireties.
[0131] In some embodiments, recombinant IL-2 muteins or biologically active variants thereof can also be produced in eukaryotes, such as yeast or human cells. Suitable eukaryotic host cells include insect cells (examples of baculovirus vectors available for protein expression in cultured insect cells (e.g., Sf9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39)); yeast cells (examples of vectors for expression in the yeast S. cerenvisiae include pYepSec1 (Baldari et al. (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and the like). expression vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187:195); or mammalian cells (mammalian expression vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187:195)). Suitable mammalian cells include Chinese hamster ovary cells (CHO) or COS cells. In mammalian cells, the control functions of the expression vector are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40. For other expression systems suitable for both prokaryotic and eukaryotic cells, see Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2 ndSee Chapters 16 and 17 of "Genetic Expression Technology: Methods in Enzymology," ed., Cold Spring Harbor Laboratory Press, Plainview, NY. See Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, Calif.).
[0132] The sequences encoding the human IL-2 muteins of the present disclosure can be optimized for expression in a host cell of interest. The GC content of the sequence can be optimized to match known genes expressed in the host cell. The codons in an IL-2 mutein coding sequence can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or at most 100% of the codons in the coding sequence are optimized for expression in a particular host cell.
[0133] Suitable vectors for use include T7-based vectors for use in bacteria (see, e.g., Rosenberg et al., Gene 56:125, 1987), the pMSXND expression vector for use in mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521, 1988), and baculovirus-derived vectors for use in insect cells (e.g., the expression vector pBacPAK9 from Clontech, Palo Alto, Calif.).
[0134] In some embodiments, nucleic acid inserts encoding the subject IL-2 muteins in such vectors can operably link the sequence to a promoter selected based, for example, on the cell type in which expression is desired.
[0135] In selecting an expression control sequence, various factors should be considered. These include, for example, the relative strength of the sequence, controllability, and compatibility with the actual DNA sequence encoding the subject IL-2 mutein, particularly with respect to potential secondary structure. A host should be selected by considering compatibility with the selected vector, toxicity of the product encoded by the DNA sequence of the invention, secretion characteristics, ability to properly fold the polypeptide, fermentation or cultivation requirements, and ease of purification of the product encoded by the DNA sequence.
[0136] Within these parameters, one skilled in the art may select various vector / expression control sequence / host combinations that will express the desired DNA sequence on fermentation or in large scale animal culture using, for example, CHO or COS7 cells.
[0137] The choice of expression control sequences and expression vectors will, in some embodiments, depend on the host cell chosen. A wide variety of expression host / vector combinations can be used. Expression vectors useful for eukaryotic hosts include, for example, vectors having expression control sequences derived from SV40, bovine papillomavirus, adenovirus, and cytomegalovirus. Expression vectors useful for bacterial hosts include known bacterial plasmids such as E. coli-derived plasmids, including colE1, pCRI, pER32z, pMB9, and their derivatives; broad-host-range plasmids such as RP4; phage DNA, e.g., numerous derivatives of lambda phage, e.g., NM989, and other DNA phages such as M13 and filamentous single-stranded DNA phages. Expression vectors useful for yeast cells include the 2μ plasmid and its derivatives. Vectors useful for insect cells include pVL941 and pFastBac™1 (GibcoBRL, Gaithersburg, Md.). Cate et al.,“Isolation Of The Bovine And Human Genes For Mullerian Inhibiting Substance And Expression Of The Human Gene In Animal Cells”, Cell, 45, pp. 685-98 (1986).
[0138] In addition, any of a wide variety of expression control sequences can be used in these vectors. Such useful expression control sequences include the expression control sequences associated with the structural genes of the expression vectors described above. Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of lambda phage, e.g., PL, f Examples include the regulatory region of the d coat protein, promoters of 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of acid phosphatases such as PhoA, promoters of the yeast a mating system, the polyhedrin promoter of baculovirus, and other sequences known to control the expression of genes in prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
[0139] The T7 promoter can be used in bacteria, the polyhedrin promoter can be used in insect cells, and the cytomegalovirus promoter or metallothionein promoter can be used in mammalian cells. Furthermore, in the case of higher eukaryotes, a wide range of tissue-specific and cell-type-specific promoters are available. These promoters are so named because of their ability to direct the expression of nucleic acid molecules in a given tissue or cell type in the body. Those skilled in the art are familiar with numerous promoters and other control elements that can be used to direct the expression of nucleic acids.
[0140] In addition to sequences that facilitate transcription of the inserted nucleic acid molecule, vectors can contain other genes that encode replication origins and selectable markers. For example, neomycin resistance (neomycin resistance) rThe ) gene confers G418 resistance to cells in which it is expressed, thereby allowing for phenotypic selection of transfected cells. Those skilled in the art can readily determine whether a given control element or selectable marker is suitable for use in a particular experimental situation.
[0141] Viral vectors that can be used in the present invention include, for example, retroviral, adenoviral, and adeno-associated vectors, herpesvirus, simian virus 40 (SV40), and bovine papillomavirus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY).
[0142] Prokaryotic or eukaryotic cells that contain and express nucleic acid molecules encoding the IL-2 muteins of the presently disclosed subject matter are also a feature of the invention. Cells of the invention are transfected cells, i.e., cells into which a nucleic acid molecule, e.g., a nucleic acid molecule encoding a mutant IL-2 polypeptide, has been introduced using recombinant DNA techniques. Progeny of such cells are also considered within the scope of the invention.
[0143] The exact components of the expression system are not critical. For example, IL-2 muteins can be produced in prokaryotic hosts such as the bacterium E. coli, or eukaryotic hosts such as insect cells (e.g., Sf21 cells) or mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, Va.). In selecting an expression system, it is important only that the components are compatible with each other. Those of skill in the art are able to make such decisions. Additionally, if guidance is needed in selecting an expression system, those of skill in the art can refer to Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, 1999; Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987) may also be used as references.
[0144] The expressed polypeptide can be purified from the expression system using routine biochemical procedures and used, for example, as a therapeutic agent as described herein.
[0145] In some embodiments, the resulting IL-2 mutein is used to produce muteins. Depending on the host organism used, the IL-2 mutein will be glycosylated or non-glycosylated. If a bacterium is selected as the host, the IL-2 mutein produced will then be non-glycosylated. On the other hand, eukaryotic cells will glycosylate the IL-2 mutein, although perhaps not in the same manner as native IL-2 is glycosylated. The IL-2 mutein produced by the transformed host can be purified according to any suitable method. Various methods for purifying IL-2 are known. See, for example, Current Protocols in Protein Science, Vol. 2, Eds.: John E. Coligan, Ben M. Dunn, Hidde L. Ploehg, David W. Speicher, Paul T. Wingfield, Unit 6.5 (Copyright 1997, John Wiley and Sons, Inc.). IL-2 muteins can be isolated from inclusion bodies produced in E. coli or from conditioned medium derived from either mammalian or yeast cultures producing a given mutein using cation exchange, gel filtration, and / or reverse-phase liquid chromatography.
[0146] Another exemplary method for constructing a DNA sequence encoding an IL-2 mutein is by chemical synthesis. This involves the direct synthesis of a peptide by chemical means of a protein sequence encoding an IL-2 mutein exhibiting the described properties. This method can incorporate both natural and unnatural amino acids at positions that affect the interaction of IL-2 with IL-2Rα, IL-2Rβ, and / or IL-2Rγ. Alternatively, a gene encoding a desired IL-2 mutein can be synthesized by chemical means using an oligonucleotide synthesizer. Such oligonucleotides are preferably designed based on the amino acid sequence of the desired IL-2 mutein, selecting codons preferred for the host cell in which the recombinant mutein will be produced. In this regard, it is well recognized that the genetic code is degenerate—that is, an amino acid may be coded for by more than one codon. For example, Phe (F) is coded for by two codons, TIC or TTT, Tyr (Y) is coded for by TAC or TAT, and his (H) is coded for by CAC or CAT. Trp(W) is encoded by a single codon, TGG. Thus, for a given DNA sequence encoding a particular IL-2 mutein, it will be understood that there will be many degenerate DNA sequences that will encode that IL-2 mutein. For example, in addition to the preferred DNA sequence for mutein 5-2 shown in Figure 2, it will be understood that there will be many degenerate DNA sequences that encode the IL-2 mutein shown. These degenerate DNA sequences are considered to be within the scope of this disclosure. Thus, "degenerate variants thereof" in the context of the present invention means all DNA sequences that encode a particular mutein and thereby allow its expression.
[0147] The biological activity of the IL-2 muteins can be assayed by any suitable method known in the art, including PHA-blast proliferation and NK cell proliferation.
[0148] treatment method In some embodiments, the subject IL-2 muteins and / or nucleic acids expressing them can be administered to a subject to treat disorders associated with abnormal apoptotic or differentiation processes (e.g., cell proliferation or differentiation disorders such as cancer, e.g., by generating active or passive immunity). In treating such diseases, the disclosed IL-2 muteins may possess advantageous properties, such as reduced vascular leak syndrome.
[0149] Examples of cell proliferation and / or differentiation disorders include cancer (e.g., carcinoma, sarcoma, metastatic disorders, or hematopoietic neoplastic disorders, e.g., leukemia). Metastatic tumors can arise from a number of primary tumor types, including, but not limited to, tumors of the prostate, colon, lung, breast, and liver. The compositions of the invention (e.g., mutant IL-2 polypeptides and / or The antibodies (or nucleic acid molecules encoding them) can also be administered to patients with viral (eg, AIDS or influenza) infections.
[0150] Variant IL-2 polypeptides can be used to treat patients suffering from, suspected of suffering from, or who may be at high risk of developing any type of cancer, including kidney cancer or melanoma, or any viral disease. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, which include malignant tumors composed of carcinomatous and sarcomatous tissues.
[0151] Further examples of proliferative disorders include hematopoietic neoplastic disorders.
[0152] Other examples of proliferative and / or differentiation disorders include skin disorders. Skin disorders may involve the abnormal activity of cells or groups of cells or layers in the dermis, epidermis, or subcutaneous layers, or abnormalities in the dermal-epidermal junction. For example, skin disorders may involve the abnormal activity of keratinocytes (e.g., hyperproliferative basal and suprabasal keratinocytes), melanocytes, Langerhans cells, Merkel cells, immune cells, and other cells found in one or more epidermal layers, such as the stratum basale (stratum germinativum), stratum spinosum, stratum granulosum, stratum lucidum, or stratum corneum. In other embodiments, the disorder may involve the abnormal activity of dermal cells, such as dermal endothelial cells, fibroblasts, and immune cells (e.g., mast cells or macrophages), found in the dermis, such as the papillary or reticular layers.
