COMPOSITIONS FOR THE TREATMENT AND / OR PREVENTION OF CELL AND / OR TISSUE NECROSIS SPECIFICALLY TARGETING CATHEPSIN C AND / OR CELA1 AND / OR CELA3A AND / OR ENZYMES STRUCTURALLY RELATED THERETO - Patent application

Abstract

To provide inhibitor compounds and agents of Cathepsin C, CELA1, CELA3A and / or structurally related molecules thereto, compositions comprising the same and uses thereof in the inhibition and / or prevention of cell and / or tissue necrosis.SOLUTION: Presented are, for example, 3,4-bis((2-(pyrrolidine-1-yl)ethyl)amino)-1,2,5-thiadiazole 1,1-dioxide; cyclopropyl (2-(5-isopropylisoxazol-3-yl)pyrrolidin-1-yl)methanone; 6-bromo-2-(3,5-dimethoxyphenyl)-4benzo[d][1,3]oxazin-4-one 6-methyl-5-((2-methylpiperidin-1-yl)sulfonyl)pyrimidine-2,4(1H,3H)-dione, etc.SELECTED DRAWING: None

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. Provisional Patent Application No. 62 / 143,821 filed April 7, 2015, and U.S. Provisional Patent Application No. 62 / 143,821 filed June 4, 2015. The benefit of U.S. Provisional Patent Application No. 62 / 170,717 is claimed, both of which are incorporated by reference in their entireties. Incorporated here as.

[0002] FIELD OF THE INVENTION The present invention, in some embodiments, provides a method for treating and / or preventing cell necrosis. and more particularly to compositions and methods for inhibiting intracellular cathepsin C and / or CE. Downregulation of the expression of LA1 and / or CELA3A and / or their structurally related targets and / or inhibiting the activity of the steroid hormone, thereby preventing or treating cell necrosis. [Background technology]

[0003] Necrosis is considered to be a unique process of cell and tissue death. Necrosis is differentiated from programmed cell death (apoptosis). Characterized by digestion and destruction of plasma and organelle membranes. The first stage is caused by extensive DNA hydrolysis, vacuolization of the endoplasmic reticulum, organelle disintegration, and cell lysis. The release of intracellular contents after cell membrane rupture is the cause of the inflammation seen in necrosis. Necrosis has long been considered a random pathological mode of cell death; however, Recent studies have provided several lines of evidence indicating that necrosis is a regulated process. was done.

[0004] Apoptosis, unlike necrosis, is energy dependent. They are characterized by specific modes of enzyme activation and DNA cleavage; however, both processes is not present in necrosis.

[0005] Cell death is a process that leads to a point of no return. For example, hepatocytes subjected to total ischemia For the cells, cell death occurred at approximately 150 minutes, a time that varied little in histological sections. Necrosis is only fully developed after 12 to 24 hours. The cells die long before any necrotic changes can be seen by optical microscopy.

[0006] There are many causes of necrosis, including injury, ischemia, anoxia, infarction, infection, These include prolonged exposure to cancer, poisons, venom, and inflammation. For example, necrosis can occur due to the application of This can result from a lack of proper care.

[0007] Necrosis also contributes to several diseases, including myocardial infarction, stroke, liver cirrhosis, and other potentially fatal diseases. Heart failure is one of the leading causes of death in the Western world and is associated with the development of cardiac muscle It is characterized by the loss of muscle cells (cardiomyocytes). It is well established that necrotic cell death plays an important role in this process.

[0008] Early and aggressive surgical debridement and exploratory incision of necrotic tissue, hyperbaric oxygen therapy, high Pressure oxygen therapy, antibiotics, anti-inflammatory drugs, and intravenous immunoglobulin were administered. There are currently several existing treatments for necrosis, including: It has been used with partial success and partial failure, causing significant morbidity and mortality. Death due to complications.

[0009] There are many causes of necrosis, including injury, ischemia, anoxia, infarction, infection, These include prolonged exposure to cancer, poisons, venom, and inflammation. For example, necrosis can occur due to the application of Necrosis can also result from myocardial infarction, stroke, cirrhosis of the liver, and other potential It is involved in the pathology of several serious diseases, including fatal diseases. It is one of the leading causes of death in the Western world. Heart failure, one of the diseases, is characterized by the loss of cardiac muscle cells (cardiomyocytes). It is well established that necrotic cell death plays an important role in vacuole loss.

[0010] Additionally, necrotic processes are associated with preserving harvested organs and tissues prior to transplantation. In particular, this process contributes to the deterioration of cardiac tissue during storage of donor hearts. Other examples include skin flaps, kidneys, livers and other tissues. Necrosis also contributes to cytotoxicity to healthy tissue during chemotherapy. Get involved. Summary of the Invention [Problem to be solved by the invention]

[0011] Currently, the only treatment for necrosis is hyperbaric oxygen therapy. It is not a drug treatment for death itself, which is why there is significant morbidity resulting from complications of necrosis. This is the reason for the high mortality and high mortality rates.

[0012] Certain elastases, which catalyze the degradation of proteins, have been implicated in necrotic cell death. Treatment of diseased cells with certain (neutrophil elastase) inhibitor compounds has been shown to The technique is based on the idea that such inhibitors are produced in vitro at several hundred microns. When used at low molar concentrations, it prevented / treated cell necrosis (International Publication No. WO2003079969).

[0013] These early findings are encouraging, given the breadth of family members, but are devastating. the difficulty in predefining high-affinity inhibitors that would be effective in preventing / treating death; and elastase family members are effective targets for the treatment and prevention of necrosis. The lack of understanding of its role and its ideal treatment remains elusive to this day. is. [Means for solving the problem]

[0014] Overview of the invention The present invention relates to the inhibition of the expression and / or activity of certain elastase-like proteases. The surprising finding that the control provides highly effective prevention and treatment of cell and tissue necrosis Surprisingly, cathepsin C, CELA1, CELA3A or other structurally related Specific inhibition of the molecules involved prevents and / or treats cell and / or tissue necrosis.

[0015] In particular, the present invention provides, inter alia, for the discriminatory identification of a series of highly specific targets. In some embodiments, they are proteolytic enzymes, and in some embodiments, In such cases, elastase activity may also be exhibited, and as described herein, compounds, agents and In some embodiments, the present invention provides a method for the prevention of flu-like symptoms, and compositions for the prevention of flu-like symptoms. Specific in vitro inhibition with the described compounds is greater than previous elastase inhibitors. It is provided at concentrations several orders of magnitude lower and is effective in preventing and / or treating and / or halting / eliminating necrosis. It was surprisingly effective.

[0016] In some embodiments, such enhanced affinity can be achieved by incorporating a composition, as described herein. For more specific target identification for applications in products, methods, uses, agents and compounds Related.

[0017] In certain aspects, such enhanced affinity may be achieved in some embodiments by: Distinct subunits of active enzymes in necrotic pathways serve as highly effective therapeutic targets. Reflects the identity of the set.

[0018] In some embodiments, such enhanced affinity reduces cell and tissue necrosis. Identifying a class of targets with activity distinct from previously identified targets for application in Related to identification.

[0019] Thus, the present invention provides, inter alia, a method for treating cell and tissue necrosis and diseases associated therewith. The present invention provides a method for administering and preventing cathepsin C to a subject in need thereof. , CELA1, CELA3A, or structurally related enzymes. by administering an effective amount of an agent that inhibits the

[0020] Such agents may inhibit the activity of cathepsin C, CELA1, CELA3A, or structurally related enzymes. The expression and / or activity of the polynucleotides may be specifically inhibited, as further described herein. and, as further described herein, a nucleotide or polypeptide inhibitor. The compound may be a chemical compound that is

[0021] In some embodiments, the present invention provides a compound of formula I: [ka] Formula I It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted piperidine, a substituted or Unsubstituted piperazine, substituted or unsubstituted imidazolidine, or substituted or unsubstituted pyrazolidine Gin; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted substituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl or a substituted or unsubstituted heterocycle; or Formula II: [ka] Formula II It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted pyridine, a substituted or unsubstituted Substituted aryl, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazolidine or substituted or unsubstituted pyrazolidine; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted substituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl or a substituted or unsubstituted heterocycle; or Formula III: [ka] Formula III It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted pyridine, a substituted or unsubstituted Substituted aryl, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazolidine or substituted or unsubstituted pyrazolidine; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl or a substituted or unsubstituted heterocycle; or Next: 3,4-bis((2-(pyrrolidin-1-yl)ethyl)amino)-1,2,5-thiadiazole 1,1-di oxide; Cyclopropyl(2-(5-isopropylisoxazol-3-yl)pyrrolidin-1-yl)methyl Tanon; 6-Bromo-2-(3,5-dimethoxyphenyl)-4-benzo[d][1,3]oxazin-4-one 6-Methyl-5-((2-methylpiperidin-1-yl)sulfonyl)pyrimidine-2,4(1H,3H) -Zion; N-methyl-4,5,6,7,8,9-hexahydro-1H-cycloocta[c]pyrazole-3-carboxamide Do; 2-(5-(pyridin-4-yl)-2H-tetrazol-2-yl)acetic acid; 2-(furan-2-yl)-5,6,7,8-tetrahydro-4H-benzo[4,5]thieno[2,3-d][1,3]oxo Sazin-4-one; 3-((5-acetamido-1H-1,2,4-triazol-3-yl)thio)propanoic acid; N,N'-(oxybis(4,1-phenylene))bis(2-methylpropanamide); 7-(4-ethylpiperazin-1-yl)-5,6-dimethyl-[1,2,4]triazolo[1,5-a]pyrimidin hmm; 7-Fluoro-10-(2-(4-isopropylpiperazin-1-yl)-2-oxoethyl)-2,3-di Hydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepine-5,11(10H,11aH)-dione; 2-(tert-butyl)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-4-oxo-4H- Chromene-7-ilpivalate; 3-methyl-8-(piperidin-1-yl)-1H-purine-2,6(3H,7H)-dione; 2-(3-Bromophenyl)-4-oxo-4H-benzo[d][1,3]oxazin-6-yl acetate; N-(1-ethyl-3,5-dimethyl-1H-pyrazol-4-yl)-3,4,5-trimethoxybenzamide Do; 5-Ethyl-N-(pyridin-2-ylmethyl)-5H-[1,2,4]triazino[5,6-b]indole-3- amines; 3-((4-chloro-1H-pyrazol-1-yl)methyl)-N-(2-(3-fluorobenzamide) Ethyl)-1,2,4-oxadiazole-5-carboxamide; 1-(4-(methylthio)benzyl)-4-tosylpiperazine; 2-(2-ethylphenylsulfonamido)-5-(4-ethylpiperazin-1-yl)benzoic acid; 4((2-methylindolin-1-yl)sulfonyl)benzoic acid; 6-Bromo-2-(3,5-dimethoxyphenyl)-4H-benzo[d][1,3]oxazin-4-one; 2-amino-N-(2,4-difluorophenyl)pyrimidine-5-sulfonamide; 3-methyl-8-(piperidin-1-yl)-1H-purine-2,6(3H,7H)-dione; 5-chloro-N-(2-oxo-1-phenylpyrrolidin-3-yl)thiophene-2-sulfonamide ; 3-(Pyrrolidin-1-ylsulfonyl)benzoic acid; (3,5-dimethyl-1H-pyrazol-1-yl)(3,4,5-trimethoxyphenyl)methanone; N-(3,4-difluorophenyl)-2-(8-fluoro-5,11-dioxo-2,3,11,11a-tetrahydro- Doro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-10(5H)-yl)acetamide; 5-(cyclohexylmethyl)-3-(pyridin-2-yl)-1,2,4-oxadiazole; Ethyl 5-methyl-4-(2-((4-methylbenzyl)amino)-2-oxoethyl)-7-phenyl 4,7-dihydro-[1,2,4]triazolo[1,5-a]pyrimidine-6-carboxylate; [1,2,4]Triazolo[1,5-a]pyrimidine-2-carboxylic acid; 1-(2-(piperidin-1-yl)-4,5-dihydro-1H-imidazol-1-yl)butan-1-one ; (4-(6-chloro-[1,2,4]triazolo[4,3-a]pyridin-3-yl)piperazin-1-yl)(1 -phenylcyclopropyl)methanone; N-(2,4-difluorophenyl)-2-(5,11-dioxo-2,3,11,11a-tetrahydro-1H-benzo[a]phenyl] Zo[e]pyrrolo[1,2-a][1,4]diazepin-10(5H)-yl)acetamide; and Ethyl-2,3-dihydro-3-oxo-1,2-benzisothiazole-2-acetate-1,1-diox or a pharmaceutical salt thereof, or any combination thereof. Compounds for use in the treatment or prevention of cell or tissue necrosis or diseases associated therewith. The present invention provides a compound for use in

[0022] Pharmaceutical compositions containing compounds as defined immediately above also constitute an embodiment of this invention. It should be understood that

[0023] This invention describes a first medical use of the compound as defined immediately above, and this use It should be understood that also constitute embodiments of the present invention.

[0024] The invention further provides a method for treating cell or tissue necrosis or a disease or condition associated therewith. and a method for preparing a pharmaceutical composition comprising administering to a subject an effective amount of a compound as defined immediately above, or a pharmaceutical composition comprising the same. administering a substance to a subject in need thereof or attaching diseased cells or tissues thereto and contacting the tissue with the cell to treat cell or tissue necrosis or conditions associated therewith. Provide a method for placing

[0025] The present invention also provides an effective amount of a compound as defined immediately above or a pharmaceutical composition containing same. Treating a disease or condition associated with cell or tissue necrosis occurring in a subject The present invention provides a method for the manufacture of a medicament for use in a pharmaceutical composition comprising administering to a subject a pharmaceutical composition comprising the steps of:

[0026] In some embodiments, this is achieved by using embodied compounds as described herein. This is the first demonstrated medical use of, and the same is contemplated by the present invention. In some embodiments, the compounds or compounds structurally related thereto as described herein are The compound specifically inhibits the activity of cathepsin C, CELA1, CELA3A, or structurally related enzymes. These compounds possess a defined activity that specifically inhibits the production of steroid hormones, and are an envisioned embodiment of this invention.

[0027] In some embodiments, the compounds of the invention inhibit cathepsin C, CELA1, CELA3A or are structurally related enzymes, or Kd 10 -7 M or lower minimum It is defined by its selective binding to those combinations for which it has affinity. In some embodiments, the compounds of the invention inhibit CELA2A, CELA3B, or cathepsin A, B, D, E. , G, H, K, L1, L2, O, S, W or Z or a combination thereof, which may In an embodiment, Kd 10 -6 Due to its less selective binding to those showing minimal affinity above M It is stipulated that:

[0028] In some embodiments, the present invention provides a method for treating a rheumatoid arthritis, comprising administering to a subject a rheumatoid arthritis, a rheumatoid arthritis, or .... In some embodiments, the present invention provides a method for treating a rheumatoid arthritis, comprising administering to a subject a rh In some embodiments, the composition comprises a compound described herein. In some embodiments, the present invention includes an effective amount of any combination of any of the compounds described herein or any single compound described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier or excipient.

[0029] According to some embodiments of the present invention, the pharmaceutical composition is designed to penetrate cell membranes. It is prescribed.

[0030] According to some embodiments of the present invention, the pharmaceutical composition comprises lipid vesicles.

[0031] In some embodiments, the composition further comprises an anti-apoptotic or anti-aging agent. According to some embodiments of the present invention, the anti-aging agent may be an antioxidant, a phytochemical, a hormone, or a combination thereof. The active ingredient is selected from the group consisting of acetaminophen, metformin and fatty acids.

[0032] In some embodiments, the present invention provides a method for detecting cathepsin C, CELA1, CELA3A, or a compound having a structure similar to that of the cathepsin C. and (iii) an inhibitor agent of a target enzyme, wherein the agent is an antisense, si From the group consisting of RNA, microRNA, Ribozyme, and DNAzyme The polynucleotides selected are SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36.

[0033] In some embodiments, the CELA3A, CELA1, or cathepsin C inhibitor agent is a poly and the polynucleotide agent is a nucleotide selected from SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0034] In some embodiments, the CELA3A, CELA1, or cathepsin C inhibitor agent is a poly and the polynucleotide agent is a nucleotide that is a nucleotide sequence of a CELA1 or CELA3A sequence or a sequence thereof. and hybridizes specifically to the combination of Hybridization to CELA2A or CELA3B sequences under stringent (stringent) hybridization conditions. Do not zoom.

[0035] In some embodiments, the CELA3A, CELA1, or cathepsin C inhibitor agent is a poly The polynucleotide agent is a nucleotide that specifically hybridizes to cathepsin C. and under moderate to stringent hybridization conditions. Does not hybridize to psin A, B, D, E, G, H, K, L1, L2, O, S, W, or Z.

[0036] In some embodiments, the CELA3A, CELA1, or cathepsin C inhibitor agent is a poly The polynucleotide agent is a polynucleotide having a nucleic acid sequence represented by SEQ ID NO:1. In some embodiments, CELA3A, CELA4A, CELA5A, CELA6A, CELA7A, CELA8A, CELA9A, CELA10A, CELA11A, CELA12A, CELA13A, CELA14A, CELA15A, CELA16A, CELA17A, CELA18A, CELA19A, CELA11B, CELA11C, CELA12C, CELA13A, CELA14A, CELA15B, CELA16C, CELA17C, CELA18A, CELA19A, CELA19B, CELA19C, CELA19C, CELA19D, CELA19E, CELA19F, CELA19H, CELA19H, CELA19I, CELA19I CELA1, or cathepsin C, inhibitors are polynucleotides, and the polynucleotides The nucleotide sequence of the nucleotide sequence represented by SEQ ID NO:2 is at least 95% identical to the polynucleotide sequence represented by SEQ ID NO:2. In some embodiments, CELA3A, CELA1, or cathepsin C inhibitors are The polynucleotide agent is a polynucleotide, and the polynucleotide agent is a nucleic acid represented by SEQ ID NO:3. The polynucleotides share at least 95% identity with the nucleic acid sequence.

[0037] In some embodiments, the invention provides any polynucleotide as described herein. Nucleic acid constructs comprising the inhibitor agents are provided.

[0038] In some embodiments, the invention provides CELA3A, CELA1, or cathepsin C inhibitors. and a method for treating a leukemia, the method comprising administering to a patient a therapeutically effective amount of a leukemia virus ... , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: The present invention relates to a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23. Antibodies that specifically bind to and inhibit or prevent the function of a protein.

[0039] According to some embodiments of the invention, the high affinity binding molecule is an antibody or its antigen-binding fragments, including Fab or scFv fragments, which can be readily obtained by skilled artisans (e.g., This will be understood by the business (also known as the dealer).

[0040] The present invention provides compositions and methods for treating and preventing cell necrosis and diseases associated therewith. and methods are provided.

[0041] In additional embodiments, the present invention provides compounds that inhibit cell destruction, particularly at low concentrations, for the prevention and treatment of necrosis. The present invention relates to the use of specific small inhibitory molecules that have been found to inhibit death. The list of molecules includes: Small inhibitory compounds belonging to various chemical families, e.g., 2-aminoimidazolines The present invention also relates to the use of thiazolines, 2-aminothiazolines, and isoxazoles. Various small molecule inhibitors for use in treating and / or preventing related diseases or medical conditions. In yet another embodiment, the present invention relates to a method for treating a disease or medical condition associated with cell necrosis. Use of small molecule inhibitors in the manufacture of a medicament for the treatment and / or prevention of a cardiac condition Provided.

[0042] In some embodiments, the present invention provides a method for treating, inhibiting, suppressing, or preventing cellular necrosis. The use of any compound described herein, or any cathepsin C, CELA1, CELA3A or The use of structurally related enzymes thereof is contemplated. In some embodiments, the enzymes The cells that are involved are brain cells, nerve cells, Purkinje cells, hippocampal pyramidal cells (hypocampal pyramidal cells), and ell, low pyramidal pyramidal cells), glial cells, cardiac myocytes, muscle cells, keratinocytes (keratinocytes) , epidermal cells, bone or cartilage cells, pancreatic cells, heart cells, muscle cells, liver cells ), respiratory cells or lung cells, hepatocytes, kidney cells, hepatocytes, gastrointestinal tract alveoli (gastrointestinal cells), spleen cells, hematopoietic cells, lymphocytes, macrophages Macrophages, thymocytes, fibroblasts, epithelial cells, parenchymal cells, bronchial epithelial cells, nephrocytes Nephrotic tubular cells, glomerular capillary cells ( glomerulus capillary cells, and lung epithelial cells, and stem cells, gonad cells, sperm, and eggs The cell is selected from the group consisting of a fetus, a fertilized egg, an embryonic cell, a stem cell, and a retinal cell.

[0043] In some embodiments, the present invention provides a method for treating a disease or condition associated with cell or tissue necrosis. the use of any compound as described herein for the treatment, suppression, inhibition or prevention, or The use of any CELA3A, CELA1, or cathepsin C inhibitor agent is contemplated. In embodiments, the disease or medical condition is a neurodegenerative disease, e.g., dementia, Parkinson's disease (Parkinson's disease), Alzheimer's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis multiple sclerosis (amyotrophic lateral sclerosis) (ALS), macular degeneration, Age-related macular degeneration (AMD), acute retinal necrosis (ARN), progressive outer retinal necrosis (Progressive outer retinal necrosis), muscular dystrophy, leukemia, lymphoma, respiratory distress (neonatal respiratory distress) Distress), suffocation, incarcerated hernia (constricted hernia), diabetes, tuberculosis, endometriosis, vascular dysplasia Vascular dystrophy, psoriasis, cold injury, iron-load complications cation), complications of steroid treatment, ischemic heart disease, myocardial infarction, reperfusion injury, cerebrovascular disease or injury, examples of which include stroke or traumatic brain injury, gangrene, pressure sores, pain), pancreatitis, severe acute pancreatitis, hepatitis, chronic hepatitis, cirrhosis (liver cirrhosis), hemoglobinuria, bacterial Sepsis, viral sepsis, burns, high fever (elevated body temperature), Crohn's disease, celiac disease disease, compartment syndrome, necrotizing proctitis (necrotizing colitis), Stevens-John Son's syndrome (SJS), toxic epidermal necrolysis (TEN), cystic fibrosis, rheumatoid arthritis Gore, osteomyelitis, necrotizing fasciitis, nephrotoxicity, spinal cord injury, glomerulonephritis, acute tubular necrosis, renal cortex Necrosis, osteoarthritis (degenerative arthritis), tyrosemia (tyrosinemia, hypothyroidism), Multiple sclerosis, congenital mitochondrial disease, metabolic Metabolic inherited disease, mycoplasmosis, anthrax infection, bacterial infection , viral infection, Ebola infection, Anderson's disease, congenital mitochondrial disease Andria disease, phenylketonuria, placental infarction, syphilis, syphilis, aseptic necrosis, ischemic necrosis, alco Necrosis associated with drug dependence, administration and / or self-administration, and / or exposure ssociated with administration and / or self-administration with, and / or exposure t o) cocaine, drugs, e.g., paracetamol or doxorubicin; chemical Toxins, pesticides, heavy metals, warfare organophosphates, spiders, or snake venom, or related to the application of dermal fillers. necrosis related to ectopic drug administration, e.g., dextrose solution, chemotherapy drugs chemotherapy-induced necrosis, radiation-induced necrosis, transplanted tissue and aging The maintenance management is selected from the group consisting of:

[0044] In some embodiments, the present invention provides a method for treating a pulmonary arthritis, including the use of any compound as described herein, or or any inhibitor of cathepsin C, CELA1, CELA3A, or structurally related enzymes The use of the agent is contemplated for improving the appearance or quality of skin, and in some embodiments Contemplated herein are cosmetic uses of the compounds and agents as described herein.

[0045] Also included are at least one pharmaceutically acceptable carrier and a compound or As described herein, cathepsin C, CELA1, CELA3A, or structurally related enzymes Pharmaceutical compositions containing a therapeutically effective amount of any of the inhibitor agents are also provided.

[0046] In some embodiments, the cathepsin C, CELA1, CELA3A, or a compound thereof of the present invention Any inhibitor of a related enzyme, such as CELA3A, CELA1, or cathepsin C or Binds to these combinations with a minimal affinity of Kd 10-7M or less, and CELA2A, and / or or CELA3B, and / or cathepsins A, B, D, E, G, H, K, L1, L2, O, S, W, or Z , and the minimum binding affinity for CELA3A, CELA1, or cathepsin C is less than that for Both bind with a minimum affinity of 10-fold higher Kd.

[0047] In some embodiments, such inhibitor agents are CELA3B and / or OCI. It may bind to AD1 with a minimal affinity of Kd 10-7 M or less. According to an embodiment, the inhibitor agent has at least 95% identity to the sequence set forth in SEQ ID NO:3. They have an array that shares the same

[0048] In some embodiments, such inhibitor agents are CELA3B and / or OCI. AD1, CELA2A and / or cathepsin A, B, D, E, G, H, K, L1, L2, O, S, W, or Z may bind with a higher affinity than the binding to In some embodiments, the inhibitor agent has the sequence set forth in SEQ ID NO:3 in accordance with this aspect. The sequence shares at least 95% identity with the sequence disclosed.

[0049] In certain aspects, the present invention, as will be appreciated by those skilled in the art, provides a method for preparing a polymeric material comprising the steps of: Conservative substitutions of nucleotides are contemplated.

[0050] In some further embodiments, in the treatment of a medical disease or condition associated with cell necrosis. The method comprises administering a therapeutically effective amount of any of the compounds described herein to a subject in need thereof. Any of the agents or compounds described may be used in combination with analogs, derivatives, fragments, or the like, as appropriate. (also referred to as fragments), isomers or salts thereof, and administering them to a subject. In an embodiment, the subject is a human or non-human mammal.

[0051] In some embodiments, the agents or compounds described herein may be used to treat cells in the early stages of necrosis. In some further embodiments, the agent as described herein is effective when Alternatively, the compound is active when the cell is subjected to a necrotic signal.

[0052] According to a further embodiment, the present invention provides a method for treating and / or preventing aging, comprising administering to a subject a The present invention provides a method in a subject in need thereof, the method comprising administering to said subject: (a) any agent as described herein; or a compound or combination thereof to a subject; and (b) administering an anti-aging agent to a subject. and administering it to elephants to treat and / or prevent aging. do.

[0053] According to some embodiments of the invention, the cells are necrotic cells.

[0054] According to some embodiments of the invention, the method further comprises administering to the subject an anti-apoptotic agent, e.g., a caspases This includes administering to the subject a therapeutic agent such as a phospholipase inhibitor.

[0055] According to some embodiments of the present invention, the anti-apoptotic agent is an agent as described herein. Alternatively, the compound may be administered prior to, simultaneously with, or after administration of the compound. According to some embodiments, the method is performed in vivo.

