Method for inhibiting heavy metal accumulation in plants using anti-transpiration components
Anti-transpiration components inhibit heavy metal translocation in plants, addressing accumulation issues and improving yield by applying them during risk conditions, offering a cost-effective and efficient solution to heavy metal accumulation in crops.
Patent Information
- Application Number
- JP2021048879
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-03-23
- Publication Date
- 2025-08-27
- Estimated Expiration
- 2041-03-23
AI Technical Summary
Heavy metal accumulation, particularly arsenic, in plants poses a significant problem in agriculture, leading to economic losses and potential health risks, with existing methods requiring laborious water management and additional materials to mitigate arsenic concentration.
The use of anti-transpiration components, such as plant-spreading antidesiccants and plant hormone-acting antidesiccants, to inhibit the translocation of heavy metals from underground to aboveground plant parts, reducing accumulation and improving yield by applying these components during specific weather conditions.
Reduces heavy metal accumulation effectively without laborious water management, maintains crop quality, and suppresses metal concentration rises, reducing labor and material costs while enhancing crop yield.
Smart Images

Figure 0007730131000002 
Figure 0007730131000003 
Figure 0007730131000004
Abstract
Description
[Technical Field]
[0001] The present disclosure discloses a method for inhibiting the accumulation of heavy metals in plants. [Background technology]
[0002] Heavy metal accumulation is a serious problem in the agricultural sector. For example, it has been reported that arsenic, a harmful substance, can accumulate in rice grains.
[0003] A nationwide survey of arsenic concentrations in brown rice (3,007 locations, Ministry of Agriculture, Forestry and Fisheries, 2019) published in 2019 found that inorganic arsenic in brown rice exceeded the international standard value (0.35 mg / kg, Codex Alimentarius Commission, 2016) at 41 locations. If a national standard value is established, the economic losses caused by the occurrence of rice exceeding the arsenic standard value are expected to be enormous. Summary of the Invention [Means for solving the problem]
[0004] The present disclosure relates to the use of an anti-transpiration component to inhibit the accumulation of heavy metals such as arsenic in plants. The present disclosure also provides a technology for improving the yield of edible parts of crops. Transient application of a highly safe anti-transpiration component inhibits the translocation of heavy metals such as arsenic from aboveground parts to other parts of the plant body (e.g., brown rice), thereby reducing the accumulation of heavy metals such as arsenic in important parts of the grain (e.g., brown rice). The present disclosure provides, for example: (Item 1) A composition for inhibiting the accumulation of heavy metals in a plant or a part thereof, the composition comprising an anti-transpiration component. (Item 2) A composition for improving the yield of edible parts of a plant, the composition comprising an anti-transpiration component. (Item 3) The composition according to any one of the preceding items, wherein the composition is a solution and the surface tension of the solution is 72.8 dynes / cm or less. (Item 4) The composition according to any one of the preceding items, wherein the composition is a solution and the surface tension of the solution is 45 dynes / cm or less. (Item 5) Item 10. The composition according to any one of the preceding items, wherein the antidesiccant is a plant-spreading antidesiccant or a plant hormone-acting antidesiccant. (Item 6) Item 10. The composition according to any one of the preceding items, wherein the plant-spreadable transpiration inhibiting component is a sessile-spreadable component. (Item 7) Item 10. The composition according to any one of the preceding items, wherein the plant-spreadable transpiration-suppressing component is selected from the group consisting of alkane hydrocarbons, natural cellulose, and polyoxyethylene resin acid esters. (Item 8) Item 10. The composition according to any one of the preceding items, wherein the plant-adhering transpiration inhibitor is a paraffin. (Item 9) Item 10. The composition according to any one of the preceding items, wherein the plant-spreading transpiration inhibitor is selected from the group consisting of normal paraffins, isoparaffins, and cycloparaffins. (Item 10) Item 10. The composition according to any one of the preceding items, wherein the plant-spreading anti-transpiration component is an alkane hydrocarbon having a number-average molecular weight of from about 300 to about 1000 or from about 15 to about 60 carbon atoms. (Item 11) The composition according to any one of the preceding items, wherein the plant hormone-active transpiration inhibitor is selected from the group consisting of abscisic acid, jasmonic acid, or derivatives thereof, or inducers thereof (e.g., melatonin, an ABA / JA-inducing component, systemin, etc.), and stomatal opening-regulating components. (Item 12) The composition according to any one of the preceding items, which is for application to plants or to the environment. (Item 13) The composition according to any one of the preceding items, which is in a dosage form selected from the group consisting of a liquid, a granular, a flowable, a jumbo, an emulsifiable concentrate, a water dispersible granule, a dust, a microcapsule, and an aerosol. (Item 14) The composition according to any one of the preceding items, wherein the accumulation of heavy metals is inhibited at least in a part of the plant selected from the group consisting of leaves and seeds. (Item 15) Item 10. The composition of any one of the preceding items, wherein the heavy metal is arsenic. (Item 16) The composition according to any one of the preceding items, wherein the plant body is a monocotyledon. (Item 17) The composition according to any one of the preceding items, wherein the plant is a cereal. (Item 18) The composition according to any one of the preceding items, wherein the plant is a grass plant. (Item 19) The composition according to any one of the preceding items, wherein the plant body is an aquatic plant. (Item 20) The composition according to any one of the preceding items, wherein the plant body is an emergent plant or a wetland plant. (Item 21) The composition according to any one of the preceding items, wherein the plant body is rice. (Item 22) The composition according to any one of the preceding items, which is for spraying on plants. (Item 23) The composition of any one of the preceding items, wherein the part of the plant body includes a seed. (Item 24) A method for inhibiting accumulation of heavy metals in a plant or a part thereof, the method comprising the step of applying an anti-transpiration component to the plant. (Item 25) 1. A method for improving the yield of an edible portion of a plant, the method comprising the step of applying an anti-transpirant component to the plant. (Item 26) 10. The method according to any one of the preceding items, wherein the plant body is rice, and the anti-transpiration component is applied once or a plurality of times at any time point between the panicle formation stage and maturity stage of rice or during the vegetative growth stage of rice. (Item 27) Item 10. The method according to any one of the preceding items, wherein the antidesiccating component is applied once or multiple times during the vegetative growth period. (Item 28) 24. The method according to any one of the preceding items, further comprising the features according to any one or more of items 1 to 23.
[0005] It is contemplated that one or more of the above features may be provided in combinations other than those explicitly stated. Further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary. [Effects of the Invention]
[0006] The present disclosure achieves the effect of reducing the concentration of heavy metals such as arsenic in a plant body or a part thereof (e.g., brown rice). The present disclosure also achieves the effect of improving the yield of the edible part of the plant body. For example, in one example, with water volume adjustment (e.g., water management (3 weeks before and after heading, 3 days of flooding and 4 days of draining, intermittent irrigation repeated 6 times in total, 3 draining times; 3 times of 4-day draining to avoid rain based on weather forecasts) which can be considered as other methods, excessive water conservation may cause a decrease in brown rice yield and quality, and in paddy fields with poor drainage, it is necessary to aim to reduce the arsenic concentration in brown rice by adjusting the number of draining days, which requires a great deal of effort for delicate water volume adjustment and work management. However, the method of the present disclosure does not require such laborious water volume adjustment, while still maintaining quality. This allows for the provision of high-quality crops. It also suppresses the rise in cadmium concentration that can occur when soil dries out too much during the drainage period, a problem that has been a problem in fields with a high cadmium risk. Furthermore, the composition of the present disclosure can be applied only when weather conditions that pose a risk of arsenic accumulation, such as high temperatures during ripening, are predicted, effectively suppressing rising labor and production costs due to increased agricultural work and rising material costs. Arsenic concentration reduction techniques such as the application of iron and silicate materials (steelmaking slag: 2 t / 10a, zero-valent iron: 1 t / 10a) are also unnecessary. [Brief explanation of the drawings]
[0007] [Figure 1] FIG. 1 shows the results of Example 2, and the average amount of arsenic accumulated in brown rice grown in a greenhouse on two separate occasions was used, with the value of the amount untreated with an anti-transpiration component set at 1.
[0008] [Figure 2] Figure 2 shows the results of RNAseq analysis using PDJ-treated spikelets. The expression levels of heavy metal transport proteins in each control are shown as 1. [Figure 3]Figure 3 shows the effect of paraffin-containing fertilizer on arsenic accumulation during foehn damage. The median total arsenic concentration (inorganic arsenic and total arsenic) in control brown rice is shown as 1. Control: foehn treatment, Paraffin: foehn treatment + paraffin-containing fertilizer application, Nt: untreated. DETAILED DESCRIPTION OF THE INVENTION
[0009] The present disclosure will be described below. Throughout this specification, singular expressions should be understood to include the plural concept unless otherwise specified. Therefore, singular articles (e.g., "a," "an," "the," etc. in English) should be understood to include the plural concept unless otherwise specified. Furthermore, it should be understood that terms used in this specification are used in the sense commonly used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will prevail.