[0153] Examples of skin disorders include psoriasis, psoriatic arthritis, dermatitis (eczema), e.g., exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosea, parapsoriasis, pityriasis lichenoides, lichen planus, lichen nitidus, ichthyosiform erythroderma, keratoderma, skin diseases, alopecia areata, pyoderma gangrenosum, vitiligo, pemphigoid (e.g., ophthalmic cicatricial pemphigoid or bullous pemphigoid), urticaria, porokeratosis, hyperproliferation of epithelial-associated cells lining the joint capsule. and rheumatoid arthritis with inflammation; dermatitis such as seborrheic dermatitis and sun dermatitis; keratosis such as seborrheic keratosis, senile keratosis, actinic keratosis, light-induced keratosis, and follicular keratosis; acne vulgaris; keloids and prevention of keloid formation; birthmarks; warts, including verrucae, condyloma, or genital warts, and warts including those infected with human papillomavirus (HPV), such as venereal warts; leukoplakia; lichen planus; and keratitis. The skin disorder may be dermatitis, for example, atopic dermatitis or allergic dermatitis, or psoriasis.
[0154] Patients suitable for treatment may also have psoriasis. The term "psoriasis" is intended to have its medical meaning: a disease that primarily affects the skin and results in raised, thickened, scaly, non-scarring lesions. Lesions are usually sharply defined, erythematous papules covered with overlapping, shiny scales. The scales are usually silvery or slightly milky white. Nail involvement is frequent, resulting in pitting, peeling, thickening, and discoloration of the nails. Psoriasis may be associated with arthritis and may be paralytic. Keratinocyte hyperproliferation, along with epidermal inflammation and reduced keratinocyte differentiation, is a key feature of psoriatic epidermal hyperplasia. Multiple mechanisms have been proposed to explain the keratinocyte hyperproliferation that characterizes psoriasis. Impaired cellular immunity is involved in the pathogenesis of psoriasis. Examples of psoriatic disorders include chronic constant psoriasis, plaque psoriasis, eruptive (guttate) psoriasis, erythrodermic psoriasis, generalized pustular psoriasis (Von Zumbusch type), annular pustular psoriasis, and localized pustular psoriasis.
[0155] Alternatively or in addition to direct administration to a patient, in some embodiments, a variant IL-2 polypeptide can be used in an ex vivo method. For example, cells (e.g., peripheral blood lymphocytes or purified lymphocyte populations isolated from a patient and maintained stationary or in culture) can be cultured in an in vitro culture medium, contacting can be affected by adding an IL-2 variant to the culture medium. The culturing step can include further steps in which the cells are stimulated or treated with other agents, for example, to stimulate proliferation or to expand the population of cells reactive to an antigen of interest (e.g., a cancer antigen or a viral antigen). The cells are then administered to the patient after treatment.
[0156] In certain embodiments, the subject IL-2 muteins described herein that function as IL-2 antagonists are useful in the treatment of one or more conditions in which inhibition of one or more IL-2- and / or IL-15-dependent functions is beneficial. In certain embodiments, the IL-2 mutein antagonists described herein are used to treat one or more diseases or conditions in which inhibition of IL-2Rβ / IL-2Rγ heterodimerization and downstream signaling is beneficial (e.g., GVDH or leukemia).
[0157] In one embodiment, the method of treatment is for the treatment of graft-versus-host disease (GVHD). In some embodiments, the treatment comprises administering to a subject suffering from GVHD a therapeutically effective amount of an IL-2 mutein that is an IL-2 antagonist. IL-2 and IL-15 are known to contribute to GVHD (Ferrara et al., Journal of Immunology 137:1874 (1986); and Blaser et al., Blood 105:894 (2005)). Therefore, without being bound to a particular theory of operation, the IL-2 antagonists described herein are believed to be useful in the treatment of GVHD. In one embodiment, the IL-2 mutein for the treatment of GVHD is characterized by a decrease in the IL-2Rγ activity of the IL-2 mutein compared to wild-type IL-2. c and one or more mutations that reduce binding to the receptor (e.g., IL-2Rγ as described herein). c In some embodiments, the IL-2Rγ receptor is a mutated IL-2Rγ receptor. c Mutations that reduce the binding affinity of the receptor include the amino acid substitutions L18R, Q22E, Q126T, and S130R. cAn IL-2 mutein with further reduced receptor binding affinity further comprises one or more amino acid mutations that increase the IL-2 mutein's binding affinity for IL-2Rβ compared to wild-type IL-2 (e.g., any one of the mutations that increase IL-2Rβ binding as described herein). In some embodiments, the IL-2 mutein further comprises the amino acid substitutions L80F, R81D, L85V, I86V, and I92F. In some embodiments, the IL-2 mutein comprises the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, Q126T, S130R, I86V, and I92F.
[0158] In another embodiment, the therapeutic method is for the treatment of IL-2 and / or IL-15-mediated leukemia. In a specific embodiment, the leukemia is adult T-cell leukemia (ATL). ATL is characterized by the malignant proliferation of CD4+ T cells, whose early growth phase involves autocrine signaling by IL-2 and IL-15 and paracrine signaling by IL-9. Such cytokine-dependent proliferation is evident in patients with chronic and smoldering ATL, but not acute ATL. Therefore, without being bound by a particular theory of operation, it is believed that IL-2 partial agonists and antagonists can be used to treat these forms of leukemia. In some embodiments, the treatment comprises administering a therapeutically effective amount of an IL-2 mutein that is an IL-2 antagonist to a subject with adult T-cell leukemia. In some embodiments, the patient is suffering from chronic or smoldering ATL. In one embodiment, the IL-2 mutein for the treatment of ATL has the following properties: the IL-2Rγ of the IL-2 mutein is increased relative to wild-type IL-2 c one or more mutations that reduce binding to the receptor (e.g., IL-2Rγ as described herein) c In some embodiments, the IL-2Rγ receptor comprises a mutation that reduces receptor binding. c Mutations that decrease the binding affinity of the receptor include the amino acid substitutions L18R, Q22E, Q126T, and S130R. c Receptor binding IL-2 muteins with further reduced affinity further comprise one or more amino acid mutations that increase the IL-2 mutein's binding affinity to IL-2Rβ compared to wild-type IL-2 (e.g., any one of the mutations that increase IL-2Rβ binding as described herein). In some embodiments, the IL-2 mutein further comprises the amino acid substitutions L80F, R81D, L85V, I86V, and I92F. In some embodiments, the IL-2 mutein comprises the amino acid substitutions L18R, Q22E, L80F, R81D, L85V, Q126T, S130R, I86V, and I92F.
[0159] Pharmaceutical compositions and methods of administration In some embodiments, the subject IL-2 muteins and nucleic acids can be incorporated into compositions, including pharmaceutical compositions. Such compositions typically include a polypeptide or nucleic acid molecule and a pharmaceutically acceptable carrier.
[0160] Pharmaceutical compositions are formulated to be compatible with the intended route of administration. The mutant IL-2 polypeptides of the present invention may be administered orally but will likely be administered parenterally. Examples of parenteral routes of administration include, for example, intravenous, intradermal, subcutaneous, transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral use can contain the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methylparaben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid; a buffer such as acetic acid, citric acid, or phosphate, and an agent for adjusting isotonicity such as sodium chloride or dextrose. The pH can be adjusted (e.g., to about 7.2 to 7.8, e.g., 7.5) with an acid or base such as monobasic and / or dibasic sodium phosphate, hydrochloric acid, or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0161] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that easy syringability exists. The composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants, such as sodium dodecyl sulfate. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, for example, sugars; polyalcohols such as mannitol and sorbitol; sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0162] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in the appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by combining a basic dispersion medium and the It is prepared by incorporating the active compound into a sterile vehicle containing the required other ingredients from those listed. In the case of sterile powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze-drying, which produce a powder of the active ingredient plus any additional desired ingredients from a previously sterile-filtered solution thereof.
[0163] Oral compositions, if used, generally contain an inert diluent or an edible carrier. For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, such as gelatin capsules. Oral compositions can also be prepared using a fluid carrier used as a mouthwash. Pharmaceutically compatible binders and / or adjuvants can be included as part of the composition. Tablets, pills, capsules, troches, etc. can contain any of the following ingredients or compounds of similar nature: binders such as microcrystalline cellulose, tragacanth, or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, Primogel®, or corn starch; lubricants such as magnesium stearate or Sterotes®; lubricants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, or orange flavoring.
[0164] For administration by inhalation, the subject IL-2 muteins or nucleic acids encoding them are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer, such as those described in U.S. Patent No. 6,468,798.
[0165] Systemic administration of the subject IL-2 muteins or nucleic acids may also be via transmucosal or transdermal routes. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved by the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0166] In some embodiments, the compounds (variant IL-2 polypeptides or nucleic acids) can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
[0167] In some embodiments, the compounds (subject IL-2 muteins or nucleic acids) can also be administered by transfection or infection using methods known in the art, including, but not limited to, those described by McCaffrey et al. (Nature 418:6893, 2002), Xia et al. (Nature Biotechnol. 20:1006-1010, 2002), or Putnam (Am. J. Health Syst. Pharm. 53:151-160, 1996, errata in Am. J. Health Syst. Pharm. 53:325, 1996).
[0168] In one embodiment, the subject IL-2 muteins or nucleic acids are prepared with carriers that will protect the mutant IL-2 polypeptides against rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. Materials are also available from Alza Corporation and Nova Pharma. These are commercially available from Ceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0169] The dosage, toxicity, and therapeutic efficacy of such subject IL-2 muteins or nucleic acid compounds may be determined, for example, by LD 50 (lethal dose for 50% of the population) and ED 50 The dose that is therapeutically effective in 50% of a population can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, which is defined as the ratio LD 50 / ED 50 Compounds that exhibit a high therapeutic index are preferred. Compounds that exhibit toxic side effects may also be used, but care should be taken to design a delivery system that targets such compounds to the affected tissue site in order to minimize potential damage to uninfected cells, thereby reducing side effects.
[0170] The data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The dosages of such compounds can be administered with little or no toxicity. 50 Preferably, the circulating concentration of the compound is within a range including the IC50, IC60, IC70, IC80, IC90, IC10, IC11, IC12, IC13, IC14, IC15, IC26, IC27, IC28, IC29, IC30, IC40, IC51, IC61, IC72, IC83, IC94, IC10, IC12, IC13, IC26, IC14, IC27, IC28, IC15, IC29, IC29, IC29, IC30, IC29, IC29, IC30, IC40, IC51, IC61, IC12, IC29, IC29, IC29, IC30, IC40, IC51, IC61, IC14, IC29, IC29, IC29, IC29, IC30, IC29, IC29, IC30, IC40, IC51, IC61 ...30, IC40, IC51, IC61, IC29, IC29, IC29, IC30, IC29 50 The compound may be formulated in animal models to achieve a circulating plasma concentration range that includes the test compound (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms). Such information can be used to more accurately determine useful doses in humans. Plasma levels may be measured, for example, by high performance liquid chromatography.