[0056] According to some embodiments of the present invention, the pharmaceutical composition is formulated to permeate cell membranes. According to some embodiments of the present invention, the pharmaceutical composition comprises lipid vesicles.

[0057] According to some embodiments of the present invention, the anti-aging agent is an antioxidant, a phytochemical, a hormone The active ingredient is selected from the group consisting of acetaminophen, metformin and fatty acids.

[0058] According to a further aspect of the present invention, the functional integrity of organs, tissues and cells is maintained by the destruction of Methods and compositions for storing and preserving by preventing and / or inhibiting the induction of death - Patents.com is provided.

[0059] In some embodiments, the present invention provides methods for treating heart, kidney, liver, skin, lung and other organs and tissues. Human, human-compatible or non-human tissue requiring preservation prior to transplantation, including transplantation or retransplantation of tissue The present invention provides a method for preserving harvested organs, tissues or cells. The present invention further provides a method for improved preservation of organs. This allows for more efficient transportation of the item to alternate geographic locations. In addition to preservation, it also improves cell viability during the cell recovery process, e.g., thawing. Additionally, the present invention provides methods for the assessment of the post-transplant period and the pre-transplant period. During their maintenance, preservation and transplantation, regeneration-related cells, i.e., gonad cells, sperm, eggs, A method for preserving and maintaining fertilized eggs and / or embryonic cells is provided.

[0060] In one embodiment, the composition for preserving biological tissue comprises a physiological salt solution, a bioavailable source of ATP, and a soluble form of ATP. and one of the inhibitors, as disclosed herein, thereby Optionally, the substrate for ATP production is creatine phosphate. Creatine, creatine ethyl ester, dicreatine malate, glucoside Creatine phosphate, fructose, sucrose, ribose, hexose or pentose Alternatively, the substrate for the production of ATP is creatine oleate, creatine mononitrate, or creatine mononitrate. hydrate, adenosine, or dextrose / glucose.

[0061] In some embodiments, an agent or compound as described herein is an agent or compound that is art-recognized. As such, it is a small molecule.

[0062] In some embodiments, the agent or compound as described herein is a polynucleotide. antisense, siRNA, microRNA, ribozyme, and DNAzyme. Sometimes, the polynucleotide agent, according to one embodiment of the present invention, is selected from the group consisting of: Provided herein are methods for preventing or inhibiting necrosis, the methods including: the cells expressing at least one of intracellular CELA3, CELA1, and / or cathepsin C activity; administering a therapeutically effective amount of an agent that specifically downregulates and / or inhibits thereby preventing or inhibiting cell necrosis.

[0063] In some embodiments, the agent or compound as described herein inhibits CELA3A. Although it has higher specificity than CELA3B, inhibition of either or both targets is not part of the present invention. and specifically inhibits the activity of the compound and / or the compound. Included are agents that specifically interact with the agent as defined.

[0064] In a particularly preferred embodiment, a method for preventing or inhibiting necrosis of cells is provided, the method comprising: We characterized the expression of CELA3 activity, including CELA3A and CELA3B, in cells subjected to necrotic signals. A therapeutic approach that specifically downregulates or additionally inhibits it. This involves administering an effective amount of the agent.

[0065] According to a further embodiment of the present invention, treatment of a medical disease or condition associated with cell necrosis and a method for treating a subject in need thereof, the method including administering to a subject a therapeutically effective amount of intracellular cathepsin C, CEL A1, CELA3A or a small number of structurally related enzymes thereof in the cells of a subject. Specifically downregulates the expression of at least one activity, and / or additionally downregulates the expression of at least one activity. In some embodiments, the method comprises administering to a subject a therapeutically effective amount of an agent that inhibits Although inhibition of CELA3A may provide less optimal activity than inhibition of CELA3A, it may nonetheless In addition, the effect on expression and / or activity may, for example, in some embodiments, be It is useful to treat conditions associated with cell necrosis.

[0066] In another preferred embodiment, the present invention also provides a method for detecting moderate to stringent hypersensitivity. hybridizes specifically to CELA3A and / or CELA1 under hybridization conditions However, the polynucleotides that are separated are not optimal for CELA2A or less optimal for CELA3B. It is also intended for use in octides.

[0067] In a particularly preferred embodiment, the isolated polynucleotide is a CELA3A-specific polypeptide. Hybridize.

[0068] In a particularly preferred embodiment, the present invention relates to intracellular cathepsin C, CELA1, CELA3A or the like. and the use of small molecules that specifically inhibit at least one of the structurally related enzymes. do.

[0069] According to an aspect of some embodiments of the present invention, the small molecule has a Kd of 10 -7 Minimum affinity below M associated with a low level of intracellular cathepsin C, CELA1, CELA3A, or structurally related enzymes. specifically binds to at least one CEL with a minimum affinity of at least 10-fold higher Kd. A2A and / or CELA3B, and / or cathepsins A, B, D, E, G, H, K, L1, L2, and O , S, W or Z.

[0070] In some embodiments, an agent or compound as described herein may inhibit the activity of a CELA3A receptor rather than CELA3A. Although the agents or compounds described herein bind with low affinity to CELA3B, , CELA2A and / or cathepsins A, B, E, G, H, K, L1, L2, O, S, W, or Z Moderate to stringent hybridization to CELA3B with higher affinity than They bind under cleavage conditions.

[0071] In accordance with another embodiment of the present invention, there is provided herein a high affinity molecule, which is At least one fold of cathepsin C, CELA1, CELA3A, or structurally related enzymes It binds to at least one domain consisting of a folded amino acid sequence.

[0072] According to an aspect of some embodiments of the present invention there is provided an antibody,-7 M binds to CELA3A and CELA1 with a minimum affinity of at least 10 times higher Kd It binds to CELA2A or CELA3B with affinity.

[0073] According to an aspect of some embodiments of the present invention there is provided an antibody, -7 M binds to cathepsin C with a minimal affinity of 0.1, but with an affinity of at least 10-fold higher Kd. It binds to cathepsin A, B, D, E, G, H, K, L1, L2, O, S, W, or Z.

[0074] According to an aspect of some embodiments of the present invention, the isolated polynucleoside a peptide, a high affinity molecule of the present invention, or an antibody of the present invention, and a pharmaceutically acceptable carrier A pharmaceutical composition comprising:

[0075] According to an aspect of some embodiments of the present invention, the isolated polynucleoside A pharmaceutical composition is provided comprising a medicament, an anti-apoptotic agent, and a pharmaceutically acceptable carrier.

[0076] In some embodiments, the present invention provides a method for the preparation of a polynucleotide or polynucleotides as described herein. vectors, conjugates, liposomes or carriers containing the peptide; and compositions containing them.

[0077] According to an aspect of some embodiments of the present invention, in the treatment and / or prevention of aging, A method is provided in a subject in need thereof, the method comprising: (a) administering to a subject a cell comprising: At least one of intracellular cathepsin C, CELA1, CELA3A, or structurally related enzymes administering to the subject an agent that downregulates and / or additionally inhibits the expression of the activity of and (b) administering an anti-aging agent to a subject, thereby treating and / or preventing aging. This includes preventing or preventing

[0078] According to an aspect of some embodiments of the present invention, the isolated polynucleoside A pharmaceutical composition is provided comprising a medicament, an anti-aging agent and a pharmaceutically acceptable carrier.

[0079] According to some embodiments of the present invention, the compounds, medicaments, compositions, uses and methods of the present invention The method can be applied to any cell that has received a necrotic signal.

[0080] According to some embodiments of the present invention, the amount of agent is adjusted to decrease cell necrosis to cell apoptosis. Selected to cause a transformation.

[0081] According to some embodiments of the present invention, the method comprises administering an anti-apoptotic agent to the subject. It further includes:

[0082] According to some embodiments of the present invention, the anti-apoptotic agent is -[R]-N-[2-heptyl]-methyl Tyrpropargylamine (R-2HMP), vitamin E, vitamin D, caspase inhibitor, Drugs that downregulate anti-apoptotic proteins and hydrophilic bile salts, including ursodeoxycholic acid The agonist is selected from the group consisting of those that regulate

[0083] According to some embodiments of the present invention, the anti-apoptotic agent is cathepsin C, CELA1, CE Specifically downregulates the expression of LA3A or enzymes structurally related thereto, and Alternatively or additionally, it may be administered before, simultaneously with, or after the administration of a suppressing agent, In some embodiments, the activity is more preferential for CELA3A than for CELA3B. It is possible.

[0084] According to some embodiments of the invention, the method is performed in vivo.

[0085] The present invention also utilizes intracellular CELA3A or CELA4A to provide protection against necrosis in vitro. for the inhibition of at least one of the structurally similar enzymes, CELA1, and / or cathepsin C. It also applies to the following methods.

[0086] In some embodiments, the present invention provides a compound of formula VI: [ka] Equation VI It is characterized by the structure During the ceremony: G1 is an optionally substituted NH-pyrrolidine, an optionally substituted NH-piperidine, an optionally substituted optionally substituted NH-piperazine, optionally substituted NH-imidazolidine, optionally substituted NH-pyra zolidine, optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, Substituted pyrrolidine, optionally substituted piperidine, optionally substituted Piperidin, optionally substituted piperazine, optionally substituted imidazoline lysine or an optionally substituted pyrazolidine; G2 is an optionally substituted alkyl, an optionally substituted aryl, an optionally substituted cyclohexyl alkyl or an optionally substituted heterocycle; where: When G1 is unsubstituted pyrrolidine, then G2 is alkyl, cyclopentyl, alkyl not cyclopentyl or furan; or When G1 is piperidine, then G2 is not alkyl; and When G1 is piperazine, then G2 is not alkyl or furan. A compound is provided.

[0087] In some embodiments, G1 is pyrrolidine and G2 is ethyl or furan. In some embodiments, G1 is a substituted piperazine and G2 is a furan or phenyl. In some embodiments, G1 is piperidine and G2 is cyclopentyl. In some embodiments, G is an optionally substituted methyl, furan, or phenyl. It is midazolidine or an optionally substituted pyrazolidine.

[0088] In some embodiments, the present invention provides a compound of formula VII: [ka] Formula VII It is characterized by the structure During the ceremony: G1 is an optionally substituted NH-pyrrolidine, an optionally substituted NH-piperidine, an optionally substituted optionally substituted NH-piperazine, optionally substituted NH-imidazolidine, optionally substituted NH-pyra zolidine, optionally substituted NH-pyridine, optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, optionally substituted pyrrolidine, optionally substituted piperidine, Optionally substituted piperidine, optionally substituted piperazine, optionally substituted imidazo lysine, optionally substituted pyrazolidine, or optionally substituted aryl; G2 is [ka] or optionally substituted alkyl, optionally substituted aryl or optionally substituted cyclohexyl is chloroalkyl; and G4 is an optionally substituted pyrrolidine, an optionally substituted piperidine, an optionally substituted piperazine, optionally substituted imidazolidine, or optionally substituted pyrazolidine the law of nature; where: When G1 is piperidine, then G4 is not pyrrolidine, or G2 is optionally substituted is not an aryl; or When G1 is imidazolidine, then G2 is not optionally substituted aryl; or or When G1 is an optionally substituted NH-pyridine, then G2 is an optionally substituted aryl. not ; or When G1 is an optionally substituted NH-aryl, then G2 is an optionally substituted aryl. not ; or When G1 is an optionally substituted pyridine, then G2 is an optionally substituted aryl. There is no A compound is provided.

[0089] In some embodiments, according to this aspect, G1 is optionally substituted NH-pyridine. ,G2, [ka] wherein G4 is pyrrolidine, or G2 is haloaryl, and In one embodiment, according to this aspect, G1 is optionally substituted NH-aryl and G2 is teeth, [ka] wherein G4 is pyrrolidine.

[0090] Unless otherwise defined, all technical and / or scientific terms used herein are It is commonly understood by a person of ordinary skill in the art to which the invention pertains. Methods and materials similar or equivalent to those described herein may be used in the practice or testing of embodiments of the present invention, but exemplary methods and / or or substances are described below. In case of conflict, the patent specification, including definitions, will control. In particular, the materials, methods, and examples are illustrative only and are not necessarily limiting.

[0091] Some embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which: It is to be understood that the details shown herein, particularly with reference to the drawings, are by way of example only and are not intended to limit the scope of the invention. In this regard, it is emphasized that the description using the drawings is for illustrative purposes only. It will be apparent to those skilled in the art how the embodiments can be practiced. In the drawings: [Brief explanation of the drawings]

[0092] [Figure 1] Figure 1 is a line graph showing the kinetics of KCN-induced cell death in U-937 cells. Figure 1 illustrates the time and dose response of KCN-induced necrosis. Nuclear morphology was determined by double staining with acridine orange and ethidium bromide. [Figure 2] 1 is a line graph showing the induction of proteolytic activity by 10 mM KCN ​​treatment as assessed by enzymatic assay. U-937 cells were treated with KCN for different time intervals. Cathepsin C activity and elastase-like activity in cell lysates were measured using specific substrates (as detailed in the Examples section herein below). [Figure 3] This figure illustrates the dose-dependent inhibition of KCN-induced elastase-like activity in cells by elastase inhibitor III. Cell lysates were prepared after 30 minutes of treatment with 10 mM KCN. Elastase-like activity was measured using the substrate MAAPV. Cathepsin L inhibitor and E-64d did not affect elastase-like proteolytic activity. Data not shown. [Figure 4A] Figures 4A-B illustrate the effect of silencing siRNA for CELA1 and CELA3A on LDH release from U-937 cells undergoing necrosis induced by different concentrations of KCN. Figure 4A is a bar graph showing cells transfected with control siRNA or siRNA for specific enzymes and treated with or without KCN for 7 hours, and then LDH release from the cells was measured. Transfection with control siRNA had no effect by itself. *P<0.001. Figure 4B depicts a photograph illustrating a Western blot demonstrating downregulation of specific proteins due to treatment with the appropriate siRNAs. [Figure 4B] Same as Figure 4A. [Figure 4C] This figure shows the effect of silencing cathepsin C, CELA1, and CELA3A by siRNA on LDH release from PC12 cells undergoing KCN-induced necrosis. PC12 cells transfected with control siRNA or siRNA for specific enzymes were preincubated in glucose-free medium for 1 hour and treated with or without KCN for 5 hours. LDH release from the cells was then measured. *P<0.001. [Figure 5]Figures 5A-B are bar graphs showing the effect of siRNA on elastase activity (Figure 5A) and cathepsin C activity (Figure 5B). Cells treated with control siRNA or siRNA for cathepsin C, CELA1, or CELA3A were exposed to 10 mM KCN ​​for 30 minutes. Cells were then lysed, and cathepsin C or elastase-like activity in the lysates was measured by specific colorimetric substrates. [Figure 6] Figure 1 shows the effect of specific cathepsin C inhibitors on LDH release from PC12 cells undergoing KCN-induced necrosis. Cells were treated with or without different concentrations of KCN for 5 hours in the presence or absence of different concentrations of cathepsin C inhibitors, and then LDH release from the cells was measured. Elastase inhibitors were used as positive controls. *P<0.01. [Figure 7] Figures 7A-B are bar graphs showing the protective effects of various elastase inhibitors on PC12 cells undergoing necrosis. Figures 7A-B show PC12 cells treated with or without KCN for 5 hours in the presence or absence of different concentrations of elastase inhibitors II or III, respectively. LDH release from the cells was then measured. *P<0.05. Figure 7C is a bar graph showing the protective effect of elastase inhibitor II in rescuing KCN-treated cells for up to 48 hours. Cells maintained in glucose-deprived medium were incubated with or without elastase inhibitor II for 30 minutes. The cells were then treated with or without KCN for 5 hours. The medium was then changed to complete DMEM, and incubation proceeded for 24 or 48 hours. The elastase inhibitor itself did not affect the viability of control cells. Cell viability was measured at the indicated times using the XTT method, and the results were compared with their respective controls. [Figure 8]Figures 8A-B are bar graphs showing that elastase inhibitors II and III protect mouse brains from closed head injury in vivo. Quantification of the effects of elastase inhibitors II and III (Figure 8A) on neurological severity score (NSS) and the development of necrotic areas in the brains of traumatized mice is shown in Figure 8B. *P<0.01. [Figure 9] We demonstrate the protective in vivo effect of compound Z601-4253 (2-(piperidin-1-yl)thiazol-4-yl)(pyrrolidin-1-yl)methanone, which belongs to the 2-aminothiazole group of active compounds, against liver toxicity caused by acetaminophen (APAP) administration. The compound was discovered by screening a library of CELA3A inhibitors based on 3D structural similarity and topological analogues of the CELA3A enzyme. Notably, the compound is active when administered 4 hours after APAP administration. [Figure 10]

[0023] Figure 1 shows the protective effect of the compound 1-(2-(4-methylpiperazin-1-yl)-4,5-dihydro-1H-imidazol-1-yl)propan-1-one (M059-0891), which belongs to the 2-aminoimidazoline series found to be active by screening a library of CELA3 inhibitors as described above. These results demonstrate a significant reduction in necrosis and infarct size by this inhibitor in a model of myocardial infarction / reperfusion in mice. [Figure 11] 1 shows a sequence alignment of the amino acid sequences of elastase proteins CELA1 (SEQ ID NO: 8), CELA2A (SEQ ID NO: 27), CELA3A (SEQ ID NO: 10), and CELA3B (SEQ ID NO: 25). Amino acid target sites are indicated (shown in yellow for CELA1 and in green for CELA3A) as determined by clustalW2 software from the European Bioinformatics Institute (EBI). DETAILED DESCRIPTION OF THE INVENTION

[0093] The following is a detailed description of the present invention. In some embodiments, the present invention provides methods for detecting cell or tissue necrosis and / or associated therewith. and compositions and methods for treating and / or preventing diseases and conditions associated with and more specifically, but not exclusively, cell or tissue necrosis, which is associated with intracellular CELA3, In some embodiments, it preferentially targets CELA3A or structurally related enzymes, or In some embodiments, CELA1, or in some embodiments, cathepsin C, or In some embodiments, the expression of any combination of these activities is downregulated, and It relates to preventing or treating by suppressing and / or inhibiting.

[0094] Surprisingly, certain proteolytic enzymes are specifically involved in the early stages of necrosis and They act as targets for the targeting of compounds or drugs, and can downregulate the activity of either or both. and the like, ... This results in a combination of:

[0095] Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPP-1), is a lysosomal In humans, it is encoded by the CTSC gene. Cathepsin C catalyzes the excision of a dipeptide from the N-terminus of a protein. Synthin C is known to be an activator of elastase (Turk D. et al., The Journal of MBO Journal (2001) 20(23):6570-6582).

[0096] CELA1 is a member 1 of the chymotrypsin-like elastase family. The gene is , located at position 12q13 on chromosome 12. It is involved in, for example, the pancreas, stomach, intestines, kidneys, lungs, and embryos. Expressed in tissues liver, muscle, joints, brain, mammary gland, spleen, blood, tongue, bone and bladder CELA3A is a member of the chymotrypsin-like elastase family, member 3A. The gene is It is located on chromosome 1 at position 1p36.12. It is found in, for example, the pancreas, bladder, liver, prostate, and skin. It is expressed in the skin, thymus, connective tissue, brain and blood.

[0097] Surprisingly, it is now believed that cathepsin C, or CELA1 or CELA3, in particular CELA3A, or downregulates the expression of or the activity of an enzyme structurally related thereto. In terms of the definition of a compound or agent that inhibits necrosis, prevention of necrosis, treatment of necrosis, or a combination thereof Surprisingly, the compositions and uses / methods of the present invention have been shown to provide Described herein are novel agents and novel compounds useful in treating rheumatoid arthritis.

[0098] Also, surprisingly, classes of drugs and compounds are defined herein, which downregulate or inhibit the expression of the activity of either or both of these, preventing necrosis. and providing a necrotic treatment, a necrotic treatment, or a combination thereof, whereby the presence of the compound However, no therapeutic use has been described.

[0099] Also, surprisingly, a class of drugs or compounds is defined herein, which downregulating or inhibiting the expression of the activity of one or both of and can result in the prevention of necrosis, the treatment of necrosis, or a combination thereof, thereby The existence of the compound may have been previously known, or as such, its therapeutic use may have been previously unknown. Although it may have been known, the cell or tissue necrosis or diseases related thereto No specific use in preventing, inhibiting, reducing the incidence or treating disease is described.

[0100] The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions. It can be well understood.

[0101] Before describing at least one embodiment of the present invention in detail, it is important to understand that the present invention is not limited to the specific application thereof. The present invention is not limited to the details set forth in the following description or illustrated by way of example. It is to be understood that the invention is capable of other embodiments or of being practiced or of being carried out in various ways. It is also understood that the phraseology and terminology employed herein is for illustrative purposes only. It should be understood that the present disclosure is illustrative and should not be construed as limiting.

[0102] Myocardial infarction, brain injury, stroke, cirrhosis of the liver and many other diseases and conditions involve the formation of necrotic forms of cells. Involved in cell death.

[0103] In simplifying the practice of the invention, the inventors have identified cathepsin C, CELA1, and in particular CE Cells in which LA3A or structurally related enzymes or enzymes regulate the necrotic cell response targets, the downregulation or inhibition of which protects cells from necrosis-induced cell death It was revealed that it can be used for

[0104] As shown herein below and in the Examples section that follows, the inventors have demonstrated that cell necrosis can be a cause of death in cells. We also found that it induces the activation of intracellular elastase (see Figures 2A-B and 3). specifically inhibiting the expression of at least one of intracellular CELA3A, CELA1, and / or cathepsin C. Down-regulating RNA silencing agents prevent necrotic forms of cell death (see Figure 4A-B). In addition, the inhibition of these targets by specific siRNAs (SEQ ID NOs: 1-3, respectively) resulted in the production of ribosomal proteins in target cells. It specifically inhibits cathepsin C enzyme activity or CELA1 / CELA3A elastase-like activity. Furthermore, in mice and rats (see Figures 8A-B), In an APAP-induced hepatotoxicity model in mice (Figure 9), and in a myocardial ischemia / reperfusion model in mice (Figure 10), In a closed head injury (trauma) model, elastase inhibitors were used to prevent brain cell necrosis. These results demonstrate the ability of necrosis-induced cell death to prevent damage in vivo. and / or intracellular CELA3A or structurally related enzymes, CELA1, and / or CELA2, for the treatment or prevention of or a down-regulator or inhibitor of at least one of cathepsin C. Furthermore, the use of CELA3A or structurally related enzymes and optionally CELA1 The identification of elastase as a primary target in the necrotic process does not interfere with the enzymatic activity of other elastases. This allows the design of specific elastase inhibitors.

[0105] Thus, according to one aspect of the present invention, there is provided a method for preventing or inhibiting cell necrosis. The method includes administering to cells subjected to a necrotic signal intracellular CELA3A or structurally associated Specifically downregulates the expression of at least one of the enzymes, CELA1, and / or cathepsin C. and administering a therapeutically effective amount of a drug that regulates and / or additionally inhibits This includes giving.

[0106] As used herein, the term "necrosis" refers to the premature death of cells in living tissue. Necrosis typically involves destruction of cell membranes and organelles, cell swelling, and mitochondrial destruction. pathological condition characterized by cellular damage followed by cell lysis and ultimately cell death Furthermore, cell lysis is typically accompanied by an inflammatory response, and inflammation leads to necrosis. It may increase.

[0107] Necrosis-induced cell death can be achieved, for example, by CytoTox 96 (R) (Cytotox 96 商標 )Non-Radioactive Non-radioactive Cytotoxicity Assay (Promega, WI) LDH Cytotoxicity Assay Kit (LDH Cytotoxicity Assay Kit) Acridine oleate was prepared by the kit (Cayman, MI, USA). staining with ethidium bromide and by fluorescence microscopy, or or FACS (e.g., using the vital dye HO342), any method known to those skilled in the art. can be assayed by methods herein, see further details in the Examples section below. Light.

[0108] According to some embodiments of the present invention, necrosis is associated with various medical conditions / diseases. and each of which is a therapeutic agent contemplated according to some embodiments of the present invention. Examples of such medical conditions / diseases include, but are not limited to, infections, poisons, venoms, Radiation, physical trauma, inflammation, lack of nutrient or oxygen supply, chemical imbalances, in the blood supply This includes cytotoxicity, cytotoxicity, other conditions that result in cell or tissue death, or a combination of two or more of the above. In this embodiment, tissue necrosis may be associated with poor engraftment and / or preservation of tissue during transplantation. For example, cell or tissue necrosis can occur in any of the following conditions (also called pathologies): May be associated with one or more of: abscess, chills (malaria fever), anemia, catarrh, anoxia, apnea, arthritis, suffocation, asthma, ataxia, atrophy, backache, bleeding, blennorrhea ), cachexia, caries (bone ulcers), colic, constipation, convulsions, cough, chiarrhea Nose, diarrhea, dizziness, edema (blisters), dry gangrene, dysentery, indigestion, shortness of breath Difficulty, edema (water retention), emaciation (thinning), fainting, fatigue, fever, fibrillation (fibrillation, fibrin Gas gangrene, genetic disorders, high blood pressure, hydrocephalus, hypertension Tension, hypotension, icterus, indigestion, inflammation, Insomnia, itching, jaundice, low blood pressure, lower back pain mbago), wasting, wet gangrene, noma, pain, paralysis, pruritus s, pruritus), rash, room (catarrhal), hardening, seizures, shock, skin rash, wounds (sores) spasms, spasms, sphacelation, tabes, tachycardia, dental caries Symptoms include nausea, vomiting, bloating, stomach aches, dizziness, or vomiting.

[0109] Necrosis can be localized to groups of living cells or to one or more tissue regions. It will be appreciated that the tissue may spread over (e.g., necrotic tissue).

[0110] The term "tissue" refers to an organism (organism) made up of cells designed to perform a function or group of functions. Typically, solid tissues are vascularized. Examples include brain tissue, Retina, skin tissue, liver tissue, pancreatic tissue, bone tissue, cartilage tissue, connective tissue, blood tissue, muscle tissue , heart tissue, brain tissue, vascular (blood vessel) tissue, kidney tissue, lung tissue, gonadal tissue, and hematopoietic tissue. do.

[0111] Typically, cells undergo necrosis after receiving necrotic signals from their extracellular environment. Examples of any of the above conditions include, but are not limited to, lack of oxygen, poisons, toxins, etc.; It may initiate a process that leads to cell necrosis.

[0112] As used herein, the term "necrotic cell" or "necrotic cell" refers to a cell that has undergone a necrotic signal and and any type of cell that exhibits at least one phenotype associated with necrosis (see above). Something like that).