[0010] (definition) As used herein, "about" means ±10% of the value that follows.
[0011] As used herein, the term "plant" is used in the broadest sense in the art to refer to an entity that engages in life phenomena, and refers to an entity that lives without moving, by photosynthesis. Plants typically have various characteristics such as cell structure, proliferation (self-reproduction), growth, regulation, metabolism, and repair ability, and typically have as basic attributes proliferation involving genetics governed by nucleic acids and metabolism governed by proteins. The plant may be either an angiosperm or gymnosperm cell, or either a dicotyledonous or monocotyledonous plant cell, or either a herbaceous or woody plant. Examples of herbaceous plants include cereal plants, turfgrasses, and vegetables, and examples of woody plants include evergreen broadleaf trees, deciduous broadleaf trees, and the like. Specific examples of horticultural crops include, but are not limited to, rice, wheat, barley, corn, grapes, apples, pears, peaches, cherries, persimmons, citrus fruits, soybeans, green beans, strawberries, potatoes, cabbage, lettuce, tomatoes, cucumbers, eggplants, watermelons, sugar beets, spinach, snow peas, pumpkins, sugarcane, tobacco, bell peppers, sweet potatoes, taro, konjac, cotton, sunflowers, tulips, chrysanthemums, and lawn grass. Furthermore, the term "plant" as used herein refers to all parts of the plant. In this specification, preferably, such a plant is fertile. More preferably, such a plant is capable of producing seeds. It is understood that the compositions and methods of the present disclosure can be applied to any plant that has leaves.
[0012] As used herein, a "part of a plant" may refer to a specific part of a plant, such as a stem, leaf, root, seed, flower, or fruit, or may refer to a combination of multiple organs including a stem, leaf, seed, etc. A part of a plant may include above-ground parts (e.g., leaves, stems, and nodes, or leaves, stems, nodes, and panicles), underground parts, etc.
[0013] As used herein, the term "seed" refers to a substance that stores nutrients for the germination of young plants and is used for agricultural propagation. Specific examples include grains such as rice, corn, cottonseed, wheat, and barley, millet, foxtail millet, finger millet, barnyard millet, annual millet, sorghum, Job's tears, oats, and rye, as well as sunflower seeds, pumpkin seeds, legumes, and rapeseed seeds.
[0014] As used herein, the term "edible parts of crops" refers to edible parts such as seeds of cereals and fruits of fruit trees. The term "edible parts of crops" is a concept that mainly encompasses seeds and fruits.
[0015] As used herein, "aerial parts" refers to parts of a plant that include leaves and stems during vegetative growth and leaves, stems, inflorescences, and flowers during reproductive growth. For example, in grasses, the "aerial parts" during vegetative growth consist of leaves, stems, and nodes, while the "aerial parts" during reproductive growth consist of leaves, stems, nodes, and panicles (rachises and spikelets).
[0016] In the present disclosure, a plant may be an edible part of a plant other than a seed. For example, a plant part may be the fruit of a vegetable such as a tomato, cucumber, eggplant, snow pea, pumpkin, or bell pepper. Alternatively, a plant part may be a leafy vegetable such as spinach, mizuna, or nozawana. A plant part may also be an edible underground part such as taro, potato, sweet potato, konjac, lotus root, or lily root. A plant or part thereof used in the present disclosure may also be inedible. A plant or part thereof may be a bulb such as a seed potato, lily, or tulip, or a seed bulb such as a scallion. The subject of the present disclosure may also be a part of a plant used for feed or as a material. Examples include grains such as rice, corn, cottonseed, wheat, and barley, and the above-ground parts, underground parts, and seeds of grass family cereals such as pearl millet, foxtail millet, common millet, finger millet, barnyard millet, annual millet, sorghum, Job's tears, oats, and rye. Materials may also include rice husks and rice straw. In terms of the cultivation stage, if the stems and leaves are used as feed, they can be called "above-ground parts in the vegetative growth stage."
[0017] Examples of the turfgrass include grasses (e.g., subfamily Sphagnum (e.g., turfgrasses or Bermuda grasses), subfamily Festucinae (e.g., bentgrasses, bluegrasses, fescue, or ryegrass), or subfamily Panicum), turfgrasses of the Cyperaceae family, and turfgrasses of the Asteraceae family. Examples of the cereal plants include grasses such as rice, rye, barley, wheat, millet, sorghum, sugarcane, corn / popcorn, and Job's tears. Examples of the vegetables include plants of the Solanaceae family (e.g., tobacco, eggplant, potato, tomato, or chili pepper), plants of the Chenopodiaceae family (e.g., spinach, sugar beet, etc.), plants of the Fabaceae family (e.g., soybean, adzuki bean, pea, etc.), plants of the Brassicaceae family (e.g., rapeseed, arugula, etc.), and plants of the Pesamomeae family (e.g., sesame).
[0018] Examples of the evergreen broad-leaved trees include eucalyptus, acacia, and coffee, and examples of the deciduous broad-leaved trees include poplar, oak, willow, birch, and oak.
[0019] The method of the present disclosure is also useful for plants generally known as ornamental plants (e.g., plants of the Agavaceae, Araceae, Palmaceae, Araliaceae, Moraceae, Asclepiadaceae, Acanthaceae, Apocynaceae, Aragonaceae, Cupressaceae, Rutaceae, Bombacaceae, Pandanaceae, Musaceae, Euphorbiaceae, Oleaceae, Commelinaceae, Bromeliaceae, Crassulaceae, Russaceae, Salicaceae, ferns, etc.).
[0020] Among such plants, plants of the Gramineae family, Chenopodiaceae family, Leguminosae family, Cruciferae family, eucalyptus, acacia, and poplar are preferred, and cells of rice, wheat, barley, sugarcane, sugar beet, soybean, rapeseed, sesame, eucalyptus, and poplar are particularly preferred, with rice, wheat, and barley being more preferred, and rice being most preferred, but the plants are not particularly limited as long as the accumulation of heavy metals can be reduced.
[0021] As used herein, "heavy metal accumulation" refers to the accumulation of heavy metals (e.g., arsenic) or compounds containing heavy metals in a part or the whole of a plant. Heavy metal accumulation can vary in concentration depending on the organ of the plant. For example, it is known that heavy metals tend to accumulate in the roots and nodes of rice. As used herein, "heavy metals" refers to cadmium, lead, mercury, chromium, arsenic, selenium, tin, and antimony, which are non-essential elements not naturally required by plants. These heavy metals can be toxic to the cytoplasm. "Inhibition of heavy metal accumulation" refers to the reduction of the accumulation of any one of these heavy metals, not necessarily the reduction of all heavy metals. In the present disclosure, heavy metals whose accumulation is reduced preferably include, but are not limited to, arsenic. Because plants or parts thereof that accumulate large amounts of heavy metals can have adverse effects on humans or animals when consumed, it is preferable to reduce the accumulation of heavy metals in plants or parts thereof as much as possible. By using the technology of the present disclosure, even if a plant is grown in soil contaminated with these heavy metals, heavy metals are less likely to accumulate.
[0022] As used herein, the term "anti-transpiration component" refers to any component that, when applied to all or part of a plant (e.g., leaves, panicles, etc.), inhibits water transpiration compared to when the component is not applied. The anti-transpiration effect may be a direct result of the component, or, if the component is a gene or the like, may be achieved by a gene product or the like that is expressed as a result of application or incorporation into the plant.
[0023] In one embodiment, the transpiration suppression effect evaluated by the method for confirming the transpiration suppression effect of the present disclosure is increased by 20% or more, preferably 50% or more, more preferably 65% or more, and most preferably 80% or more, compared to a plant not treated with the transpiration suppression component of the present disclosure. The transpiration suppression component may be in the form of a liquid, fine powder, paste, or the like, but other formulations may also be used as long as they do not impair the stability of the active ingredient contained in the transpiration suppression component of the present disclosure and can be used in the use examples described below.