[0171] As defined herein, a therapeutically effective amount (i.e., an effective dosage) of a subject IL-2 mutein will depend on the polypeptide selected. For example, a single dose ranging from about 0.001 to 0.1 mg / kg of patient body weight can be administered, although in some embodiments, about 0.005, 0.01, or 0.05 mg / kg may be administered. In some embodiments, 600,000 IU / kg is administered (IU can be determined by lymphocyte proliferation bioassay and is consistent with World Health Organization guidelines). st (Expressed in International Units (IU) as defined in the International Standard for Interleukin-2 (human)). Dosages may be similar to, but are expected to be lower than, those specified for PROLEUKIN®. The compositions can be administered one or more times daily to one or more times weekly, including once every other day. One of skill in the art will appreciate that certain factors, including, but not limited to, the severity of the disease or disorder, previous treatments, general health, and / or age of the subject, as well as other diseases present, can affect the dosage and timing required to effectively treat a subject. Furthermore, treatment of a subject with a therapeutically effective amount of a subject IL-2 mutein can include a single treatment or can include a series of treatments. In one embodiment, the composition is administered every 8 hours for 5 days, followed by a rest period of 2 to 14 days, e.g., 9 days, followed by administration every 8 hours for an additional 5 days.
[0172] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
[0173] The following examples are provided to describe certain embodiments of the invention provided herein and should not be construed as limiting. [Example]
[0174] Example 1: Functional expression of IL-2 on the surface of yeast IL-2 has already been displayed on bacteriophage (Buchli et al. (E. al., Arch. Biochem. Biophys. 339:79-84, 1997), however, conventional systems are not amenable to directed evolution and therefore are not suitable for obtaining IL-2 mutants with improved binding to IL-2R subunits. To overcome this, IL-2 was expressed on the surface of yeast cells. Human IL-2 DNA was cloned into the yeast display vector pCT302. Saccharomyces cerevisiae strain EBY100 was transformed with the pCT302_IL-2 vector and grown on SD-CAA plates at 30°C for 3 days. Individual colonies of IL-2 yeast were grown in SD-CAA at 30°C overnight and then transferred to SGCAA at 20°C for 2 days. Yeast were stained with tetramerized biotinylated IL-2Rβ, biotinylated γ, or biotinylated IL-2Rβ in the presence of biotinylated γ. The ectodomains of IL-2Rβ and γ were biotinylated at the C-terminus and linked to phycoerythrin-conjugated streptavidin, which was used as a staining and selection reagent. IL-2Rβ tetramers were formed by incubating 2 μM biotinylated IL-2Rβ with 470 nM streptavidin-phycoerythrin (SA-PE, Invitrogen) on ice for 15 minutes. These receptor "tetramers" enhanced the avidity of the low-affinity monomeric ectodomain (ECD) interaction with IL-2, enabling maximum recovery of IL-2 variants from the library. Yeast-displayed IL-2, which binds weakly to IL-2Rβ alone, similar to wild-type IL-2 in solution, did not bind to γ alone at all, but bound to γ in the presence of IL-2Rβ, as evidenced by diagonal staining seen by flow cytometry (data not shown). Thus, yeast-displayed IL-2 recapitulates the coordinate assembly of heterodimeric receptor complexes on cells seen with soluble IL-2 and is therefore suitable as a platform for library selection.
[0175] Example 2: Construction and screening of an IL-2 variant library The first-generation in vitro strategy was to create an error-prone PCR library of the entire IL-2 gene. The first-generation mutant IL-2 library was constructed as follows: Wild-type human interleukin-2 (IL-2) was subjected to error-prone mutagenesis using the GeneMorph® II Random Mutagenesis Kit according to the manufacturer's instructions. The following primers were used for error-prone PCR: 5'-GCACCTACTTCAAGTTCTAC-3' (IL-2_errprone_for) and 5'-GCCACCAGAGGATCC-3' (IL-2_errprone_rev). The error-prone PCR reaction product was then amplified using the following primers: 5'AGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTAGCGCACCTACTTCAAGTTCTAC-3' (SEQ ID NO: 33) and 5'ACACTGTTGTTATCAGATCTCGAGCAAGTCTTCTTCGGAGATAAGCTTTTGTTCGCCACCAGAGGATCC-3' (SEQ ID NO: 34) to yield approximately 130 μg of DNA. The yeast display vector pCT302 was double-digested with restriction enzymes NheI and BamHI and gel-purified. Electrocompetent EBY100 yeast was mixed with IL-2 DNA and pCT302 DNA at a μg ratio of 5:1. The yeast was electroporated to facilitate the transfer of the library DNA into the yeast. This electroporation was repeated approximately 20 times to obtain a final library size of 1 x 10 8 Transformants were obtained. First generation IL-2 library selection: The library underwent six rounds of selection against IL-2Rβ (Figure 2A). In the first round, the library was labeled with 470 nM tetrameric IL-2Rβ, formed by mixing 2 μM biotinylated IL-2Rβ with 470 nM streptavidin-phycoerythrin conjugate (SAV-PE) for 15 minutes. The library was incubated with IL-2Rβ for 1.5 hours and then resuspended in PBS-BSA buffer (phosphate-buffered saline + bovine serum albumin). The cells were washed with 500 nM IL-2Rβ (albumin) and incubated with Miltenyi anti-PE MicroBeads for 20 minutes at 4°C. The cells were washed again and loaded onto a magnetic column for selection. This selection method was successfully repeated five more times, varying only the concentration of IL-2Rβ (round 2: 1 μM, round 3: 1 μM, round 4: 300 nM, round 5: 300 nM, round 6: 100 nM, all monomeric IL-2Rβ). At the end of selection, yeast cultures from rounds 5 and 6 were plated onto SD-CAA plates, which yielded individual yeast colonies. The resulting 18 yeast colonies were tested for binding to 500 nM IL-2Rβ. IL-2 DNA isolated from these 18 yeast colonies was sequenced. The amino acid differences between these 18 yeast colonies compared to the corresponding residues in wild-type IL-2 are shown in Table 1. [Table 1] Library construction of second generation IL-2 library: Based on the high percentage of clones containing L85V, a second IL-2 library was constructed, focusing primarily on hydrophobic core residues. A site-specific IL-2 library was constructed with mutations at Q74, L80, R81, L85, I86, I89, I92, and V93. Q74 was varied as H / K / N / Q / R / S. R81 was varied at all 20 amino acids with the NNK degenerate codon, where N represents a 25% mixture of adenine, thymine, guanine, and cytosine nucleosides, and K is either guanine or thymine. The remaining residues were varied as F / I / L / V. The library was constructed by assembly PCR using the following oligos: IL-2_affmat_ass01 [ka] (SEQ ID NO: 35) IL-2_affmat_ass02 [ka] (SEQ ID NO: 36) IL-2_affmat_ass03 [ka] (SEQ ID NO: 37) IL-2_affmat_ass04B [ka] (SEQ ID NO: 38) IL-2_affmat_ass05B [ka] (SEQ ID NO: 39) IL-2_affmat_ass06 [ka] (SEQ ID NO: 40) IL-2_affmat_ass07 [ka] (SEQ ID NO: 41) IL-2_affmat_ass08 [ka] (SEQ ID NO: 42) IL-2_affmat_ass09 [ka] (SEQ ID NO: 43) IL-2_affmat_ass10 [ka] (SEQ ID NO: 44) IL-2_affmat_ass11 [ka] (SEQ ID NO: 45) IL-2_affmat_ass12 [ka] (SEQ ID NO: 46) IL-2_affmat_ass13 [ka] (SEQ ID NO: 47) Site-specific PCR was performed with the following oligos: PCR amplification oligos (containing 50 bp homology) IL-2_site2_assFor: [ka] IL-2_site2_assRev: [ka] PCR generated 40 μg of DNA, which was mixed with double-digested pCT302 and electrocompetent EBY100 yeast and electroporated in the same manner as the first generation library. Selection of second generation IL-2 libraries: The library was subjected to five rounds of selection against IL-2Rβ (Figure 2B). This selection method was performed exactly as for the first-generation library, with the only difference being the concentration of IL-2Rβ used (round 1: 1 μM, round 2: 100 nM, round 3: 30 nM, round 4: 30 nM, round 5: 10 nM, all monomeric IL-2Rβ). At the end of selection, yeast cultures from rounds 4 and 5 were plated onto SD-CAA plates, which yielded individual yeast colonies. 48 individual yeast clones from both rounds were grown in a 96-well block format and screened by labeling with 5 nM IL-2Rβ followed by SAV-PE. The screening yielded seven high-affinity binders to IL-2Rβ (Figure 3 and Table 2). The amino acid differences between these seven high-affinity binders compared to the corresponding residues in wild-type IL-2 are shown in Table 2, along with their binding affinities to IL-2Rβ. [Table 2]
[0176] Example 3: IL-2 mutein protein expression and purification Human IL-2 variant (amino acids 1-133), IL-2Rβ ectodomain (amino acids 1-214), and γ cThe gp67 cDNA (amino acids 34-232) was cloned in-frame with the N-terminal gp67 signal sequence and C-terminal hexahistidine tag into the pAcGP67-A vector (BD Biosciences) and produced using a baculovirus expression system. Baculovirus stocks were prepared by transfection and amplification in Spodoptera frugiperda (Sf9) cells grown in SF900II medium (Invitrogen), and protein expression was performed in Trichoplusia ni (High Five™) cell suspensions grown in BioWhittaker® Insect-XPRESS™ medium (Lonza). Proteins were expressed and captured from 48-60 hour High Five™ supernatants using nickel agarose (QIAGEN), then concentrated and purified by size exclusion chromatography on a Superdex™ 200 column (GE Healthcare) equilibrated in 10 mM HEPES (pH 7.2) and 150 mM NaCl. IL-2 variants used in SPR and cell-based assays were expressed fully glycosylated. For biotinylated receptor expression, IL-2Rβ and γ were used. c The C-terminal biotin acceptor peptide (BAP) LNDIFEAQKIEWHE and a hexahistidine tag were cloned into the pAcGP67-A vector. The acceptor protein was co-expressed with BirA ligase with excess biotin (100 μM).
[0177] Example 4: CD25 - and CD25 + Stimulation of natural killer (YT-1) cells YT-1 cells and CD25+ YT-1 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, minimal non-essential amino acids, sodium pyruvate, 25 mM HEPES, and penicillin-streptomycin (Gibco). + YT-1 cells were purified as follows: 1 × 10 7Cells were washed with FACS buffer (phosphate-buffered saline + 2% bovine serum albumin) and stained with PE-conjugated anti-human CD25 (1:20; Biolegend, San Diego, CA) in 1 mL of FACS buffer for 20 minutes at 4°C. Stained cells were labeled with paramagnetic microbeads linked to anti-PE IgG and purified according to the manufacturer (Miltenyi). The cells were separated using an LS MACS® separation column according to the manufacturer's instructions (Biotec, Bergisch Gladbach, Germany). The eluted cells were diluted to 1 x 10 in complete RPMI medium. 5 The cells were resuspended at a cell concentration of 1000 and expanded for subsequent experiments. Cell enrichment was monitored by flow cytometry in the FL-2 channel using an Accuri® C6 flow cytometer.
[0178] The dose-response relationship of H9, D10, and 6-6 on YT-1 cells was determined by assaying STAT5 phosphorylation by flow cytometry (Figures 4A and 4B). + or CD25 - YT-1 cells were washed with FACS buffer and resuspended in 200 μL of FACS buffer in a 96-well plate with the indicated concentrations of wild-type, 6-6, H9, or D10. Cells were stimulated for 20 minutes at room temperature and then fixed by adding formaldehyde to 1.5% and incubated for 10 minutes. Cells were permeabilized with 100% ice-cold methanol on ice for 20 minutes, followed by overnight incubation at -80°C. Fixed and permeabilized cells were washed with excess FACS buffer and incubated for 20 minutes with 50 μL of Alexa647-conjugated anti-STAT5 pY694 (BD Biosciences, San Jose, CA) diluted 1:20 in FACS buffer. Cells were washed twice in FACS buffer, and mean cell fluorescence was determined using the FL-4 channel of an Accuri® C6 flow cytometer.