[0113] Cells according to the present teachings can be, for example, brain cells, neurons, heart cells, muscle cells, skin cells, , bone cells, pancreatic cells, liver cells, kidney cells, intestinal cells, spleen cells, respiratory cells, lung cells, The diseased cells include lymphocytes or monocytes or any of the diseased cells described herein.

[0114] The term "necrotic cells" as used herein further relates to cells in any stage of necrosis. Therefore, cells undergo early stages of necrosis (e.g., cell swelling or mitochondrial dysfunction). The cell may be in the final stages of cell death (e.g., during cell lysis) or in the final stages of cell death (e.g., during cell lysis). That's fine.

[0115] As used herein, the terms "inhibit" or "treat" refer to the harmful effects of necrosis. To mitigate, cure, reverse, attenuate, mitigate, minimize, arrest or stop the harmful effects of mentions that.

[0116] In some embodiments, when referring to the prevention of diseases associated with cell or tissue necrosis, Such reference relates to a reduction in the incidence of disease at a population level. Such references are to patients suffering from recurrent or recurrent disease. There may be sufficient symptoms, etiology, or other factors that have previously occurred in such patients. Failure to develop disease severity can serve as an indicator of true prevention.

[0117] In some embodiments, when referring to preventing necrosis at the cellular or tissue level, are classical markers or histopathological evidence or secretory signals typically associated with necrosis One can also note a clear decrease in

[0118] According to one embodiment, treating or inhibiting necrosis of a cell or tissue comprises treating or inhibiting necrosis by The same cells / tissues that were not treated with the inventive drug but received the same necrotic signals as the treated cells / tissues. by at least about 10% compared to control necrotic cells / tissue of the same type, At least about 20%, at least about 30%, at least about 40%, at least about 50% %, at least about 60%, at least about 70%, at least about 80%, or less Both may be reduced by about 90%, or at least by about 100%.

[0119] As noted above, the method of this aspect of the invention involves administering intracellular CE to cells that are subjected to a necrotic signal. LA3A, or at least one of the structurally related enzymes, CELA1, and / or cathepsin C Specifically downregulating the expression of and / or, in addition, the activity of This can be affected by administering drugs that suppress the

[0120] As used herein, "specifically" means specifically directed to intracellular CELA3A or structurally similar enzymes, downregulating the expression of at least one of CELA1 and / or cathepsin C; and and / or its activity, but not the activity or expression of any other protein in the cell. does not substantially interfere with the expression of intracellular CELA3A, CELA1, and / or cathepsin C 10%, 15%, 20%, 25%, 30% or more in the activity or expression of at least one non-cellular component Specifically, the present teachings also relate to intracellular CELA3A, CELA1, and and / or cathepsin C, at least one of two of them (e.g., CELA3A and CELA1C) or to downregulate and / or suppress the expression of all of their activities Refers to the potency of a single drug.

[0121] As used herein, "downregulate" or "inhibit" refers to an intracellular A small number of proteins that are cathepsin C, CELA1, CELA3A, or structurally related enzymes refers to the reduction, decrease, weakening, attenuation, minimization, inhibition or cessation of at least one expression or activity According to one embodiment, intracellular cathepsin C, CELA1, CELA3A or a structurally equivalent thereof Downregulation of the expression of at least one protein that is an associated enzyme and / or Alternatively, the inhibition of the activity of CELA3A, CELA1, or CELA2 in cells not treated with the agent of the present invention may be achieved. and / or cathepsin C protein, but the others are subjected to the same conditions. at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least By about 20%, by at least about 30%, by at least about 40%, by at least about 50%, by a small amount At least about 60%, at least about 70%, at least about 80%, at least about 90% Or at least only about 100%.

[0122] As used herein, the term "expression" refers to protein expression or mRNA expression.

[0123] As used herein, "intracellular cathepsin C, CELA1, CELA3A or a structurally related The phrase "at least one activity of the enzyme involved" refers to a biological activity, e.g., an enzymatic activity of the enzyme involved. In one embodiment, CELA3A and / or CELA1 are characterized by their serine proteases. refers to enzyme activity (e.g., the ability to hydrolyze proteins such as elastin) According to another embodiment, the activity of cathepsin C is refers to the activity of somatic cysteine ​​proteinases (e.g., activation of serine proteinases) (The one in).

[0124] Levels of expression or activity of cathepsin C, CELA1, CELA3A, or structurally related enzymes Evaluating the level (e.g., downregulation thereof) of a gene can be performed using any method known to those skilled in the art. Thus, for example, enzyme-linked immunosorbent assay (ELISA) can be used. ) assay, immunofluorescence (IF) assay or chemiluminescent immunoassay (CLIA) assay Uscn, OriGene, or Sigma-Aldrich Intracellular cathepsin C, CELA1, CELA3A or structurally related thereto, using those available from The protein level of at least one of the enzymes associated with the enzyme can be determined. The mRNA expression level can be measured by Northern blot analysis. This can be accomplished using RT-qPCR or RT-qPCR. Assays for CELA3A and / or CELA3A activity include, for example, the Ellman Esterase Assay. ELISA assay) (Ellman, GL et al., Biochem. Pharmacol. (See Chem. 7, 88-95, 1961) or by flow injection analysis (FIA). Binding enzyme activity assay [Joga et al., Biotechnology Letters Letters (2201) 23(12):943-948. For the tetracycline C activity assay, an example is provided by Uscn Life Science Inc. ) and available CTSC assay kits.

[0125] Thus, for example, and as described in more detail in Example 3 below, The enzyme-like activity was observed with N-methoxysuccinyl-Ala-Ala-Pro-Valp-nitroacetate used as a substrate. It can be measured by ELISA using nilide (MAAPV) (Sigma), while Psin C-like activity was measured by EL with Gly-Phe p-nitroanilide (Sigma) used as a substrate. It can be measured by ISA.

[0126] As used herein, the term "cathepsin C" refers to dipeptidyl peptidase I (DPP- 1) or cathepsin C (CTSC), an example of which is set forth in NP_001107645.1 (SEQ ID NO: 6). It is a lysosomal exocysteine ​​protease belonging to the peptidase C1 family. Regarding Ze.

[0127] As used herein, the term "CELA1" refers to elastase-1, also known as ELA1. Examples include those described in NP_001962.3 (SEQ ID NO: 8), chymotrypsin-like enzymes, Related to CELA1 family member 1 (CELA1).

[0128] As used herein, the term "CELA3A" refers to elastase family member 3A. Also known as NP_005738.4 (SEQ ID NO: 10), which is an example of a cytochrome P450 enzyme. Related to lipsin-like elastase family member 3A.

[0129] Downregulation of cathepsin C, CELA1, and CELA3A expression is associated with transcriptional and / or Various molecules that disrupt translation [e.g., RNA silencing agents (e.g., antisense, siRNA Genome and / or transcription factors using [RNA, shRNA, microRNA, ribozymes and DNAzymes] It can affect the transcription levels of intracellular CELA3A, CELA1, and / or cathepsins. Inhibition of at least one of the C activities affects protein levels, i.e., Examples include antibodies, antagonists, enzymes that cleave polypeptides, Inducing its degradation using small molecules, natural inhibitors, and the like .

[0130] According to one embodiment, at least one of intracellular CELA3A, CELA1 and / or cathepsin C Drugs that can inhibit this process include those that inhibit the folding of cathepsin C, CELA3A, and CELA1. It is a high-affinity binding molecule that binds to at least one domain consisting of a sequence of amino acids.

[0131] For example, the high affinity binding molecule specifically binds to cathepsin C, CELA3A, and CELA1. The antibody may be an aptamer, antibody or antibody fragment capable of binding to the target molecule. For example, high affinity molecules may contain antigen recognition domains, e.g., cathepsin C, CELA3A, and CELA1. As used herein, "antibodies" includes antibodies that specifically bind to at least one epitope. The term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. It extends to.

[0132] Epitopic determinants are often fragments of molecules such as amino acids or carbohydrate side chains. It consists of chemically active surface groupings of molecules and has specific three-dimensional structural characteristics and They usually have specific charge characteristics.

[0133] Exemplary epitopes of CELA1 and CELA3A that can be targeted according to the present teachings are shown in SEQ ID NO:1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 23 These exemplary amino acid sequences include those represented by CELA1 and CELA3A. These are intended as epitope regions of the Methods well known in the art, for example, ELISA or Western blot, can be used. For each of the antibodies generated using the ELISA assay, antibody specificity and enzyme inhibition were evaluated. It will be understood that further modifications may need to be made.

[0134] As used herein, the term "antibody" includes intact (also called intact) antibodies. These molecules and their functional fragments, for example, bind to macrophages. These functional fragments include Fab, F(ab')2, and Fv, which can be synthesized by the antibody. Antibody fragments are defined as follows: (1) Fab contains a monovalent antigen-binding fragment of an antibody molecule. fragments, obtained by digesting whole antibodies with the enzyme papain to extract intact light chains and one heavy chain fragment. (2) Fab' is prepared by treating whole antibody with pepsin and then reducing it to produce an Fab' fragment. Fragments of antibody molecules that can be obtained by generating identical light and heavy chain portions. (3) (Fab')2 is a fragment of the whole antibody; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2 is a fragment of the whole antibody; can be obtained by treating with the enzyme pepsin without subsequent reduction. F(ab')2 is a fragment of an antibody that binds to two disulfide bonds; (4) Fv is a dimer of two Fab' fragments; and (5) Fv is expressed as a dimer of the variable region of the light chain and two Fab' fragments. (5) single-chain antibodies (defined as genetically engineered fragments containing the variable region of a heavy chain); "SCAs") are genetically fused as single chain molecules with a suitable polypeptide linker. It is a genetically engineered molecule that contains linked light chain variable regions and heavy chain variable regions.

[0135] Methods for producing polyclonal and monoclonal antibodies and their fragments The method is well known in the art (see, for example, Harlow and Lane). ), Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory ), New York, 1988, which is incorporated herein by reference. ).

[0136] Antibody fragments according to some embodiments of the invention are capable of withstanding proteolytic degradation of the antibody. Thus, the DNA encoding the fragment can be transformed into E. coli or mammalian cells (e.g., prepared by expression in Spanish hamster ovary cell culture or other protein expression system Antibody fragments can be produced by pepsin digestion of whole antibodies by conventional methods or For example, antibody fragments can be obtained by papain digestion. It is produced by enzymatic cleavage of antibodies with Fab to provide a 5S fragment designated F(ab')2. This fragment can be obtained by cleaving the disulfide linkages. 3.5S Fab' monovalent fragments with a thiol reducing agent for the cleavable group, and optionally a blocking group. Alternatively, enzymes using pepsin can be used to further cleave the nucleotides to produce the desired fragments. Elementary cleavage directly produces two monovalent Fab' fragments and an Fc fragment. The method is described, for example, in Goldenberg, U.S. Pat. No. 4,036,945 and No. 4,331,647 and the references contained therein, The patent is incorporated herein by reference in its entirety. Porter, RR [Biochem. J. (The Biochemical Journal) 73:119-126 (1959)]. The fragment binds to the antigen. Other methods of cleaving antibodies, e.g., monovalent cleavage, are also possible, as long as they are recognized by intact antibodies. separation of the heavy chains to form light chain-heavy chain fragments of the Alternatively, other enzymatic, chemical, or genetic techniques may also be used.

[0137] The Fv fragment comprises an association of a VH and a VL chain. This association is described by Inbar et al. It can be monovalent, as described [Proc. Nat'l Acad. Sci. USA 69:2659-62 (19720)]. Alternatively, the variable chains may be linked by an intramolecular disulfide bond or by chemical bonds, such as glutaraldehyde. The Fv fragment can be linked by cross-linking with a hydroxyl group or the like. These single-chain antigen-binding fragments contain VH and VL chains connected by a peptide linker. The sFv protein consists of a VH domain and a VL domain connected by an oligonucleotide. It is prepared by constructing a structural gene containing a DNA sequence that encodes the gene. The construct is inserted into an expression vector, which is then transformed into a host cell, such as E. coli. The recombinant host cell expresses a linker peptide that bridges the two V domains. A single polypeptide chain having the sFv domain is synthesized. Whitlow and Filpula, Methods 2:97-105 1991); Bird et al., Science 242:423-426 (1988); Pack Bio / Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, the entire contents of which are incorporated herein by reference.

[0138] Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") are synthesized by constructing genes encoding the CDRs of the target antibody. Such genes can be obtained by constructing, for example, polymerase chain reaction (PCR). They are prepared by using a chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, e.g., Larrick and Fry [Methods, 2:106-10 (1991)]. .

[0139] Humanized forms of non-human (e.g., murine) antibodies may contain immunoglobulins, immunoglobulin chains, or The fragments (Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) Humanized antibodies are humanized molecules that contain minimal sequence derived from non-human immunoglobulins. The present invention relates to a method for determining whether the residues forming the recipient complementarity determining regions (CDRs) are identical to those of a non-human species, e.g., a human. Such as mice, rats, or rabbits with the desired specificity, affinity, and capacity These include human immunoglobulins in which residues from the CDRs of the donor antibody are substituted. As such, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies also have the same CDRs or framework sequences as the recipient antibody. Generally, humanized antibodies may contain at least one residue that is not found in the target sequence. and typically substantially all of the two variable domains, in which all of the CDR regions all or substantially all of the FR regions correspond to those of a non-human immunoglobulin, and all of the FR regions correspond to those of a non-human immunoglobulin. or substantially all of the human immunoglobulin consensus sequences. Also optimally, at least a portion of an immunoglobulin constant region (Fc), typically a human Including immunoglobulins themselves [Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and and Presta, Curr. Op. Struct. Biol. (Current Opinion in (1992).

[0140] Methods for humanizing non-human antibodies are well known in the art. Generally, humanized antibodies are , having one or more amino acid residues introduced into it from a source that is non-human. The non-human amino acid residues are often called import residues, and they are usually The humanization was performed by Winter and collaborators. According to the law [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)] Substitution of rodent CDRs or CDR sequences with the corresponding sequences of a human antibody essentially Such humanized antibodies can therefore be referred to as chimeric antibodies (U.S. Pat. No. 6,423,299). No. 4,816,567, in which a substantially intact human variable domain is derived from a non-human species. In practice, humanized antibodies are typically human antibodies. where some CDR residues and possibly some FR residues are identical to those of rodent residues are substituted by residues from analogous sites in the antibody.

[0141] Human antibodies have also been generated using phage display libraries [Hoogenboom and Winter, J. Mol. Biol. (Journal of Molecular Biology), 227 :381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. These can be produced using a variety of techniques known in the art. The techniques of Boerner et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies. (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 7 7 (1985) and Boerner et al., J. Immunol. (Journal of Immunology), 147 (1 ):86-95(1991)). Similarly, human antibodies can be produced in transgenic animals, e.g., animals that express endogenous antibodies. Mice in which the immunoglobulin genes were partially or completely inactivated were given human immunoglobulins. Human antibodies can be produced by introducing a gene locus into the host. The formation of the ribosomal nucleosomes was observed, which was evident from all aspects, gene rearrangement, assembly, and antibody remodeling. This approach is similar to that seen in humans, including in the primates. , U.S. Patent Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, and 5,633,42 5, No. 5,661,016, and in the following scientific publications: Marks et al., Bio / Technol ogy 10,:779-783(1992); Lonberg et al., Nature 368:856-859(1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); Lonberg and Hu Husar, Intern. Rev. Immunol. (International Reviews of Immunology) 13, 65-93 (1995).

[0142] Thus, at least one of the intracellular CELA3A, CELA1, and / or cathepsin C enzyme activities One type of inhibition, for example, specifically binds to active enzymes by recognizing conformational changes in the enzyme. Alternatively, the antibody can inhibit the enzyme by binding to the enzyme's substrate. The activity can be inhibited.

[0143] According to one embodiment of the present invention, Kd 10 -7 Minimal affinity for CELA3A and CELA1 below M binds at a rate at least 10 times lower (e.g., 10 -6 M) CELA2A or CELA3 with minimal affinity Antibodies are provided that bind to B. According to certain embodiments, the antibodies -8 -10 -10 M or 10 -9 -10 -10 It binds to the target with a Kd in the range of M.

[0144] According to one embodiment of the present invention, 10 -7 With a minimum affinity of Kd below M binds to at least one of cathepsin A, B, D, E, G, H, K, L1, L2, O, S, W, or Z 0 times lower (e.g., 10 -6 M) Antibodies that bind with minimal affinity are provided. For example, the antibody -8 -10 -10 M or 10 -9 -10 -10 It binds to the target with a Kd in the range of M.

[0145] Exemplary antibodies that can be used in accordance with the present teachings include, but are not limited to, EMD Millipor e (EMD Millipore), Sigma-Aldrich, and Santa Cruz Biotechnology (Santa Cruz, CELA1 antibodies available from Biotechnology; examples include Abcam, Sigma-Aldrich, and Sigma-Aldrich. Anti-CELA3A antibodies available from Aldrich, and Santa Cruz Biotechnology; examples include Sig Anti-cathepsin C / CTS available from ma-Aldrich and R&D Systems Such antibodies may be used for their specificity, as further described below. It can be certified as such.

[0146] Can inhibit cathepsin C, CELA1, CELA3A, or structurally related enzymes Other suitable agents bind to and inhibit cathepsin C, CELA1, CELA3A, or structurally related enzymes. Any molecule that binds and / or cleaves the nucleoside. Such molecules include cathepsin C, CELA1, CELA3, Antagonists of A or structurally related enzymes, or cathepsin C, CELA1, CEL It may be an inhibitory peptide of A3A or an enzyme structurally related thereto.

[0147] At least catalytic or Non-functional analogs of the binding moiety may be used for cathepsin C, CELA1, CELA3A, or structurally related enzymes. It will be understood that the compound can also be used as a drug to inhibit the growth of proteins.

[0148] The present invention relates to the inhibition of cathepsin C, CELA1, CELA3A or structurally related enzymes. Another agent that can be used with some embodiments of the present invention is cathepsin C, CELA1 , a molecule that prevents activation or substrate binding of CELA3A or structurally related enzymes. be.

[0149] The present invention relates to the inhibition of cathepsin C, CELA1, CELA3A or structurally related enzymes. Another agent that can be used with some embodiments of the present invention is a dominant negative A peptide molecule, i.e., a portion or variant thereof, is used for cathepsin C, CELA1, CELA It competes with the effector (also called effector) of 3A or structurally related enzymes.

[0150] At least one of intracellular cathepsin C, CELA1, CELA3A, or structurally related enzymes Other agents that can be used with some embodiments of the present invention to inhibit is a natural inhibitor in that activation pathway. Exemplary natural inhibitors of cathepsin C include, but are not limited to, cystatin F, human protease inhibitors, and cystatin C inhibitors. Proteinase inhibitor 9 (PI-9 / serpin B9), cystatin C and stefin A and Contains B.

[0151] Thus, they may be permeable to cell membranes or modified to be permeable (see below for details). as described above), and intracellular cathepsin C, CELA1, CELA3A, or structurally related enzymes At least one of the following catalytic activities may be used in accordance with the present teachings. In this regard, the present invention relates to intracellular CELA3A or structurally similar enzymes CELA1 and / or catecholamines. Some aspects of the present invention are directed to the use of small molecules that specifically inhibit at least one of the psin C proteins. According to one aspect of the embodiments, the small molecule inhibits intracellular CELA3A, CELA1, and / or cathepsin. Specific for at least one of the synthase Cs with a Kd of 10 -7 The minimum of M and lower (also called below) It binds with affinity to CELA2A or CELA3B, or cathepsins A, B, D, E, G, and H. , K, L1, L2, O, S, W, or Z with a minimum affinity of at least 10-fold higher Kd. do.

[0152] In another aspect, the present invention provides specific elastase inhibitors, e.g., elastase Inhibitor II (MeOSuc-AAPA-CMK) and others, which are available from Calbiochem-Novabiochem (Calbiochem). It is intended to use those available from Novabiochem, USA.

[0153] Exemplary elastase inhibitors that can be used in accordance with the present invention also include non- Also included are small peptide molecules.

[0154] In some embodiments, such elastase inhibitors also include CELA1, CELA3, and and in particular downregulates the expression and / or activity of CELA3A and / or cathepsin C. The term "compounds / agents of the present invention that inhibit CELA3 or structurally related inhibitors" may also refer to compounds / agents of the present invention that inhibit CELA3 or structurally related inhibitors. Bitar is a candidate for CELA3A based on 3D structural similarity and topological analogues. Some small molecules can belong to different chemical families. The present invention aims to develop a novel antibody capable of selectively and specifically inhibiting CELA 3A or structurally similar enzymes. Exemplary compounds include those listed in Table 1 herein.

[0155] The present invention also relates to the agents listed in Table 1 below, or derivatives, isomers, salts thereof, Includes any subgrouping of oxides, polymorphs, or other known forms thereof. It is understood as something.

[0156] Drugs capable of inhibiting necrosis include, among others, other drugs belonging to various chemical families. Small inhibitory compounds such as 2-aminoimidazolines, 2-aminothiazoles and iodoimidazolines It contains isoxazole.

[0157] In some embodiments, the agent is any compound described by Table I below. or in some embodiments, the agent is a derivative, analog, or pharmaceutical salt thereof or isomers.

[0158] In some embodiments, any combination or subcombination of the agents listed in Table 1 Subgroupings are contemplated as part of and represent embodiments of the present invention. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0159] Exemplary compounds that can selectively and specifically inhibit CELA 1 include, but are not limited to, N-[4-[4-(isobutyrylamino)phenoxy]phenyl]-2-methyl-propionamide , ethyl-2,3-dihydro-3-oxo-1,2-benzisothiazole-2-acetate-1,1-diox Sid included.

[0160] In some embodiments, the compounds of the invention and / or compositions of the invention are and / or the method of the present invention provides a use, and / or the first medical Use the following formula: [ka] or any combination thereof. The compounds of the invention and / or the compositions of the invention are included and / or The method of the invention provides a use and / or the first medical use of this invention includes M059-0032 ;M059-0055;M059-0082;M059-0053;M059-0335;M059-0891;M059-0891;M059-1012,M 008-0111; 4112-3656; Z632-2266; or Z601-4253 structure or any substructure thereof In some embodiments, the compounds of the present invention may include drugs characterized by a set The article and / or composition of the invention includes and / or the method of the invention provides use and / or the first medical use of this invention includes M059-0032; M059-0055; M059-0082 ;M059-0053;M059-0335;M059-0891;M059-0891;M059-1012 structure, or the central 2- substituted or unsubstituted pyrrolidine at the 2-amino position of either of them. , substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazoline azolidine, substituted or unsubstituted pyrazolidine, substituted or unsubstituted aryl, substituted or unsubstituted A substituted 5- or 6-membered heterocyclic ring, or a substituted or unsubstituted 5- or 6-membered cycloalkyl. These include drugs characterized by compounds with similar structures, including those containing substituted hydroxybenzoates. In embodiments, the compounds of the invention and / or compositions of the invention are included and / or The method of the invention provides a use and / or the first medical use of the invention is Structure of 9-0055;M059-0082;M059-0053;M059-0335;M059-0891;M059-0891;M059-1012, or unsubstituted pyrrolidine, unsubstituted piperidine, unsubstituted Substituted piperazine, unsubstituted imidazolidine, unsubstituted pyrazolidine, unsubstituted aryl, unsubstituted 5 or a 6-membered heterocyclic ring, or any two of those with unsubstituted 5- or 6-membered cycloalkyl - Drugs characterized by compounds with similar structures containing substitutions at the amino position. In some embodiments, the compounds of the invention and / or compositions of the invention are included, and and / or the method of the present invention provides a use, and / or the first medical use of the present invention provides a method for treating M 059-0032;M059-0055;M059-0082;M059-0053;M059-0335;M059-0891;M059-0891;M059 The structure of -1012, or the central 2-aminoimidazoline substituted pyrrolidine, substituted piperidin azine, substituted piperazine, substituted imidazolidine, substituted pyrazolidine, substituted aryl, substituted 5 or a 6-membered heterocyclic ring, a substituted 5- or 6-membered cycloalkyl with a similar 2-amino position at any These may include drugs characterized by compounds with similar structures containing substitutions with In some embodiments, the compounds of the invention and / or the compositions of the invention are included and / or The method of the present invention provides a use, and / or the first medical use of the present invention is ;M059-0055;M059-0082;M059-0053;M059-0335;M059-0891;M059-0891;M059-1012 structure, or by the central 2-aminoimidazoline at the 2-amino position of either of them , substituted or unsubstituted pyrrolidine, substituted or unsubstituted piperidine, substituted or unsubstituted pipera substituted or unsubstituted imidazolidine, substituted or unsubstituted pyrazolidine These may include drugs characterized by compounds with similar structures, including:

[0161] In some embodiments, the compounds of the invention and / or compositions of the invention are included, and and / or the method of the present invention provides a use, and / or the first medical use of the present invention provides a 008-0111; 4112-3656; or Z632-2266, or any subset thereof It may contain a drug to be characterized.

[0162] In some embodiments, the compounds of the invention and / or the compositions of the invention are included and / or Alternatively, the method of the present invention provides a use, and / or the first medical use of the present invention is 111;4112-3656 or Z632-2266 structures, or by the central 2-aminoimidazoline. Substituted or unsubstituted pyrrolidine, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine substituted or unsubstituted imidazolidine, substituted or unsubstituted pyrazolidine, substituted or unsubstituted substituted aryl, substituted or unsubstituted 5- or 6-membered heterocyclic ring, or substituted or unsubstituted 5- or 6-membered heterocyclic ring and compounds having a similar structure containing substitution at the 2-amino position. In some embodiments, the compound of the present invention and / or the agent of the present invention The disclosed compositions include and / or the methods of the invention provide uses and / or the disclosed compositions include and / or the disclosed compositions provide uses and / or the disclosed compositions The first medical use of M008-0111;4112-3656 or Z632-2266 structure, or the central 2- Unsubstituted pyrrolidine, unsubstituted piperidine, Unsubstituted piperazine, unsubstituted imidazolidine, unsubstituted pyrazolidine, unsubstituted aryl, unsubstituted A substituted 5- or 6-membered heterocyclic ring, or an unsubstituted 5- or 6-membered cycloalkyl, with a 2-amino position These may include drugs characterized by compounds with similar structures containing substitutions at positions. In some embodiments, the compounds of the invention and / or the compositions of the invention are included, and the methods of the invention are The method provides for the use and / or the first medical use of the present invention is or Z632-2266, or the central 2-aminothiazoline, Substituted piperidine, substituted piperazine, substituted imidazolidine, substituted pyrazolidine, substituted aryl , a substituted 5- or 6-membered heterocyclic ring, a substituted 5- or 6-membered cycloalkyl at the 2-amino position The present invention may include drugs characterized by compounds having similar structures containing the following substitutions:

[0163] In some embodiments, the compounds of this invention and / or compositions of this invention include and / or the method of the present invention provides a use, and / or the first medical The use is of formula I: [ka] Formula I It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted piperidine, a substituted or Unsubstituted piperazine, substituted or unsubstituted imidazolidine, or substituted or unsubstituted pyrazolidine Gin; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted substituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or an agent that is an unsubstituted cycloalkyl or a substituted or unsubstituted heterocycle; or Formula II: [ka] Formula II It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted pyridine, a substituted or unsubstituted Substituted aryl, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazolidine or substituted or unsubstituted pyrazolidine; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted substituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl or a substituted or unsubstituted heterocycle; or Formula III: [ka] Formula III It is characterized by the structure In the formula, G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted pyridine, a substituted or unsubstituted Substituted aryl, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazolidine or substituted or unsubstituted pyrazolidine; and G3 has the following structure: [ka] or G3 is a substituted or unsubstituted alkyl, substituted or unsubstituted aryl or substituted or unsubstituted cycloalkyl; In the formula, G2 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or It may include compounds that are unsubstituted cycloalkyl or substituted or unsubstituted heterocycles.