[0024] As used herein, the term "spreading component" refers to a component with spreading properties that affect the physicochemical properties of sprayed pesticides, such as spreading, emulsification, solubilization, dispersion, suspension, penetration, adhesion, and defoaming. Spreading components are adjuvants that promote the adhesion of solid granules to target surfaces, such as leaves, and can be applied to the target surface, thereby achieving dual functionality: controlled release and specific surface adhesion. Spreading components can be dispersed in water for spraying onto agricultural substrates, and the water may contain additional components that improve the properties of the sprayable solution. Spreading components can be considered components that increase the effectiveness of the main pesticide on each crop compared to when it is not used, and each experimental data can be evaluated relatively (denoted by ◎, ○, ×, or △). For example, a spreading component is an adjuvant that reduces the surface tension of the solution when dissolved to 72.8 dynes / cm (water) or less, preferably 45 dynes / cm or less.
[0025] Spreading components are generally divided into (1) spreaders (components (surfactants) that reduce the surface tension of the spray liquid), (2) functional spreading components (adjuvants; agents that increase penetration), (3) adhesive spreading components (stickers; agents that stick the spray liquid, such as paraffin and resin acid esters), and (4) others, but the ones preferably used in this disclosure may be adhesive spreading components.
[0026] A fixing spreading component refers to a component that has the property of increasing fixing property, contains paraffin or resin ester as a main component, or the like, and increases the residual effect of the target component, and representative examples of such agents include paraffin preparations such as Greener, Avion C, Steckel, and Betan V, as well as KK Sticker and Tomono Spray Sticker. Those skilled in the art can understand the criteria for fixing property by referring to Plant Protection Vol. 63, No. 4 (2009) and Agriculture and Horticulture Vol. 89, No. 2, pp. 241-246 (2014).
[0027] Alternatively, in this specification, technical judgments of "spreadability," "transpiration suppression," and "adhesion" can be made based on agents such as Spray Sticker (polyoxyethylene resin acid ester) and Greener, whose numerical values and effects are published, and generally, judgments can be made by using polyoxyethylene resin ester as dispersibility △, solubilization rate △, and adhesion 〇, or by absolute values. For example, polyoxyethylene resin ester can be evaluated as dispersibility △, solubilization rate △, and adhesion 〇. For example, in the case of Spray Sticker, whose active ingredient is polyoxyethylene resin ester, the surface tension of the main agent alone, 72 dynes / cm, can be reduced to 44 dynes / cm. For example, paraffin agents can be evaluated as having adhesion 〇. In this case, for example, in the case of Greener, whose active ingredient is paraffin, treatment with Greener can prevent the death of camphor tree seedlings.
[0028] In this specification, the term "spreadable anti-transpiration component" refers to any agent that has spreadability and an anti-transpiration effect, and is a spreading component that has an anti-transpiration effect.
[0029] As used herein, the terms "hormone," "plant hormone," and "plant hormone-acting anti-transpirant component" are used interchangeably and refer to any factor that can act on a plant or plant hormone (e.g., have an effect on growth), and include not only those produced by plants but also those artificially synthesized, as well as plant growth regulators. Hormones include, but are not limited to, auxins, cytokines, abscisic acid (ABA), jasmonic acid or its derivatives, gibberellins, ethylene, brassinosteroids, and polyamines. Hormones that can be used in the present disclosure include abscisic acid, jasmonic acid, their derivatives, factors that induce them (such as melatonin, which induces abscisic acid or jasmonic acid, and systemin, which induces jasmonic acid), their genes, gene products, or derivatives thereof.
[0030] As used herein, "alkane hydrocarbons" refer to saturated hydrocarbons and may include any of linear, branched (in these cases, represented by the formula CnH2n+2), and cyclic hydrocarbons. In the present disclosure, alkane hydrocarbons may include various polymers, including paraffins (e.g., normal paraffins, isoparaffins, cycloparaffins, etc.).
[0031] In this specification, "paraffin" (broadly defined) or "paraffins" refers to a type of hydrocarbon compound (organic compound) generally consisting of alkanes (linear, branched, or cyclic saturated hydrocarbons) with 15 or more carbon atoms, usually 20 or more. They are also referred to as paraffin wax. Paraffins may include normal paraffin, isoparaffin, cycloparaffin, etc., and are typically translucent to white, soft solids (wax-like) at room temperature, insoluble in water, and chemically stable. Typically, paraffins with 15 or more carbon atoms are preferred, although those with 60 or less carbon atoms may be used. In a typical example, the components are primarily mixtures of normal paraffins with 20 or more carbon atoms, and the melting point varies depending on the application. Liquid paraffin may also be used in this disclosure. Paraffin is typically a colorless, non-volatile liquid at room temperature, insoluble in water, chemically stable, and does not oxidize under normal conditions. It contains more olefinic hydrocarbons than solid paraffins. It is easily emulsified and has excellent spreadability and permeability. Purity is measured by ultraviolet light absorbance. Liquid paraffin has many names, including nujol, white oil, white mineral oil, water paraffin, mineral oil, mineral oil white, medicinal paraffin, paraffin fax, saxol, USP mineral oil, adepsine oil, albolene, and glymol. Among paraffins, those with a linear carbon skeleton are called normal paraffins (n-paraffins). In this disclosure, the term "paraffin" may refer to normal paraffins. Hydrocarbons with a cyclic structure are sometimes referred to as cycloparaffins, and the term cycloparaffin is used to refer to hydrocarbons with 20 or fewer carbon atoms, and is synonymous with cycloalkanes.
[0032] Examples of agents containing normal paraffin include Avion C, Avion E, Karwax, and Steckel.
[0033] In this specification, "isoparaffin" refers to a branched paraffin in the broad sense. Examples of agents containing isoparaffin include Greener and Moisture.
[0034] Examples of drugs containing cycloparaffin include Greener and Moisture.
[0035] As used herein, "cellulose" refers to water-compatible cellulose such as water-compatible cellulose hydroxylpropylmethylcellulose. Examples of cellulose-containing drugs include Cellcoat Agri and 64 Never.
[0036] As used herein, "resin ester" or "polyoxyethylene resin acid ester" refers to any ester having a polyoxyethylene structure. Polyoxyethylene resin acid esters are adhesive spreading components and are used as adjuvants for pesticide application. Examples include Neocosterin and KK Sticker.
[0037] As used herein, "plant spraying" refers to spraying a target component directly onto a plant. Plant spraying may involve primarily spraying the target component onto the plant, with small amounts of the component incidentally being sprayed into the environment. In plant spraying, for example, the effect intended by the present disclosure can be achieved by directly applying the target component to the plant. Examples of plant spraying methods include, but are not limited to, directly applying the anti-transpiration component, spraying the target component onto the underside of leaves, and spraying the anti-transpiration component over the entire plant, including the ears, after ear emergence. Specifically, plant spraying can be considered a concept that encompasses foliar spraying, floral spraying, flower spike spraying, tree spraying, and the like.
[0038] As used herein, "environmental spraying" refers to spraying a target component into the environment surrounding a plant. Environmental spraying may involve primarily spraying the target component into the environment, with a small amount of the component being incidentally sprayed onto the plant. In environmental spraying, for example, the effect intended by the present disclosure may be achieved by spraying the target component into the environment. Examples of environmental spraying methods include spraying into the environment of a plant, but also include, but are not limited to, soil treatment in which the component is applied directly into the soil in advance, and base application in which the component is sprayed at the base of the plant. Environmental spraying can be considered a concept that includes water surface spraying, soil spraying, base spraying, irrigation water spraying, etc.
[0039] The composition of the present disclosure may be used in any formulation that can be used as a pesticide, and for example, dust, DL dust, FD (flow dust), granule, jumbo, dust granule, fine granule, fine granule, powder, wettable powder, flowable sol (SC), water dispersible granule, dry flowable water-soluble powder, water-soluble granule, emulsifiable concentrate, EW (exhaustive water) formulation, liquid, ME liquid, oil, surf formulation, aerosol, paste, fumigant, fumigant, microcapsule, or pack may be used.
[0040] As used herein, the term "liquid preparation" refers to a drug that is provided in a liquid state at room temperature.
[0041] As used herein, "dust" refers to a formulation in which the pesticide active ingredient is diluted with fine mineral powder such as clay, and if necessary, an anti-decomposition agent is added to form a fine powder of, for example, 45 μm or less. It refers to a formulation to be used as is. Formulations that use a bulking agent with a reduced amount of fine powder of 10 μm or less to reduce drift (drift), and further use a flocculant to aggregate the mixed fine powder and make it less likely to drift, are also called DL dusts. DL stands for Drift Less. Formulations that are made into ultra-fine powder of 2 μm or less to increase the time they remain suspended in the air, and are designed to be sprayed from outside the greenhouse and distributed evenly throughout, are also called FD agents or flow dusts.