[0179] The CD25 independence of IL-2 muteins (so-called "super-2" molecules) was further tested by utilizing a well-characterized mutation in IL-2, a phenylalanine to alanine at position 42 (F42A). This mutation (F42A) abolishes binding to CD25 but does not affect the ability to bind IL-2Rβ or IL-2Rγ (Mott, 1995). This mutation was also introduced into the H9 mutein, yielding H9 F42A. The CD25-independent binding of IL-2, IL-2 F42A, H9, and H9 F42A by IL-2, IL-2 F42A, H9, and H9 F42A was significantly reduced. - and CD25 + A comparison of STAT induction in YT-1 cells was performed (Figure 5). The IL-2 F42A mutation shifted the dose-response curve of wild-type IL-2 for CD25+ cells to the right by approximately 1 log, whereas the F42A mutation had no observable effect on STAT induction in CD25− cells (Figure 5A). In contrast, the dose-response curves of H9 and H9 F42A were virtually overlapping for both CD25− and CD25+ cells (Figure 5B). Thus, these experiments demonstrate that the IL-2 muteins do not clearly benefit from the presence of CD25, but their activity is insensitive to mutations that disrupt the CD25 interface.
[0180] Example 5: Stimulation of CD25- and CD25+ T cells Human and mouse CD4 T cells were prepared from PBMCs (Stanford Blood Bank) and spleens and lymph nodes of BALB / C mice using antibody-coated CD4 T cell isolation magnetic beads (Stem Cell Technologies and Miltenyi Biotec), respectively. For naive cell stimulation assays, cells were used immediately. For in vitro generation of "experienced" T cells, wells were precoated with a secondary antibody (Vector Labs) in pH 9.6 bicarbonate buffer before coating plates with 100 ng / mL anti-CD3 (OKT3 for humans, 2C11 for mice, eBiosciences). T cells were incubated with soluble anti-CD28 (CD28.2 for humans, 37.51 for mice, eBiosciences) at 0.1 × 10 6 Cells were seeded at 1000 cells / well. Cells were cultured with whole TCR stimulated for 3 days, then placed in conditioned medium for 2 days and in fresh culture medium for 2 days. Before use, viable cells were harvested by Lympholyte-M (Cederlane) centrifugation and counted.
[0181] The activity of IL-2 muteins on T cells that were either CD25-deficient or CD25-expressing was assessed (Figure 6). The dose-response relationship of wild-type IL-2 and six IL-2 muteins was assayed for STAT5 phosphorylation at protein concentrations ranging from 1 ng / ml to 1000 ng / ml. The ability of IL-2 muteins to stimulate STAT5 phosphorylation in CD25-deficient T cells correlated well with their affinity for IL-2Rβ. The increase in STAT5 phosphorylation by the IL-2 mutein was two orders of magnitude greater than that by IL-2.
[0182] Large amounts of the complete IL-2 receptor complex, CD25 (IL-2Rα), IL-2Rβ, and γ cWe also evaluated the ability of IL-2 muteins to stimulate STAT5 phosphorylation in experienced human CD4+ T cells expressing IL-2 (Figure 7). Human CD4 T cells were stimulated in vitro with TCR and then rested to generate "experienced" human CD4+CD25+ T lymphocytes. At 1 ng / mL, little difference in STAT5 phosphorylation was observed. Each IL-2 variant, including wild-type, stimulated over 90% of the cells. At 0.1 ng / mL, small differences were observed. Wild-type IL-2 resulted in 48% pSTAT5 stimulation, while the IL-2 muteins resulted in 65-79% pSTAT5 stimulation. Thus, the IL-2 muteins clearly stimulate experienced human T cells better than wild-type IL-2, although this enhancement is not as pronounced as that observed in cells lacking CD25.
[0183] Example 6: NK cell cytotoxicity assay The effect of the D10 IL-2 mutein on natural killer cell function, specifically spontaneous antibody-dependent cell-mediated cytotoxicity (ADCC), was evaluated using an EGFR (endothelial growth factor receptor)-expressing squamous cell carcinoma cell line (SCC6) and the EGFR monoclonal antibody cetuximab. The human EGFR+ squamous cell carcinoma cell line, SCC6, was kindly provided by J. Sunwoo's laboratory (Stanford, CA). The SCC6 cell line was cultured in DMEM / F12 medium (Invitrogen Life Technologies) supplemented with 10% heat-inactivated FCS (HyClone Laboratories), 100 U / mL penicillin, and 100 μg / mL streptomycin (all from Invitrogen Life Technologies). Cells were grown adherently in culture at 37°C in 5% CO2. Cetuximab (mouse chimeric IgG1 anti-human epidermal growth factor receptor-EGFR, IMC-C225, Erbitux®) was obtained from Bristol-Myers Squibb.
[0184] Chromium release was performed as follows: approximately 1 × 10 9NK cells were isolated from leukocyte reduction system (LRS) products of healthy donors containing 1000 cells. NK cells were isolated by negative magnetic cell sorting using NK cell isolation beads (Miltenyi Biotec) according to the manufacturer's instructions. NK cells were purified (CD3 - CD56 + SCC6 target cells were assessed for purity (>90% as defined by flow cytometry). 6 150μCi per piece 51 Cr for 2 hours. In medium alone, in cetuximab (100 pg / mL), in IL-2 (1000 IU / mL), in IL-2 D10 (1 pg / mL), in IL-2 D10 (10 pg / mL), or in combinations including cetuximab (100 pg / mL) plus IL-2 (1000 IU / mL), cetuximab (100 pg / mL) plus IL-2 D10 (1 pg / mL), or cetuximab (100 pg / mL) plus IL-2 D10 (10 pg / mL), 51 Cytolysis rates were determined after 5 hours of incubation of purified NK cells with Cr-labeled SCC6 cells at variable effector:target cell ratios of 0:1, 1:1, and 5:1. Assays were performed in triplicate. Purified NK cells were incubated with or without various concentrations of cetuximab, IL-2, or IL-2 D10. 51 The stimulation of spontaneous NK cell cytotoxicity by D10 was significantly enhanced by the addition of high doses of IL-2 (Fig. 8, * p=.008, ** p=0.001), with minimal spontaneous cytotoxicity without stimulation with IL-2 or D10. ADCC of cetuximab-bound SCC6 was similarly increased with D10 stimulation compared to high-dose IL-2 or cetuximab alone (*p=0.0005, **p=0.0001). Notably, greater enhancement of cytotoxicity (both spontaneous cytotoxicity and ADCC) occurred with D10 compared to high-dose IL-2 at all effector:target ratios, including 1:1.
[0185] Example 7: IL-2 muteins result in enhanced memory phenotype expansion with relatively low stimulation of regulatory T cells (Tregs). Memory phenotype CD8 expressing low levels of CD25 but high levels of IL-2Rβγ + The efficacy of the IL-2 mutein H9 on T cell proliferation was evaluated in vivo. C57B1 / 6 mice were administered either PBS, 20 μg of IL-2, 20 μg of H9, or 1.5 μg of IL-2 / anti-IL-2 monoclonal antibody complex, and splenic CD3 + CD4 + CD44 high The total number of memory T cells was assessed by flow cytometry. Spleen cell suspensions were prepared and stained with fluorochrome-conjugated monoclonal antibodies CD3 (clone 145-2C11, eBioscience), CD4 (clone RM4-5, Caltag Laboratories), CD8a (clone 53-6.7, BD Biosciences), CD25 (clone PC61, BD Biosciences), CD44 (clone IM7, eBioscience), NK1.1 (clone PK136, BD Biosciences), and Thy1.1 (clone HIS51, eBioscience). At least 100,000 viable cells were acquired using a BD FACSCanto™ II flow cytometer and analyzed using FlowJo software (TriStar, Inc.). As shown in Figure 10A, treatment with the disclosed IL-2 muteins significantly increased the number of CD3 + CD4 + CD25 high While limiting the expansion of regulatory T cells, this treatment resulted in a greater expansion of memory T cells compared to other treatments (Figure 10B).
[0186] Example 8: Reduced in vivo toxicity of IL-2 muteins IL-2 treatment is known to potentially cause severe adverse effects, such as acute pulmonary edema, which is currently a limitation preventing the effective use of IL-2. Therefore, the toxicity of the disclosed IL-2 muteins compared with IL-2 was evaluated (Figure 11A). C57B1 / 6 mice received daily intraperitoneal injections of PBS, 20 μg of IL-2, 20 μg of H9, or 1.5 μg of IL-2 / anti-IL-2 monoclonal antibody complex for 5 consecutive days. Six days after adoptive cell transfer, lungs were removed and weighed before and after drying overnight under vacuum at 58°C. Wet lung weight was calculated by subtracting the initial lung weight from the post-dehydration lung weight.
[0187] Example 9: Increased antitumor activity of IL-2 muteins in vivo The efficacy of the disclosed IL-2 muteins against tumor cells was tested in vivo. 6 B16F10 melanoma cells were injected into the upper dermis on the back of mice (3-4 mice per group). Treatment consisted of five daily injections of either PBS, 20 μg IL-2, 20 μg H9, or 1.5 μg IL-2 / anti-IL-2 monoclonal antibody complex (IL-2 / mAb), until tumor nodules grew to approximately 15 mm. 2 The tumors were clearly visible and palpable starting one day after tumor growth. The disclosed IL-2 muteins resulted in enhanced anti-tumor activity in vivo, as demonstrated in Figure 11B.
[0188] Example 10: Structural comparison of IL-2 muteins and IL-2 Some of the IL-2 muteins were recombinantly expressed to measure the binding affinity and kinetics of the IL-2 muteins to IL-2Rβ by surface plasmon resonance (SPR). The affinity between IL-2 and IL-2Rβ is expressed as K D = 280 nM. The IL-2 muteins were clustered into low-, medium-, and high-affinity classes. The low-affinity IL-2 muteins (5-2 and 6-6) had K values of 50-70 nM, respectively. DThe intermediate- and high-affinity mutants selected from the second site-specific library bound to IL-2Rβ at 10–15 nM (C5, H4) and 1.2–1.7 nM (B1, D10, E10, G8, H9), respectively, with 4–6-fold increased affinity compared to wild-type IL-2. D The increased affinity was accompanied by a decreased off-rate. The high affinity IL-2 muteins contained the consensus sequence at random positions among L80F / R81D / L85V / I86V / I92F.