[0164] In some embodiments, the present invention provides a compound of formula I, II, III, IV, V or V as described herein. The present invention contemplates a compound of formula I, or a composition containing the same, and the primary medical use thereof includes Rarely, whereby the ring structure depicted in the formula may further contain additional heteroatoms, e.g. , additional nitrogen or oxygen may be incorporated.

[0165] Base: [ka] When referring to a group, the asterisk indicates the point of attachment for the group being described. For example, G3 is a group [ka] According to Formula I, [ka] When characterized in terms of: [ka] The skilled artisan will appreciate that the asterisk, as described herein, indicates the formula Indication of the appropriate corresponding structure in any of the compounds characterized by I-VI It will be understood that this similarly indicates the attachment point at the indicated location.

[0166] In some embodiments, G1, G2, or G3 is pyrrolidine, pyridine, piperidine , piperazine, imidazolidine, pyrazolidine or heterocycle, but several In some embodiments, the point of attachment for such a described group to the indicated atom is: Optionally, this may be through a nitrogen or heteroatom or through a carbon atom of the same group.

[0167] In some embodiments, with respect to compounds of formula I, when G is pyrrolidine, The point is through the nitrogen atom of the pyrrolidine group, and in some embodiments, G1 is a pipera When the piperazine group is a nitrogen atom, the point of attachment is through the nitrogen atom of the piperazine group, and in some embodiments In the case of , when G1 is piperidine, the point of attachment is via the nitrogen atom of the piperazine group.

[0168] In some embodiments, with respect to compounds of formula II, when G is piperidine, The points are through the nitrogen atom of the piperazine group, and in some embodiments, G is piperidine. Sometimes the point of attachment is through the carbon atom of the piperidine group, where the nitrogen atom is at the point of attachment. It is in the ortho position relative to the nucleus.

[0169] In some embodiments, the present invention provides a compound of formula VI: [ka] Equation VI It is characterized by the structure During the ceremony: G1 is an optionally substituted NH-pyrrolidine, an optionally substituted NH-piperidine, an optionally substituted optionally substituted NH-piperazine, optionally substituted NH-imidazolidine, optionally substituted NH-pyra zolidine, optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, Substituted pyrrolidine, optionally substituted piperidine, optionally substituted Piperidin, optionally substituted piperazine, optionally substituted imidazoline lysine or an optionally substituted pyrazolidine; G2 is an optionally substituted alkyl, an optionally substituted alkenyl, an optionally substituted aryl, aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl or optionally substituted is a heterocycle substituted with where: When G1 is unsubstituted pyrrolidine, then G2 is alkyl, cyclopentyl, alkyl not cyclopentyl or furan; or When G1 is piperidine, then G2 is not alkyl; and When G1 is piperazine, then G2 is not alkyl or furan. A compound is provided.

[0170] In some embodiments, G1 is pyrrolidine and G2 is ethyl or furan. In some embodiments, G1 is a substituted piperazine and G2 is a furan or phenyl. In some embodiments, G1 is piperidine and G2 is cyclohexyl. In some embodiments, G is optionally substituted. The compound is an optionally substituted imidazolidine or an optionally substituted pyrazolidine.

[0171] In some embodiments, the compounds of this invention and / or compositions of this invention include and / or the method of the present invention provides a use, and / or the first medical Use is made of Formula V: [ka] Formula V It is characterized by the structure wherein X is N or S; G1 is a substituted or unsubstituted pyrrolidine, a substituted or unsubstituted pyridine, a substituted or unsubstituted aryl aryl, substituted or unsubstituted piperidine, substituted or unsubstituted piperazine, substituted or unsubstituted imidazolidine, or substituted or unsubstituted pyrazolidine; G3 is [ka] or G3 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl or is substituted or unsubstituted cycloalkyl, that is, when X is N; There is no G3, which is when X is S; G4 or G5, respectively, independently [ka] ;substituted or unsubstituted alkyl, substituted or unsubstituted alkoxy, acyl, substituted or unsubstituted substituted aryl or substituted or unsubstituted cycloalkyl, when X is S; and; G4 or G5 are each independently H, OH, or halogen, which is the case when X is N; and Call G2 is a substituted or unsubstituted alkyl, alkoxy, acyl, or substituted or unsubstituted aryl. cycloalkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted heterocycle, It may include.

[0172] In some embodiments, the present invention provides a compound of formula VI: [ka] Equation VI It is characterized by the structure During the ceremony: G1 is an optionally substituted NH-pyrrolidine, an optionally substituted NH-piperidine, an optionally substituted optionally substituted NH-piperazine, optionally substituted NH-imidazolidine, optionally substituted NH-pyra zolidine, optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, substituted pyrrolidine, optionally substituted piperidine, optionally substituted piperidine, Optionally substituted piperazine, optionally substituted imidazolidine, or optionally substituted It is a pyrazolidine; G2 is an optionally substituted alkyl, an optionally substituted aryl, an optionally substituted cyclohexyl alkyl or an optionally substituted heterocycle; where: When G1 is unsubstituted pyrrolidine, then G2 is alkyl, cyclopentyl, alkyl not cyclopentyl or furan; or When G1 is piperidine, then G2 is not alkyl; and When G1 is piperazine, then G2 is not alkyl or furan. A compound is provided.

[0173] In certain embodiments, G1 is pyrrolidine and G2 is ethyl or furan. In certain embodiments, G1 is a substituted piperazine and G2 is furan or phenyl. In certain embodiments, G1 is piperidine and G2 is cyclopentyl, furan or phenyl. In certain embodiments, G1 is an optionally substituted imidazolidine or is an optionally substituted pyrazolidine.

[0174] In some embodiments, G is an optionally substituted NH-pyrrolidine, an optionally substituted N H-piperidine, optionally substituted NH-piperazine, and G2 is optionally substituted alkyl or in some embodiments, G1 is optionally substituted NH-pyrrolidine, optionally optionally substituted NH-piperidine, optionally substituted NH-piperazine, and G2 is optionally substituted or in some embodiments, G is an optionally substituted NH-pyridine. Roridin, optionally substituted NH-piperidine, optionally substituted NH-piperazine, and G2 is an optionally substituted aryl; or in some embodiments, G is an optionally substituted Optionally substituted NH-pyrrolidine, optionally substituted NH-piperidine, optionally substituted NH-piperazine and G2 is optionally substituted heteroaryl; or in some embodiments, , G2 is optionally substituted cycloalkyl; or in some embodiments, G1 is Optionally substituted NH-pyrrolidine, optionally substituted NH-piperidine, optionally substituted NH -piperazine, and G2 is an optionally substituted heterocycle.

[0175] In some embodiments, G1 is an optionally substituted NH-imidazolidine or an optionally substituted substituted NH-pyrazolidine, and G2 is optionally substituted alkyl; or In some embodiments, G1 is an optionally substituted NH-imidazolidine or an optionally substituted and G2 is optionally substituted alkyl; or In some embodiments, G1 is an NH-imidazolidine or an optionally substituted NH-pyrazolidinone. and G2 is optionally substituted aryl; or in some embodiments , G1 is NH-imidazolidine or optionally substituted NH-pyrazolidine, and G2 is or in some embodiments, G2 is an optionally substituted heteroaryl; or in some embodiments, G1 is NH-imidazoline. and G2 is an optionally substituted heterocyclic group. It is a ring.

[0176] In some embodiments, G1 is optionally substituted NH-aryl, optionally substituted NH- cycloalkyl, and G2 is optionally substituted alkyl; or some In embodiments, G1 is optionally substituted NH-aryl, optionally substituted NH-cycloalkyl. and G2 is optionally substituted alkenyl; or in some embodiments, G1 is optionally substituted NH-aryl, optionally substituted NH-cycloalkyl; and G2 is optionally substituted aryl; or in some embodiments, G1 is optionally optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, and G2 is optionally substituted NH-aryl; or in some embodiments, G2 is optionally substituted heteroaryl; or in some embodiments, G is optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, and G2 is optionally substituted It is a heterocycle.

[0177] In some embodiments, G1 is an optionally substituted pyrrolidine, an optionally substituted pipetidine, lysine, optionally substituted piperidine, and G2 is optionally substituted alkyl; or in some embodiments, G1 is optionally substituted pyrrolidine, optionally substituted and G2 is an optionally substituted piperidine, an optionally substituted piperidine, and or in some embodiments, G is an optionally substituted alkenyl; pyrrolidine, optionally substituted piperidine, optionally substituted piperidine; and G2 is optionally substituted aryl; or in some embodiments, G1 is optionally Optionally substituted pyrrolidine, optionally substituted piperidine, optionally substituted piperidin and G2 is optionally substituted heteroaryl; or in some embodiments, In some embodiments, G2 is an optionally substituted cycloalkyl; or in some embodiments, G1 is an optionally substituted pyrrolidine, an optionally substituted piperidine, an optionally substituted piperidine, and G2 is an optionally substituted heterocycle.

[0178] In some embodiments, G1 is an optionally substituted piperazine, an optionally substituted imidinone, G2 is optionally substituted pyrazolidine or an optionally substituted pyrazolidine; alkyl; or in some embodiments, G1 is optionally substituted pyrrolidine, optionally substituted piperidine, optionally substituted piperidine, and G2 is optionally or in some embodiments, G is optionally substituted alkenyl; piperazine, optionally substituted imidazolidine, or optionally substituted pyrazolidine and G2 is optionally substituted aryl; or in some embodiments, G1 is an optionally substituted piperazine, an optionally substituted imidazolidine, or an optionally substituted and G2 is an optionally substituted heteroaryl; or In some embodiments, G2 is an optionally substituted cycloalkyl; or In this embodiment, G1 is an optionally substituted piperazine, an optionally substituted imidazolidine or an optionally substituted pyrazolidine, and G2 is an optionally substituted heterocycle. do.

[0179] In some embodiments, the present invention provides a compound of formula VII: [ka] Formula VII It is characterized by the structure During the ceremony: G1 is an optionally substituted NH-pyrrolidine, an optionally substituted NH-piperidine, an optionally substituted optionally substituted NH-piperazine, optionally substituted NH-imidazolidine, optionally substituted NH-pyra zolidine, optionally substituted NH-pyridine, optionally substituted NH-aryl, optionally substituted NH-cycloalkyl, optionally substituted pyrrolidine, optionally substituted piperidine, Optionally substituted piperidine, optionally substituted piperazine, optionally substituted imidazo lysine, optionally substituted pyrazolidine, or optionally substituted aryl; G2 is [ka] or optionally substituted alkyl, optionally substituted aryl or optionally substituted cyclohexyl is chloroalkyl; and G4 is an optionally substituted pyrrolidine, an optionally substituted piperidine, an optionally substituted piperazine, optionally substituted imidazolidine, or optionally substituted pyrazolidine the law of nature; where: When G1 is piperidine, then G4 is not pyrrolidine, or G2 is optionally substituted is not an aryl; or When G1 is imidazolidine, then G2 is not optionally substituted aryl; or or When G1 is an optionally substituted NH-pyridine, then G2 is an optionally substituted aryl. not ; or When G1 is an optionally substituted NH-aryl, then G2 is an optionally substituted aryl. not ; or When G1 is an optionally substituted pyridine, then G2 is an optionally substituted aryl. There is no A compound is provided.

[0180] In some embodiments, according to this aspect, G1 is optionally substituted NH-pyridine. ,G2, [ka] wherein G4 is pyrrolidine, or G2 is haloaryl, and In the embodiment, this aspect is followed.

[0181] G1 is an optionally substituted NH-aryl, and G2 is [ka] wherein G4 is pyrrolidine.

[0182] In certain embodiments, alkyl, alkenyl, pyrrolidine, piperidine, piperazine, Imidazolidine pyrazolidine, aryl, heteroaryl, heterocyclic, or cycloaryl Reference to the term "substituted" with respect to alkyl groups includes but is not limited to halogen, hydroxyl, C1-C6 straight chain or Branched alkyl, nitro, CN, nitrile amide, amide sulfide, amino, aldehyde , substituted ketone, -COOH, ester, trifluoromethyl, amide, alkoxy or halo It may include alkyl groups or any subcombination thereof.

[0183] In some embodiments, alkyl, alkenyl, pyrrolidine, piperidine, piperazine, Imidazolidine pyrazolidine, aryl, heteroaryl, heterocyclic, or cycloaryl Reference to the term "substituted" with respect to alkyl groups includes but is not limited to halogen, hydroxyl, C1-C6 straight chain or Branched alkyl, nitro, CN, nitrile amide, amide sulfide, amino, aldehyde or any subcombination thereof, or in some embodiments, substitution Ketone, -COOH, ester, trifluoromethyl, amide, alkoxy or haloalkoxy In some embodiments, the alkyl group or any subcombination thereof is a halogen group. halogen, hydroxyl, C1-C6 straight or branched chain alkyl, or any subcomponent thereof In some embodiments, a combination of nitro, CN, nitrile amide, amine, sulfide, amino, aldehyde, or any subcombination thereof. It is okay to do so.

[0184] In certain embodiments, the term "alkyl" includes straight or branched chain C1-C6 alkyl. It should be understood that in certain embodiments, the term "cycloalkyl" refers to 3-, 4- It should be understood to include 5- or 6-membered unsaturated rings.

[0185] In certain embodiments, the term "alkyl" refers to linear, branched, or cyclic hydrocarbon structures and Examples of alkyl groups include methyl, ethyl, propyl, and the like. These include propyl, isopropyl, butyl, sec- and t-butyl, and others of the same type. In some embodiments, the alkyl group is C20 or less. In some embodiments, the alkyl group is C7 or less. In some embodiments, the alkyl group is C6 or less. Cycloalkyl is a subset of alkyl and has 3 to 13 carbon atoms. Examples of cycloalkyl groups include c-propyl, c-butyl, and cyclohexane. , c-pentyl, norbornyl, adamantyl and the like. In this application, alkyl refers to alkanyl, alkenyl and alkynyl residues. Cyclohexylmethyl, vinyl, allyl, isoprenyl and similar Alkylene is another subset of alkyl and has the same residues as alkyl. Although it refers to a group, it has two points of attachment. Examples of alkylene include ethylene (-CH2CH2-). , propylene (-CH2CH2CH2-), dimethylpropylene (-CH2C(CH3)2CH2-) and cyclo hexylpropylene (-CH2CH2CH(C6H13)-). When a carbon residue is specified, all geometric isomers with that number of carbon atoms are included. thus, for example, "butyl" includes n-butyl, sec-butyl, isobutyl, and and t-butyl; "propyl" includes n-propyl and isopropyl. Included.

[0186] The term "alkoxy" or "alkoxyl" as used herein refers to the group -O-alkyl, preferably , one of straight chain, branched chain, cyclic configurations and combinations thereof attached to the parent structure through an oxygen Examples include methoxy, ethoxy, propoxy, and the like. , isopropoxy, cyclopropyloxy, cyclohexyloxy and the like This includes things such as:

[0187] The term "substituted alkoxy" refers herein to the group -O-(substituted alkyl). This can be done.

[0188] The term "acyl" as used herein refers to a straight-chain acyl group attached to the parent structure through a carbonyl functionality. , branched, cyclic configuration, saturated, unsaturated and aromatic and combinations thereof. As long as the point of attachment to the parent remains at the carbonyl, the aryl group can be any group of up to 10 carbon atoms. One or more carbons in the alkyl residue may be replaced by nitrogen, oxygen, or sulfur. Examples include: Acetyl, benzoyl, propionyl, isobutyryl, t-butoxycarbonyl, benzyl oxycarbonyl and the like.

[0189] The term "aryl" as used herein refers to a 5- or 6-membered aromatic ring, a bicyclic 9- or 10-membered aromatic ring, Examples include cyclopenta-1,3- Diene, phenyl, naphthyl, indane, tetralin, fluorene, cyclopenta[b]na These include phthalene and anthracene.

[0190] The term "heterocycle" or "heterocyclyl" as used herein refers to a heterocycle having 1 to 4 carbon atoms. , for example, cycloalkyl substituted by heteroatoms such as oxygen, nitrogen or sulfur. The term "aryl" may refer to 4-, 5-, 6- or 7-amino groups containing 1-4 (or more) heteroatoms. 8-, 9-, or 7-membered non-aromatic rings, bicyclic 8-, 9-, or 7-membered non-aromatic rings containing 1-4 (or more) heteroatoms - or 10-membered non-aromatic ring systems or containing 1-4 (or more) heteroatoms a tricyclic 11- to 14-membered non-aromatic ring system containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2 Examples include pyrrolidine, tetrahydrofuran, tetrahydro-thiophene, thiazolidin piperidine, tetrahydropyran, tetrahydrothiopyran, piperazine, morpholine These include phosphorus, thiomorpholine and dioxane.

[0191] The term "heterocycle" or "heterocyclyl" as used herein refers to the number and arrangement of unsaturations. Reference may be made to ring systems containing unsaturated bonds, provided that the positioning does not render the group aromatic. Midazoline, oxazoline, tetrahydroisoquinoline, benzodioxane, benzodioxane Examples of substituted heterocyclyls include benzoxazinyl and 3,5-dihydrobenzoxazinyl. Examples include 4-methyl-1-piperazinyl and 4-benzyl-1-piperidinyl.

[0192] The term "arylalkyl" in some embodiments refers to both an aryl and an alkyl group. The provisions provided herein shall be understood to apply to all methods, and similarly, in any combination. The terms of the functional groups mentioned are understood in the same way to encompass the description of each group independently.

[0193] The terms "optional" or "optionally" mean that the subsequently described event or circumstance occurs. This means that the event or circumstance may or may not occur, and the description applies if the event or circumstance occurs. Includes examples of when this does and does not happen.

[0194] For example, "optionally substituted alkyl" refers to "alkyl" or "alkyl" as defined below. or "substituted alkyl." Such groups may be optionally substituted or unsubstituted. It is not intended to introduce turns (e.g., substituted alkyl is optionally substituted cyclohexane). alkyl groups, which in turn can include a potentially infinite number of optionally substituted alkyl groups. ), which are sterically infeasible, synthetically not feasible, and / or inherently The term "substituted or unsubstituted" refers to whether the indicated group contains one or more substituents. It is understood that the same selection is encompassed with respect to either.

[0195] The term "substituted" means that one or more hydrogens on the designated atom have been replaced with a hydrogen atom from the indicated group. means to replace the atom with a selection, provided that it is the Normal valences are not exceeded and substitutions result in stable compounds. Combinations of variables are permissible only if such combinations result in stable compounds. A "stable compound" or "stable structure" is one that can be isolated to a useful degree of purity from a reaction mixture, and and compounds that are sufficiently robust to survive formulation into effective therapeutic agents. The term "optionally substituted" refers to a specific group, radical, or moiety. It refers to optional substitution by a radical or moiety.

[0196] Any carbon and valence atoms with insufficient valence in the text, schemes, examples and tables herein and heteroatoms, indicating that there are sufficient hydrogen atoms (groups, possibly multiple) to satisfy the valence. It should also be noted that the eigenvalues ​​are assumed to have the same value.

[0197] As described herein, the present invention includes any isomer or pharmaceutical form of the compounds as described herein. a commercially available salt, N-oxide, hydrate, prodrug, solvate, or derivative thereof, Any isomer or pharmaceutically acceptable salt, N-oxide, solvate of a compound as described in Compositions containing compounds or derivatives thereof, and any isomers or derivatives of such compounds as described herein. The first medical use method employing a physiologically acceptable salt, N-oxide, solvate, hydrate or derivative thereof The present invention provides therapeutic uses and / or methods of treatment.

[0198] The term "pharmaceutically acceptable salt" is used herein to refer to a compound of the present invention that is biologically effective. and salts that retain the properties, and they are not biological, In many cases, the compounds of the present invention are not amino and / or acid and / or base due to the presence of carboxyl or similar groups. Pharmaceutically acceptable acid addition salts can be formed from inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, These include hydrochloric, sulfuric, nitric, phosphoric, and the like. Organic acids that can be used include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, Oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, Cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, These include licylic acid, and others of the same type.

[0199] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, Ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like; in particular ammonium salts, potassium salts, sodium salts The salts, calcium salts and magnesium salts are preferred. Organic bases from which salts can be derived include, e.g. For example, primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines. amines, cyclic amines, basic ion exchange resins, and the like. Specific examples include isopropylamine, trimethylamine, diethylamine, triethylamine, and the like. Examples include ethylamine, tripropylamine, and ethanolamine.

[0200] As used herein, the term "solvate" refers to a compound that is physically combined with one or more molecules of a pharmaceutically acceptable solvent. The term "solvate" may refer to a compound associated with the compound described, Pharmaceutically acceptable salts, solvates of the compounds, and pharmaceutically acceptable salts of the compounds. It is understood to include solvates of the salts.

[0201] For example, "a compound as described herein" or "a compound for a use as described." and the like refer to a compound of Formulas I-VII or any pharmaceutically acceptable salt, isomer, N- -oxides, isomers or solvates.

[0202] Prodrugs and solvates of the compounds of the invention are also contemplated herein. The drug discussion is given in T. Higuchi and V. Stella, Pro-drugs as No Prodrug Delivery Systems (1987) 14 o f the ACS Symposium Series (14th in the ACS Symposium Series), and Bioreversible Carriers in Drug Design (1987) Edward B. Roche, ed., American Pharmaceutic al Association and Pergamon Press (American Pharmaceutical Association) The term "prodrug" is described in "Prodrugs and Prodrugs for Pharmacists" (Prodrugs and Prodrugs for Pharmacists, Vol. 1, No. 1, pp. 111-114, 1997). The term refers to compounds that are converted in vivo to form compounds of formula (I)-(IV) or pharmaceutically acceptable salts of those compounds. This refers to a compound (e.g., a drug precursor) that produces a possible salt, hydrate, or solvate thereof. Conversion can occur via various mechanisms (e.g., metabolic or chemical processes), e.g., This can occur through hydrolysis in the blood, etc. For a complete discussion, see T. Higuchi and W. Stella, "Prodrugs as Novel Delivery Systems," Vol. 14 of the ACS Symposium Series ) and Bioreversible Carriers in Drug Design, ed. Edward B. Ro che, American Pharmaceutical Association and Pergamon Press, 1987. can be.

[0203] Exemplary cathepsin C inhibitors that can be used in accordance with the present invention include, for example, M Gly-Phe-diazomethyl available from MP Biomedicals, USA Contains ketone (Gly-Phe-DMK).

[0204] According to some embodiments of the present invention, any bioinformatics method may include at least at least one intracellular CELA3A or structurally related enzyme, CELA1, and / or cathepsin can be used to design and synthesize specific inhibitors of cycloheximide C (e.g., Bioinformatics technologies, such as Vigyaan, DNALinux Virtual Desktop (VD) or Bioclipse).

[0205] As mentioned above, downregulating the activity or expression of cathepsin C, CELA3A, and CELA1 Another agent that can be administered is a nucleotide analog to silence expression in a targeted manner. Suitable polynucleotide agents include, but are not limited to, those listed below.

[0206] Downregulation of at least one of intracellular CELA3A, CELA1, and / or cathepsin C This can be achieved by RNA silencing. The term "regulating" refers to a group of regulatory mechanisms mediated by RNA molecules. Examples include RNA interference (RNAi), transcriptional gene silencing (TGS), and post-transcriptional gene silencing. PTGS, quelling, co-repression, and translational repression]. This results in the suppression or "silencing" of expression of the corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi. was done.

[0207] As used herein, the term "RNA silencing agent" refers to a gene that specifically inhibits the expression of a target gene. In certain embodiments, the term "silence" refers to an RNA that is capable of selectively suppressing or "silencing" a gene. RNA silencing agents act by silencing mRNA molecules sufficiently through a post-transcriptional silencing mechanism. It is possible to prevent proper processing (e.g., full translation and / or expression) of the protein. NA silencing agents include non-coding RNA molecules, e.g., those that contain paired strands. RNA duplexes containing small non-coding RNAs, as well as the precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs, e.g., siRNAs, miRNAs, and In one embodiment, the RNA silencing agent is an RNA inhibitor. In another embodiment, the RNA silencing agent induces translational repression. It is possible to mediate.

[0208] According to one embodiment of the present invention, the RNA silencing agent is capable of silencing a target RNA (e.g., cathepsin C, C ELA3A and CELA1) and globally target up to 99% of the target genes. Morology, examples are 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88% ,87%, 86%, 85%, 84%, 83%, 82%, 81% less global for target genes Do not cross-suppress or silence genes or splice variants that show homology stomach.

[0209] RNA interference is a sequence-specific posttranscriptional pathway mediated by short interfering RNA (siRNA) in animals. This refers to the process of gene silencing. The corresponding process in plants is usually In bacteria, this is referred to as post-transcriptional gene silencing or RNA silencing, and in fungi The process of post-transcriptional gene silencing is also referred to as quelling in It is an evolutionarily conserved cellular defense mechanism used to prevent the expression of foreign genes. It is believed to be a group of plants and animals, and is usually shared by diverse flora and phyla. Such protection from foreign gene expression may be due to viral infection or the expression of homologous double-stranded RNA or The virus transposons into the host genome via a cellular response that specifically destroys viral genomic RNA. evolved in response to the production of double-stranded RNA (dsRNA) derived from random integration of dsRNA elements. Maybe.

[0210] The presence of long dsRNAs in cells inhibits the activity of a ribonuclease III enzyme called Dicer. Dicer converts dsRNA into short fragments of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from Dicer activity are typically , about 21 to about 23 nucleotides in length, and containing a duplex of about 19 base pairs. The response is also characterized by an endonuclease complex, commonly referred to as the RNA-induced silencing complex The iRNA duplex is also called the RISC, which is a single strand that has a sequence complementary to the antisense strand of the iRNA duplex. Cleavage of the target RNA occurs at the region complementary to the antisense strand of the siRNA duplex. occurs in the center of the region.