[0042] In this specification, "granules" refers to pesticides that are solid at room temperature and supplied in granular form. Under the Agricultural Chemicals Control Act, these are fine granules with a particle size of 300–1700 μm and are intended for use as is. They come in various shapes depending on the manufacturing method, including types in which the pesticide active ingredient is kneaded into mineral matter such as clay (primarily cylindrical), and types in which the active ingredient is impregnated into porous mineral matter (primarily fine sand-like). Larger particle sizes are also available in pellet or tablet form. In this specification, "jumbo formulations" are registered granules under the Agricultural Chemicals Control Act. They are available in 50g tablets (tablets) and packs containing granules, tablets, or powder wrapped in 50g water-soluble film. 10–20 of these formulations are dropped into rice paddies from the ridges per 10 ares. Since no spraying equipment is required, they are highly labor-saving. Most of them are herbicides.
[0043] As used herein, "wettable powder" refers to a powdery formulation that dissolves in water and is used by suspending it in water, and when the prepared solution is left to stand, it precipitates. As used herein, "flowable agent" refers to a formulation in which the active ingredient is made into fine particles (average particle size 1 to 5 μm) and dispersed in a liquid with an appropriate surfactant.
[0044] In this specification, the term "water-soluble" refers to a water-soluble powder, granule, or other preparation that is dissolved in water. Since the active ingredient is completely soluble in water, no precipitation occurs in the preparation.
[0045] In this specification, "emulsifiable concentrate" refers to an oily liquid formulation in which a poorly water-soluble agricultural chemical active ingredient is dissolved in an organic solvent and an emulsifier is added. Some formulations are treated as hazardous materials. They are used in an emulsified state after being diluted with water.
[0046] In this specification, "microencapsulated formulation" refers to a formulation containing capsules in which the pesticide active ingredient is uniformly coated with a polymer membrane or the like. Encapsulation enhances the durability of the ingredient's effectiveness and reduces inhalation toxicity, phytotoxicity, and paint contamination. The appearance of the formulation is liquid, similar to that of a flowable formulation.
[0047] In this specification, "aerosol" refers to a mixture of tiny liquid or solid particles suspended in air and the surrounding gas, and is a spray agent contained in a can (cylinder) that sprays the ingredients using the internal gas pressure. It is easy to use.
[0048] As used herein, "aquatic plants" refers to plants whose roots are immersed in water during their normal life cycle. Examples include floating plants, floating-leaf plants, submerged plants, emergent plants, and wetland plants. They can be freshwater, brackish, or seawater, but freshwater is preferred. "Floating plants" refer to plants whose roots are exposed to the water rather than extending to the bottom, with the entire plant body floating on the water surface. Examples include plants of the Lemnaceae family, such as duckweed (Lemna aoukikusa) and duckweed (Lemna minor), and plants of the Pontederiaceae family, such as water hyacinth (Eichhornia crassipes). "Floating-leaf plants" refer to plants whose roots extend to the bottom and whose leaves float on or near the water surface. Examples include plants from the Nymphaeaceae family, such as Nymphaea tetragona and Brasenia schreberi, plants from the Trapaceae family, such as Trapajaponica, and plants from the Menyanthaceae family, such as Nymphoides peltata. "Submerged plants" refer to plants that have roots on the water bottom and whose entire plant body is below the water surface. Examples include plants from the Hydrocharitaceae family, such as Hydrillaverticillata, plants from the Potamogetonaceae family, such as Potamogeton crispus, and algae from the Charophyceae family, such as Charabraunii.
[0049] As used herein, the term "emergent plants" refers to plants that have roots on the water bottom and upper parts of the plant body, such as leaves and stems, that extend above the water surface. Examples of such plants include plants of the Poaceae family, such as rice (Oryza sativa), water hyacinth (Zizania latifolia), and common reed (Phragmites australis), plants of the Nelumbonaceae family, such as lotus (Nelumbonucifera), plants of the Nymphaeaceae family, such as water lily (Nuphar japonicum), and plants of the Typhaceae family, such as cattail (Typhalatifolia). As used herein, the term "hygrophyte" refers to a plant that lives in places where its roots can be submerged in water, such as wetlands or around rivers or ponds, but where the majority of the plant body, excluding the roots and rhizomes, is not submerged in water. Examples of such plants include plants of the Lythraceae family, such as Lythrum anceps, plants of the Orchidaceae family, such as Habenaria radiata, and plants of the Iridaceae family, such as Irispseudacorus.
[0050] As used herein, "stomatal closure" refers to the closure of stomata in a plant, which can be observed microscopically. As used herein, "stomatal opening regulatory component" refers to a component that regulates the stomatal opening mechanism. Regarding stomatal opening, blue light activates the proton pump on the guard cell membrane, which causes intracellular hyperpolarization, increases osmotic pressure, and causes water to flow into the cell, resulting in a decrease in cell volume and an increase in stomatal opening. Therefore, a stomatal opening regulatory component can be said to regulate the activation and inactivation of the proton pump on the guard cell membrane, thereby regulating stomatal opening. The compounds disclosed in WO2018 / 062036 are proposed as plant stomatal opening regulatory components and may be employed in the present disclosure.
[0051] (Preferred embodiment) Preferred embodiments of the present disclosure will be described below. The embodiments provided below are provided for a better understanding of the present disclosure, and it is understood that the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that those skilled in the art can make appropriate modifications within the scope of the present disclosure by referring to the description in this specification. It is also understood that the following embodiments of the present disclosure can be used alone or in combination.
[0052] The embodiments described below are all comprehensive or specific examples. The numerical values, shapes, materials, components, component placement and connection configurations, steps, and step order shown in the following embodiments are merely examples and are not intended to limit the scope of the claims. Furthermore, among the components in the following embodiments, components that are not described in the independent claims that represent the highest concepts are described as optional components.
[0053] (Use of transpiration inhibitors) In one aspect, the present disclosure provides a composition for inhibiting heavy metal accumulation in a plant or a part thereof.
[0054] In another aspect, the present disclosure provides a composition for improving the yield of edible parts of a crop.
[0055] In a typical aspect, the composition of the present disclosure includes an anti-transpirant. The anti-transpirant used in the present disclosure may be a plant-spreading anti-transpirant or a hormonal anti-transpirant. The composition of the present disclosure may be provided in a form ready to use as a diluted solution, or may be provided as a concentrated solution or concentrate (also referred to herein as a stock solution) intended to be diluted at or before use. Therefore, when the composition of the present disclosure is provided as a stock solution, it can be provided as a diluted solution by diluting it with an appropriate dilution medium (e.g., water, an organic solvent (e.g., alcohol), a mixture thereof, etc.).
[0056] Without wishing to be bound by theory, in one preferred embodiment of the present disclosure, the transient application of a highly safe anti-transpiration component inhibits the translocation of heavy metals such as arsenic from underground parts to aboveground parts of the plant body, such as brown rice, thereby reducing the accumulation of heavy metals such as arsenic in plant body parts such as brown rice. For example, the anti-transpiration component may be a plant hormone analogue that induces stomatal closure, i.e., a hormonal anti-transpiration component. This invention is based in part on the discovery that spreadable anti-transpiration components, such as isoparaffin and paraffin agents that physically block stomata, can also be used. Unlike conventional techniques, for example, this component can be applied only when weather conditions that pose a risk of arsenic accumulation, such as high temperatures during ripening, are predicted, potentially reducing labor and material costs.
[0057] In a preferred embodiment of the present disclosure, the anti-transpirant component is a plant-spreadable anti-transpirant component or a plant hormone-acting anti-transpirant component, and in a preferred embodiment, the spreadable anti-transpirant component may be a sticking spreadable component.
[0058] Any adhesive spreading component can be used, but preferably, it is a component whose main component is paraffin or cellulose, which has the property of coating parts of the plant body such as the leaf surface or panicle and suppressing transpiration. Commercially available drugs containing such adhesive spreading components include Greener and Avion C.
[0059] In one embodiment, plant-adherent anti-transpiration components used in the present disclosure include, but are not limited to, alkane hydrocarbons, cellulose, and the like.
[0060] Specific examples of plant-spreading transpiration inhibiting components include alkane-based substances in the broad sense, such as (normal) paraffin, isoparaffin, and cycloparaffin, and cellulose, and may also be fatty acid esters.
[0061] In one embodiment of the present disclosure, isoparaffins and cycloparaffins may be used more preferably than normal paraffins. Without wishing to be bound by theory, it is believed that isoparaffins and cycloparaffins have smaller and finer crystals than paraffin wax (normal paraffin), and thus coat plant surfaces more efficiently.
[0062] In one embodiment, the plant-spreading anti-transpirant component of the present disclosure can be an alkane hydrocarbon having a number average molecular weight of from about 300 to about 1000, or from about 15 to about 60 carbon atoms.