[0189] To understand the structural consequences of the IL-2 muteins, the D10 mutein and the IL-2Rβ and γ c We crystallized a ternary complex of D10 bound to IL-2Rβ. In the structure of D10 alone, five of the six mutations cluster on the BC loop and within the C helix core, positions that do not contact IL-2Rβ. In particular, the BC helix linker region is well-ordered in the electron density map compared to other IL-2s, where this region is partially or completely disordered (Figure 9). Overall, the substitutions at F80, V85, and V86 appear to stabilize the loop and "pin" the C helix to the core of the molecule, collapsing it into a hydrophobic cluster that packs helix B. The H74 and D81 mutations are solvent-exposed and therefore their structural roles are less clear, but Asp is a well-known helix N-capping residue that may further contribute to helix C structure. Only one of the six consensus mutations, I92F, was in a position that contacts IL-2Rβ in the receptor complex. Phe92 is deeply inserted between the C and A helices, accounting for an additional 10 Å of the molecular surface covered by IL-2Rβ in the complex compared to Ile92. 2 Therefore, the IL-2Rβ contacts may only contribute slightly to the overall ∼300-fold increase in affinity of D10.
[0190] A low-resolution (3.8 Å) structure of the D10 ternary receptor complex was also determined to assess whether the mutations disrupted the binding geometry of the IL-2Rβ / γc receptor. A stable ternary complex of D10 and IL-2Rβ was crystallized and purified in the absence of CD25. The overall IL-2Rβ / γc heterodimer architecture and cytokine / IL-2Rβ contact pattern in the D10 ternary complex are virtually identical to those in the previously reported quaternary assembly. Therefore, the increased potency of Super-2 may be due to enhanced affinity rather than structural changes in the receptor dimer architecture.
[0191] As mentioned above, the C helix of IL-2 appears to undergo subtle rearrangements upon binding to IL-2Rα, as seen in both the binary and quaternary complexes. In contrast, inspection of the three wild-type, unliganded structures in the PDB database revealed variability in the position of the C helix, consistent with the higher B-factor of this helix relative to the rest of the molecule. The structure of D10 was compared to structures of unliganded IL-2 and IL-2 in the receptor complex. The C helix of D10 was observed to be shifted upward and inward toward the helical core, more similar to that seen in the two receptor-bound conformations of IL-2 than in the free form.
[0192] Molecular dynamics (MD) simulations were used to investigate the mechanism by which IL-2 muteins are endowed with higher binding affinity for IL-2Rβ. To probe the relative conformational flexibility of IL-2 versus IL-2 muteins, an atomically refined Markov state model (MSM) was constructed. The states in this MSM are derived from dynamic clustering of rapidly interconverting conformations obtained from atomistic simulations. Each of these metastable states corresponds to a local minimum in the fundamental free energy landscape that ultimately determines the structure and dynamics of the system. Analysis of the MSM demonstrates that IL-2 muteins can be more stable than IL-2, with IL-2 giving rise to nearly twice as many clusters as the IL-2 mutein. For example, the most populated state of the IL-2 mutein has an equilibrium probability of approximately 0.20 compared to approximately 0.05 for IL-2. Helix B, the BC loop, and helix C of the IL-2 mutein are rigidified compared to IL-2. The mutations that occurred are located on the BC loop (H74, D81) and in the packing interface with the B and C helices (F80, V85, V86). Thus, both helices, not just helix C, benefit from the mutations and undergo collective stabilization. F92 likely acts as a molecular wedge between helix C and helix A, exerting an additional stabilizing influence at the more C-terminal end of the helices. It was surprising that the MD simulations suggested that helix B was responsible for the additional stabilization in Super-2, since this was not evident from comparison with the IL-2 crystal structure. IL-2Rα binds IL-2 primarily through the B helix and part of the D helix. MD simulations suggest that binding of IL-2Rα to IL-2 may rigidify helix B, and that this structural stabilization may propagate to the BC loop and helix C. This is, in principle, similar to the apparent effects of mutations in the IL-2 muteins.
[0193] Visualization of the most dense conformations from the simulations of each protein shows that helix C is more flexible in IL-2 than in the IL-2 mutein, and also indicates that the mutations in the IL-2 mutein actually stabilize the receptor-binding-like conformation.
[0194] Example 11: Partial IL-2 agonists and antagonists An IL-2 "superkine" was previously developed that exhibits enhanced binding affinity to IL-2Rβ, resulting in enhanced activity (Levin et al., Nature 484:529 (2012)). It was hypothesized that this high-affinity superkine / IL-2Rβ complex could serve as a dominant-negative scaffold to generate a "receptor signaling clamp" that blocks endogenous signaling. c Directed mutations of these super IL-2 "full agonists" that reduce binding to IL-2Rβγ c These molecules attenuate heterodimerization of IL-2 and may represent a new class of mechanism-based IL-2 partial agonists and non-signaling (neutral) molecules that functionally act as antagonists by blocking endogenous cytokines and exerting no effects of their own (see schematic diagram in Figure 1).
[0195] Based on the IL-2-IL-2R crystal structure, IL-2γ cWe identified four key residues at the interface (Fig. 12A) and generated H9 variants, each containing one (Q126[T]), two (L18[R], Q22[E]), three (L18[R], Q22[E], and Q126[T]), or four (L18[R], Q22[E], Q126[T], and S130[R]) mutations (designated H9-T, H9-RE, H9-RET, and H9-RETR, respectively, based on the newly introduced amino acids). Surface plasmon resonance analysis revealed that the recombinant H9 and H9-RET proteins have similar affinities for IL-2Rβ. However, in contrast, the H9-IL-2Rβ complex c (Fig. 12B), but not H9-RET-IL-2Rβ (Fig. 12C).
[0196] To measure the activity of the H9 variant, CD25 expression was measured on NK-like YT-1 cells. + and CD25 - Subpopulations were purified and signaling quantified. The H9 mutant behaved as a partial IL-2 agonist and suppressed wild-type E1 expression of STAT5 phosphorylation. max The level of activity for each analog varied from γ to γ (Figure 13A), yielding a wide range of signaling potency, from approximately 90% to approximately 10% of the (maximum possible effect) level. c Inversely correlated with the degree of mutation at the interface. + YT-1 cells (Figure 13B) vs. CD25 - Relative E for H9-RET and H9-RETR on YT-1 cells (Fig. 13C) max As demonstrated by the values, signaling efficacy is relatively independent of IL-2Rα and is dependent on IL-2Rβ and γ. c suggested that altered binding to was the main cause of the behavior of the H9 variant.
[0197] H9-RET and H9-RETR express CD25 +We also demonstrated a decreased induction of other IL-2 signaling pathways, including pERK1 / ERK2, in YT-1 cells (Fig. 14A). Because receptor internalization is a critical event in signal transduction, we also assessed the surface expression of IL-2Rβ and IL-2Rγ in YT-1 cells in response to IL-2 variants. Like IL-2 and H9, both H9-RET and H9-RETR rapidly triggered and completed the internalization of IL-2Rβ (Fig. 13B), whereas these partial agonists inhibited γ. c was extremely inefficient in promoting the internalization of γ c This is consistent with the decrease in binding to γ c Variable perturbation of the binding interface can yield a variety of IL-2 partial agonists with a potentially rich repertoire of signaling effects.
[0198] We next analyzed the effects of these molecules on primary cells. Both H9-RET and H9-RETR inhibited the proliferation of freshly isolated CD8 + It was found that pSTAT5 in CD8 T cells could not be induced (Fig. 13, E and F, upper panels). + T cells are activated CD8 + Strikingly, CD8 T cells express less IL-2Rβ and IL-2Rγ than T cells (Fig. 14b, upper panel vs. lower panel), and little or no IL-2Rα (Fig. 13E, upper left panel). + After T cell activation, H9-RET can induce weak / partial phosphorylation of STAT5 (lower right panel of Fig. 13E; lower panel of Fig. 13F; Fig. 13G) and S6 ribosomal protein (Fig. 13H), members of the PI3 kinase signaling pathway. Meanwhile, H9-RETR remained essentially inactive. Interestingly, H9-T cells were significantly more sensitive to the phosphorylation of freshly isolated CD8 +H9-T and H9-RET significantly induced pSTAT5 in T cells (Figure 13E, upper right panel), which was significantly increased in preactivated T cells, but still not to the levels observed with IL-2, H9, or H9-RE (Figure 13E, lower right panel, and Figure 13G). Thus, H9-T and H9-RET exhibit moderate activity reminiscent of true partial agonists.
[0199] Given the weak pSTAT5 expression induced by H9-RET and H9-RETR, we further investigated the effects of these molecules on lymphocyte proliferation. IL-2 and H9-RET induced primary CD8 + H9-RET and H9-RETR strongly induced T cell proliferation, whereas H9-T had a moderate effect, but neither H9-RET nor H9-RETR induced T cell proliferation by carboxyfluorescein diacetate succinimidyl ester (CFSE) dilution (Figure 15) or [ 3 H9-RET did not induce proliferation of these cells as assessed by [H]thymidine incorporation (upper panel of Figure 16A). However, when pre-activated cells were used, H9-RET reproducibly induced proliferation (lower panel of Figure 16B), whereas H9-RETR remained ineffective, demonstrating that H9-RET can induce distinct functional outcomes in distinct cell subsets. This was confirmed by the results of freshly isolated CD8 + T cells versus preactivated CD8 + Consistent with the differential effects of H9-RET on pSTAT5 in T cells (Fig. 13E), as expected, IL-2 and H9 inhibited the activation of preactivated CD8 + Both H9-RET and H9-RETR potently induced IL-2Rα expression in T cells, whereas H9-T induced only moderate levels of IL-2Rα. H9-RET and H9-RETR, on the other hand, significantly reduced IL-2Rα expression below control levels, likely reflecting strong competition with endogenous IL-2 (Figure 17). Next, we used RNA-Seq to identify the expression of pre-activated CD8 +We further characterized the conditions for the weak effects of H9-RET and H9-RETR in T cells (Fig. 16, B and C). As expected, IL-2 and H9 induced genes involved in cell cycle regulation or cytokine signaling (e.g., CCND2, IL2RA, CISH, and CDK6) but repressed many other genes (e.g., IL7R and BCL6). On the other hand, H9-RET had only weak stimulatory activity, and H9-RETR had little effect (Fig. 16B and Table S1), revealing both quantitative and qualitative differences in gene expression between full and partial agonist signals. IL-2 and H9 induced more genes than they repressed, while H9-RETR repressed more genes than it induced, although the overall effect was minimal (Figure 16C). STAT5 is a key mediator of IL-2-induced transcription, and genomic STAT5 binding was assessed globally using chromatin immunoprecipitation and next-generation sequencing (ChIP-Seq). H9-RET- and H9-RETR-induced STAT5 binding to the consensus TTCnnnGAA motif was observed at fewer sites than observed with either IL-2 or H9 (Figure 16D). Based on heatmap clustering, only approximately 35% of the IL-2-induced STAT5 sites were induced by H9-RET, while H9-RETR had little effect (Figure 16E). IL-2 and H9-preactivated CD8 + Induction (IL2RA, CISH, LTA) or repression (IL7RA, BCL6) of several STAT5 target genes in T cells was confirmed by RT-PCR (Fig. 16F), whereas neither H9-RET nor H9-RETR had any effect, except that, interestingly, RET, but not RETR, reproducibly reduced BCL6 expression (Fig. 16F).