[0211] Thus, some embodiments of the present invention downregulate protein expression from mRNA. The use of dsRNA to stimulate transcription is contemplated.

[0212] According to one embodiment, the dsRNA is greater than 30 bp. Long dsRNAs (i.e., greater than 30 bp) The use of longer dsRNAs has been shown to increase the activity of these longer regions of double-stranded RNA in the production of interferon and PK However, the idea that this would result in the induction of an R response is quite limited. Therefore, the use of long dsRNAs is an optimal strategy that alleviates the need to test a large number of siRNAs. This provides many advantages in terms of the ability to select the illuminating sequence; Long dsRNAs require less complexity for silencing libraries than siRNAs. and perhaps most importantly, long dsRNA can be used as a therapeutic agent. When used in combination, it was possible to prevent viral escape mutations.

[0213] Various studies have shown that long dsRNAs induce stress responses without inducing or significantly altering the function of the dsRNAs. can be used to silence gene expression without causing an off-target effect. and demonstrate that - see, for example, Strat et al., Nucleic Acids Research (Nucleic Acids Research), 2006, Vol. 34, No. 13, 3803-3810; Bhargava Bhargava A et al., Brain Res. Protoc. 2004, 1 3:115-125; Diallo M. et al., Oligonucleotides, 2003 ;13:381-392; Paddison PJ et al., Proc. Natl Acad. Sci. USA. Readings of the National Academy of Sciences United States of America, 2002;99:1443-1448; Tran N. et al., FEBS Lett., 2004;573:127-134].

[0214] In particular, the present invention according to some embodiments provides a method for treating inflammatory bowel diseases in which the interferon pathway is not activated. Long dsRNAs for gene silencing in young cells (e.g., embryonic cells and oocytes) A (transcripts of more than 30 bases) is intended to be introduced, and examples are given in Billy et al., PNAS 2001, Vol. 98, pp. 14428-14433. and Diallo et al., Oligonucleotides, October 1, 2003, 13(5): 381-392. See doi:10.1089 / 154545703322617069.

[0215] The present invention according to some embodiments also provides an interface for downregulating gene expression. We aim to introduce long dsRNA specifically designed not to induce the IL-1 and PKR pathways. For example, Shinagawa and Ishii [Genes&Dev. Development 17(11):1340-1345, 2003] is a nucleotide sequence encoding RNA polymerase II (Pol II). A vector named pDECAP was created to express long double-stranded RNA from a promoter. The transcripts derived from pDECAP contain a 5'-cap structure that facilitates transport of ds-RNA into the cytoplasm. Because it lacks both a 3'-poly(A) tail and a 3'-poly(A) tail, the long ds-RNA derived from pDECAP is not interferon-dependent. It does not induce an anti-inflammatory response.

[0216] Another method to circumvent the interferon and PKR pathways in mammalian systems is transactivation. Small inhibitory RNA (siRNA) is expressed either via transfection or endogenously. By introducing NA).

[0217] The term "siRNA" refers to small inhibitory RNA duplexes (generally 18- Typically, siRNAs consist of a central 19 bp double-stranded region and a symmetric are chemically synthesized as 21mers with unique 2-base 3'-overhangs on the termini However, chemically synthesized RNA duplexes of 25-30 bases in length were found to be more resistant to cleavage than 21mers at the same location. It has recently been demonstrated that the potency of RNAi can be increased by as much as 100-fold. The observed increased potency obtained with longer RNAs was due to the use of 21mer instead of the product. It is theorized that this provides a substrate (27mer) to Dicer, which then passes the siRNA to RISC. Improves the rate or efficiency of double-stranded invasion.

[0218] The position of the 3'-overhang influences the potency of the siRNA, and the 3' Asymmetric duplexes with 3'-overhangs generally have a 3'-overhang on the sense strand. It was found to be more potent than the one used in the study (Rose et al., 2005). The opposite efficacy pattern is observed when targeting antisense transcripts, suggesting that RISC This may be due to asymmetric chain loading of the

[0219] The strands of double-stranded interfering RNA (e.g., siRNA) can be arranged in a hairpin or stem-loop structure (e.g., shRNP). A). Thus, as mentioned, some of the present invention The RNA silencing agent of this embodiment may be a short hairpin RNA (shRNA).

[0220] The term "shRNA" as used herein refers to an RNA agent having a stem-loop structure. It comprises first and second regions of complementary sequence, and the complementarity and orientation of the regions are The extent is sufficient so that base pairing occurs between these regions, and the first and second regions are connected by a loop region, and this loop is The number of nucleotides in the loop is due to the lack of base pairing between the nucleotides (the nucleotide analogs). Between 3 and 23, or 5 and 15, or 7 and 13, or 4 and 9, or 9 and 11 or the number inclusive. Some of the nucleotides in the loop are The interaction between the oligonucleotide and the nucleotide is a pair of oligonucleotides that can be used to form a loop. An example of a nucleotide sequence is 5'-UUCAAGAGA-3' (Brummelkamp TR et al. (2002) Science 296:550) and 5'-UUUGUGUAG-3' (Castanotto Tanoto, D. et al. (2002) RNA 8:1454. The resulting single-stranded oligonucleotides are capable of activating the RNAi mechanism. They form stem-loop or hairpin structures containing double-stranded regions that can interact with the The accomplishment of this will be recognized by those skilled in the art.

[0221] Synthesis of RNA silencing agents suitable for use according to some embodiments of the present invention can be carried out as follows: First, the cathepsin C, CELA3A and CELA1 mRNA sequences were , and scan downstream of the AUG start codon for AA dinucleotide sequences. The occurrence of each AA and the 3' adjacent 19 nucleotides is recorded. Because the open reading frame (TRs) are rich in regulatory protein binding sites, siRNA target sites are often found in open reading frames. UTR-binding proteins and / or translation initiation complexes are selected from the siRNA. It can interfere with the binding of the endonuclease complex [Tuschl, ChemBiochem. However, siRNA directed to the 5'UTR inhibited cellular GAPDH mRNA and and GAPDH, which mediates a 90% reduction in fully disrupted protein levels. As evidenced by the results, it is understood that siRNA directed to untranslated regions may also be effective. Arau (www.ambion.com / techlib / tn / 91 / 912.html).

[0222] Second, any sequence alignment software can be used, for example, the NCBI server (www.ncbi.nl Use BLAST software, such as that available at m.nih.gov / BLAST / , to identify potential Potential target sites are compared with the appropriate genome database (e.g., human, mouse, rat, etc.). Putative target sites that show significant homology to other coding sequences are eliminated.

[0223] Qualifying target sequences are selected as templates for siRNA synthesis. The sequences were those containing a low G / C content, compared to those with a G / C content higher than 55%. have been shown to be more effective in mediating gene silencing compared to Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNA, a negative control ( It is preferable to use a negative control siRNA in combination. or contain the same nucleotide composition as siRNA, but lack significant homology to the genome. Therefore, the scrambled nucleotide sequence of the siRNA does not have any significant correlation with other genes. It is preferred to use unless it indicates same sex.

[0224] For example, a suitable siRNA molecule for cathepsin C may be the nucleic acid sequence set forth in SEQ ID NO:1. It can contain columns.

[0225] Exemplary siRNA, miRNA, or shRNA molecules for cathepsin C silencing are , for example, can be purchased commercially from Sigma-Aldrich, QIAGEN, or OriGene.

[0226] For example, a suitable siRNA molecule for CELA1 comprises the nucleic acid sequence set forth in SEQ ID NO:2. It is possible.

[0227] Exemplary siRNA, miRNA, or shRNA molecules for CELA1 silencing are shown in It can be commercially purchased from Sigma-Aldrich, QIAGEN, or OriGene.

[0228] For example, a suitable siRNA molecule for CELA3A may comprise the nucleic acid sequence set forth in SEQ ID NO:3. can be done.

[0229] Exemplary siRNA, miRNA, or shRNA molecules for CELA3A silencing are e.g. can be purchased commercially from Sigma-Aldrich, QIAGEN or OriGene.

[0230] The present invention further provides a method for the preparation of a nucleic acid sequence which shares at least 95% to 99% identity with SEQ ID NO: 1 or or an isolated polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO:1. do.

[0231] The present invention further provides a method for the preparation of a nucleic acid sequence which shares at least 95% to 99% identity with SEQ ID NO:2 or or an isolated polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO:2. do.

[0232] The present invention further provides a method for the preparation of a nucleic acid sequence which shares at least 95% to 99% identity with SEQ ID NO:3 or or an isolated polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:3.

[0233] The RNA silencing agents of some embodiments of the present invention are directed to those molecules that contain only RNA. but need not be limited to chemically modified nucleotides and non-nucleotides. It will be understood that this further encompasses

[0234] mRNAs that can be targeted using RNA silencing agents include, but are not limited to, their expression Exemplary mRNAs that can be targeted include those that correlate with undesirable phenotypic traits. Thus, the present invention provides a method for producing a truncated protein, i.e., a mRNA encoding a truncated protein, i.e., a deletion. In some embodiments, the RNA silencing agent targets the bridging region on either side of the deletion. Introduction of such RNA silencing agents into cells can result in mutations. Downregulation of mutated proteins while leaving unaffected proteins This causes a malfunction.

[0235] According to another embodiment, the RNA silencing agent may be a miRNA.

[0236] The terms "microRNA," "miRNA," and "miR" are synonyms and refer to approximately 19-28 nucleotide sequences. refers to a collection of short-length non-coding single-stranded RNA molecules that regulate gene expression. miRNAs are found in a wide range of organisms (viruses, humans) and play important roles in development, homeostasis, and have been shown to play a role in the pathogenesis of disease.

[0237] Note that there may be variability at the 5' and 3' ends of any pair of miRNA and miRNA*. This variability is due to the differences in the cleavage sites between Drosha and Dicer ( This may be due to variability in the enzymatic processing of miRNAs (Dicer) at the 5' and 3' ends of miRNAs and miRNA*. Variability may also result from mismatches in the stem structures of pri-miRNA and pre-miRNA Mismatches in the stem strand can result in a population of different hairpin structures. Variation in stem structure may also affect the generation of cleavage by Drosha and Dicer. This can lead to variations in things.

[0238] Other agents capable of downregulating cathepsin C, CELA3A, and CELA1 specifically cleaves the mRNA transcripts or DNA sequences of cathepsin C, CELA3A, and CELA1. DNAzymes are molecules that can bind to single-stranded and double-stranded target sequences. A single-stranded polynucleotide capable of cleaving both ends of a sequence (Breaker) RR and Joyce G. Chemistry and Biology Biology 1995;2:655; Santoro SW & Joyce, GF Proc. Natl. Acad. Sci. USA, 1997;943:4262. A general model for DNAzymes (the "10-23" model) The "10-23" DNAzyme is a catalytic domain of 15 deoxyribonucleotides. and has two adjacent substrate recognition domains of 7 to 9 deoxyribonucleotides each. This type of DNAzyme binds to the purine:pyrimidine junction (also called the junction). (Santoro, SW & Joyce, GF , Proc. Natl. Acad. Sci. USA 199; for the review of DNAzymes, see Khachigian ( )LM[Curr Opin Mol Ther(Current Opinion in Molecular Therapeutics Journal of Clinical Chemistry 4:119-21 (2002).

[0239] Construction and characterization of synthetic and engineered DNAzymes that recognize single- and double-stranded target cleavage sites Examples of gene expression and amplification are disclosed in US Patent No. 6,326,174 to Joyce et al. A DNAzyme of similar design to the receptor inhibits urokinase receptor expression. , and was recently observed to successfully inhibit colon cancer cell metastasis in vivo (Itoh ( Ito et al., 2002, Abstract 409, Ann Meeting Am Soc Gen Ther www In another application, a DNAzyme complementary to the bcr-ab1 oncogene is used to induce leukemia. Successful suppression of oncogene expression in diseased cells and autologous bone marrow in cases of CML and ALL It has been successful in reducing recurrence rates in transplants.

[0240] Downregulation of cathepsin C, CELA3a, and CELA1 also correlates with the downregulation of cathepsin C, CELA Amino acids capable of specifically hybridizing to mRNA transcripts encoding A3A and CELA1 This can be achieved by using transsense polynucleotides.

[0241] Efficiently downregulates at least one of intracellular CELA3A, CELA1, and / or cathepsin C. The design of antisense molecules that can be used to regulate This must be done while taking into account two aspects that are important to the approach. The first embodiment involves delivery of the oligonucleotide to the cytoplasm of the appropriate cell, while the second embodiment involves delivery of the oligonucleotide to the cytoplasm of the appropriate cell. Oligonucleotides that specifically bind to designated mRNAs in cells to inhibit their translation This is the design.

[0242] Prior art techniques have been used to efficiently deliver oligonucleotides to a wide variety of cell types. [See, e.g., Luft, J Mol Med (Journal of Molecular Medicine 76:75-6(1998); Kronenwett et al. , Blood 91:852-62 (1998); Rajur et al. Bioconjug Chem Conjugate Chemistry 8:935-40 (1997); Lavigne et al., Bioche m Biophys Res Commun (Biochemical and Biphysical Research Commun) Applications 237:566-71 (1997) and Aoki et al. (1997) Biochem Biophys R See es Commun 231:540-5 (1997)].

[0243] Furthermore, these sequences are used to engineer structural changes in both the target mRNA and the oligonucleotide. Based on the thermodynamic cycle that describes the energy theory, Algorithms for identification by predicted binding affinity are also available [e.g., Walt Walton et al., Biotechnol Bioeng (Biotechnology and Bioengineering) [See Journal of the American Psychological Association (1999) 65:1-9]

[0244] Such algorithms are the first step to implementing antisense approaches in cells. For example, the algorithm developed by Walton et al. On mouse globin (RBG) and mouse tumor necrosis factor-alpha (TNF-alpha) transcripts This has enabled scientists to successfully design antisense oligonucleotides. The same research group more recently evaluated the Three model target mRNAs (human lactate dehydrogenases A and B and The antisense activity of rationally selected oligonucleotides against rat gp130 was In almost all cases, phosphodiester and phosphorothioate oligonucleotides This included testing against three different targets in two cell types using nucleotide chemistry, demonstrating efficacy. reported that this proved to be efficient.

[0245] Additionally, we designed and predicted the efficacy of specific oligonucleotides using an in vitro system. Several approaches to this have also been published (Matveeva et al., Nature B Nature Biotechnology 16:1374-1375 (1998).

[0246] Other agents that can downregulate cathepsin C, CELA3A, and CELA1 can specifically cleave mRNA transcripts encoding cathepsin C, CELA3A, and CELA1. Ribozymes are molecules that can bind to mRNA encoding a protein of interest. It is increasingly used for sequence-specific inhibition of gene expression by cleavage [Welch et al., Cu rr Opin Biotechnol.(Current Opinion in Biotechnology)9:486-96( The possibility of designing ribozymes to cleave any specific target RNA is This has made it a valuable tool in both basic research and therapeutic applications. Zymes are used to treat infectious diseases, dominant oncogenes in cancer, and specific muscle damage in genetic disorders. It has been used to target viral RNAs in vacuolar mutations (Welch et al., Clin Diagn Virol. Clinical and Diagnostic Virology 10:163-71(1998)]. Also noteworthy is that some ribozyme gene therapy protocols for HIV patients It is already in Phase 1 trials. More recently, ribozymes have been used in transgenic animals. Ribozymes have been used in research, gene target validation, and pathway elucidation. Several ribozymes are in clinical trials. ANGIOZYME is the first to be studied in human clinical trials. ANGIOZYME is a chemically synthesized ribozyme that inhibits VEG, a key component in the angiogenesis pathway. Specifically inhibits the formation of Fr (vascular endothelial growth factor receptor). Ribozyme Pharmaceuticals, Ribozyme Pharmaceuticals, Inc. and other companies are using animal models Heptazyme has demonstrated the importance of antiangiogenic therapy in the treatment of hepatitis C virus (HCV) RNA It is a ribozyme designed to selectively destroy hepatitis C virus in cell culture assays. It has been found to be effective in reducing viral RNA (Ribozyme Pharmaceuticals, ncorporated-WEB homepage).

[0247] Thus, for any given sequence in the cathepsin C, CELA3A and CELA1 regulatory regions, A triplex-forming sequence can be designed based on the above. or at least 15, more preferably 25, and even more preferably 30 or more They are often many nucleotides long, up to 50 or 100 bp.

[0248] Transfection of cells with TFOs (e.g., by cationic liposomes), and The formation of a triple helix structure with the target DNA induces steric and functional changes that accelerate transcription initiation. Initiation and elongation are blocked, allowing the introduction of desired sequence changes in the endogenous DNA, and This results in specific downregulation of the expression of TFOs and genes. Examples of such suppression of gene expression in cells include the suppression of gene expression in cells treated with TFOs. Examples of such suppression of expression include episomal supFG1 and endogenous HP in mammalian cells. RT gene knockout (Vasquez et al., Nucl Acids Res. Acids Research 1999;27:1176-81 and Puri et al., J Biol Chem Journal of Chemical Biology, 2001;276:28991-98), and prostate Sequence- and target-specific downregulation of expression of Ets2 transcription factor, important in cancer pathogenesis tion (Carbone et al., Nucl Acid Res. 2003;31:833-43), and inflammatory induction The exogenous ICAM-1 gene (Besch et al., J Biol Chem, 2002;277:32473-79) Furthermore, Vuyisich and Beal recently demonstrated that sequence-specific TFOs It can bind to RNA and act as a dsRNA-dependent enzyme, such as an RNA-dependent kinase. (Vuyisich and Beal, Nuc. Acids Res 2000;2 8:2369-74).

[0249] Additionally, TFOs designed according to the above principles can perform DNA repair. It is possible to induce directed (also called directed) mutagenesis, thus reducing the expression of endogenous genes. Both down- and up-regulation are provided (Seidman, Ideman and Glazer, J Clin Invest (The Journal of Clinical (Nical Investigation) 2003;112:487-94). Design, synthesis and characterization of effective TFOs. A detailed description of the method and control is provided in U.S. Patent Application No. 2003017068 to Froehler et al. and Nos. 2003 0096980, and 2002 0128218 and 2003 0096980 to Emanuele et al. 2002 0123476, as well as U.S. Patent No. 5,721,138 to Lawn. This can be done.

[0250] Exemplary nucleoside analogs of CELA1 and CELA3A that can be targeted by polynucleotide agents of the present teachings are shown. The acid region is SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 , SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 However, any of cathepsin C, CELA1 and / or CELA3A may be used. Any nucleic acid region can be used in accordance with the teachings of the present invention to silence its expression in a targeted manner. It will be understood that this can be done.

[0251] The present invention further provides a method for detecting moderate to stringent hybridization. Under the conditions of CELA1 and / or CELA3A, the CELA providing an isolated polynucleotide that does not hybridize to CELA2A or CELA3B In the present invention, stringent hybridization conditions are, for example, 10% dextrose lan sulfate, 1 M NaCl, 1% SDS and 5 × 10 6 Hybridization with cpm 32p labeled probe Wash with a washing solution of 0.2x SSC and 0.1% SDS at 65°C, and a final wash at 65°C. whereas moderate hybridization conditions are, for example, 10% dextrose phosphate buffer, 1M NaCl, 1% SDS, and 5×10 6 Hybridization containing cpm 32p labeled probe with a final wash solution of 1x SSC and 0.1% SDS at 65°C, and with a final wash solution of 1x SSC and 0.1% SDS at 50°C. It can be applied in the final wash.

[0252] The present invention further provides a method for the preparation of a nucleotide sequence that specifically hybridizes to cathepsin C, but does not exhibit moderate or severe activity. Stringent hybridization conditions detect cathepsins A, B, D, E, G, H, K, L1, and L 2, O, S, W or Z do not provide isolated polynucleotides.

[0253] Downregulating cathepsin C, CELA1 and / or CELA3A expression in necrotic cells The isolated polynucleotide agent for inducing the induction of a cellular response can itself be provided to the cell. Such polynucleotide agents are typically administered to cells as part of an expression construct. In this case, the polynucleotide agent may be constitutively or partially transfected to direct expression of the polynucleotide agent in the cell. of cis-acting regulatory elements (e.g., promoters) that can be directed in an inducible manner. It is regulated and linked in a nucleic acid construct.

[0254] The expression constructs of the present invention may also be modified to make them suitable for replication and integration in eukaryotes. A typical cloning vector may contain additional sequences (e.g., a shuttle vector) that allow The vector contains transcription and translation initiation sequences (e.g., promoter, enhancer) and transcription and translation promoters. and a translation terminator (e.g., a polyadenylation signal). The construct may be adjacent to or separate from the promoter sequence from which it upregulates transcription. The nucleic acid sequence may further comprise an enhancer that can enhance the expression of the nucleic acid sequence.

[0255] In addition to the embodiments already described, the expression constructs of the present invention typically comprise a cloning increase the expression level of the recombinant nucleic acid or facilitate the identification of cells that harbor the recombinant DNA. For example, many animal viruses can be expressed in permissive cells. These viruses contain DNA sequences that promote extrachromosomal replication of the viral genome. The replicon-carrying plasmid may be carried on the plasmid or on the genome of the host cell. It will replicate episomally as long as the appropriate factors are provided by either gene.

[0256] Expression constructs of the present invention may or may not contain a eukaryotic replicon. If the replicon is present, the vector can be transformed into a eukaryotic cell using an appropriate selectable marker. If the construct does not contain a eukaryotic replicon, episomal amplification can occur. No. Instead, the recombinant DNA is integrated into the genome of the engineered cell, where it In general, a promoter directs the expression of a desired nucleic acid.

[0257] Suitable gene delivery vehicles / methods (transfection, transduction, etc.) and suitable Any suitable expression system can be used to introduce the nucleic acid construct into the necrotic cells of the present invention.

[0258] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, p ZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5 , DH26S, DHBB, pNMT1, pNMT41, and pNMT81, which were purchased from Invitrogen. pCI is available from Promega, and pM pBK-bac, pPbac, pBK-RSV, and pBK-CMV, which were purchased from Strategene. pTRES is available from Clontech, and and their derivatives.

[0259] A variety of methods can be used to introduce the expression vectors of the present invention into human cells. Such methods are comprehensively described, for example, in: Sambrook J. and Russell DW (1989, 1992, 2001), Molecular Cloning: A Laboratory Manual Laboratory Manual), Cold Springs Harbor Laboratory (Cold Springs Harbor Laboratory) Spring Harbor Laboratory, New York; Ausubel Bell, RM et al., eds. (1994, 1989). Current Protocols in Molecular Biology. Current Protocols in Molecular Biology, John Wiley and Soc. John Wiley & Sons, Baltimore, MD, USA Land State) (1989); Chang PL et al., ed. (1995). Somatic Gene Therapy ( Somatic Gene Therapy, CRC Press, Boca Raton Vega, MA (1995). Gene Targeting. Getting, CRC Press, Boca Raton, FL. Rodriguez R. L. and Denhardt DH (1987). Vectors: A Survey of Molecular Cloning Vectors and Their Uses (Survey for Use), Butterworth-Heinemann, Boston , Massachusetts; and Gilboa E. et al. (1986). Transfer and Expression of cloned genes using retroviral vectors Introduction and expression of cloned genes using Biotechniques 4(6) 504-512; and, for example, stable or transient transfection, Lipofection, electroporation, and infection with recombinant viral vectors Further, U.S. Patent No. 5,464,764 and U.S. Patent No. 5,464,764 for positive-negative selection methods are also included. See U.S. Pat. Nos. 5,487,992 and 5,487,992.

[0260] At least one of intracellular CELA3A, CELA1, and / or cathepsin C is intracellular Being targeted, the agents of the present invention can be formulated for intracellular delivery. High affinity binding molecules (eg, antibodies) can further be engineered for intracellular delivery.

[0261] In some embodiments, the RNA silencing agents provided herein are cell-permeable. As used herein, a "cell-penetrating peptide" refers to a molecule capable of functionally associating with a peptide. A "tide" is a short (approximately 12-30 residues) amino acid sequence or peptide containing a functional motif. It has energy-independent (i.e., non-endocytic) translocation properties, which allow it to penetrate membranes. The present invention provides a method for the transport of the functional complex across the plasma and / or nuclear membranes of cells. In some embodiments, the membrane-permeable complex preferably contains at least one non-functional cysteine ​​residue. Preferably, it comprises a hydroxyl group, either free or derivatized, for such linkage. It forms disulfide bonds with double-stranded ribonucleic acid modified with Representative amino acid motifs are listed in U.S. Pat. No. 6,348,185, the contents of which are incorporated by reference. The cell penetrating peptide of some embodiments of the present invention comprises: Preferred, but not limited to, are penetratin, transportan, pIsl, TAT(48-60), pV These include EC, MTS, and MAP.

[0262] Thus, for example, the binding of these antibodies to target cells (e.g., necrotic cells) in the present invention For delivery, lipid-based systems can be used.

[0263] Liposomes include any synthetic (i.e., naturally occurring) lipid bilayer that encloses a volume. Liposomes include emulsions, foams, micelles, and insoluble structures. These include polymeric monolayers, liquid crystals, phospholipid dispersions, lamellar (lamellar) layers, and the like. Liposomes can be prepared by any method known in the art. [Monkkonen J. et al., 1994, J. Drug Target (Journal of Drug Targeting), 2:299-308; Monkkonen, J. et al., 1993, Calcif. Tissue Int. Feed Tissue International, 53:139-145;Lasic D D. , Liposomes Technology Inc., Elsevier A), 1993, 63-105. (Chapter 3); Winterhalter M, Lasic DD, C hem Phys Lipids (Chemistry and Physics of Lipids), September 1993 ;64(1-3):35-43]. Liposomes may be positively charged or neutral. For mononuclear phagocyte system (MPS) uptake, the liposome membrane Hydrophilic masking of the membrane (e.g., the use of polyethylene glycol-conjugated lipids and hydrophilic particles) Liposomes should be hydrophobic because some liposomes (e.g., those derived from cephalosporins) may be less likely to uptake MPS. Liposomes can also contain sterically hindered lipids, such as ganglioside GM1 and and phosphatidylinositol, these lipids inhibit MPS uptake. Therefore, it is preferable not to include it.