[0063] In another embodiment, the hormonal antidesiccant component of the present disclosure may be abscisic acid, jasmonic acid, or a derivative thereof, or a component that induces these. Examples of components (inducers) that induce abscisic acid, jasmonic acid, etc. include melatonin and systemin. Without wishing to be bound by theory, abscisic acid binds to the abscisic acid receptor present in guard cells, inducing the production of reactive oxygen species within the cells, which activates calcium and potassium channels, resulting in intracellular depolarization and a decrease in osmotic pressure, causing water to flow out of the cells and a decrease in cell volume, resulting in stomatal closure. Similarly, jasmonic acid binds to the jasmonic acid receptor present in guard cells, inducing the production of reactive oxygen species within the cells, which activates calcium and potassium channels, resulting in intracellular depolarization and a decrease in osmotic pressure, causing water to flow out of the cells and a decrease in cell volume, resulting in stomatal closure.
[0064] In another embodiment, the anti-transpirant component or composition of the present disclosure is for application to plants or for application to the environment.
[0065] For application to plants, it is preferably provided as a liquid agent containing a spreading component such as a surfactant or emulsifier, and used as such. For foliar application to plants, it is effective to spray on the underside of the leaf, which has many stomata. For foliar application, it may contain an adjuvant that is retained on the leaf surface. Such an adjuvant may include a surfactant.
[0066] For environmental spraying, slow-release components are preferably used that are applied at low concentrations in paddy fields or soil. Since environmental spraying is expected to be primarily absorbed through the roots, it can be carried out by hand spraying from the product bag, mechanical spraying using a manual sprayer, a power sprayer, or an unmanned helicopter, soil treatment, or application at the base of the plant. For environmental spraying, it may contain an adjuvant that promotes absorption through the roots.
[0067] The compositions of the present disclosure may take any dosage form, including, for example, liquids, granules, flowables, jumbo formulations, emulsions, suspensions, dispersions, pastes, fine powders, dusting materials, powders and microcapsules, aerosols, and the like.
[0068] In one embodiment, the target heavy metal accumulation of the present disclosure is characterized by being suppressed at least in a part of the plant selected from the group consisting of leaves and seeds, and preferably, but not limited to, both leaves and seeds. Other parts where heavy metal accumulation is suppressed include nodes, roots, stems, glumes, rachises, etc.
[0069] In a preferred embodiment, the heavy metal to be inhibited by the present disclosure is arsenic. Arsenic is widely distributed in nature and has been considered difficult to remove. By using the method of the present disclosure, arsenic accumulation can be inhibited using a simple method similar to conventional pesticide spraying.
[0070] In one embodiment, the plant subject of the present disclosure includes a monocotyledon. While not wishing to be bound by theory, monocotyledonous plants (e.g., cereals) tend to accumulate heavy metals, but are difficult to remove. The method of the present disclosure can be used to inhibit accumulation in such plants. The terminal rot may be a cereal. Examples of monocotyledonous plants include, but are not limited to, families such as Poaceae, Palmaceae, Liliaceae, Araceae, Liliaceae, Musaceae, and Zingiberaceae.
[0071] In another embodiment, the plant comprises a grass family plant, which may include, but is not limited to, rice, wheat, barley, corn, sugarcane, sorghum, oats, and foxtail millet.
[0072] In one embodiment, the plant subject of the present disclosure includes an aquatic plant. Aquatic plants are often found in environments where heavy metals, particularly arsenic, are likely to accumulate, but inhibiting this accumulation is often difficult. The technology of the present disclosure exhibits excellent effects, even in the sense that it can inhibit accumulation in such plants. Aquatic plants include, for example, marsh plants that literally grow near water or in wetlands. They germinate at the bottom of the water and may grow completely submerged or in an emerged state for long periods of time. Examples of aquatic plants include submerged plants, whose entire plant is submerged, floating plants, floating plants that float on the water surface without roots in the soil at the bottom, and emerged plants, whose leaves and stems emerge above the water. Most are freshwater plants, often belonging to angiosperms and ferns, but may also include mosses and, due to morphological similarities, charophytes. Submerged plants include, but are not limited to, monocotyledonous plants such as the Penicillaceae and Potamogetonaceae, and dicotyledonous plants such as the Cramboraceae and the Aragonaceae families, including, but not limited to, water hyacinth, baikama, Vallisneria, water plantain, subtilis, Ebimosa, britannica, birdweed, water shield (cabomba), Elodea canadensis, etc. Floating-leaf plants are plants whose roots are attached to the bottom and whose leaves float on the water surface, including, but not limited to, water lilies, water hyacinths, water shields, water lilies, water chestnuts, water hyacinths, pondweed, horse chestnuts, water spurge, etc. Floating plants include those whose bodies float on the water surface and whose roots do not attach to the bottom, such as the Duckweed family, water hyacinth, Pistia crassifolia, the aquatic ferns Azolla and Salvinia nigra, and the bryophyte Duckweed biloba. Emergent plants are those whose roots are underwater and whose stems and leaves extend above the water surface, and among the water lilies and water lilies there are both floating-leaf and emergent species, and some are floating-leaf at first but become emergent as they grow well, such as lotus, wild rice, reed, water chestnut, Chinese laurel, water lily, water lily, arrowhead, Sagittaria pygmaea, pearl lilies, calamus, cattails, iris, Monochoria kannagi, and Three-leaved lily.
[0073] In a preferred embodiment, the plant subject to the present disclosure may be rice. Accumulation of heavy metals such as arsenic has been considered a problem in some rice plants both in Japan and overseas, but the present disclosure can address this issue. In particular, the present disclosure suppresses the amount of transpiration from plants such as rice plants around the heading stage, thereby reducing the amount of heavy metals such as arsenic translocated to parts such as rice panicles, and suppressing the concentration of heavy metals such as arsenic in parts of rice grains where the heavy metals accumulate.
[0074] In one embodiment, the plant part of the present disclosure may include a seed.
[0075] In a preferred embodiment, a hormone agent is preferably used in rice. Alternatively, a paraffin agent is also considered to be effective for leaves in the vegetative growth stage.
[0076] Alternatively, in another preferred embodiment, in the case of grains such as brown rice, it is considered appropriate to spray from before heading to three weeks after heading, when arsenic accumulation increases. Without wishing to be bound by theory, a certain degree of effect is also observed during the reproductive growth period, so spraying from the reproductive growth period to maturity is also preferable. In the case of grains such as brown rice, it is believed that the amount of accumulation increases when temperatures are high (above 30°C) two weeks after flowering. Furthermore, the spraying time may be adjusted appropriately depending on the temperature before, during, and after flowering. In the case of fruits, spraying during the reproductive growth period may be preferable, as this is the time when the fruit begins to swell.
[0077] (Method using anti-transpiration ingredients) In another aspect, the present disclosure provides a method for inhibiting the accumulation of heavy metals, such as arsenic, in a plant. In yet another aspect, the present disclosure provides a method for improving the yield of edible parts of a crop in a plant. Typically, the method of the present disclosure includes, for example, a step of applying an anti-transpirant component to the plant. It is understood that the anti-transpirant component used in the method of the present disclosure can employ any of the embodiments included in the section (Uses of Anti-Transpirant Component). In one embodiment, the present disclosure provides a composition containing an anti-transpirant component as a ready-to-use liquid (also referred to herein as a diluted liquid), and the anti-transpirant component may be applied as is. Alternatively, in another exemplary embodiment, when the anti-transpirant component is provided as a concentrated liquid in the present disclosure, the method may include a step of diluting the concentrated liquid with an appropriate dilution medium (e.g., water, an organic solvent (e.g., alcohol), a mixture thereof, or the like) at or before use.
[0078] In one embodiment, the transpiration-inhibiting component can be applied by any method, including, for example, manual application from a product bag, mechanical application using a manual sprayer, a power sprayer, an unmanned helicopter, hand-wave spraying, a power sprayer, or a drone, etc.
[0079] When using the transpiration-suppressing component of the present disclosure, it is desirable to adjust the spraying time and investigate the appropriate concentration in advance depending on the plant species.
[0080] (formulation) In the practice of the present disclosure, formulations are prepared by known methods, for example, by diluting the active substance with a solvent and / or carrier, optionally using emulsifiers and dispersants. A suitable solvent / auxiliary agent is typically water (as an aqueous solution, suspension, etc.). However, other solvents / auxiliaries may also be used, such as aromatic solvents (e.g., Solvesso products, xylene), alcohols (e.g., methanol, butanol, pentanol, benzyl alcohol), ketones (e.g., cyclohexanone, γ-butyrolactone), pyrrolidinones (NMP, NOP), acetates (glycol diacetate), glycols, fatty acid dimethylamides, fatty acids, and fatty acid esters. In principle, solvent mixtures may also be used.
