AAV2-based viral vector particles for gene therapy

Modified AAV2 capsid proteins with inserted amino acid sequences improve cardiomyocyte specificity and reduce liver tropism, enhancing the efficacy of gene therapy for cardiac diseases by increasing expression and reducing antibody neutralization.

JP7737385B2Active Publication Date: 2025-09-10メディツィーニシェホーホシューレハノーファー
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022550865
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-02-20
Filing Date
2021-02-22
Publication Date
2025-09-10
Estimated Expiration
2041-02-22

AI Technical Summary

Technical Problem

Existing AAV2 and AAV9 viral vector particles lack specificity for cardiomyocytes and exhibit high tropism for non-target cells, particularly hepatocytes, limiting effective gene therapy for cardiac diseases.

Method used

Modified AAV2 capsid proteins with inserted amino acid sequences at specific positions, such as between amino acids 587 and 588 or 453, enhance tropism for cardiomyocytes while reducing tropism for liver tissue, achieved by disrupting heparin sulfate proteoglycan binding sites and incorporating specific amino acid segments.

Benefits of technology

The modified AAV2 capsid proteins demonstrate increased specificity and expression in cardiomyocytes comparable to AAV9, with reduced expression in liver tissue, and are less neutralized by human intravenous immunoglobulin, facilitating effective gene therapy for cardiac conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007737385000002
    Figure 0007737385000002
  • Figure 0007737385000003
    Figure 0007737385000003
  • Figure 0007737385000004
    Figure 0007737385000004
Patent Text Reader

Abstract

The present invention provides an AAV2-based viral vector particle, which contains an inserted amino acid segment in its capsid protein (CAP) that confers tropism to cardiomyocytes.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a viral vector particle based on adeno-associated virus serotype 2 (AAV2) for use in gene therapy, particularly for use in the treatment of cardiac diseases including cardiac defects, for example, for use in gene therapy of cardiac diseases including cardiac defects. The cardiac disease or cardiac defect is preferably a disease or defect of cardiomyocytes. The cardiac disease or cardiac defect is, for example, a medical condition associated with cardiac overload or heart failure, and for example, the viral vector particle is for use in the treatment of the following medical indications: delivery of a transgene that exhibits a therapeutic effect in cardiomyocytes after myocardial infarction, cardiac hypertrophy, or for the treatment of heart failure.

[0002] The viral vector particles of the present invention have the advantage that, when compared to wild-type AAV serotypes 2 and 9 (AAV2 and AAV9), they are more specific for cardiomyocytes and less efficient at transducing non-target cells, such as hepatocytes, allowing expression of the transgene encoded by the viral vector particle in cardiomyocytes. [Background technology]

[0003] cutting edge technology Perabo et al., Molecular Therapy, Vol. 8, No. 1, pp. 151-157 (2003) (Non-Patent Document 1) describe inserting a seven-amino acid random sequence at position 587 of the capsid protein called VP1 capsid protein of the AAV2 virion and selecting AAV2 mutants from the human megakaryocytic cell line M-07e or the B-cell chronic lymphocytic leukemia cell line Mec1 co-infected with adenovirus. As a result, mutant capsid protein sequences were identified that confer receptor specificity, but not cell specificity, to the viral vector.

[0004] Ying et al., Gene Therapy 17, pp. 980-990 (2010) (Non-Patent Document 2) describe three rounds of screening of an AAV2-display peptide library to select vectors with increased specificity for cardiac tissue by injecting the AAV2 library into mice, isolating cardiac tissue slices from the mice three days later, and superinfecting the cardiac tissue slices in vitro with Ad5 in culture conditions. Two AAV2 variants showing high specificity for cardiac tissue were identified, but reporter gene expression from these variants was lower than that from wild-type AAV9 viral vector particles.

[0005] Wang et al., Nature Reviews Drug Discovery, pp. 358-378 (2019) (Non-Patent Document 3) show that recombinant AAV (AAV vector particles or AAV vectors) can consist of non-viral sequences flanked by viral ITRs in their single-stranded DNA, with the only viral sequences being the ITRs. The AAV ITRs serve as packaging signals for genome replication and during vector production.

[0006] Rockman et al., PNAS 88:8277-8281 (1991) (Non-Patent Document 4) describe the induction of cardiac pressure overload in mice to generate a mouse model of cardiac hypertrophy.