[0264] Liposomes may be single lipid layers or multilayered. If the agent is hydrophilic, large unilamellar vesicles ( The delivery of therapeutic drugs can be further improved by using small particles (also called vesicles). If is hydrophobic, its delivery can be further improved using multilamellar vesicles. , therapeutic agents (e.g., antibodies) may not be able to penetrate the lipid bilayer, and As a result, it will remain adsorbed on the liposome surface. In this case, increasing the surface area of ​​the liposome By adding a suitable hydroxybenzoate to the composition of the present invention, the delivery of the therapeutic agent can be further improved. Liposomes may be non-toxic liposomes, such as phosphatidylcholine phosphoglycerol, and liposomes prepared from cholesterol. The diameter of the liposomes can range from 0.1 to 1.0 microns (micrometers). However, other size ranges suitable for phagocytosis by phagocytes may also be used. Homogenization can be used to size the particles, which can be used to It relies on shear energy to fragment large liposomes into smaller ones. Conveniently used homogenizers include those manufactured by Microfluidics, Boston, MA. This includes microfluidizers manufactured by Luidix. In typical homogenization procedures, the size of selected liposomes is observed. Recirculate the liposomes through a standard emulsion homogenizer until The particle size distribution can be monitored by conventional laser beam particle size discrimination. Extrusion of liposomes through small-pore polycarbonate membranes or asymmetric ceramic membranes It is an effective method for reducing the size of liposomes to a relatively well-defined size distribution. Typically, the suspension is cycled through the membrane one or more times until the desired liposome size distribution is achieved. Liposomes are extruded through progressively smaller pore membranes to reduce the size of the liposomes. It can be gradually reduced.

[0265] The therapeutic agents of some embodiments of the present invention can be prepared using any method known in the art. For example, a high affinity molecule (e.g., an antibody) can be incorporated into the liposome. Alternatively, it may be adsorbed to the surface of the liposome. Other methods that can be used to incorporate pharmaceutical agents into the liposomes of the invention include Alfonso et al. (Alfonso) et al. [The science and practice of pharmacy ( The Science and Practice of Pharmacy, Mack Publishing, Easton (Easton) Pa(Pennsylvania) 19th ed.(19th edition), (1995)] and Kulkarni ( The method described by Kulkarni et al. [J. Microencapsulation. (Journal of Microelectronics) (Roencapsulation) 1995, 12(3)229-46.

[0266] The liposomes used in the method of the present invention preferably cross the blood barrier. Therefore, the liposomes of the present invention preferably contain polysaccharides ( Preferably, the liposomes of the present invention do not include blood barrier targeting. The drug does not contain peptides in the membrane portion that target receptors on the blood barrier. Examples of suitable peptides include, but are not limited to, transferrin, insulin, IGF-1, and IGF-2 antigens. Transferrin receptor antibody, anti-insulin receptor antibody, anti-IGF-1 receptor antibody These include antibodies against IGF-2 receptors and anti-IGF-2 antibodies.

[0267] To determine which liposomes are particularly suitable according to the present invention, a screening assay is performed. For example, U.S. Patent Application No. 20040266734 and U.S. Patent Application No. No. 20040266734; and Danenberg et al., Journal of Cardiovascular lar pharmacology (Journal of Cardiovascular Pharmacology) 2003 , 42:671-9;Circulation 2002, 106:599-605;Circulation 20 03, 108:2798-804.

[0268] According to one embodiment, the method for preventing or inhibiting cellular necrosis comprises administering a therapeutically effective amount of ... Alternatively, it may be performed ex vivo (also called outside the body).

[0269] The ability to modulate at least one of intracellular CELA3A, CELA1, and / or cathepsin C It can be used as a novel therapeutic modality for the treatment of necrosis-induced cell death. It can be used.

[0270] Thus, according to another aspect of the present invention, a medical disease or condition associated with cellular necrosis is provided. 2. A method for treating a subject in need thereof, comprising administering to a subject a therapeutically effective amount of a drug. and administering to the subject a method for detecting cathepsin C, CELA3A, or a combination thereof in cells of the subject. and CELA1 expression, and / or In addition, it inhibits their activity.

[0271] The term "treat" refers to inhibiting or preventing the onset of a disease, disorder, or condition; and / or causing the alleviation, remission or regression of a disease, disorder or condition; may suffer from a disease, disorder or medical condition, occurs in subjects who have not yet been diagnosed with a disease disorder or condition. Those skilled in the art will appreciate that various methods can be used to assess the onset of a disease, disorder, or condition. The methodologies and assays can be used, and similarly, to alleviate a disease, disorder or condition. A variety of methodologies and assays can be used to assess reduction, remission, or regression. You will understand that.

[0272] As used herein, the term "subject" refers to an animal, preferably a mammal, most preferably a mammal. Preferably, the present invention refers to a human suffering from or susceptible to a necrosis-related disorder or condition. Includes both young and old people of both genders.

[0273] Diseases or conditions associated with cellular necrosis include neurodegenerative diseases, dementia, Parkinson's disease ( Parkinson's disease, Alzheimer's disease, muscular dystrophy, leukemia, lymphoma, respiratory Distress (neonatal respiratory distress), suffocation, incarcerated hernia (constricted hernia), diabetes, tuberculosis, uterus Endometriosis, vascular dystrophy, psoriasis, cold injury, iron-loading complications ( iron-load complication, steroid treatment complications, ischemic heart disease, reperfusion injury, cerebral hemorrhage ductal disease or injury, gangrene, pressure sores, pancreatitis, liver inflammation, hemoglobinuria, meningitis, sphacelus, ischemic necrosis, avascular necrosis ular necrosis (e.g., bone), bacterial sepsis, viral sepsis, burns ), high fever (rise in body temperature), Crohn's disease, celiac disease, compartment syndrome, necrotizing rectum Enteritis (necrotizing colitis), cystic fibrosis, rheumatoid arthritis, nephrotoxicity, multiple sclerosis, spinal cord injury , glomerulonephritis, osteoarthritis (degenerative arthritis), tyrosemia (tyrosinemia), hypothyroidism metabolic inherited disease, mycoplasmosis, anthrax Infection, bacterial infection, viral infection, Anderson disease, congenital mitochondrial disease Doria disease, phenylketonuria, placental infarction, syphilis, aseptic necrosis, ischemic necrosis, alcohol Drug dependence and necrosis associated with administration and / or self-administration and / or exposure is associated with administration and / or self-administration with, and / or exposu re to) cocaine, drugs, chemical toxins, pesticides and heavy metals, dermal fillers (skin Necrosis related to the administration of ectopic drugs, e.g., dextromethorphan such as thrombus solution, chemotherapy drug extravasation, chemotherapy-induced necrosis, radiation-induced necrosis , including conservative management of transplant tissue and aging.

[0274] According to one embodiment, the disease or condition associated with cell necrosis is brain injury (e.g., traumatic brain injury). damage).

[0275] Thus, the present method is useful for treating necrosis associated with any acute or chronic central nervous system (CNS) injury. Such diseases or conditions include, but are not limited to, stroke (hematoma), caused by thrombosis, embolism, or vasoconstriction), closed head injury, global cerebral ischemia ( Examples include myocardial infarction, arrhythmia, hemorrhagic shock, and brain injury after coronary artery bypass grafting. These may include ischemia due to systemic hypotension of any cause, including cerebrospinal fluid (CN), focal ischemia, and intracranial hemorrhage. Ischemic damage to the S (central nervous system) can result from either global or focal ischemic conditions. Global ischemia is the loss of blood to the entire brain for a period of time, such as during cardiac arrest. Local ischemia occurs when part of the brain is deprived of normal blood flow, for example For example, thromboembolic occlusion of cerebral blood vessels, traumatic head injury, suppuration CNS damage resulting from cerebral ischemia occurs during brain tumors and other brain disorders. It occurs hours or even days after a hemorrhagic condition and is caused by cytotoxic activity by damaged tissue. This occurs secondary to the release of the product.

[0276] In some embodiments, the present invention provides a method for treating a cancer caused by any known cause, e.g., infection-based or Liver toxicity resulting from exposure to toxic substances or otherwise as would be understood by one of skill in the art Of particular consideration is the treatment or prevention of

[0277] In some aspects, the present invention, as will be appreciated by those skilled in the art, In particular, the present invention relates to the treatment or prevention of heart disease, including myocardial infarction, heart failure, heart disease, and others. Plan separately.

[0278] According to the present teachings, to treat a medical disease or condition associated with cell necrosis, a subject Specific expression of cathepsin C, CELA1 and / or CELA3A or structurally related enzymes down-regulating the ATP-dependent ATPases and, alternatively or additionally, by agents that inhibit their activity. and will be further managed as detailed above.

[0279] Each of the above-mentioned down-regulating agents or down-regulating agents is encoded The expression vector can be administered to an individual either by itself or in a pharmaceutical formulation that also includes a physiologically acceptable carrier. As part of a composition, or in some embodiments, as a conjugate, charged particle, liposome, It is understood that the composition may be administered as part of a carrier, such as a gelatin, ... gel, or any other carrier known in the art. which in some embodiments may then be further formulated as part of a pharmaceutical composition. The purpose of a pharmaceutical composition is to facilitate the administration of an active ingredient to an organism.

[0280] As used herein, a "pharmaceutical composition" refers to a pharmaceutical composition containing one or more of the active ingredients described herein. Formulation with other chemical components, such as physiologically suitable carriers and excipients The purpose of a pharmaceutical composition is to facilitate the administration of a compound to an organism.

[0281] As used herein, the term "active ingredient" refers to intracellular CELA3A, CELA1, and / or cathepsin C. At least one down-regulating or inhibitory agent that can explain the biological effect It extends to.

[0282] Hereinafter, the terms "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" are used. The terms may be used interchangeably and do not cause significant irritation to the organism; and Adjuvant refers to a carrier or diluent that does not abolish biological activity and properties. are included under these terms.

[0283] Herein, the term "excipient" refers to an additive that is added to a pharmaceutical composition to further facilitate administration of the active ingredient. Examples of excipients include, but are not limited to, calcium carbonate, calcium carbonate, calcium carbonate, calcium carbonate derivatives ... calcium phosphate, various sugar and starch types, cellulose derivatives, gelatin, vegetable oil and polyethylene glycol.

[0284] Techniques for drug formulation and administration are described in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, latest edition. Cut.

[0285] Suitable routes of administration include, for example, oral, rectal, transmucosal, particularly nasal, intestinal or parenteral delivery. These include intramuscular, subcutaneous and intrathecal injections as well as intrathecal, direct intraventricular, intracardiac, e.g. For example, into the right or left ventricular cavity, into the common coronary artery, intravenously, intraperitoneally, intranasally, or ophthalmically. Intravenous injection may be included.

[0286] Conventional approaches for drug delivery to the central nervous system (CNS) include: surgical strategies (e.g., intracerebral or intraventricular injection); molecular manipulation of drugs (e.g., have affinity for endothelial cell surface molecules in combination with drugs that cannot cross the BBB The aim of this study was to utilize one of the endogenous transport pathways of the BBB by producing chimeric fusion proteins containing transport peptides that interact with the BBB. pharmacological strategies designed to increase the lipid solubility of drugs (e.g. for example, conjugation of water-soluble drugs to lipid or cholesterol carriers); and high permeability Transient disruption of BBB integrity by pressure disruption (injection of mannitol solution into the carotid artery or The use of biologically active agents, such as angiotensin peptides, (caused by)

[0287] According to one embodiment of the present invention, the pharmaceutical composition is formulated to penetrate cell membranes. Thus, for example, the pharmaceutical composition may comprise lipid vesicles.

[0288] Alternatively, some may, for example, administer the pharmaceutical composition to a patient (meaning primarily a patient). By injecting directly into tissue areas (e.g., necrotic tissue) that are more susceptible than systemic administration, Alternatively, the pharmaceutical composition can be applied topically.

[0289] Pharmaceutical compositions of some embodiments of the present invention can be prepared, for example, by conventional mixing, dissolving, granulating, Granulation, dragee making, powdering (gel) (levigatin g) by emulsification, encapsulation, entrapment or freeze-drying processes, processes well known in the art. It can be produced by

[0290] Thus, pharmaceutical compositions for use in accordance with some embodiments of the present invention may be prepared in the form of a pharmaceutical Excipients and adjuvants that facilitate the processing of the active ingredient into the preparations that can be used above These can be formulated in a conventional manner using one or more physiologically acceptable carriers, including Proper formulation is dependent upon the route of administration chosen.

[0291] For injection, the active ingredients of the pharmaceutical composition are dissolved in an aqueous solution, preferably in a physiologically compatible buffer. agents such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0292] For oral administration, the pharmaceutical composition may contain the active compound in pharmaceutically acceptable carriers well known in the art. The compound can be easily formulated by combining it with a suitable carrier. , the pharmaceutical composition is formulated into tablets, pills, dragees, capsules, Formulated as liquids, gels, syrups, slurries, suspensions, and the like. Pharmaceutical preparations for oral use may contain suitable adjuvants as needed. After addition, solid excipients are optionally used to obtain tablets or dragee cores. The resulting mixture can be milled and the resulting granulated mixture processed. Suitable excipients are, in particular, , bulking agents, such as sugars, such as lactose, sucrose, mannitol , or sorbitol; cellulose preparations, e.g., corn starch, wheat Starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose cellulose, hydroxypropyl methylcellulose, sodium carbomethylcellulose, etc. and / or physiologically acceptable polymers, such as polyvinyl alcohol; Optionally, cross-linked polyvinylpyrrolidone (PVP) may be included. , agar, or alginic acid or a salt thereof, such as sodium alginate. Any disintegrant may be added.

[0293] Dragee cores are provided with a suitable coating. For this purpose, concentrated sugar solutions are used. These include gum arabic, talc, polyvinylpyrrolidone, carbopoly alcohol gel, polyethylene glycol, titanium dioxide, lacquer solution and suitable organic solvents Alternatively, a solvent mixture may be optionally included. Dyes or pigments are added to tablets or dragee coatings to characterize different combinations of It may be added.

[0294] Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin. and gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules are flexible, sealed capsules made of materials such as The active ingredient is separated by a filler, such as lactose, or a binder, such as dextran. starch, etc., lubricants such as talc or magnesium stearate In the soft capsule, the active ingredient may be mixed with the active ingredient and optionally with a stabilizer. The active ingredient is a suitable liquid, for example, fatty oil, liquid paraffin, or liquid polyethylene. It may be dissolved or suspended in a solvent such as glycol. In addition, a stabilizer may be added. All formulations for oral administration must be in dosages appropriate for the chosen route of administration. It must be.

[0295] For buccal (also called oral) administration, the compositions may be administered in the form of tablets or tablets formulated in a conventional manner. It can take the form of a lozenge (also called a troche).

[0296] Active ingredients for use according to some embodiments of the present invention for administration by nasal inhalation may be used in a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, di Pressurized packs or nebulizers involving the use of chloro-tetrafluoroethane or carbon dioxide These are customarily delivered in the form of aerosol spray presentations. In the case of a drug, the dosage unit is determined by providing a valve to deliver a metered amount. Capsules, e.g., gelatin capsules, for use in dispensers, and The cartridges may be filled with the compound and a suitable powder base such as lactose or starch. It can be formulated to contain any powder mixture.

[0297] The pharmaceutical compositions described herein can be administered parenterally, for example, by bolus injection or continuous infusion. Injectable preparations can be formulated for administration in unit dosage form, e.g., in ampoules. The composition may be presented individually or in multi-dose containers, optionally with a preservative. The product may be a suspension, solution or emulsion in an oily or aqueous vehicle, and and formulatory agents, such as suspending, stabilizing and / or dispersing agents. It may contain any of these.

[0298] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Suspensions of the active ingredients may be prepared as appropriate oily or water-based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil. or synthetic fatty acid esters, such as ethyl oleate, triglycerides or Liposomes and the like are included. Aqueous injection suspensions increase the viscosity of the suspension. Substances such as sodium carboxymethylcellulose, sorbitol or dextromethorphan. Optionally, the suspension may also include a solvent such as toluene, which allows for the preparation of highly concentrated solutions. In order to improve the solubility of the active ingredients, suitable stabilizers or agents which increase the solubility of the active ingredients may also be included.

[0299] Alternatively, the active ingredient may be reconstituted in a suitable vehicle, e.g., sterile, pyrogen-free, before use. It may be in powder form for constitution with a water-based solution that does not contain

[0300] The pharmaceutical compositions of some embodiments of the present invention are rectal compositions, such as suppositories or retention enemas. In the intestines, for example, with conventional suppository bases, e.g., cocoa butter or can also be formulated using other glycerides, etc.

[0301] Pharmaceutical compositions suitable for use in connection with some embodiments of the present invention comprise an active ingredient The present invention includes compositions containing the compounds of the present invention in an amount effective to achieve its intended purpose. A therapeutically effective amount is an amount effective to prevent, alleviate, or ameliorate symptoms of a disorder (e.g., cell necrosis). an amount of an active ingredient (e.g., intracellular CELA3A, CELA3B) that is effective or prolongs the survival of the subject being treated; The number of drugs that downregulate or inhibit LA1 and / or cathepsin C at least one.

[0302] According to one embodiment of the present invention, an effective amount of the agent of the present invention is sufficient to induce cell apoptosis of cell necrosis. The amount is selected to cause conversion to isoform.

[0303] As used herein, the term "cellular apoptosis" refers to the process of programmed cell death. Apoptosis refers to the cellular process of apoptosis, characterized by distinct morphological changes in the cytoplasm and nucleus, chromatin cleavage at regularly spaced sites and endonucleosomal fragmentation of genomic DNA These changes include blebbing (i.e., cytoplasmic cleavage of the nucleoproteins), and These include cell shrinkage, nuclear fragmentation, chromosome condensation, and chromosomal DNA fragmentation. Unlike necrosis, apoptosis produces cell fragments called apoptotic bodies, which are engulfed by phagocytes before their contents spill over into surrounding cells and cause damage. It can be removed quickly.

[0304] Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein. It is within the capabilities of

[0305] For any preparation used in the methods of the present invention, a therapeutically effective amount or dose is , can be estimated initially from in vitro and cell culture assays (e.g., (See Examples 1-3 in the Examples section.) Additionally, doses may be adjusted to achieve the desired concentration or titer. Such information can be used to inform useful doses in humans. can be used to more accurately determine

[0306] The toxicity and therapeutic efficacy of the active ingredients described herein may be determined in vitro, in cell culture, or experimental These in vitro and in vivo studies can be performed by standard pharmaceutical procedures in animals. Data obtained from cell culture assays and animal studies are not intended to support the dosing of A range of dosages can be used in formulating the dosage. The exact formulation, route of administration and dosage may vary depending on the patient. The choice can be made by individual physicians taking into account the patient's condition (e.g., Fingl Ingle et al., 1975, The Pharmacological Basis of Therapeutics Foundation), see Ch.1 (Chapter 1) p.1 (Page 1)).

[0307] Animal models for necrotizing diseases and conditions include the porcine model of aseptic necrosis [e.g., See, e.g., Muller-Vahl H and Pabst R., Int J Tissue Research ct.(International Journal of Tissue Reactions)(1984)6 (3):251-4], and a sheep model for femoral head necrosis [J. Manggold et al. , Laboratory Animals (2002) 36, 173-180].

[0308] Dosage and interval are determined based on the minimum effective concentration (MEC) required to induce or inhibit the biological effect. The MEC may be adjusted individually to provide a sufficient quantity of the active ingredient. The amount of ATP needed to achieve the MEC varies depending on the individual and can be estimated from in vitro data. The appropriate dosage will depend on individual characteristics and route of administration. Detection assays can be used to measure plasma concentrations. The degree can be determined.

[0309] Dosing may last from a few days to several weeks, depending on the severity and responsiveness of the condition being treated. A single treatment is administered until a subsequent course of treatment or cure is effected or a diminution of the disease state is achieved. Or it can be multiple applications.

[0310] The amount of composition administered will, of course, depend on the subject being treated, the severity of the affliction, the mode of administration, the treatment The decision will depend on the judgment of the doctor in charge.

[0311] The compositions of some embodiments of the present invention are optionally packaged in a pack or dispenser. The devices may be provided in, for example, an FDA approved kit, etc. The pack may contain one or more unit dosage forms containing the active ingredient. or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. or dispensers may also be licensed by government agencies that regulate the manufacture, use, or sale of pharmaceutical drugs. may be contained in a form prescribed by the Food Sanitation Standards Act and by a notice accompanying the container, which notice shall state the composition reflects approval by an authority for the product form or human or veterinary administration. For example, labeling approved by the U.S. Food and Drug Administration for prescription drugs or approved The present invention may be formulated in a compatible pharmaceutical carrier. A composition containing the preparation may be prepared and placed in a suitable container as further detailed above. and may be labeled for treatment of an indicated condition.

[0312] The medicaments of the present invention are suitable as pharmaceutical compositions that can be suitably packaged as articles of manufacture. Such articles of manufacture may be used in the treatment of necrosis-related diseases. The packaging material contains a pharmaceutically effective amount of the down-regulating agent. Packaging of steroids.

[0313] Each of the agents or compositions of the present invention may be used in combination with other known treatments, including, but not limited to, anti-apoptotic It will be appreciated that the therapeutic agents may be administered in combination, including anti-inflammatory or anti-inflammatory agents.

[0314] The agent or composition of the present invention may be administered before, simultaneously with, or after the administration of the latter. obtain.

[0315] Anti-apoptotic agents that can be used in accordance with the present teachings include, but are not limited to, -[R]-N -[2-heptyl]-methylpropargylamine (R-2HMP), Vitamin E, Vitamin D, Caspar These include zein inhibitors and the hydrophilic bile salt ursodeoxycholic acid.

[0316] Anti-inflammatory agents that can be used in accordance with the teachings of the present invention include, but are not limited to, acrofenib, Enac; Alclometasone dipropanoate; Algestone acetonide; Alfa-Amir Ze; Amcinafal; Amcinafide; Amfenac sodium; Amiprilose hydrochloride Salt; Anakinra; Anilorac; Anitrazafen; Apazone; Balsalazide disodium Bendazac; Benoxaprofen; Benzydamine hydrochloride; Bromelain; Bropela mol; budesonide; carprofen; cycloprofen; synthazone; criprofen Clobetasol propionate; Clobetasone butyrate; Clopirac; Propionate Tocloticasone; Cormethasone acetate; Cortodoxone; Deflazacort; Desonide; Deso Diclofenac; Diclofenac potassium; Diclofen Naclisodium; Diflurazone diacetate; Diflumidone sodium; Diflunisal; Difluprednate; Diphthalone; Dimethyl sulfoxide; Drocinonide ;Endrison;Enlimomab;Enolilam sodium;Epirizole;Etodolac;E Tofenamate; Felbinac; Fenamol; Fenbufen; Fenclofenac ;Fenclorac;Fendosal;Fenpipalone;Fentiazat Flufenamic acid; Flumizole; Flunisolide acetate Flunixin; Flunixin meglumine; Fluorocortin butyl; Fluorome Thoronacetate; Fluquazone; Flurbiprofen; Fluretofen (Fluretofen); Fluticasone propionate; Furaprofen; Flobufen; Halcino Nido; Halobetasol propionate; Haloprodone acetate; Ibufenac; Ibupro Ibuprofen; Ibuprofen aluminum; Ibuprofen piconol; Ilonidap idap); indomethacin; indomethacin sodium; indoprofen; indoxol Intrazol; Isoflupredone acetate; Isoxepac; Isoxepac Isoxicam; Ketoprofen; Lofemizole hydrochloride; Lomoxicam m); loteprednol etabonate; meclofenamate sodium; meclofenam Acid;Meclorisone dibutyrate;Mefenamic acid;Mesalamine;Meseclazone;Methylprednisolone Donisolon leptanate; Momiflumate; Nabumetone; Naproxen; Naproxen sodium; naproxol; nimazone; olsalazine sodium; orgotein; ol Panoxin; Oxaprozin; Oxyphenbutazone; Paranyline hydrochloride; Pentosan polysulfide Sodium Polysulfate (Pentosan Polysulfate Sodium); Phenbutazone Sodium Glycerol Piroxicam; Piroxicam cinnamate; Piroxicam olamine ;Pirprofen;Prednazate;Priferon;Prodol acid;Proquazone;Pro Proxazole; Proxazole citrate; Rimexolone; Romazarit; Sarcorex (Sa lcolex; Salnacedin; Salsalate; Sanguinarine chloride narium chloride); seclazone; cermetacin; sudoxicam; sulindac; sprof phen; talmetacin; talniflumate; talosalate; tebufelone; tenidap; te Nidap sodium; Tenoxicam; Tesicam; Tesimide; Tetridamine; Tioprinac ;Tixocortol pivalate;Tolmetin;Tolmetin sodium;Triclonide;Tolmetin Includes liflumidate; zidometacin; and zomepirac sodium.

[0317] To test for therapeutic efficacy, subjects were examined physically and in vitro to assess cell necrosis. Any method known in the art can be used to assess the presence or absence of necrotic cells. A tissue sample can be obtained (e.g., from a subject) and imaged using light, fluorescence, or electron By microscopic techniques or via trypan blue staining, necrotic cells are stained. Necrotic cells can be identified by taking up the enzyme and therefore staining blue. Cells exhibit morphological changes including loss of membrane integrity, organelle disintegration and / or chromatin clumping. They can be distinguished from healthy cells by morphological changes.

[0318] According to another aspect of the present invention, a subject in need thereof is provided with a method for treating and / or preventing aging. The present invention provides a method for detecting cathepsin C in a cell of a subject, the method comprising: (a) detecting cathepsin C in a cell of a subject; specifically downregulates the expression of CELA3A or structurally similar enzymes and CELA1 and / or, alternatively or additionally, administering to the subject an agent that inhibits their activity. and (b) administering an anti-aging agent to a subject, thereby treating and / or inhibiting aging. or preventing.

[0319] According to the present teachings, any anti-aging agent, such as antioxidants, phytochemicals, hormones, and and fatty acids, etc. can be used.

[0320] Exemplary anti-aging agents that can be used in accordance with the present teachings include, but are not limited to, vitamins E, Vitamin C, Coenzyme Q10, Lipoic acid, Folic acid, Selenium, Flavonoids, Carotene, Contains glutamin B and carnitine.

[0321] Molecules that can be used in conjunction with the present teachings are recognized for their specificity as follows: It can be determined.

[0322] Therefore, according to another aspect of the present invention, a drug capable of inhibiting cell necrosis is identified. Another method is provided, which involves introducing a test agent into cells that have been subjected to a necrotic signal. and that the test agent inhibits at least one of intracellular CELA3A, CELA1, and / or cathepsin C. Specifically downregulating the expression of one of the genes and / or additionally downregulating the expression of the other genes. To identify agents that can inhibit the activity of β-glucan and thereby inhibit cell necrosis. Test agents may also interact with other cellular proteins, such as other CELA proteins or proteins. Specificity can be determined by testing its effects on pathways such as proteins. The specificity of the antibody is tested for (as further detailed above under "Specificity").