[0081] The present disclosure may also include carriers such as natural minerals (e.g., kaolin, clay, talc, chalk) and synthetic minerals (e.g., highly dispersed silica, silicates), which may be preferably used, particularly for environmental application.
[0082] The present disclosure also provides lignin sulfonic acid, phenol sulfonic acid, naphthalene sulfonic acid, and dibutylnaphthalene sulfonic acid, as well as alkali metal, alkaline earth metal, and ammonium salts of fatty acids, alkyl aryl sulfonates, alkyl sulfates, alkyl sulfonates, fatty alcohol sulfates, fatty acid and sulfated fatty alcohol glycol ethers, as well as sulfonated naphthalene and naphthalene derivatives with formaldehyde condensates, naphthalene or naphthalene sulfonic acid with phenol and formaldehyde condensates, polyoxyethylene octylphenol ethers, ethoxylated isooctylphenol, octylphenol, or nonylphenol. Surface-active substances such as alcohol, alkylphenol polyglycol ether, tributylphenyl polyglycol ether, tristearylphenyl polyglycol ether, alkylaryl polyether alcohol, isotridecyl alcohol, alcohol and fatty alcohol / ethylene oxide condensates, ethoxylated castor oil, polyoxyethylene or polyoxypropylene alkyl ethers, ethoxylated polyoxypropylene, lauryl alcohol polyglycol ether acetate, sorbitol esters, lignosulfite waste liquor, methylcellulose, and siloxanes (e.g., polyether / polymethylsiloxane copolymers) may also be used. When producing directly sprayable solutions, emulsions, pastes or oil dispersions, the inert formulation adjuvants may essentially comprise medium- to high-boiling mineral oil fractions such as kerosene or diesel oil, as well as coal tar oil, and oils of vegetable or animal origin, aliphatic, cyclic and aromatic hydrocarbons such as toluene, xylene, paraffins, tetrahydronaphthalene, alkylated naphthalenes or their derivatives, alcohols such as methanol, ethanol, propanol, butanol and cyclohexanol, ketones such as cyclohexanone and isophorone, strongly polar solvents such as dimethyl sulfoxide, N-methylpyrrolidone or water.
[0083] Dusts, sprinkleable materials and dusts can be prepared by mixing or co-grinding the active substances with solid carriers.
[0084] Granules, for example coated granules, impregnated granules and uniform granules, can be prepared by binding the active substances to solid carriers.
[0085] Examples of solid carriers are silica gel, silicates, talc, kaolin, attaclay, limestone, lime, chalk, bolus, loess, clay, dolomite, diatomaceous earth, minerals such as calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials, fertilizers (e.g., ammonium sulfate, ammonium phosphate, ammonium nitrate, urea), and plant-derived products (such as grain meals, bark meals, wood meals, and nutshell meals), cellulose powder, and other solid carriers.
[0086] Typically, formulations contain the anti-desiccating ingredient of the present disclosure in an amount of 0.01 to 95% by weight, preferably 0.1 to 90% by weight, based on the total weight of the formulation. Alternatively, any intermediate range, such as 10 to 70% or 10 to 50%, may be used. Paraffins are often used at about 10 to 50% (e.g., Greener (paraffin 10% or more, moisture 30%, Avion C 36%, Petain V 42%)), and hormone agents are often used at about 1 to 10% (e.g., jasmomate (PDJ 5%)). Polyoxyethylene resin esters may be used at about 50 to 90% (e.g., KK Sticker 70%).
[0087] When a formulation for dilution aqueous solution is used in the present disclosure, for example, a water-soluble concentrate, a dispersible concentrate, an emulsifiable concentrate, an emulsion, a suspension, a water-dispersible and water-soluble granules, and a water-dispersible and water-soluble powder may be used. A product (formulation) for direct application may be, for example, a fine dust, a granule, or an ULV liquid. A water-based formulation can be prepared from a concentrate formulation such as a concentrated solution, an emulsifiable concentrate, a suspension, a paste, a wettable powder (spray powder, oil dispersion), or a water-dispersible granule by adding water, and can be applied, for example, by spraying.
[0088] (Cultivation method) When cultivating plants such as rice using the composition of the present disclosure, conventional cultivation methods can be used. For example, the information described at https: / / www.jeinou.com / benri / rice / index.html can be used as a reference for the cultivation method. (Rice Cultivation Guidelines, compiled by Niigata Prefecture Department of Agriculture, Forestry and Fisheries. -- Niigata Prefecture Department of Agriculture, Forestry and Fisheries Publishing, 2021.)
[0089] Preferably, the composition of the present disclosure is applied to cultivated plants such as rice from the reproductive stage to the maturity stage, or when high temperatures are expected.
[0090] Of the compositions of the present disclosure, wax agents (paraffins) and cellulose agents are preferably applied to the underside of leaves or panicles in the cultivation of plants such as rice.
[0091] Preferably, the composition of the present disclosure is advantageously applied by spraying in the cultivation of plants such as rice, but is not limited thereto. It is desirable to optimize the spraying time and spray concentration depending on the plant species, and those skilled in the art can appropriately optimize them based on the description in this specification.
[0092] In one aspect, the present disclosure provides a plant cultivation method comprising applying an anti-transpiration component to a plant. In one embodiment, the anti-transpiration component of the present disclosure may be applied once or multiple times at any time between the panicle formation stage and maturity stage or during the vegetative growth stage. When the target to which the anti-transpiration component of the present disclosure is applied is a plant having an edible part, applying the anti-transpiration component of the present disclosure at any time between the panicle formation stage and maturity stage can suppress the accumulation of heavy metals in the edible part (e.g., seeds) of the plant. Furthermore, when the target to which the anti-transpiration component of the present disclosure is applied is a plant that uses the entire plant or a part of it as a resource or material, applying the anti-transpiration component of the present disclosure during the vegetative growth stage can suppress the accumulation of heavy metals in the entire plant or a part of it.
[0093] By using the method of the present disclosure when cultivating rice, the rate of whole grain rice obtained can be improved compared to when the method of the present disclosure is not used. As used herein, "whole grain" refers to grains from which damaged grains, dead rice, immature grains, foreign grains, and foreign objects have been removed. "Whole grain rate" refers to the percentage of whole grains in the total rice obtained, where percentage refers to the weight ratio to the total amount.
[0094] (Note) In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when it is stated that "within a range of two values," the range includes the two values themselves.
[0095] All references cited herein, including scientific literature, patents, patent applications, and the like, are incorporated by reference in their entirety to the same extent as if each were specifically set forth.
[0096] The present disclosure has been described above by showing preferred embodiments for ease of understanding. The present disclosure will be described below based on examples. However, the above description and the following examples are provided for illustrative purposes only and are not intended to limit the present disclosure. The present invention will be further described in detail below by reference examples, examples, and test examples. However, these are provided for illustrative purposes only and do not limit the present disclosure. The compound names shown in the following reference examples and examples do not necessarily conform to IUPAC nomenclature. Abbreviations may be used to simplify the description, but these abbreviations have the same meanings as those described above. The scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but is limited only by the claims. [Example]
[0097] Where necessary, the handling of organisms used in the following examples was in accordance with the standards established by the Japanese government or the National Agriculture and Food Research Organization. While the reagents used were specifically those listed in the examples, equivalent products from other manufacturers (e.g., SIGMA-ALDRICH, Wako Pure Chemical Industries, Ltd., Nacalai Tesques, Kanto Chemical, etc.) can also be used.
[0098] Example 1: Effects of jasmonic acid analogue (prohydrojasmone (PDJ)) on rice In this example, the suppression of arsenic accumulation in brown rice by prohydrojasmone (PDJ) was confirmed.
[0099] Climate change caused by global warming is a serious problem in the agricultural sector. It has been reported that high temperatures during the ripening period of paddy rice increase the accumulation of arsenic, a harmful substance, in the grain. Transpiration is one of the factors that contribute to arsenic accumulation, and it is thought that this induces arsenic absorption and translocation, leading to increased accumulation in brown rice. Meanwhile, jasmonic acid, a plant hormone, is known to induce stomatal closure in cooperation with abscisic acid. Therefore, in this study, we investigated the arsenic accumulation-suppressing effect of prohydrojasmone (PDJ), a jasmonic acid derivative, using the super-high-yielding rice variety Hokuriku 193.