[0007] Zhang et al., Hum. Gene Ther., pp. 1284-1296, doi: 10.1089 / hu.2019 / 027 (2019) (Non-Patent Document 5) describe a plasmid called pRC'99 containing the open reading frames (ORFs) for the AAV2 rep and cap proteins for use in cloning and generating capsid-variant AAV vector particles.

[0008] Zincarelli et al., Molecular Therapy, Vol. 16, No. 6, pp. 1073-1080 (2008) (Non-Patent Document 6) showed that among the naturally occurring serotypes of AAV, AAV9 exhibited the highest transgene expression in the heart after systemic injection in mice. As outlined by Hajjar and Ishikawa, Circulation Res, Vol. 120, No. 1, pp. 33-35 (2017), AAV9 has emerged as a vector with high cardiotropy, and therefore it is typically used to target the heart in gene therapy studies. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Perabo et al., Molecular Therapy, Vol. 8, No. 1, pp. 151-157 (2003) [Non-patent document 2] Ying et al., Gene Therapy 17, pp. 980-990 (2010) [Non-patent document 3] Wang et al., Nature Reviews Drug Discovery, pp. 358-378 (2019) [Non-patent document 4] Rockman et al., PNAS 88:8277-8281 (1991) [Non-Patent Document 5] Zhang et al., Hum. Gene Ther., pp. 1284-1296, doi: 10.1089 / hu.2019 / 027 (2019) [Non-patent document 6] Zincarelli et al., Molecular Therapy, Vol. 16, No. 6, pp. 1073-1080 (2008) [Non-Patent Document 7] Hajjar and Ishikawa, Circulation Res, Volume 120, Issue 1, Pages 33-35 (2017) Summary of the Invention [Problem to be solved by the invention]

[0010] Object of the invention It is an object of the present invention to provide alternative viral vector particles based on AAV2, particularly the capsid protein of AAV2, that have improved specificity, also referred to as tropism, for mouse and human cardiomyocytes and a lower affinity for liver tissue, for example compared to wild-type serotype AAV2, and particularly compared to AAV9. For use in gene therapy, such viral vector particles with superior specificity for cardiomyocytes should enable expression of the nucleic acid coding sequence contained in the viral vector particle in cardiomyocytes. [Means for solving the problem]

[0011] Description of the Invention The present invention achieves its objects by the features of the claims and, inter alia, provides an AAV2-based viral vector particle, which contains an inserted amino acid segment in its capsid protein (CAP) at the C-terminus of amino acid 587 and / or at the C-terminus of amino acid 588 and / or at the C-terminus of amino acid 453 of the wild-type amino acid sequence of CAP, comprising or consisting of one of the following amino acid sequences selected from SEQ ID NOs: 1 to 53, preferably SEQ ID NO: 1 or SEQ ID NO: 11. The CAP of the present invention comprises or consists, from N-terminus to C-terminus, of an N-terminal segment of CAP comprising or consisting of amino acids 1-587 of wild-type CAP, optionally a linker sequence, an inserted amino acid segment, and a C-terminal segment of CAP comprising or consisting of amino acids 588-735 of wild-type CAP for insertion at the C-terminus of amino acid 587, comprising or consisting of amino acids 589-735 of wild-type CAP for insertion at the C-terminus of amino acid 588, or comprising or consisting of amino acids 454-735 of wild-type CAP for insertion at the C-terminus of amino acid 453. Thus, in one embodiment, the inserted amino acid segment is inserted between amino acids N587 and R588 of the wild-type CAP amino acid sequence. Alternatively, the inserted amino acid sequence is inserted between amino acids R588 and 589 of the wild-type CAP amino acid sequence, which are alternatively described herein by an insertion between N587 and R588 of the wild-type CAP amino acid sequence, and / or by an insertion between I456 and amino acid 454, and all features from this specification and claims apply to an insertion between N587 and R588 of the wild-type CAP amino acid sequence, apply to an insertion between R588 and 589, and apply to an insertion between amino acids I453 and 454, with each amino acid numbered as relative to the wild-type CAP amino acid sequence.For each of these insertion sites, particularly in embodiments in which the inserted amino acid segment is inserted between amino acids 453 and 454 of the wild-type CAP amino acid sequence, the CAP amino acid sequence is preferably further mutated to R585A (amino acid 585 Arg to Ala) and R588A (amino acid 588 Arg to Ala). These preferred additional mutations disrupt the heparin sulfate proteoglycan binding site of wild-type CAP.