[0200] The above studies confirmed the reduced activity of H9-RET and negligible activity of H9-RETR, which are in fact dominant-negative antagonists of IL-2. Given their enhanced ability to bind to IL-2Rβ and reduce IL-2Rα expression on preactivated T cells, it is possible that these molecules inhibit IL-2Rβ and γ. c It was hypothesized that H9-RET and H9-RETR would inhibit not only endogenous IL-2 but also IL-15, which also signal through CD8. + H9-RET and H9-RETR inhibited IL-2-induced (Fig. 18A) and IL-15-induced (Fig. 18B) pSTAT5 in T cells, with H9-RET being more potent. Inhibition of pSTAT5 by H9-RET and H9-RETR treatment correlated with a reduction in TCR-induced (Fig. 17) and IL-2-induced (Fig. 19A) CD25 expression to levels below those observed in unstimulated control cells. Correspondingly, H9-RET and H9-RETR inhibited IL-2-induced IL2RA mRNA expression (Fig. 19B) and preactivated human CD8 + It inhibited IL-2- and IL-15-induced proliferation in T cells (Figure 19C).
[0201] Because H9-RETR inhibits IL-2 signaling, we speculated that it would also inhibit IL-2-dependent TCR-induced cell proliferation, which was indeed the case (Figure 20A), and correlated with a decrease in CD25 expression (Figure 20B). Similarly, IL-2 can promote Th1, Th9, and Treg differentiation but inhibit Th17 differentiation (Liao et al., Immunity 38:13 (2013)). We therefore examined the effects of H9-RET and H9-RETR on these processes. Surprisingly, both H9-RET and H9-RETR inhibited Th1, Th9, and Treg differentiation but enhanced Th17 differentiation (Figure 21), clearly demonstrating their action as potent antagonists of IL-2.
[0202] IL-2 activation of primary human NK cells was also potently blocked by H9-RETR, as measured by IL-2-induced CD69 expression (Fig. 22A) and cytotoxicity against the breast cancer cell line HER18 (Fig. 22B) and the chronic myeloid leukemia cell line K562 (Fig. 22C). Neither H9-RET nor H9-RETR stimulated CD69 expression or cytotoxicity in primary NK cells (Fig. 22A).
[0203] Example 12: Partial IL-2 agonists and antagonists - in vivo effects Given the efficacy of H9-RETR as an IL-2 / IL-15 antagonist in vitro, we investigated its ability to antagonize the effects of endogenous cytokines in vivo. Because IL-2 has a short serum half-life (Boyman et al., Nature Reviews Immunology 12:180 (2012)), H9-RETR ETR was fused to the Fc fragment (Fc4) of human IgG4, an isotype with reduced antibody-dependent cellular cytotoxicity / phagocytosis (ADCC / ADCP) (Strohl, Current Opinion in Biotechnology 20:685 (2009)). Surprisingly, when compared to anti-Tac mAb against CD25 and Mikβ1 mAb against IL-2Rβ (Morris et al., Proc Natl Acad Sci USA 103:401 (2006)), H9-RETR-Fc4 inhibited the activation of preactivated human CD8 + It significantly more potently blocked IL-2-mediated (Fig. 18C) and IL-15-mediated (Fig. 18D) pSTAT5 induction in T cells and inhibited human CD8 + H9-RETR-Fc4 blocked IL-2-induced (Figure 18E) and IL-15-induced (Figure 18F) proliferation of T cells. Importantly, H9-RETR-Fc4 was as effective as the combination of anti-Tac and Mikβ1 in blocking IL-2 proliferation (Figure 18E) and more potent than Mikβ1 in inhibiting IL-15-induced proliferation (Figure 18F).
[0204] Next, we evaluated the efficacy of H9-RETR-Fc in vivo. Under steady-state conditions, Treg cells are the predominant population of primary cells expressing the high-affinity IL-2 receptor and can act as a systematic "barometer" of IL-2 signaling. Pretreatment of mice with H9-RETR-Fc4 prior to administration of IL-2 or IL-15 significantly reduced CD4 T cell proliferation when assessed ex vivo. + FoxP3 + It significantly inhibited STAT5 phosphorylation in Treg cells (Figure 23 and Figure 18G), demonstrating the in vivo potential of H9-RETR-Fc4 as an IL-2 antagonist. IL-2 and IL-15 signaling contribute to acute GVHD in experimental mouse models (Ferrara et al., Journal of of Immunology 137:1874 (1986); and Blaser et al., Blood 105:894 (2005)), we hypothesized that H9-RETR-Fc4 might inhibit lethal GVHD in a T cell-mediated C57BL / 6-into-BALB / C model of fully HMC-mismatched bone marrow transplantation. Indeed, mice treated with H9-RETR-Fc4 for 10 days survived longer than mice treated with the isotype control Fc4 protein (P<0.001) (Figure 18H).
[0205] Human T-cell lymphotropic virus type I (HTLV-I) induces adult T-cell leukemia (ATL), a CD4+ cell leukemia that exhibits an early proliferation stage accompanied by autocrine signaling via IL-2 and IL-15 and paracrine signaling via IL-9. +This cytokine-dependent proliferation is evident in patients with chronic and smoldering ATL, but not acute ATL (Ju et al., Blood 117, 1938 (2011)). Therefore, we tested the efficacy of H9-RETR in this system. We first used ED40515, an ATL-derived cell line whose growth is supported in vitro by the addition of exogenous IL-2. H9-RETR potently inhibited the proliferation of these cells, surpassing that of daclizumab and Mikβ1 (Figure 18I). Therefore, we next assayed spontaneous proliferation in a 6-day assay using freshly isolated cells from a patient with smoldering ATL. 10 μg / ml of RETR was slightly more effective than daclizumab and significantly more effective than Mikβ1 (Figure 18J), clearly demonstrating its potential utility in controlling these aggressively proliferating malignant cells.
[0206] Signaling amplitude at ligand saturation (E max Partial agonism, defined as a decrease in IL-2Rβ binding, is a pharmacological property typically associated with small molecules targeting GPCRs, channels, and other multi-pass transmembrane proteins. The concept of tunable signaling through dimers of type I transmembrane receptors in response to protein growth factors such as cytokines (partial agonism) has not been demonstrated. Based on structural information, researchers have attempted to enhance affinity at one receptor site (IL-2Rβ) while suppressing the affinity at the second receptor binding site (γ) to manipulate dimerization and signal initiation. c The IL-2 variant was modified by weakening the interaction at IL-2Rβ. These molecules are dominant over endogenous IL-2 and inhibit γ c The level of interaction set the strength of the signal recognized by the cells, thereby "clamping" the signaling amplitude at the level of the Emax of the partial agonist. These partial agonists were used to stimulate freshly isolated CD8 + T cells versus preactivated CD8 +We demonstrated that T cells had distinct activation thresholds for IL-2 signaling strength, as evidenced by the distinct effects of H9-T and H9-RET on these cells. In contrast, H9-RETR, an extremely weak partial agonist as indicated by pSTAT induction, possessed remarkable inhibitory properties, making it a potential new type of immunosuppressant. Notably, it was able to block IL-2Rα induction when assessed ex vivo, prolonged survival in a GVHD model, and potently inhibited the spontaneous proliferation of peripheral blood T cells from patients with smoldering ATL. In addition to its effects on T cells, H9-RETR also inhibited NK-mediated cytotoxicity. Given the differential activity of partial agonists, a larger repertoire of IL-2 variants may exhibit an even broader range of distinct signaling activities, ranging from partial agonism to full antagonism, and potentially including additional molecules with distinct actions on T cell subsets, such as Treg cells, compared to effector T cells. Furthermore, the rational design approach used by the inventors may allow for the identification of other γ-agonists. c family cytokines, and indeed a wide range of cytokines and growth factors as well. Additional partial agonist cytokine analogs may potentially elucidate the function of additional pleiotropic immune pathways and may have distinct therapeutic advantages depending on the context.
[0207] Materials and Methods Protein expression and purification Human IL-2 (amino acids 1-133) and its variants, human IL-2Rβ ectodomain (amino acids 1-214), and γ cThe ectodomain (amino acids 34-232) was secreted and purified using a baculovirus expression system as previously described (Morgan et al., Science 193:1007 (Sep 10, 1976)). Briefly, all construct sequences were cloned into the pAcGP67A vector (BD Biosciences), which contains an N-terminal gp67 signal peptide and a C-terminal hexahistidine tag. Spodoptera frugiperda (Sf9) insect cells cultured at 28°C in SF900II SFM medium (Invitrogen) were transfected with the plasmid constructs to establish and subsequently amplify high-titer recombinant viruses. Trichopulsia ni (High-Five™) insect cells (Invitrogen) grown at 28°C in Insect-XPRESS™ medium (Lonza) were infected with high-titer viruses to express recombinant proteins (Zhu et al., Annual Review of Immunology 28:445 (2010) and W. Liao et al., Nat Immunol 9:1288 (2008)). Three days after infection with the recombinant viruses, proteins were extracted and concentrated by Ni-NTA (Qiagen) affinity chromatography and further purified to >98% homogeneity on a Superdex 200 sizing column (GE Healthcare) equilibrated in 10 mM HEPES (pH 7.3) and 150 mM NaCl. Fc4 and Fc4-RETR fusion proteins were also secreted and purified using this baculovirus expression system by cloning the human IgG4 Fc domain (Fc4) or the human IL-2 RETR variant followed by the C-terminal human IgG4 Fc domain (Fc4-RETR) into the pAcGP67A vector, which contains an N-terminal gp67 signal peptide and a C-terminal hexahistidine tag. The human IgG4 Fc domain was obtained from a modified pFUSE-hIgG4-Fc vector (Invivogen) with an engineered Ser228Pro mutation (Liao et al., Nat Immunol 12:551 (2011)).For in vivo experiments, endotoxin was removed from the prepared proteins using Triton X-114 as previously described (Cheng et al., Immunol. Rev 241:63(2011)), and endotoxin removal was confirmed using the LAL Chromogenic Endotoxin Quantitation Kit (Thermo Scientific).
[0208] For biotinylated protein expression, γ-antibody with a C-terminal biotin acceptor peptide (BAP) -LNDIFEAQKIEWHE c The BirA ligase enzyme was expressed, purified by Ni-NTA (Qiagen) affinity chromatography, and then biotinylated with soluble BirA ligase enzyme in 0.5 mM bicine pH 8.3, 100 mM ATP, 100 mM magnesium acetate, and 500 mM biotin (Sigma). The protein was purified by size-exclusion chromatography on a Superdex 200 column (GE Healthcare) equilibrated in 10 mM HEPES (pH 7.3) and 150 mM NaCl.
[0209] Surface plasmon resonance coupling measurement The binding interactions were characterized by surface plasmon resonance (SPR) studies using a Biacore SA sensor chip (GE Healthcare) on a Biacore T100 instrument. c are immobilized on the chip surface at low density (RU maxSerial dilutions of H9:IL-2Rβ or H9-RET:IL-2Rβ complexes (<100 response units) were exposed to the surface for 60 seconds. Dissociation was then followed for 200 seconds. An irrelevant biotinylated protein was immobilized in the reference channel to subtract nonspecific binding from measurements. Experiments were performed at 25°C in HBS-P+ buffer (GE Healthcare) supplemented with 0.2% BSA. All binding studies were performed at a flow rate of 30 mL / min to minimize the contribution of mass transport and prevent analyte rebinding. Data analysis and determination of equilibrium and kinetic parameters for measurements were performed using BiacoreT100 Evaluation Software Version 2.0, assuming a 1:1 Langmuir binding model.