[0100] (material and method) Twenty Hokuriku 193 plants at the panicle formation stage were sprayed with 12 mL of 2000-fold diluted PDJ (final concentration: 98.3 μM) per plant at the field site of the National Agriculture and Food Research Center's Hokuriku Research Center. Flowering, fruiting, and seed collection were conducted under conventional cultivation. The PDJ concentrate consisted of 5% by weight PDJ, 33% by weight isopropanol, and 30% by weight polyoxyethylene (6) sorbitan tetraoleate, and was diluted 2000-fold with water before use. A control solution was also prepared by diluting the solvent alone (30% polyoxyethylene (6) sorbitan tetraoleate, 33% isopropanol, and 37% water) 2000-fold. The control plants were sprayed in the same manner as the PDJ treatments, and flowering, fruiting, and seed collection were conducted under conventional cultivation. The PDJ-treated and control brown rice was ground using a grinder (Yasui Machinery, Multi-Beads Shocker, MB301) to obtain rice flour, and 0.5 g of each rice flour was used to measure the arsenic concentration in the brown rice using ICTMS (Micromass, Manchester, UK). The quality of the brown rice used in the study was also examined using a grain classifier (Shizuoka Seiki, Virgo ES1000).
[0101] (Results and Discussion) 1. Arsenic accumulation in brown rice Statistical analysis of the inorganic arsenic content in brown rice from three rows and four plants (n = 12), excluding the plants in the center of the field, showed that the median arsenic concentration in brown rice was reduced by approximately 4.4% in the PDJ treatment compared to the control. In addition, both the maximum and minimum arsenic concentrations were reduced in the PDJ treatment compared to the control.
[0102] 2.Quality Survey Results A quality study was conducted on brown rice harvested from the 12 strains used in the arsenic accumulation study. The PDJ treatments showed a higher grain size distribution than the control. This was due to a decrease in damaged grains, but the number of immature grains remained the same (Table 1).
[0103] [Table 1] Table 1 shows the basic statistics for strains 1 to 4. The results of the PDJ treatment and the control were tested by Dunnett's test, and there was a significant difference in the size distribution rate (*p<0.05) (PDJ; PDJ treatment; PDJ C; control).
[0104] No clear correlation was found between the grain size distribution rate and inorganic arsenic accumulation. Furthermore, even when seeds collected from the center of the field were included in the analysis, an increase in the grain size distribution rate due to PDJ treatment was confirmed.
[0105] From the above, it was confirmed that PDJ treatment improved brown rice quality and had a slight effect of suppressing arsenic accumulation. Since there is a correlation between rice quality and arsenic accumulation, this also confirmed the reduction in arsenic accumulation. It is thought that the improvement in brown rice quality depends on the reduction in damaged grains.
[0106] (Example 2: Effect of Grinner on rice) In this example, the suppression of arsenic accumulation in brown rice by Greener was confirmed.
[0107] Methods and Materials Indica cultivar Takanari was transplanted into 15 cm pots containing 350 g of nursery soil and grown in a greenhouse under natural photoperiod conditions, either at room temperature (27 / 25°C day / night) or at elevated temperature (34 / 29°C day / night). Two to three weeks after heading, 100 mL of water containing 0.05 mg / L arsenic trioxide was applied per pot. Just before application of arsenic trioxide, a 10-fold diluted Greenner solution was sprayed onto the pot. Greenner is a plant coating agent primarily composed of microcrystalline wax, a spreading and adhesive component, and is commercially available from Greenner Co., Ltd. 5 mL of the solution was applied to each plant, three times every seven days. Mature seeds were collected from 20 plants, and the brown rice was crushed. 0.5 g of rice flour was used to measure the arsenic concentration in the brown rice using ICTMS (Micromass, Manchester, UK). Control plants were sprayed with tap water used for dilution.
[0108] (result) When the rice was sprayed with a diluted solution of a plant coating agent (Greener) containing microcrystalline wax, which is a sticky, spreading, and transpiration-suppressing component, the amount of arsenic accumulated in brown rice was reduced by about 20% compared to untreated rice at both room temperature and high temperature.
[0109] (Example 3: Example in a paddy field (1)) In paddy fields, from the panicle formation stage to maturity, rice plants are sprayed with 12 mL of 2000-fold diluted PDJ (final concentration 98.3 μM) per plant on the day before a maximum temperature forecast of over 30°C is predicted. This can be done multiple times if necessary. Spraying is carried out using an appropriate manual sprayer, power sprayer, unmanned helicopter, drone, etc. As a result, it is predicted that the arsenic concentration in brown rice will decrease.
[0110] (Example 4: Example in paddy field (2)) In general rice paddies, from the panicle formation stage to the maturity stage, a few weeks before a maximum temperature forecast of over 30°C is predicted, 2000-fold diluted PDJ (final concentration 98.3 μM) is sprayed on the paddy fields. The spraying is carried out using an appropriate method, such as hand spraying, a powered sprayer, an unmanned helicopter, or a drone. As a result, it is predicted that the arsenic concentration in brown rice will decrease.
[0111] (Example 5: Example in paddy field (3)) In paddy fields, from the panicle formation stage to maturity, a diluted spreadable anti-transpiration compound is sprayed onto rice the day before a weather forecast predicts a maximum temperature of over 30°C. This can be done several times if necessary. Spraying is carried out using an appropriately selected manual sprayer, powered sprayer, unmanned helicopter, drone, etc. Spraying should be carried out on the underside of the leaves as much as possible, and after heading, the entire panicle. As a result, it is predicted that the arsenic concentration in brown rice will decrease.
[0112] (Example 6: Examples of various dosage forms: liquid) In this example, a liquid formulation is described. PDJ is sprayed on ordinary paddy fields in an environmental environment from the panicle formation stage to the maturation stage, several weeks before weather forecasts predict that the maximum temperature will exceed 30°C. The spraying is carried out using an appropriate method such as hand spraying, power sprayer, unmanned helicopter, or drone. After heading, the entire panicle is sprayed. As a result, it is predicted that the arsenic concentration in brown rice will decrease.
[0113] (Example 7: Examples of various dosage forms: powder) This example describes the implementation with a powder. In conventional rice paddies, granules containing PDJ are sprayed at the base of plants from the panicle formation stage to maturity several weeks before a weather forecast predicts a maximum temperature of over 30°C. The spraying is carried out by hand or using an appropriately selected powered sprayer. As a result, it is predicted that arsenic concentrations in brown rice will decrease. Alternatively, by applying it to the soil at a low concentration, it is predicted that arsenic concentrations in the entire plant will decrease throughout the cultivation period.
[0114] (Example 8: Examples of various dosage forms: Jumbo dosage form) In this example, implementation with a jumbo formulation is described. In general rice paddies, a jumbo formulation containing PDJ is applied several weeks before a weather forecast predicts that the maximum temperature will exceed 30°C from the panicle formation stage to the maturity stage. As a result, it is predicted that the arsenic concentration in the brown rice will decrease. Alternatively, by applying it to the soil at a low concentration, it is predicted that the arsenic concentration in the entire plant will decrease throughout the cultivation stage.
[0115] Example 9: Gene Expression Analysis In this example, gene expression analysis was carried out after treatment with prohydrojasmone. Conventionally grown, the common cultivar Hinohikari was transplanted into 1 / 5000a Wagner pots at the time of panicle differentiation, and on the 16th day after heading, 20 mL of 2.00-fold diluted PDJ (Jasmomate, Meiji Seika Pharma Co., Ltd., Japan) was sprayed into each pot. Total RNA was extracted from spikelets that had been left standing overnight in an artificially conditioned room at 32 / 28°C (day / night), and RNAseq analysis was performed. As a control, plants sprayed with a 2,000-fold diluted solution of the solvent were used.
[0116] RNASeq analysis is as follows. Total RNA was extracted from the spikelets, which were left overnight after PDJ treatment, and a library was prepared using the KAPA Stranded mRNA-Seq Kit (KAPABIOSYSTEMS). PCR amplification was performed using 14 cycles, and adapters from the Fast Gene Adapter Kit (Fast Gene) were used. The quality of the prepared library was confirmed using the Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical Technologies), and sequencing was performed using a NextSeq500 with 2x76bp conditions. The resulting reads were quality checked using Sickle (ver. 1.33), and reads with a length of less than 20 bases were removed. Reads with a fragment length of 30 bases or less and their paired reads were discarded. The filtered reads were mapped to the reference sequence (The Rice Annotation Project Database http: / / rapdb.dna.affrc.go.jp / download / irgsp1.html) using Hisat2 (ver. 2.1.0), and a bam file was generated using Samtools (ver. 1.3). Read sequences that mapped to genic regions were counted using featureCounts (ver. 1.5.0p3). After normalization using the iDEGES normalization method, differentially expressed genes were identified using DESeq.