[0012] [Table 1]

[0013] Therein, there may be no additional amino acids between amino acid 587 of CAP, or amino acid 588 of CAP, or amino acid 453 of CAP, respectively, and the N-terminal amino acid of the inserted amino acid section, so that the inserted amino acid sequence is directly adjacent to amino acid 587 of CAP, or alternatively adjacent to amino acid 588 of CAP, or alternatively adjacent to amino acid 454 of CAP, or alternatively a linker sequence of 1 to 5 amino acids, e.g., 1 to 4 amino acids, may be positioned between amino acid 587 of CAP, alternatively amino acid 588 of CAP, or alternatively amino acid 454 of CAP, and the inserted amino acid section, and / or there may be no additional amino acids between the C-terminus of the inserted amino acid section and the remaining C-terminal part of CAP, so that the inserted amino acid sequence is directly adjacent to the amino acid of the C-terminal part of CAP, and / or a linker sequence of 1 to 4 amino acids, e.g., 1 to 3 amino acids, may be positioned between the C-terminus of the inserted amino acid section and the N-terminal amino acid of the remaining C-terminal part of CAP.

[0014] For insertions C-terminal to amino acid 587, the N-terminal amino acid of the remaining C-terminal portion of CAP is preferably wild-type CAP amino acid 588. Preferably, the C-terminal portion of CAP adjacent to the C-terminus of the inserted amino acid section has the amino acid sequence from amino acid 588 to amino acid 735 of SEQ ID NO: 56, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP.

[0015] For insertion at the C-terminus of amino acid 588, the N-terminal amino acid of the remaining C-terminal portion of CAP is preferably wild-type CAP amino acid 589. Preferably, the C-terminal portion of CAP adjacent to the C-terminus of the inserted amino acid section has the amino acid sequence from amino acid 589 to amino acid 735 of SEQ ID NO: 56, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP.

[0016] For insertions C-terminal to amino acid 454, the N-terminal amino acid of the remaining C-terminal portion of CAP is preferably wild-type CAP amino acid 455. Preferably, the C-terminal portion of CAP adjacent to the C-terminus of the inserted amino acid section has the amino acid sequence from amino acid 455 to amino acid 735 of SEQ ID NO: 56, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP.

[0017] The inserted amino acid segment may be immediately adjacent to the C-terminus of amino acid 587, alternatively directly adjacent to the C-terminus of amino acid 588, or alternatively directly adjacent to the C-terminus of amino acid 455 of the wild-type amino acid sequence of CAP, or a linker sequence of, for example, 1 to 5 amino acids, preferably 3 amino acids, may be positioned between amino acid 587, alternatively amino acid 588, or alternatively amino acid 453 of the wild-type amino acid sequence of CAP and the inserted amino acid segment. The inserted amino acids may be immediately adjacent to the N-terminus of amino acid 588, alternatively amino acid 589, or alternatively amino acid 454 of the wild-type amino acid sequence of CAP, or a linker sequence of 1 to 4 amino acids, preferably 2 amino acids, may be positioned between the inserted amino acid segment and the N-terminus of amino acid 588, alternatively amino acid 589, or alternatively amino acid 454 of the wild-type amino acid sequence of CAP. An exemplary linker sequence for placement between amino acid 588, alternatively amino acid 589, or alternatively amino acid 454 of the wild-type amino acid sequence of CAP and the N-terminus of the inserted amino acid segment is ASA, and an exemplary linker sequence for placement between amino acid 588, alternatively amino acid 589, or alternatively amino acid 454 of the wild-type amino acid sequence of CAP and the C-terminus of the inserted amino acid segment is AA. Preferably, the inserted amino acid segment, together with the linker sequence at its N-terminus and the linker sequence at its C-terminus, consists of 16 to 7 amino acids, for example 14 to 7 amino acids, more preferably 12 amino acids.

[0018] The linker section in each case may comprise or consist of at least one of the amino acids selected from Ala, Thr, Pro, Gly, Leu and / or Ser, which may be different from each other or all the same in each linker section.

[0019] The viral vector particles of the present invention have the advantages of increased tropism or specificity for cardiomyocytes, reduced tropism for cell types other than cardiomyocytes, particularly reduced tropism for liver tissue, compared to, for example, AAV2 and AAV9, each of which has a wild-type CAP, and expressing the nucleic acid sequence contained in the viral vector particle in cardiomyocytes, for example, at a level comparable to the expression level of the same transgene from AAV9 and much higher than the expression level of the same transgene from AAV2. Cardiomyocytes are part of cardiac tissue, and the viral vector particles can be used for medical purposes, for example, for the treatment of cardiac disease or cardiac defects, for example, for administration to human patients. Furthermore, the viral vector particles have the advantage of allowing their production in cells at high titers.