[0210] Tissue culture and CD25 + Magnetic purification of YT-1 cells Native YT9 (Zhu et al., Annual Review of Immunology 28:445 (2010)) and CD25 + YT-1 natural killer-like cells (Liao et al., Nat Immunol 9:1288 (2008)) were cultured in RPMI complete medium (RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, minimal non-essential amino acids, sodium pyruvate, 25 mM HEPES, and penicillin-streptomycin (Gibco)). Both cell lines were maintained at 37°C in a humidified atmosphere of 5% CO2.
[0211] Subpopulations of YT-1 cells expressing or not expressing CD25 were purified by magnetic selection as previously described (Liao et al., Immunity 38:13 (2013)). Ten million unsorted CD25 + YT-1 cells were washed with FACS buffer (phosphate-buffered saline pH 7.2 containing 0.1% bovine serum albumin) and then incubated with PE-conjugated anti-human CD25 antibody (Biolegend, clone BC96) in FACS buffer for 2 hours at 4°C. PE-stained CD25 antibodies were then analyzed. +Cells were labeled with paramagnetic microbeads conjugated to anti-PE IgG for 20 min at 4°C, washed once with cold FACS buffer, and sorted using an LS MACS separation column (Miltenyi Biotec) according to the manufacturer's protocol. Eluted cells were resuspended, grown in RPMI complete medium, and analyzed for CD25 expression using an Accuri C6 flow cytometer. + Cell enrichment was assessed. + The persistence of CD25 expression on YT-1 cells was monitored by flow cytometry analysis using a PE-conjugated anti-human CD25 antibody.
[0212] Flow cytometry analysis of intracellular phospho-STAT5 and phospho-ERK1 / 2 Approximately 2×10 5 YT cells or CD25 + YT-1 cells were cultured in each well of a 96-well plate. Cells were plated into wells, washed with FACS buffer, and resuspended in FACS buffer containing serial dilutions of IL-2, H9, H9-RET, or H9-RETR. Cells were stimulated for 20 min at 37°C and immediately fixed by adding formaldehyde up to 1.5%, followed by a 10-minute incubation at room temperature. Cells were then permeabilized with 100% ice-cold methanol for 30 min at 4°C to allow detection of intracellular signaling effectors. Fixed and permeabilized cells were washed twice with FACS buffer and incubated with Alexa488-conjugated anti-STAT5 pY694 (BD Biosciences) or Alexa488-conjugated anti-ERK1 / 2 pT202 / pY204 (BD Biosciences) diluted in FACS buffer for 2 hours at room temperature. Cells were then washed twice with FACS buffer, and mean fluorescence intensity (MFI) was quantified using an Accuri C6 flow cytometer (BD Biosciences). Dose-response curves were generated after subtracting the MFI of unstimulated cells and normalizing to the maximum signal intensity induced by cytokine stimulation, and EC 50 and E maxValues were calculated using GraphPad Prism data analysis software.
[0213] Human CD8 + T cell isolation and intracellular staining of pSTAT5 and pS6 ribosomal proteins Buffy coats were obtained from healthy donors at the NIH Blood Bank, and peripheral blood mononuclear cells (PBMCs) were isolated by gradient centrifugation using lymphocyte separation medium (Mediatech, Inc., VA). + Cells were isolated using a T cell isolation kit I (Miltenyi Biotec, Germany). For preactivation, 6-well plates were precoated with 2 μg / ml of plate-bound anti-CD3 mAb (BD Biosciences). Cells were grown at 1 × 10 in complete medium (RPMI medium supplemented with glutamine, penicillin, streptomycin, and 10% FBS) with 1 μg / ml of soluble anti-CD28 mAb (BD Biosciences) for 3 days. 6 Primary human CD8 cells were seeded at 100 cells / ml and then placed in fresh medium for 48 hours. +Dose-response experiments in T cells were performed as previously described (Liao et al., Immunity 38:13 (2013)). Briefly, cells were treated with serial dilutions of IL-2, H9, H9-RET, or H9-RETR, then fixed with Phosflow Fix Buffer I (BD Biosciences) for 10 minutes at room temperature and washed once with FACS buffer. Cells were then permeabilized by gradually adding cold BD Phosflow™ Perm Buffer III and incubated on ice for 30 minutes. Cells were washed and stained with PE-conjugated anti-STAT5 pY694 (BD Biosciences) or APC-conjugated anti-phospho-S6 ribosomal protein (Ser235 / 236) (clone D57.2.2E) for 30 min at room temperature in the dark, washed again with FACS buffer, and data were acquired on a FACSCanto II flow cytometer (BD Biosciences) and analyzed by using FlowJo (Tree Star).
[0214] Analysis of STAT5 phosphorylation ex vivo C57BL / 6 mice were obtained from the Jackson Laboratory. Animal protocols were approved by the NHLBI Animal Care and Use Committee and in accordance with the NIH guidelines for "Using Animals in Intramural Use." Research" according to the manufacturer's protocol. STAT5 phosphorylation was assayed using the manufacturer's protocol (BD Bioscience). Briefly, IL-2 or IL-15 was injected intraperitoneally into C57BL / 6 mice, and total splenocytes were isolated, immediately fixed using BD Phosphoflow™ Lyse / Fix buffer, washed twice with ice-cold PBS, stained with anti-CD4 and anti-CD25 antibodies (Biolegend), and then permeabilized using BD PhosFlow Perm Buffer III for 30 minutes on ice in the dark. Cells were then washed twice with ice-cold FACS buffer, stained with anti-FoxP3 according to the manufacturer's protocol (eBioscience), and permeabilized with ice-cold FACS buffer. After washing twice, cells were stained with anti-phospho-STAT5-PE (1:30) (BD) for 30 minutes at room temperature in the dark. Cells were washed three times with FACS buffer, and data were acquired on a FACSCanto flow cytometer (BD) and analyzed using FlowJo (Tree Star).
[0215] IL-2 receptor internalization experiments IL-2, H9, H9-RET, or H9RETR (1 μM) were incubated in 3 × 10 cells / well in a 96-well plate for 2, 5, 10, 15, 30, 60, 90, 120, 180, or 240 minutes. 5 The cells were incubated with 1000 YT-1 cells. To prevent further receptor internalization, the cells were immediately transferred to ice and washed twice with ice-cold PBSA buffer (0.1% BSA in PBS). The cells were co-stained with a 1:50 dilution of allophycocyanin-conjugated anti-human IL-2Rβ antibody (TU27; Biolegend) and a phycoerythrin-conjugated anti-human IL-2Rγ antibody (TUGh4; Biolegend) in PBSA buffer for 30 minutes on ice. After two additional washes with ice-cold PBSA buffer, the cells were fixed with 1.5% paraformaldehyde in PBSA for 10 minutes at room temperature, washed once more, and resuspended in PBSA buffer. Mean cell fluorescence was quantified using an Accuri C6 flow cytometer. Internalization data were fitted to a single-exponential decay model using nonlinear least-squares regression in the Prism software package (GraphPad).
[0216] Inhibition of IL-2-induced pSTAT5 Freshly isolated human CD8 + T cells and preactivated human CD8 +T cells were stimulated with IL-2 in the absence or presence of H9-RET or H9-RETRIL-2, and pSTAT5 levels were assessed. Cells were incubated with or without anti-Tac or Mikβ1 or Fc4-H9-RETR for 1 hour, then stimulated with a wide range of doses of IL-2 or IL-15 for 30 minutes, and pSTAT5 levels were measured by flow cytometry. For NK cell experiments, freshly isolated human NK cells (NK Cell Isolation Kit II, Miltenyi Biotech) were stimulated with serial dilutions of IL-15 in the presence or absence of the indicated IL-2 variants, and pSTAT5 was assessed.
[0217] Western blot analysis Cells stimulated with or without cytokines were lysed in RIPA buffer containing 1% IGEPAL CA-630 (Sigma). Equal amounts of lysates were separated on 4-12% Bis-Tris NuPAGE gels (Invitrogen) and transferred to membranes. The membranes were stained with antibodies against pSTAT5 (Y694) (Cell Signaling Technology, Inc., Beverly, MA) or STAT5. The membranes were incubated with BD Transduction Laboratories (San Diego, CA) for 1 hour at room temperature. Bound antibodies were detected with goat anti-rabbit IgG (H+L)-HRP conjugate (1:5,000 dilution) and goat anti-mouse IgG (H+L)-HRP conjugate (1:10,000 dilution) (Biorad). Immunoblots were visualized using enhanced chemiluminescence (ECL, GE healthcare). In some experiments, the membranes were reused after incubation in stripping buffer (Millipore) for 15 minutes at room temperature.
[0218] CFSE dilution and EdU proliferation assays Freshly isolated CD8 + T cells or preactivated CD8 + T cells (20×10 6CFSE (Molecular Probes) and immediately washed once with 100% FBS (2 ml / sample), then washed in complete RMPI. 6 CFSE-labeled cells were incubated at 1000 cells / ml with wild-type IL-2, H9, H9-RET, H9-RETR, or H9-RETR plus IL-2. Cell proliferation was assessed by flow cytometry analysis of CFSE dilutions at the indicated time points. For EdU proliferation assays, cells were cultured in the absence or presence of CFSE. Cell proliferation was assessed by flow cytometry analysis of CFSE dilutions at the indicated time points. For EdU proliferation assays, cells were cultured in the absence or presence of CFSE. Cell proliferation was assessed by flow cytometry analysis of CD8 cells preactivated as described above. + T cells were cultured. 16 hours before harvest, 10 mM EdU was added according to the manufacturer's protocol (BD Biosciences), and cells were stained for surface antigens as indicated and then for intracellular EdU. Cell proliferation was assessed by flow cytometry.
[0219] Growth of ED40515 cells and cells from patients with smoldering ATL IL-2 dependent ED40515(+) (Lenardo, Nature 353:858 (1991)) cells were washed twice with PBS. The cells were cultured at 1 x 10 in RPMI 1640 medium with or without IL-2 and with or without reagents. 4 The cells were seeded into 96-well plates at 100 μl / well and then incubated at 37° C. for 3 days.
[0220] Blood samples from ATL patients were obtained under the care of the Clinical Trials Team of the Lymphoid Malignancies Branch of the National Cancer Institute at the National Institutes of Health (NCI). The experimental protocol was approved by the Institutional Review Board of the National Cancer Institute. Informed consent was obtained in accordance with the Declaration of Helsinki. Peripheral blood mononuclear cells (PBMCs) from ATL patients were isolated from heparinized blood by Ficoll-Hypaque density gradient centrifugation. 1 × 10 5Aliquots of cells / 100 μl / well were cultured ex vivo in RPMI1640 medium supplemented with 10% FBS with or without reagents for 6 days.