[0117] The sequences of the primers used are as follows: (Primer sequences used in library construction) (index ligation) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATGAAGCGTTGCAACTCCTTGGCTCACA (SEQ ID NO: 1) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACGTGCGATCCCAACTCCTTGGCTCACA (SEQ ID NO: 2) MGI Tech Co.,Ltd Tech. Support Center Field Application Support Team Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCGGAAGGCACAACTCCTTGGCTCACA (SEQ ID NO: 3) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACCGATGTCGCCAACTCCTTGGCTCACA (SEQ ID NO: 4) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTTAGAATGCAACTCCTTGGCTCACA (SEQ ID NO: 5) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCCAAGCCTGCAACTCCTTGGCTCACA (SEQ ID NO: 6) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGACGATGATCAACTCCTTGGCTCACA (SEQ ID NO: 7) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGTCTCGTGTCAACTCCTTGGCTCACA (SEQ ID NO: 8) Ad153Ω_Bottom_2: TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 9) (PCR amplification) Ad153_PCR2_2: TGTGAGCCAAGGAGTTG (SEQ ID NO: 10) Ad153_PCR2_1: / 5Phos / GAACGACATGGCTACGA (SEQ ID NO: 11) (sequence) Read 1 sequencing primer: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 12) Read 2 sequencing primer: TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 13) (adapter sequence) Read 1 side: AAGTCGGAGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO: 14) Read 2 side: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG (SEQ ID NO: 15)
[0118] The results are shown in Figure 2. The expression level of the control heavy metal transport protein is set to 1. These results indicate that gene products related to heavy metal accumulation are suppressed.
[0119] (Example 10: Effect of fertilizer containing paraffin on rice) In this example, we confirmed that the use of paraffin-containing fertilizer Culwax to prevent foehn damage in rice inhibits arsenic accumulation in brown rice.
[0120] Methods and Materials Japonica cultivar Koshihikari was grown in pots and sprayed with 20 ml of paraffin-containing fertilizer, Calwax (Avion Corporation, 15% paraffin), on panicles 11–12 days after heading. After spraying, the seeds were treated with foehn (temperature 32.8°C, humidity 56.8%, wind speed 7 m / s, FTP 56.8) for 24 hours, and then allowed to ripen in a climate chamber at 26 / 24°C (day / night). After ripening, the seeds were harvested and ground using a grinder (Yasui Machinery, Multi-Bead Shocker, MB301) to obtain rice flour. Arsenic concentrations in the brown rice were measured using 0.5 g of rice flour using ICTMS (Micromass, Manchester, UK). Controls included brown rice treated with foehn only and untreated brown rice.
[0121] (Results and Discussion) Arsenic accumulation in brown rice Analysis of total arsenic concentrations in brown rice from plots treated with paraffin-containing fertilizer and foehn (n=9) and from the foehn-treated plot (control, n=9) revealed higher arsenic concentrations in the foehn-treated plots compared to the untreated plots (n=2). Statistical analysis using each arsenic concentration revealed a significant median decrease of approximately 13% in the paraffin-containing fertilizer Culwax-treated plots compared to the control (foehn-treated). The maximum and minimum values also decreased (Figure 3).
[0122] (Note) While the present invention has been illustrated by way of preferred embodiments thereof, it is understood that the scope of the present invention should be construed solely in terms of the claims that follow. It is understood that the patents, patent applications, and other documents cited herein are incorporated by reference in their entirety as if the contents themselves were specifically set forth herein. [Industrial Applicability]
[0123] The present disclosure finds application in fields related to cultivation techniques for plants such as rice, and is particularly applicable in situations where standard values for heavy metals such as arsenic in grains are being established. [Sequence List Free Text]
[0124] SEQ ID NO: 1: Primer sequence for index ligation SEQ ID NO: 2: Primer sequence for index ligation SEQ ID NO: 3: Primer sequence for index ligation SEQ ID NO: 4: Primer sequence for index ligation SEQ ID NO: 5: Primer sequence for index ligation SEQ ID NO: 6: Primer sequence for index ligation SEQ ID NO: 7: Primer sequence for index ligation SEQ ID NO: 8: Primer sequence for index ligation SEQ ID NO: 9: Primer sequence for index ligation SEQ ID NO: 10: PCR amplification primer sequence SEQ ID NO: 11: PCR amplification primer sequence SEQ ID NO: 12: Sequencing primer sequence SEQ ID NO: 13: Sequencing primer sequence SEQ ID NO: 14: Adapter sequence SEQ ID NO: 15: Adapter sequence
Claims
1. A composition for inhibiting the accumulation of heavy metals in a plant body or a part thereof, the composition comprising an anti-transpiration component, the composition being in the form of a solution, the solution having a surface tension of 45 dynes / cm or less, the heavy metal being arsenic, and the anti-transpiration component being a sticky spreading component.
2. A composition for inhibiting the accumulation of heavy metals in edible parts of a plant, the composition comprising an anti-transpiration component, the composition being in the form of a solution, the solution having a surface tension of 45 dynes / cm or less, the heavy metal being arsenic, and the anti-transpiration component being a sticky, spreading component.
3. 2. The composition according to claim 1, wherein the plant-spreadable anti-transpirant component is selected from the group consisting of alkane hydrocarbons, natural celluloses, and polyoxyethylene resin acid esters.
4. The composition according to claim 1 , wherein the plant-spreading anti-transpiration component is a paraffin.
5. 2. The composition according to claim 1, wherein the plant-spreadable anti-transpiration component is selected from the group consisting of normal paraffins, isoparaffins, and cycloparaffins.
6. 2. The composition according to claim 1, wherein the transpiration inhibiting component is an alkane hydrocarbon having a number average molecular weight of 300 or more and 1,000 or less, or having 15 or more and 60 or less carbon atoms.
7. The composition according to any one of claims 1 to 6, which is for application to plants or for application to the environment.
8. The composition according to any one of claims 1 to 7, which is in a dosage form selected from the group consisting of a liquid, a granular, and a microcapsule.
9. 9. The composition according to any one of claims 1 and 3 to 8, wherein the accumulation of heavy metals is inhibited at least in a part of the plant selected from the group consisting of leaves and seeds.
10. 10. The composition of any one of claims 1 and 3 to 9, wherein the heavy metal is arsenic.
11. The composition according to any one of claims 1 to 10, wherein the plant body is a monocotyledonous plant.
12. A composition for inhibiting the accumulation of a heavy metal in a plant or a part thereof, the composition comprising an anti-transpiration component, wherein the plant is a monocotyledon, the heavy metal is arsenic, and the anti-transpiration component is a sessile spreading component.
13. The composition according to any one of claims 1 to 12, wherein the plant is a cereal.
14. The composition according to any one of claims 1 to 13, wherein the plant is a grass plant.
15. The composition according to any one of claims 1 to 14, wherein the plant body is an aquatic plant.
16. The composition according to any one of claims 1 to 15, wherein the plant body is an emergent plant or a wetland plant.
17. The composition according to any one of claims 1 to 16, wherein the plant body is rice.
18. The composition according to any one of claims 1 to 17, which is for spraying on plants.
19. The composition of any one of claims 1 to 18, wherein the plant part comprises a seed.
20. A composition for inhibiting heavy metal accumulation in plant seeds, the composition comprising an anti-transpirant, wherein the heavy metal is arsenic, and the anti-transpirant is a sessile spreading component.
21. A method for inhibiting accumulation of a heavy metal in a plant body or a part thereof, the method comprising the step of applying an anti-transpiration component to the plant body or a part thereof, wherein the anti-transpiration component is in the form of a solution having a surface tension of 45 dynes / cm or less, the heavy metal is arsenic, and the anti-transpiration component is a sticky spreading component.
22. A method for inhibiting the accumulation of heavy metals in edible parts of a plant, comprising the step of applying an anti-transpirant to the plant, wherein the heavy metal is arsenic and the anti-transpirant is a sessile spreading component.
23. 23. The method according to claim 21 or 22, wherein the plant body is rice, and the anti-transpiration component is applied to the rice once or a plurality of times at any time point between the panicle formation stage and the maturity stage or during the vegetative growth stage.
24. 23. The method of claim 21 or 22, wherein the anti-transpirant component is applied one or more times during the vegetative growth period.
25. A method for inhibiting accumulation of a heavy metal in a plant or a part thereof, the method comprising the step of applying an anti-transpirant to the plant or a part thereof, wherein the plant is a monocotyledon, the heavy metal is arsenic, and the anti-transpirant is a sessile spreading component.
26. 1. A method for inhibiting heavy metal accumulation in seeds of a plant, comprising the step of applying an anti-transpirant to panicles containing ripening seeds, wherein the heavy metal is arsenic and the anti-transpirant is a sessile spreading component.