[0323] In a further preferred embodiment, the present invention provides a method for preventing necrosis and related diseases and conditions. The present invention provides specific small inhibitory molecules for use in the treatment of various diseases. Small inhibitory compounds belonging to various chemical families, e.g., 2-aminoimidazolines, The present invention also relates to the treatment of diseases associated with cell necrosis. Various small molecule inhibitors for use in the treatment and / or prevention of diseases or medical conditions In yet another embodiment, the present invention relates to a method for treating a disease or medical condition associated with cell necrosis. Use of small molecule inhibitors in the manufacture of a medicament for the treatment and / or prevention of a cardiac condition Provided.

[0324] Thus, according to one embodiment, the test agent is a small molecule or a natural inhibitor of elastase. inhibitors (e.g., indole-3-carbinol or flavanol (-) epigallocatechin) and its specific inhibition of CELA1 or CELA3 can be achieved by the present teachings. The test agent can be validated as a specific CELA1 / CELA3A inhibitor. After being tested, they are further analyzed for the inhibition of cell necrosis. Shown in Table 1.

[0325] For example, small molecules in the present invention may be transition state analogs (i.e., small molecules that are capable of reacting with the transition state in an enzyme-catalyzed chemical reaction). These may include chemical compounds that have a chemical structure similar to the transition state of the substrate molecule. These typically do not undergo chemical reactions and act as enzyme inhibitors, and are reversible inhibitors. Inhibitors (i.e., inhibitors that typically bind non-covalently to the enzyme, the enzyme-substrate complex, or both) inhibitors that bind to the enzyme) and irreversible inhibitors (i.e., inhibitors that typically do not react with the enzyme) and chemically modifying it, for example, through covalent bond formation, and These include inhibitors that modify key amino acid residues that are essential for the synthesis of ribosomal proteins.

[0326] With respect to any of the compounds described herein, the present invention also includes any isomers, pharmaceutically acceptable salts thereof. Any possible salts, pharmaceutical products, hydrates, N-oxides, crystals or any combination thereof are contemplated. , and the same are considered part of this invention.

[0327] According to one embodiment, the test agent is a high affinity binding molecule or a polynucleotide and its characteristics of cathepsin C, CELA1, CELA3A or structurally related enzymes. The specific inhibition can be assessed using the present teachings. After being validated, the inhibition of cell necrosis will be further analyzed.

[0328] Thus, according to some embodiments of the present invention, a method for treating a disease or medical condition associated with cell necrosis is provided. US201301226333A1 - Cell-permeable protease inhibitors for use in the treatment and / or prevention of biological conditions - Google Patents The protease inhibitor inhibits necrosis in cells undergoing necrosis. Inhibits the enzymatic activity of at least one intracellular protease involved in cell death. The protease is selected from the group consisting of CELA3A, CELA1, and cathepsin C. In an embodiment, the protease is CELA3A.

[0329] As used herein, the term "about" refers to ±10%.

[0330] The terms "comprises," "comprising," "includes," "including," "having" and and their conjugates (cognate words) mean "including but not limited to" do.

[0331] The term "consisting of" means "including and limited to."

[0332] The term "consisting essentially of" means that additional ingredients, steps and / or parts are not included in the claimed The invention may be modified only if it does not materially alter the basic and novel characteristics of the composition, process, or structure. means that the composition, method, or structure may include additional components, steps, and / or parts. .

[0333] As used herein, the singular forms "a," "an," and "the" are used unless the context clearly indicates otherwise. Unless otherwise indicated, plural references are included. For example, "a compound" or "at least one The term "compound" may include a plurality of compounds, including mixtures thereof.

[0334] Throughout this application, various embodiments of this invention may be presented in a range format. The description in this form is for convenience only and should not be construed as an inflexible limitation on the scope of the invention. It should be understood that the description of a range should not be construed as limiting the scope of the invention. All possible subranges and individual values ​​should be considered specifically disclosed. For example, a range statement such as 1 to 6 can be written as 1 to 3, 1 to 4, 1 to 5, etc. , subranges such as 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within those ranges. The characters, e.g., 1, 2, 3, 4, 5, and 6, should be considered to be specifically disclosed. This applies regardless of the width of the range.

[0335] Whenever a numerical range is given herein, any quoted numbers (including fractions) within the given range may be used. "within" the range of the phrase, the first reference number, and the second reference number. "Range between / and" and "Range within / and from" from the first instruction number to the second instruction number are used interchangeably herein, and the first and second designation numbers and all numbers therebetween This means that all fractional and whole numbers are included.

[0336] As used herein, the term "method" refers to a manner for accomplishing a given task; Refers to means, techniques and procedures, including but not limited to chemical, pharmacological, biological, biochemical known in known forms or readily developed by practitioners of the scientific and medical arts This includes the forms, means, techniques and procedures used.

[0337] Certain features of the invention that are, for clarity, described in the context of separate embodiments, may also be incorporated into a single embodiment. It is understood that in an embodiment they may be provided in combination. Therefore, various features of the invention that are described in the context of a single embodiment may also be used separately or in any combination. In suitable subcombinations or with any other described embodiment of the present invention Certain features described in the context of various embodiments may be provided as part of the embodiments. should not be considered essential features of those embodiments unless the invention is inoperable without those elements. It's not that.

[0338] The various embodiments and aspects of the present invention as described in detail above and as claimed in the following claims are These embodiments find experimental support in the examples below. [Example]

[0339] Reference is now made to the following examples which, together with the above description, illustrate the invention in a non-limiting manner.

[0340] In general, the nomenclature used herein and the experimental procedures utilized in the present invention include molecular, These include biochemical, microbiological and recombinant DNA techniques. Such techniques are well documented. See, for example, "Molecular Cloning: A Laboratory Manual" by Sambrook et al. 1989); “Current Protocols in Molecular Biology”, Volumes I-III Ausubel, RM (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley an D Sons, Baltimore, Maryland (1989); Perbal, “A Practical Guide to Molecular Cl "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York (1988); Wa Watson et al., "Recombinant DNA," Scientific American Books (Scientific American Books), New York; Birren et al. (eds) "Genom Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); U.S. Patent No. 4,666 Nos. 6,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057 Such methodologies are discussed in "Cell Biology: A Laboratory Handbook" "Current Protocols in Immunology", Volumes I-III, Cellis, JE (1994); (Current Protocols in Immunology) Volumes I-III Coligan JE ed. (1994); Stites (eds), Basic and Clinical Immunology (8th ed.) ), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected "Methods in Cellular Immunology," W.H. Freeman and d Co., New York (1980); available immunoassays are extensively documented in the patent and scientific literature. and are described, for example, in U.S. Patent Nos. 3,791,932; 3,839,153; 3,850,752; No. 3,850,578; No. 3,853,987; No. 3,867,517; No. 3,879,262; No. 3,901,654; No. 3,9 No. 35,074; No. 3,984,533; No. 3,996,345; No. 4,034,074; No. 4,098,876; No. 4,879,21 No. 9; Nos. 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" "Nucleic Acid Hybridization (Diffusion Hybridization)" Gait, MJ, ed. (1984); "Transcribing" in Hames, B.D., and Higgins, S.J., eds. (1985); "Transcribing" in "Transcription and Translation," Hames, BD and Higgins SJ, Eds. (1 984); "Animal Cell Culture" Freshney, RI, ed. (1986); "Im "Immobilized Cells and Enzymes," IRL Press, (1986); "A Pr Practical Guide to Molecular Cloning, Perbal , B. (1984) and "Methods in Enzymology", Vol. 1-317, Academic Press. © Press; "PCR Protocols: A Guide To Methods And Applications" A Guide to Law and Application," Academic Press, San Diego, CA (1990); Marshak et al., "St rategies for Protein Purification and Characterization - A Laboratory Course Man "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press 1996); all of which are incorporated by reference as if set forth herein. Other comprehensive references are provided throughout this document. are believed to be well known in the art and are provided for the convenience of the reader. All information contained herein is incorporated by reference. Comprehensive materials and experimental procedures In vitro necrosis model KCN-induced necrosis

[0341] 10% heat-inactivated fetal bovine serum, 2 mM glutamine, 100 U / ml penicillin and 100 μg / ml penicillin in suspension in RPMI-1640 medium supplemented with nicotinic acid and 100 μg / ml streptomycin. Human promonocytic U-937 cells (a p53-negative promonocytic cell line) were grown in log phase. were seeded at a concentration of 4 × 10 5 / ml (Tsesin N et al., Chemistry and Physics of Lipids, 2014 , 183:159-168).

[0342] Rat pheochromocytoma PC12 cell line (also called cell line) was cultured in 5% heat-inactivated bovine calf serum, 10% heat-inactivated bovine serum, and 10% Inactivated horse serum, 2 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin The cells were grown in DMEM medium (Beit Haemek, Israel) supplemented with tocopherol. PC12 cells were seeded at a concentration of 1.2 x 10 cells / well in a 96-well plate and incubated overnight. I was invited.

[0343] The cells were then washed twice and resuspended in RPMI-16 supplemented with 2 mM pyruvate and 10% dialyzed FCS. 40 (U-937 cells) and DMEM (PC-12 cells) glucose-free medium for 1 hour. KCN (Merck, Germany) was incubated at the indicated concentrations for 7 hours (U-937 cells) or 5 hours (PC12 cells). Cells were treated with or without ATP. Inhibitor testing

[0344] Elastase inhibitor II (MeOSuc-AAPA-CMK) and elastase inhibitor III (MeOSuc-AAPV-CMK) was purchased from Calbiochem-Novabiochem, USA. Azomethylketone was purchased from MP Biomedicals, USA. All compounds were purchased from ChemDiv, San Diego, CA. Compounds were dissolved in DMSO and The final concentration of DMSO added to all samples was 30 min before the addition of the cell death inducer. The concentration was 0.1%, which had no effect by itself. siRNA and cell transfection

[0345] Cells were transfected with HiPerFect Transfection Reagent and specific promoters. by complexing with siRNA to inhibit the enzyme, or by using suitable The cells were treated with a control for 48 hours. HiPerFect transfection reagent was used to effectively transfect the cells. Enables iRNA uptake and efficient siRNA release within cells, resulting in complete gene knockdown It is a blend of cationic and neutral lipids that produces negative and positive death complexes. The control was used according to the manufacturer's instructions. siRNA for cathepsin C silencing The sequence was ATGATCTGCATCAGTTGTAAA (SEQ ID NO: 1). The siRNA sequence for CELA1 was CG GCAACATGCTGGTCCTTTA (SEQ ID NO: 2), and the siRNA sequence for CELA3A is CTGCCTT The siRNA sequence used for the control was TGGCTGCAACTTCA (SEQ ID NO: 3). GTGTCACGT (SEQ ID NO: 4). All siRNAs and HiPerFect TM Transfection Reagents were purchased from Qiagen.

[0346] Then, normal or silenced cells were washed twice and glucose was added. Transfer to medium containing no ATP for 1 hour, and then induce necrosis with potassium cyanide as described above. Cell mortality was measured by the production of lactate dehydrogenase, a stable cytosolic enzyme, from lysed cells. Promega's CytoTox™ accurately and rapidly measures cell death by quantifying the release of LDH. x96 (R) Evaluated by Non-Radioactive Cytotoxicity Assay It was worth it.

[0347] The CELA1 siRNA sequence perfectly matches the CELA1 transcript, but it also encodes CELA3A and CEL A3B is an imperfect match, whereas CELA3A siRNA is a perfect match to CELA3A. Morphological quantification of necrosis and apoptosis

[0348] Cells undergoing morphological changes associated with apoptotic or necrotic cell death as previously described The results were monitored [McGahon AJ et al., Methods Cell Biol (1995) 46:153-184] and [Zelig U et al., Biophys J. 2009 Oct. 7;97(7):2107-14]. At each point, 1 ml of cell suspension was collected, centrifuged, and the pellet was diluted with a dye mixture (100 μg / ml A 20-fold dilution of acridine orange and 100 μg / ml ethidium bromide in PBS The cells are resuspended in a medium solution, placed on a glass slide, and observed under a fluorescent microscope. Cells were assessed as viable if they showed normal morphology and orange color. Cells with a dark red color were scored as necrotic. Cells were scored as apoptotic if they showed fragmentation. A minimum of 100 cells were counted for each sample. Cells were scored. Assay of necrosis using lactate dehydrogenase (LDH) release

[0349] The amount of LDH released from lysed cells is a sensitive measure of cell death. Necrotic cell death was measured using the Promega CytoTox 96 LDH assay kit. The LDH content from cells lysed in 10% Triton X-100 for 10 min was used as an index of total LDH. LDH released into the soil was used as an index of necrotic cell death, and the percentage of total LDH was The inhibitor protection was calculated in the presence and absence of inhibitor. The percentage of LDH release was calculated based on the comparison of the inhibitors. The absorbance at 490 nm was measured using an ELISA reader (Bi Measurements were taken using a oTec. Assays for elastase and cathepsin C activity

[0350] Cells were collected, washed twice with ice-cold PBS, and lysed in ice-cold lysis buffer (50 mM Tris-HCl pH 7.5). 2 × 10 cells in 0.1% NP-40, 1 mM DTT 8 The mixture was resuspended in 1 ml of Polytron (3 cycles of 7 seconds each). Cells were disrupted by centrifugation at 13,000 g for 30 min at 4°C, and the debris was pelleted. The supernatant was used immediately. Each protein was analyzed using the Bradford Protein Assay (Bio-Rad) The protein content of the samples was measured. All assays were performed in a total volume of 100 μl and N-Methoxysuccinyl-Ala-Ala-Pro-Val-p-nitroanilide (MA) was used as an elastase substrate. APV (Sigma) to a final concentration of 5 mM, 40 μg sample protein was added to the PBS containing the specified concentration of protease In the presence or absence of inhibitors or solvent for controls, flat-bottom microfluidics were used. After incubation at 37°C for 1.5 hours, the titer was measured at 405 nm. The OD of the mixture was measured using a plate ELISA reader (Molecular Devices). Cathepsin C-like activity was calculated according to a calibration curve of nitroaniline. Measurement was performed with troanilide (Sigma). In vivo traumatic brain injury model

[0351] Closed head injury techniques are used to prevent the development of brain necrosis and Elastase and neurological status assessed using the Neurological Severity Score (NSS) The effect of the inhibitor was determined. The NSS test was performed 1 hour after the trauma. During the NSS test, various Reflexes, mobility, beam balance, beam walk, and cycle search and termination Other behavioral parameters were monitored, such as: The occurrence of necrosis was measured by 2,3,5-triphenyl-2H-tetrahydrofuran. By assessing the necrotic space in brain slices stained with trichloroethylene (TTC), and measured.

[0352] C57BL / 6J mice weighing 40±4g (mean±SD) were used in this study. The impact caused a shock to the skull, resulting in a controlled brain injury. Silicone coated 5mm metal extruded from a lowered platform This cranial injury model was used in a previous study [Feldman Z et al. , J Neurosurg(1995)83:1060-1066;Shapira Y et al., J Neurosurg Anesthesiol(1995) 7:17-25). All animal handling and care techniques are taught at the Ben-Gurion University of the Negev Committee for the Ethical Care and Use of Animals in Research (Benglio Approved by the Negev Committee for the Ethical Care and Use of Animals in Research at the University of Illinois. I received it.

[0353] Mice were prepared for surgery by anesthesia with isoflurane and allowed to breathe spontaneously. Maintenance of adequate anesthesia for each procedure was confirmed by the loss of corneal reflex. A midline scalp incision was made and the scalp and underlying muscles were laterally mobilized. (CHT) was delivered to the skull over the frontal portion of the left cerebral hemisphere. One minute after trauma, elastase 100 μg of inhibitor II or III in its vehicle (DMSO solution) was injected directly into the cisterna magna. The vehicle itself has previously been shown to be ineffective. The NSS of untreated mice was 0 to 1, and stained brain slices showed no necrotic lesions. There was no pace.

[0354] After the injection anesthesia was discontinued, the animals were returned to their cages and given food and water ad libitum.

[0355] In addition to wild-type C57BL / 6J mice, we also used the neutrophil elastase knockout mouse strain B6.129X1-E All procedures were approved by the Ethics Committee of Ben-Gurion University of the Negev. was done. In vivo liver toxicity model

[0356] Wild-type C57BL / 6J mice weighing 23±3 grams were used, with 6 mice per treatment. All animal handling and care techniques were obtained from Harlan (Israel). Approved by the Negev Committee for the Ethical Care and Use of Animals in Research at the University of Nuremberg Mice were treated with acetaminophen (N-acetyl-p-aminophenol) APAP (3 The rats were fasted for 16 hours before administration of a single intraperitoneal (ip) dose of 0.000 mg / kg. Four hours after APAP injection, the rats were Mice were injected ip with test compound dissolved in vehicle (20% DMSO in PBS). The control mice were injected with the vehicle only. 24 hours after APAP injection, the mice were sacrificed and Blood was collected from the heart and from the lungs. Heparin was used as an anticoagulant additive for plasma collection. The samples were centrifuged at 4000 g for 10 minutes at room temperature. The supernatant was collected for measurement of ALT and AST levels. Enzyme levels were measured at Soroka's Biochemistry Medical Center. The blood glucose levels were measured using an automated analyzer at the University of Tokyo's Mistry Medical Center. Cardiac necrosis in vivo model

[0357] Male Balb / c mice (20-25 g; Charles River, Milan) were cultured. ; Italy) were housed in a controlled environment and fed standard rodent chow and water. .

[0358] Using published methodology (Yet et al., 2001), mice underwent 30 min of myocardial ischemia and 6 h of The study groups were sham, vehicle control, and inhibitor (n=8 / group). Briefly, sodium pentobarbital (60 mg / kg body weight) was administered. Mice were anesthetized and given additional doses as needed to maintain anesthesia. Mice were mechanically ventilated with 100% oxygen and 1-(2-(4-methyl-2-methylpropional)-4-methylpropional. (I)piperazin-1-yl)-4,5-dihydro-1H-imidazol-1-yl)propan-1-one (M059 The patient received an initial IV dose of IV inhibitors (-0891) (30 mg / kg) and had his chest opened. Twenty minutes after administration, the left anterior descending coronary artery (LAD) was transected from the tip of the left atrium, usually positioned over the LAD. by ligating with an 8-0 silk suture at a section of PE-10 tubing placed 1 mm After 30 minutes of occlusion, the ligature was released and the PE-10 tubing was removed. Reperfusion was initiated by removing the IV dose of thrombus from the blood. Animals received a second IV dose of thrombus at the beginning of reperfusion. The chest wall was then closed, the animals were extubated, and the body temperature was raised to 37°C. After 6 hours of reperfusion, the animals were then placed in a ventricular chamber and maintained at 4°C for determination of morphological damage. The animals were then euthanized for cardiac collection. The necrotic area, as a % of the AAR, was quantified.

[0359] Experimental Groups: A total of 24 mice were assigned to the following groups: -Ischemia / reperfusion + vehicle: mice subjected to LAD occlusion (30 min) followed by reperfusion (6 h) (n =8). -Ischemia / reperfusion + compound: The surgical procedure was performed as described above, and mice were then initiating ischemia. before and 20 min at the beginning of reperfusion and in mice treated with elastase inhibitors (IV 30 mg / kg) administered via bolus (n=8). Sham + vehicle: Subjected to identical surgical procedures except for LAD occlusion and under anesthesia for the duration of the experiment. Mice kept at (n=8).

[0360] At the end of all experiments, animals were processed for assessment of infarct area as described below. Determination of infarct size.

[0361] After the reperfusion period, 1 mL / kg of 4% Thioflavin S solution was injected IV to delineate the non-reflow area. Thioflavin S solution is a fluorescent yellow-green dye that stains the perfused area fluorescently. After 5 minutes, the LAD was reoccluded and the AAR (lacking blue dye) was removed. To delineate the tissue, administer 0.6 mL of 50% Unisperse blue (Unisperse blue) by IV injection. Blue) (Ciba Geigy, Hawthorne, NY) The mice were euthanized by administering 1 mL of KCl (150 mg / mL IV) under deep anesthesia. The liver is excised and the LV is cut into four equal-thickness transverse slices. These slices are non-rib-like. Use ultraviolet light (λ = 254 nm) and a yellow filter to determine the low (dark) region. Photographs are taken and then the AAR is identified under halogen lighting (unstained blue). The slices were then inoculated with 1% triphenyltetrazolium chloride to delineate the infarct area. The tissue is then incubated in tetrahydrofuran (TTC) at 37°C for 15 minutes. TTC is used to bridge viable myocardial tissue. The infarcted tissue appears white, and the ventricular slice is then photographed again. Digital photographs of cardiac slices showing flow areas, AAR and necrotic areas were tracked and then The specimens are then digitized using a computerized planimetric system. The areas of the ischemic and non-ischemic regions were calculated and expressed as necrotic and non-ischemic regions as a percentage of the slice. The % of necrotic tissue in each slice is multiplied by the slice weight. The weights are summed for each heart. The AAR (unstained blue area) accounts for 1 / 2 of the LV mass. The extent of necrosis was calculated as a percentage of the LV mass. , and infarct size was expressed as a percentage of AAR (infarct size = extent of necrosis / extent of AAR). It is expressed as: Data analysis

[0362] All values ​​in figures and text are expressed as the mean standard error of the mean (SEM) of N observations. Data were presented as mean ± SD. Data were analyzed by one-way ANOVA followed by Bonferroni regression for multiple comparisons. Non-parametric data were analyzed using Fisher's post-hoc test. Analysis was performed using the exact (Fisher exact) test. A p value of less than 0.05 was considered significant. *p<0.05 vs. sham. *p<0.05 vs. I / R statistical analysis

[0363] Unless otherwise stated, each experiment was performed in triplicate; each sample was tested at least in duplicate. Results The mean ± SE is shown. Statistical analysis was performed using Student's T-test. The NSS value is based on the Microsoft Windows (R) (Microsoft Windows(商標) )So The results were analyzed using the non-parametric Mann-Whitney test using SPSS software. Significance was set at P<0.05. Example 1 Necrosis is accompanied by the induction of intracellular elastase-like proteolytic activity

[0364] To determine whether necrosis involves the induction of intracellular proteolytic activity, the first experiment Necrosis in U-937 cells was induced by treatment with KCN, which is a chemical hypoxic KCN-induced necrosis in U-937 cells The dose- and time-dependent kinetics of is shown in Figure 1.

[0365] Activation of elastase-like proteolytic activity occurs during the necrotic cell death process. To further confirm this, control extracts were prepared from KCN-treated U-937 cells. The activity of MAAPV was determined using elastase-specific substrates in comparison with that of IL-1. To see whether elastase-like enzymes were activated during the treatment, the cells were treated with KCN for different time intervals. Enzyme assays were performed in lysates prepared from U937 cells treated with 10 mM KCN. As can be seen, the time-dependent induction of proteolytic activity induced by elastase The tase-like activity also increased dramatically within 10 minutes, and its activity increased sevenfold within 15 minutes. The increase in elastase activity was detected before morphological signs of cell death were observed. It was.

[0366] The elastase-like inducing activity was further characterized using different protease inhibitors. EIIII at a concentration of 100 μM had little effect on the elastase activity of control cells. However, it sufficiently inhibited the necrosis-inducing activity. The inhibition was dose-dependent, exceeding IC50. The induced necrosis-related events in U-937 cells were 2.735 μM (Figure 3). It was shown that the proteolytic activity was compatible with serine protease activity.

[0367] The present inventors also investigated the role of cathepsin C in the activation of elastase in necrotic tissue. To this end, enzyme assays were performed at different time intervals. The results were obtained in lysates of cells treated with 10 mM KCN ​​at 200 rpm. As can be seen, already at 10 After 2 min of treatment, cathepsin C-like activity increased by 4-fold and reached its maximum.

[0368] The induction of elastase-like proteolytic activity (min, Figure 2) and the progression of the necrotic process (h, The enormous difference in time scales (Fig. 1) indicates that proteolytic activity is the primary pathway for necrosis. This led to the hypothesis that this is part of the molecular step. due to the inhibition and downregulation of the expression of tase-like enzymes and their effect on the necrotic process. To investigate the effects, different methods were used (see Examples 2 and 3 below). Example 2 Transfection with siRNA for cathepsin C, CELA3A, and CELA1 inhibits necrosis Protects against induced cell death

[0369] In an attempt to characterize the enzyme(s) activated in the early stages of the necrotic process, the present invention They used a library of siRNAs against different proteases. The experiments were performed using siRNAs against a total of 93 proteases.

[0370] Figure 4A-B shows that transfection of U-937 cells with CELA1 or CELA3A siRNA significantly inhibited the expression of KCN and This resulted in a stable and significant decrease in LDH release after 7 hours of incubation. Transfection with either CELA1 or CELA3A alone resulted in partial protection. induced protection, whereas a combination of siRNAs against both CELA1 and CELA3A Transfection provided significant protection against necrosis.

[0371] In addition to CELA1 and CELA3A siRNAs, siRNAs for other proteases were also tested. Tepsins A, B, C, D, E, G, H, K, L1, L2, O, S, W and Z, serine proteases HNE and H trA, chymotrypsin C, CELA 2A and CELA 3B, matrix metallopeptidases 7, 11, and 1 2, 21, and 25. The results showed that siRNA against cathepsin C also had a protective effect against necrosis. The results are shown in Figure 4A. Infection failed to confer any protection against KCN-induced cell death.

[0372] To confirm that the effects of certain siRNAs are not specific to U-937 cells, these experiments was repeated with PC12 cells (Fig. 4C).

[0373] Comparative experiments using PC12 cells showed that siRNA for cathepsin C, CELA3A, and CELA1 were , which has a significant protective effect against cyanide-induced cell death in U-937 and PC12 cells. In addition, siRNA and HiPerFect transfection reagent (control treatment) It was also observed that the mixture of ) was not toxic to cells. Activation of cathepsin C during the necrosis stage is associated with a decrease in necrosis rate, as is the suppression of necrosis by small molecule cathepsin C inhibitors. The results also showed that inhibition of the activity of the above enzymes was associated with a decrease in cell death. The results suggest that these enzymes may serve as targets for controlling / regulating necrotic cell death. This shows that there is a possibility. Example 3 Transfection with siRNA for cathepsin C, CELA1, and / or CELA3A Leading to specific suppression

[0374] The protective effect of certain siRNAs is due to the silencing of the transcription of the target enzyme and To ensure that this was not due to off-target effects of the catecholamines, we Psin C and elastase-like activity were increased in cells transfected with specific siRNAs. Enzymatic assays were performed to demonstrate that the silencing was effective. For additional support of the binding, Western blot analysis was performed for the indicated proteins. These results demonstrated that the expression of the silencing enzyme was indeed suppressed.