[0221] During the last 6 hours of culture, ED40515(+) cells or ATL PBMCs were treated with 1 μCi (0.037 MBq) of [ 3 The cells were pulsed with [H]thymidine, then harvested with a cell harvester (Tomtec, Hamden, CT) and counted in a MicroBeta2 microplate counter (PerkEmer). Assays were performed in triplicate.
[0222] NK cell activation Peripheral blood mononuclear cells (PBMCs) were cultured for 24 hours in the presence of 1 μg / mL of IL-2 analog. Cells were then stained with APC-conjugated anti-CD56 (BD Biosciences), Pacific Blue-conjugated anti-CD3 (BioLegend), and FITC-conjugated anti-CD69 (BD Biosciences). Samples were analyzed by flow cytometry using a FACSAria II (BD Biosciences). NK cells were gated as CD3-negative, CD56-positive.
[0223] PBMCs were isolated by gradient centrifugation using Ficoll-Paque Premium (GE Life Sciences), and then intact NK cells were purified using a Human NK Cell Isolation Kit (Miltenyi) and subsequently separated using autoMACS (Miltenyi). HER18 target cells were incubated at 1 × 10 for 2 h. 6 150 μCi per cell 51 Cr (Perkin Elmer). NK cells were added to 10,000 HER18 cells at an effector:target ratio of 10:1. Specific lysis was determined after 4 hours of culture in the presence of various concentrations of IL-2 analogs.
[0224] Lysis of K562 cells by primary NK cells was performed as described (Yuan et al., Immunol Rev 259, 103 (2014)). Briefly, intact human NK cells were purified using a human NK isolation kit (STEMCELL). K562 cells were labeled with PKH67 green fluorescent cell linker kit (Sigma-Aldrich), and NK cells were added to 5,000 K562 cells at a ratio of 10:1. The cells were cultured for 4 hours at 37°C in the presence of various concentrations of IL-2 analogs to further enhance the response. The cells were then stained with propidium iodide (PI) (Sigma-Aldrich) and placed on ice to prevent precipitation. + PKH67 + The percentage of K562 cells was determined by flow cytometry.
[0225] T helper polarization and intracellular cytokine staining Naive CD4 + C57BL / 6 T cells were differentiated under different T helper polarization conditions in the absence or presence of the indicated cytokines. After 4 days, cells were first stained for expressed antigens as indicated and then stained with BD cytofix and cytoperm or eBioscience FoxP3 staining kits according to the manufacturer's protocol. Cells were stained with antibodies against IFNγ (eBioscience), IL-17A (eBioscience), IL-4 (BioLegend), IL-9 (BioLegend), or FoxP3 (eBioscience) in a buffer kit. Stained cells were analyzed on a FACSCanto II flow cytometer (Becton Dickinson) using FlowJo software (Tree Star, Inc.). All mouse cytokines were from Peprotech.
[0226] RNA-Seq analysis Preactivated human CD8 +T cells were rested in complete medium for 2 days and stimulated with 1 μg / ml wild-type IL-2, H9, H9-RET, or H9-RETR for 24 h, and 5 × 10 6 Total RNA from 100 cells was isolated (RNeasy kit, Qiagen, Valencia, CA). RNA from 5 donors was pooled, and 1 μg of pooled RNA was used to synthesize cDNA. RNA-Seq libraries were generated as described previously (Liao et al., Immunity 38:13 (2013)). PCR-amplified products were barcoded and sequenced using the Illumina HiSeq2000 platform. Sequenced reads were aligned to the human genome (hg18, NCBI build 36.1) using Bowtie 0.12.4 (Leonard, Nature Reviews. Immunology 1:200 (2001)). Uniquely mapped reads were retained, and digital expression levels of genes were calculated using RPKM (Reads Per Kilobase per Million mapped reads). Differentially expressed genes were identified using the R package edgeR, and differences in fold change (on a log2 scale) were compared between untreated cells and cells treated with IL-2 variants for 24 hours.
[0227] ChIP-Seq library generation and analysis Preactivated CD8 +T cells were treated with different cytokines for 90 minutes and then chemically cross-linked with 1% paraformaldehyde. Chromatin from 10-20 million cells was sonicated to 250-500 bp fragments, immunoprecipitated with anti-STAT5B (Invitrogen), and processed for sequencing as described previously (Noguchi et al., Cell 73:147 (1993)). All reads were aligned to the human genome (hg18, NCBI build 36.1) using Bowtie 0.12.4 (Leonard, Nature Reviews. Immunology 1:200 (2001)). Uniquely mapped reads were converted to browser extensible data (BED) files and duplicate reads (multiple reads at the same genomic location) were filtered. The filtered (non-duplicate) BED files were then converted to binary data (.tdf) and visualized using the Integrative Genome Viewer (Broad Institute).
[0228] Gene expression analysis by RT-PCR Total RNA was purified using the RNeasy Plus mini kit (Qiagen). 200 ng of the isolated DNA was mixed with oligo dT (Invitrogen) and Omniscript cDNA was synthesized using a reverse transcription kit (Qiagen). Quantitative RT-PCR was performed using an ABI 7900 HD Sequence Detection System. RT primers and probes were from Applied Biosystems. Expression levels were normalized to RPL7.
[0229] Bone marrow transplantation into an allogeneic host Seven-week-old female C57BL / 6 (H2K) mice were obtained from the NCI-Frederick Cancer Research Facility. b ) and BALB / c (H2K d) Mice were housed in a specific pathogen-free facility and maintained under the supervision of the NCI Animal Care and Use Center. Treatment was performed according to an approved animal protocol approved by the Committee. BALB / c mice were conditioned with 950 cGy of total-body irradiation and then reconstituted with 10 million T-cell-depleted bone marrow cells from C57BL / 6 mice, either alone or together with 2 million Treg-depleted pan-T cells. T-cell depletion was performed using a kit from Miltenyi Biotec with anti-CD90 [Thy1.2] microbeads (total T-cell depletion) or anti-CD25 (Treg depletion). Mice receiving pan-T cells were further treated with Fc4 or H9-RETR-Fc4 (100 μg intraperitoneally twice daily for 10 days). Drinking water was supplemented with ciprofloxacin from the day before total-body irradiation until day 14. Survival and weight loss were monitored. Survival was analyzed according to the Kaplan-Meier method, and survival curves were compared using the log-rank test. Statistical analysis was performed using GraphPad Prism 4 software.
[0230] Other embodiments While the present invention has been described in conjunction with a detailed description thereof, it should be understood that the foregoing description is illustrative, but not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. For example, while IL-2 is referred to throughout this specification, those of skill in the art will understand that the methods and compositions described herein are equally applicable to other cytokines, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-2, IL-3, IL-5, IL-6, or IL-15, which possess this property. Accordingly, the present invention also includes variants of GM-CSF, IL-2, IL-3, IL-5, IL-6, and IL-15 that have increased binding affinity for their respective receptors compared to the wild-type variants, as well as methods for identifying and using these variants.
Claims
1. A nucleic acid encoding an IL-2 mutein having amino acid substitutions L18R, Q22E, Q126T, and S130R compared to wild-type human IL-2 (hIL-2), wherein the IL-2 mutein has greater binding affinity to the IL-2Rβ receptor and reduced binding affinity to the IL-2Rγ c receptor compared to wild-type hIL-2 (excluding nucleic acids encoding IL-2 muteins having amino acid substitutions L18R, Q22E, L80F, R81D, L85V, I86V, I92F, Q126T, and S130R).
2. The nucleic acid described in claim 1, wherein the IL-2 mutein further comprises one or more amino acid substitutions selected from the group consisting of Q74N, Q74H, Q74S, L80F, L80V, R81D, R81T, L85V, I86V, I89V, and I92F compared to wild-type hIL-2.
3. The nucleic acid described in claim 2, wherein the IL-2 mutein comprises, compared to wild-type hIL-2, an amino acid substitution selected from the group consisting of L80F and L80V, an amino acid substitution selected from the group consisting of R81D and R81T, and amino acid substitutions L85V, I86V, and I92F.
4. The nucleic acid of claim 3, wherein the IL-2 mutein comprises the amino acid substitutions Q74N and I89V compared to wild-type hIL-2.
5. The nucleic acid of claim 2, wherein the IL-2 mutein comprises the amino acid substitutions Q74N, L80V, R81T, L85V, I86V, and I92F compared to wild-type hIL-2.
6. The nucleic acid of claim 3, wherein the IL-2 mutein comprises the amino acid substitution Q74H compared to wild-type hIL-2.
7. The nucleic acid of claim 3, wherein the IL-2 mutein comprises the amino acid substitution Q74S compared to wild-type hIL-2.
8. The nucleic acid of claim 3, wherein the IL-2 mutein comprises the amino acid substitution Q74N compared to wild-type hIL-2.
9. The nucleic acid of claim 3, wherein the IL-2 mutein comprises amino acid substitutions Q74S, R81T, L85V, and I92F compared to wild-type hIL-2.
10. A nucleic acid described in any one of claims 1 to 9, wherein the IL-2 mutein has a reduced ability to stimulate STAT5 phosphorylation in IL-2Rβ+ T cells compared to wild-type hIL-2.
11. The nucleic acid described in claim 10, wherein the T cell is a CD8+ T cell.
12. A nucleic acid described in any one of claims 1 to 9, wherein the IL-2 mutein has a reduced ability to stimulate pERK1 / ERK2 signaling in IL-2Rβ+ cells compared to wild-type hIL-2.
13. The nucleic acid according to any one of claims 1 to 12, wherein the IL-2 mutein is an IL-2 and / or IL-15 antagonist.
14. The nucleic acid of claim 13, wherein the IL-2 mutein is an inhibitor of IL-2 and / or IL-15 STAT5 phosphorylation in CD8+ T cells.
15. The nucleic acid of claim 13, wherein the IL-2 mutein is an inhibitor of IL-2 and / or IL-15-induced proliferation of CD8+ T cells.
16. The nucleic acid of claim 13, wherein the IL-2 mutein is an inhibitor of IL-2-dependent TCR-induced cell proliferation.
17. The nucleic acid of claim 13, wherein the IL-2 mutein is an inhibitor of IL-2-dependent Th1, Th9, and / or Treg differentiation.
18. The nucleic acid described in claim 13, wherein the IL-2 mutein is a promoter of Th17 differentiation.
19. The nucleic acid of claim 13, wherein the IL-2 mutein is an inhibitor of IL-2-dependent activation of NK cells.
20. A nucleic acid encoding an IL-2 mutein fusion protein comprising an IL-2 mutein according to any one of claims 1 to 19 linked to a human Fc antibody fragment.
21. A nucleic acid encoding an IL-2 mutein fusion protein comprising an IL-2 mutein according to any one of claims 1 to 19 and a heterologous polypeptide.
22. A nucleic acid encoding an IL-2 mutein fusion protein comprising an IL-2 mutein according to any one of claims 1 to 19 and an albumin polypeptide.
Citation Information
Patent Citations
Compositions and methods for treating inflammatory and autoimmune diseases
JP2012515778A
IL-2-derived immunomodulatory polypeptides and their use in the treatment of cancer and chronic infections
JP2013512200A
Interleukin-2 superagonists and antagonists
JP2014502967A