[0375] Figure 5A-B shows that siRNAs for cathepsin C, CELA1, and CELA3A were expressed in appropriate amounts in cell lysates. It has been shown that it induces a stable and significant reduction in enzyme activity. Transfection with siRNA against CELA1 and CELA3A did not affect cathepsin C activity. This experiment demonstrated that treatment with specific siRNAs did not affect the specificity of the effect. The protective effect must be due to enzyme downregulation and not other non-target effects. These results suggest that cathepsin C is essential for programmed necrotic cell death. It was further shown that

[0376] Furthermore, the combined results of both Figure 4A and Figure 5A-B show that these specific enzymes (CELA Under conditions where the activity of CELA1 and CELA3A is suppressed (Fig. 5A-B), the necrotic process is suppressed. (Fig. 4A), indicating that blocking the activity of these enzymes leads to the suppression of cell death. Taste.

[0377] Therefore, these studies provide the basis for the enzyme being a valid target for the inhibition of necrosis. In summary, specific CELA3A and CELA1 inhibitors inhibit the activity of other elastases. These results suggest that necrotic cell death can be suppressed by IFN-γ-α, but not by IFN-γ-α. Example 4 Cathepsin C, CELA3A, and CELA1 inhibitors suppress necrotic cell death

[0378] Figure 6 shows the effect of a cathepsin C inhibitor (Gly-Phe-DMK, MP Biomedicals, USA) on KC in PC12 cells. The addition of the inhibitor was able to suppress the necrosis induced by L It inhibited cell necrosis as evidenced by a dose-dependent decrease in DH release. The results in Figures 5A-B and 6 suggest that cathepsin C provides a target for anti-necrotic agents. It meant that it was possible.

[0379] A direct consequence of this hypothesis linking elastase-like activity to the necrotic death pathway is that this protein Inhibition of cytolytic activity delays or prevents the execution of the necrotic cell death program. To test this hypothesis, we investigated the effect of a permeable elastase inhibitor on necrotic cell death. EI II and III inhibited the oxidative stress response in PC12 cells as assessed by LDH release. The non-cell-permeable enzyme inhibited KCN-induced cell death in a dose-dependent manner (Fig. 7A and B). The telomerase inhibitor elastatinal inhibits cells undergoing KCN-induced necrosis. It had no protective effect on the cells (data not shown).

[0380] CELA3A inhibitors were synthesized based on 3D structural and topological similarities. These were tested for their ability to provide anti-necrotic protection. Some representative results are shown in Table 1. Protection against KCN-induced necrosis was observed at various concentrations up to 0.1 nM ( Table 2). Two small molecule inhibitors of CELA1 were similarly able to suppress necrosis, and Furthermore, certain compounds, such as the last three listed in the table, Higher concentrations conferred protection.

[0381] [Table 2-1] [Table 2-2] [Table 2-3]

[0382] High concentrations (up to 300.MU.M) of nonspecific elastase inhibitors were inactive by themselves. Exposure of PC-12 cells to EI II and III significantly inhibits KCN-induced necrosis However, small molecule CELA3A inhibitors are effective at concentrations several orders of magnitude lower. It is equally easy to see that CELA1 and C in the prevention / treatment of necrosis The unexpected enhanced activity of ELA3A-specific inhibition is due to these two unique targets, and This highlights the importance of targets structurally related to them. Example 5 The protective effect of elastase inhibitors appears to be due to the rescue of KCN-treated cells rather than to the prevention of membrane disruption. It appears in the end.

[0383] The protective effect of elastase inhibitors on cells is maintained for a long period after ischemia. To investigate whether KCN induces oxidative stress, we performed a kinetic study. After incubation, the medium was replaced with normal DMEM without KCN or elastase inhibitors. and incubation was allowed to proceed for 48 hours. Cell survival was determined by membrane integrity. The results showed that the cells were irreversibly damaged. These results show that the cells survived 5 hours of KCN treatment without any abnormalities. They recovered well after 48 hours of KCN treatment. These results suggest that elastase inhibitors have a long-term protective effect. It is clinically relevant because it demonstrates that the treatment provides a beneficial effect, e.g., in the setting of an MI or stroke. Treatment with elastase inhibitors during the therapeutic window after ischemic stress The tissue was then preserved. Example 6 Effect of elastase inhibitors on necrosis in vivo

[0384] Considering the above encouraging results, the role of elastase inhibitors in the necrotic process in vivo is unclear. The first in vivo model studied was traumatic brain injury. First, the elastase inhibitors II and III and the vehicle control were tested (Figure 8). The effects of the drug on mice were investigated. Mice were healthy with NSS 0 or 1 and no necrotic brain tissue. Figures 8A-B show that in mice treated with elastase inhibitor II or III, reduced neuronal damage and necrotic space compared to untreated traumatized animals Neurological status was assessed using a neurological severity score. EIs II and III are , significantly reduces neurological damage when measured 1 hour after injury. Figure 8B shows that TTC staining significantly reduces neurological damage when measured 1 hour after injury. The amount of necrotic space in traumatized mice measured by the Treatment with turpentine significantly reduced the volume of necrotic tissue in the injured hemisphere from 50% to 25%. When the effect of the inhibitor was tested in neutrophil elastase knockout mice, virtually In addition to the data shown in Figures 8A-B, the same results were obtained in wild-type Sprague Dawley ( The same experiment was performed on Sprague-Dawley rats, and similar results were obtained (data not shown).

[0385] Taken together, the results presented in Figures 4A-C, 7A-B, and 8A-B demonstrate that endothelial cells attenuate necrotic injury. Interestingly, the incidence of necrosis and the difference between normal and non-normal necrotic lesions are not well understood. There was no difference in the response to treatment between the checkout mice and the control mice, and neutrophil elastase was elevated in these mice. This shows that it plays no role in these two processes.

[0386] Additionally, selected specifically potent inhibitors of CELA3A or structurally related enzymes was tested in vivo in additional models of necrosis. Small molecule inhibitors based on 3D structural similarities and topological analogs of the CELA3A enzyme It was discovered by screening a library of CELA3A inhibitors. The in vitro activity of the compounds of Z601-4253 (2-(piperidine)-2-methylpropional)-2-methylpropional) is shown below, see Example 7. (-1-yl)thiazol-4-yl)(pyrrolidin-1-yl)methanone, which is the active compound -belonging to the aminothiazole group, which was tested for protection against liver toxicity.

[0387] We evaluated the potential of this compound as an anti-necrotic agent against APAP hepatotoxicity. To this end, we investigated the changes in the levels of serum biochemical markers of hepatocyte death. We examined changes in serum ALT and AST levels.

[0388] As shown in Figure 9, treatment of mice with 300 mg / kg APAP resulted in significant changes in enzyme levels. Increases were produced and liver enzyme levels were measured in the blood 24 hours after paracetamol administration. The ALT levels of mice treated with APAP alone were 8220±413 U / L, and their AST levels were The ALT was 3553 ± 290 U / L. In the sham, control, and compound alone, the ALT was less than 2%. Parallel controls showed a significant decrease from the corresponding APAP treatments. Compound Z601-4253, administered IP 4 hours after APAP administration, significantly increased the levels of both liver enzymes in the blood. It significantly reduces paracetamol-induced toxicity in a dose-dependent manner and protects against paracetamol-induced toxicity.

[0389] Another model studied was a murine in vivo model of myocardial ischemia / reperfusion injury ( Figure 1 0). 2-(4-(4-methylpiperazin-1-yl)-4,5-dihydro-1H-imidazol-1-yl)propanol The active compound of lopan-1-one (M059-0891), which belongs to the 1-aminoimidazoline series The results show a significant reduction in necrosis and infarct size with the inhibitor. Example 7 Generic Synthetic Methods for Specific Compounds for Use According to the Invention

[0390] Scheme 1, provided below, illustrates a general synthesis for the preparation of 2-aminoimidazoline compounds. Table 3 provides specific substituents for the indicated variables. do.

[0391] [ka] [Table 3]

[0392] Certain 2-aminoimidazoline compounds were prepared by the reaction of 2-thiomethyldihydrochloride with 2-aminoimidazoline. Imidazole hydroiodide (1.550 gm (grams), 0.0063 moles) and and diisopropylethylamine (2.2 equivalents) (15 ml) and stirred at room temperature. This was achieved by treating the mixture with propionic anhydride and ethanol. The mixture was stirred at room temperature overnight. The reaction mixture was concentrated and diluted with methylene chloride and water (20 ml each). The methylene chloride layer was separated, dried over sodium sulfate, and concentrated to give N-propanoyl N-Propylene glycol diisopropyl ether in t-butanol (12 ml) was used to obtain 1.2 gm of 2-thiomethyldihydroimidazole. 400 mg of thiomethyl-2-dihydroimidazole and 3 equivalents of 1-methylpiperazine The mixture was refluxed for 3 days, then concentrated and purified on a silica gel column with 20-30% methanol- Elution with methylene chloride gave compound 1 (50 mg) along with starting material (210 mg). 1 HNM R(DMSo-D6): 0.99(t, J=8Hz, 3H), 2.16(s, 3H), 2.32(q, J=8Hz, 2H), 2.49(m , 4H), 3.04), 3.39(t, J=8Hz, 2H), 3.81(t, J=8Hz, 2H). LCMS m / z 225.0[M+1] This synthetic procedure follows Method A outlined above.

[0393] Certain 2-aminoimidazoline compounds can be prepared by dissolving 2-thiomethyldiamine in methanol (15 ml). A mixture of hydroimidazole hydroiodide (1.1 g) and 1-methylpiperazine (1.5 equivalents) The mixture was refluxed until the reaction was complete (6-18 hours), then concentrated and diluted with methylene chloride ( 20 ml) and triethylamine (2 equivalents) and propionic anhydride (1.25 equivalents) The mixture was stirred at room temperature for 1 hour. Then, The reaction mixture was concentrated and purified by silica gel column chromatography using 10-30% methanol-methylene chloride. The above purification gave compound 1 (780 mg). Compound 1 (0.5 gm) was purified using 0.1% TFA-water to give C-18 Further purification on a column gave the TFA salt of compound 1 (280 mg). 1 HNMR (CDCl): 1.17 (t , J=8Hz, 3H), 2.38(s, 3H), 2.49(q, J=8Hz, 2H), 2.54(m, 4H), 3.32(m, 4H), 3. 61 (t, J = 8 Hz, 2H), 3.93 (t, J = 8 Hz, 2H); LCMS m / z 225.0 [M+1]. This synthetic procedure was previously described. Follow Method B as outlined.

[0394] Following the synthetic procedure of Method A, compound 2 (M059-0851) was also synthesized with the following properties: 1 HNMR (DMSO-d6): 0.98 (t, J=8Hz, 3H), 1.50-1.83 (m, 8H), 2.30 (q, J=8Hz, 2H), 2.34-2.3 7(m, 4H), 3.03-3.05(m, 4H), 3.12-3.16(m, 1H), 3.39(t, J=8Hz, 2H), 3.84(t, J=8Hz) , 2H); LCMS m / z 279.1 [M+1].

[0395] Following the synthesis procedure of Method A, the TFA salt of compound 3 (M059-0032) was synthesized, followed by C-18 column chromatography. Purification was carried out to produce the following properties: 1 HNMR (DMSO-d6): 1.82-1.90 (m, 2H), 1.96-2.03 (m, 2H), 3.33-3.37(m, 2H), 3.50-3.54(m, 2H), 3.71(t, J=8Hz, 2H), 4.39(t, J=8Hz, 2H) , 6.81-6.82(m, 1H), 7.50(d, J=Hz, 1H), 8.11(m, 1H), 9.84(s, 1H); LCMS m / z 234.0[ M+1].

[0396] Following the synthetic procedure of Method A, the TFA salt of compound 4 (M059-0055) was synthesized and had the following properties: did: 1 HNMR (DMSO-d6): 1.08-1.83(m, 8H), 1.81-1.85(m, 4H), 2.15-2.22(m, 1H), 2.59( d, J=8Z, 2H), 3.38-3.41(m, 4H), 3.36(t, J=8Hz, 2H), 4.17(t, J=8Hz, 2H), 9.47(s, 1H); LCMS m / z 250.1 [M+1].

[0397] Compound 5 (M059-0082) was synthesized following the synthetic procedure of Method A. hand, 1 HNMR (DMSO-d6): 1.48-1.74 (m, 8H), 1.85-1.90 (m, 4H), 2.49-2.56 (m, 1H), 3.18-3. 23 (m, 2H), 3.34-3.40 (m, 6H); LCMS m / z 236.1 [M+1].

[0398] Compound 6 (M059-0053) and compound 7 (M059-0335) were prepared in the same manner as compound 4 according to method A. It was prepared according to the protocol.

[0399] Compound 8 (Z601-4253) is a 2-piperidino-1,3-thiazole-4-carboxylic acid and pyrrolidine It was prepared from acetone in the presence of DCC, triethylamine, and DMAP in methylene chloride.

[0400] Scheme 2, shown below, illustrates a comprehensive synthetic method for the preparation of 2-aminoimidazoline compounds. The method is described below, and Table 3 provides specific substituents for the indicated variables.

[0401] [ka]

[0402] Compounds 9 (M008-0111) and 10 (4112-3656) were converted to the corresponding bromoacetophenones and and an amine according to the method described in Scheme 2.

[0403] Scheme 3, shown below, illustrates a comprehensive synthetic method for the preparation of 2-aminoimidazoline compounds. Describe the law.

[0404] [ka]

[0405] According to Scheme 3, commercially available 5-isopropyl-3-pyrrolidin-2-ylisoxa Diazolidinyl benzoate and cyclopropanecarboxylic acid in methylene chloride, DCC, triethylamine, and Compound 11 (Z632-2266) was prepared in the presence of methylparaben and DMAP.

[0406] Scheme 4, provided below, illustrates the embodied compounds / compounds used as described herein. Additional generic synthetic procedures for the group are described:

[0407] Scheme 4: [ka]

[0408] Scheme 5, provided below, illustrates the synthesis of embodied compounds / compounds for use as described herein. Additional comprehensive synthetic procedures for

[0409] [ka]

[0410] Scheme 6, provided below, illustrates the synthesis of embodied compounds / compounds for use as described herein. Additional comprehensive synthetic procedures for

[0411] [ka]

[0412] Scheme 7, provided below, illustrates the synthesis of embodied compounds / compounds for use as described herein. Additional comprehensive synthetic procedures for

[0413] [ka]

[0414] Scheme 8, provided below, illustrates an embodied compound for use as described herein. Additional generic synthetic procedures for compounds / groups of compounds are described. The references provided also include: No. 6,029,799, the entire contents of which are hereby fully incorporated by reference.

[0415] [ka]

[0416] Scheme 9, provided below, illustrates an embodied compound for use as described herein. Additional generic synthetic procedures for compounds / compound classes are described:

[0417] [ka]

[0418] Briefly, PMR spectra were registered with a 300 MHz Bruker DPX and Bruker XWinNMR software. All commercially available reagents were used without further purification. did.

[0419] Compound 3. Compound 1 (0.1 mol) was dissolved in a mixture of compound 1 (0.1 mol) and ether (100 ml). The mixture was stirred at 28-30° C. for 12 hours and then cooled to 5° C. A precipitate formed. The material was collected by filtration, washed with water, dried, and crystallized from ethanol to give a pure product. The reaction gave the desired product 3 in 70-75% yield.

[0420] Compound 4. Compound 3 (0.1 mol) was dissolved in water (200 ml) with NaOH (0.25 mol) and ethanol. (5 ml) of solution. The mixture was stirred at 90°C until the solid was completely dissolved. The resulting solution was cooled to room temperature and carefully acidified with acetic acid. The resulting precipitate was filtered off. The pure reaction product was collected from HCl, washed with water, dried, and crystallized from dioxane. This gave product 4 in 75-80% yield.

[0421] Compound 5. 1 mmol of acid 4 was added to a solution of CDI (0.95 mmol) in 5 ml of dry DMF. Mixture The mixture was stirred at 80 °C for 2 h during which gas was formed. Then, 1 mmol of the amine HNR2aR2b was added to the reaction mixture. The reaction mixture was refluxed for 3-4 hours and then allowed to stand at room temperature overnight. The mixture was then diluted with water (10 ml) l) and the precipitate formed was collected by filtration and crystallized from propanol-2 Purification gave the pure reaction products 5 in 40-85% yields.

[0422] Also, see Scheme 10: [ka]

[0423] The references provided are fully incorporated herein in their entirety.

[0424] Those skilled in the art will appreciate that the above synthetic methods can be used to prepare compounds such as those listed in Table 1. or how modified as defined by any formula provided herein. You will understand what you can do. Example 8 CELA3A and CELA1 inhibitors based on 3D structural and topological similarities Active small molecule inhibitors discovered by screening a library of List of

[0425] The following compounds were prepared by the vendor ChemDiv Inc. (San Diego, USA) and Their respective ChemDiv ID numbers are shown in Table 4 below.

[0426] [Table 4-1] [Table 4-2] [Table 4-3] Inhibitors of necrotic cell death

[0427] These compounds were compared with their inhibitory effects on KCN-induced necrosis in PC12 cells. The necrotic mode of cell death in this system was tested as previously described. The results are shown in the table below. PC12 cells were challenged with KCN as described above. The protective effect of the compounds against KCN-induced necrosis evaluated using the LDH release assay was shown in the following table. The IC50 values ​​of these inhibitors range from several tens to single nanomolar. [Table 5] Consideration

[0428] The inability to prevent or treat necrotic cell death remains an unsolved problem. They investigated the inhibition of elastase by siRNA or by specific elastase small molecule inhibitors. We have shown that a reduction in phospholipase-like activity confers protection against cells undergoing necrotic cell death. The protective effect was verified by different methods. Elastase inhibitors protect cells from death. The ability to bind to KCN in the presence of oligomycin A or previously with anti-Fas and staurostatin was investigated. This appears to be unrelated to the induction of cell death, as observed after treatment with rosporin. Different classes of peptide and heterocyclic elastase inhibitors confer protection. This indicates that the effect is not specific to the compound. Further support for the role of intracellular elastase in necrotic cell death was found in cell extracts of necrotic cells. This is caused by an early increase in elastase-like activity, before overt signs of necrotic cell death The increase in activity was confirmed by measuring elastase-like activity using specific substrates. In addition, the interleukin-1 (IL-1)-induced elastase inhibition by permeable elastase inhibitors (EI II and EI III) was also confirmed. Treatment of intact cells abolished the induction of enzyme activity in the cells. The short time required for induction of necrotic activity suggests that the enzyme is involved in the early stages of the necrotic process, possibly ultimately in the cell death process. It acts as a proteolytic activator of the early steps in the cascade of molecular events leading to cell death. This role of elastase in necrosis is thought to be a key factor in the cell death process. This is consistent with the known involvement of the proteolytic cascade. The ability of elastase inhibitors to prevent the marked induction of the necrotic process and cell death is These findings support the important role of elastase-like enzymes in the

[0429] Using closed head injury (trauma) models in mice and rats, we investigated the effects of closed head injury on brain function in vivo. The ability of elastase inhibitors to prevent necrotic damage to the cysts has been demonstrated. The improvement in neurological function (decrease in NSS) after administration of bitter was most pronounced in the decline of neurological function. When the necrotic area was observed, it was mainly observed 1 hour after the trauma. The protective effect against the development of glaucoma was significant even 24 hours after trauma. reveals a dramatic picture: elastase inhibitors protect up to 60% of brain tissue, otherwise, necrosis would have developed.

[0430] Affected tissue, such as from a myocardial infarction, undergoes necrosis within 4-12 hours after the event. Similarly, in the case of a stroke, necrosis occurs within a few hours and up to 24 hours after the infarction, causing brain tissue Treatment with elastase inhibitors immediately after the event reduces necrosis. Therefore, this study clearly represents a therapeutic treatment.

[0431] In this study, elastase inhibitors suppressed necrosis independently of immune cell activity or contribution. This experimental system clearly demonstrated that HNE could be released and inhibited cell death. We utilized a cell monoculture lacking neutrophils or glial cells. The PC12 cell line used herein is of neuronal origin and lacks neutrophil elastase. Furthermore, cumulatively, these results suggest that a ubiquitous elastase-like enzyme is involved in the initiation of necrotic cell death. Therefore, the NSS after administration of elastase inhibitors in vivo was The improvement in vasopressin may be the result of the inhibition of intracellular elastase-like enzymes present in neuronal cells. This is likely due to the increased risk of post-traumatic injury at immune-preferred sites. During the early stages of recovery, there was no significant neutrophil infiltration and thus no neutrophil elastase. This concept is due to the fact that the confounding effects of NE knockout are least likely to occur. demonstrate that OUT mice respond to the protective effects of elastase inhibitors against necrosis This is borne out by the results.

[0432] In conclusion, specific cell-permeable elastase inhibitors prevent necrotic cell death. These inhibitors are used to prevent cell death before the onset of necrotic injury. It is surprising that the protective effect that results from the studies conducted here. Therapeutic approaches may be particularly useful in treating patients at high risk for stroke or myocardial infarction. It is possible.

[0433] The ability of elastase inhibitors to protect cells from death is independent of the trigger for cell death The effects of siRNA on the cellular signal transduction pathway appear to be significant and have been documented in vitro and in vivo. Lensing allowed for even more specific discrimination of targets.

[0434] The presented list of exemplary active compounds has structural similarity to CELA3A or similar enzymes. and molecules with topological similarity. All of these compounds were assayed All compounds showed significant protection at concentrations below 1 μM. It could be given in concentrations.

[0435] High concentrations (up to 300 μM) of the nonspecific elastase inhibitors EI II and III inhibited their They are inactive by themselves, and exposure of PC-12 cells to them significantly inhibited KCN-induced necrosis. However, the small molecule inhibitors disclosed are several orders of magnitude more potent than the previously reported inhibitors. It is also easy to see that it was effective at low concentrations. This unexpected display of differential inhibitor superiority confirms the importance of specific targeting. do.

[0436] Affected tissue, such as from a myocardial infarction, dies within 4-12 hours after the event. Similarly, in the case of a stroke, necrosis occurs within a few hours of the infarction, up to 24 hours at most, and repair of brain tissue occurs. Treatment with elastase inhibitors immediately after the event reduces the incidence of necrosis. This is based on 3D structural and topological similarities to CELA3A. Specific small molecule inhibitors discovered by screening a library of inhibitors Infusion of the inhibitor protected against liver toxicity even when administered 4 hours after APAP administration. This is further supported by results showing that treatment of MI is This was also supported by showing a reduction of approximately 30% in infarct size with another small inhibitor. Therefore, this study clearly demonstrates the potential for therapeutic intervention.

[0437] While this invention has been described in conjunction with specific embodiments thereof, many alternatives, modifications and variations will become apparent to those skilled in the art. It is clear that modifications are readily apparent. Therefore, it is intended that the present invention be practiced within the spirit and breadth of the appended claims. The present invention includes all such alternatives, modifications and variations that fall within the scope of the present invention. It is intended that

[0438] All publications, patents and patent applications mentioned herein are the property of their respective owners. Each of the patent applications is specifically and individually indicated to be incorporated by reference herein. and are incorporated herein by reference in their entirety to the same extent as if each of the preceding claims had been incorporated by reference in its entirety. Furthermore, citation or identification of any reference in this application is expressly incorporated by reference in its entirety. Nothing herein shall be construed as an admission that such reference is available as prior art to the present invention. No. To the extent that section headings are used, they should not be construed as necessarily limiting. It shouldn't be.

Claims

1. Formula II: 【Chemical 1】 It is characterized by the structure wherein G1 is a substituted or unsubstituted piperidine where the point of attachment to the thiazole ring is through the nitrogen atom, or G1 is C 1 -C 6 NH-pyridine substituted with a straight or branched chain alkyl, or unsubstituted NH-pyridine; and G3 has the following structure: 【Chemistry 2】 Is characterized by; or G3 is halogen, C 1 -C 6 aryl substituted with a straight or branched chain alkyl or haloalkyl group; or is unsubstituted aryl; wherein G2 is a substituted or unsubstituted pyrrolidine where the point of attachment to the carbonyl is through the nitrogen atom in the pyrrolidine. A pharmaceutical composition comprising an effective amount of a compound; or a pharmaceutical salt thereof, and optionally further comprising a pharmaceutically acceptable carrier or excipient.

2. The composition of claim 1 further comprising an anti-apoptotic or anti-aging agent.

3. 10. The composition of claim 1 for use in the treatment or prevention of cell or tissue necrosis.

4. The composition of claim 3, wherein the use is ex vivo or in vitro.

5. 4. The composition for use of claim 3, wherein treating or preventing cell or tissue necrosis affects cells selected from the group consisting of brain cells, nerve cells, Purkinje cells, hippocampal pyramidal cells, glial cells, cardiomyocytes, muscle cells, keratinocytes, epidermal cells, bone or chondrocytes, pancreatic cells, liver cells, kidney cells, gastrointestinal cells, spleen cells, hematopoietic cells, lymphocytes, macrophages thymocytes, fibroblasts, epithelial cells, bronchial epithelial cells, kidney cells, glomerular canal cells, gonad cells, sperm, eggs, fertilized eggs, embryonic cells, and lung epithelial cells.

6. Treating or preventing cell or tissue necrosis is useful in the treatment of the following conditions: neurodegenerative diseases, macular degeneration, retinal necrosis, muscular dystrophy, leukemia, lymphoma, respiratory distress, asphyxiation, incarcerated hernia, diabetes, tuberculosis, endometriosis, vascular dystrophy, psoriasis, cold injury, iron-loading complications, complications of steroid treatment, ischemic heart disease, myocardial infarction, reperfusion injury, cerebrovascular disease or gangrenous injury, decubitus ulcers, pancreatitis, hepatitis, cirrhosis, hemoglobinuria, sepsis, burns, hyperthermia, Crohn's disease, celiac disease, compartment syndrome, necrotizing proctitis, Stevens-Johnson syndrome (SJS), toxic epidermal necrosis (TEN), cystic fibrosis, rheumatoid arthritis, osteomyelitis, necrotizing fasciitis, nephrotoxicity, spinal cord injury, glomerulonephritis, acute urinary tract infections, and the like.

4. The composition for use according to claim 3, wherein the composition treats, ameliorates, inhibits, or reduces the incidence of a disease or medical condition selected from the group consisting of ductal necrosis, renal cortical necrosis, osteoarthritis, chylosemia, metabolic genetic diseases, bacterial, viral, fungal, or parasitic infections, Anderson's disease, congenital mitochondrial diseases, phenylketonuria, placental infarction, syphilis, aseptic necrosis, ischemic necrosis, alcoholism, necrosis associated with administration or exposure to drugs, chemical toxins, pesticides, heavy metals, organophosphate warfare agents, spider or snake venom, necrosis associated with dermal filler application, necrosis associated with ectopic drug application, chemotherapy-induced necrosis, radiation-induced necrosis, defects or reduced quality of transplanted tissue, or aging.

7. 10. The composition of claim 1 for use in treating, preventing, ameliorating, arresting or reducing the incidence of symptoms of a disease or medical condition associated with cell or tissue necrosis.

Images