[0020] Furthermore, viral vector particles according to the invention were found to be neutralized to a significantly lesser extent by human intravenous immunoglobulin (IVIG), an antibody present in most people that is known to neutralize wild-type AAV particles, indicating that viral vector particles according to the invention for use in treatment have the advantage of avoiding neutralization by naturally occurring antibodies against AAV.

[0021] Viral vector particles containing CAP comprising one of the inserted amino acid segments of SEQ ID NO: 1 to SEQ ID NO: 53, preferably SEQ ID NO: 1 or SEQ ID NO: 11, inserted between amino acid 587 and amino acid 588 of wild-type CAP, and / or inserted between amino acid 588 and amino acid 589 of wild-type CAP, and / or inserted between amino acid 453 and amino acid 454 of wild-type CAP, have higher tropism for cardiomyocytes and allow expression of the nucleic acid sequence contained in the particle in cardiomyocytes and significantly lower expression in liver tissue than, for example, AAV9 viral vector particles containing the same nucleic acid sequence encoding a transgene.

[0022] Therefore, it is now believed that viral particles with a CAP containing one of the inserted amino acid segments have an affinity for the same cardiomyocyte surface molecule that acts as the target molecule.

[0023] An amino acid segment inserted between amino acids 587 and 588 of wild-type CAP, i.e., C-terminal to amino acid 587 of wild-type CAP, is contained as an insert in wild-type CAP in SEQ ID NO:54, with a preferred inserted amino acid segment of SEQ ID NO:1. A preferred inserted amino acid segment of SEQ ID NO:11 is contained as an insert in wild-type CAP in SEQ ID NO:55. For each inserted amino acid segment, a linker sequence of amino acids ASA is disposed between the N-terminal segment of wild-type CAP, i.e., between amino acids 587, and a linker sequence of amino acids AA is disposed between the inserted amino acid segment and the C-terminal segment of CAP, i.e., between the inserted amino acid segment and amino acid 588 of wild-type CAP. Wild-type CAP is encoded by the AAV2 cap ORF (coding sequence SEQ ID NO:56). As an alternative to ASA, the linker disposed between the N-terminal segment of wild-type CAP, i.e., between amino acid 587 of wild-type CAP and the inserted amino acid segment, may have the amino acid sequence AAA.

[0024] The viral vector particle contains a nucleic acid construct, such as the sense strand or antisense strand of single-stranded DNA, that comprises or consists of an effector sequence between the terminal ITR sequences of AAV2.The effector sequence can be an expression cassette that encodes an effector molecule, for example, functional non-coding RNA or protein-coding RNA, and the effector molecule can be expressed from the vector construct in cardiomyocytes, thereby exhibiting therapeutically beneficial functions in cardiomyocytes and therefore for the whole heart.

[0025] As used herein, transduction of cardiomyocytes refers to the introduction of nucleic acid into cardiomyocytes by viral vector particles, and this process can also be referred to as infection by viral vector particles, particularly for the use of viral vector particles in the treatment of cardiomyocytes. Generally, the viral vector particles can be for use in the treatment of cardiomyocytes in vivo or in vitro, for example for the treatment of genetic defects in cardiomyocytes, particularly for the transduction of cardiomyocytes.

[0026] Exemplary effector molecules can be selected from any wild-type sequence, e.g., for use in complementing a defective gene in a recipient of a viral vector particle. Exemplary effector molecules are naturally occurring genes, including genes from any species, preferably human genes.

[0027] In certain embodiments, empty viral particles that do not contain nucleic acid molecules are provided. These empty viral particles can be associated with functional molecules, for example, for delivery of functional molecules to cardiac tissue. The functional molecule can be, for example, a therapeutic agent or an indicator compound, such as a dye or a pharmaceutically acceptable diagnostic imaging agent, or a combination of at least two of these. The empty viral particles can be produced in HEK293 cells. The process involves transfecting HEK293 cells with each helper plasmid (containing the wild-type AAV2 cap gene (with inserted amino acid segments, if applicable) and the rep gene) and an adenovirus helper plasmid (containing the adenovirus helper functions required for AAV vector production) to produce AAV empty capsids (the vector genome plasmid containing the ITRs on both sides of the expression cassette is not used in this particular case), followed by purifying the empty capsid particles by iodixanol gradient centrifugation.

[0028] Generally, the process for producing AAV viral vector particles according to the present invention can be by delivery, e.g., by plasmid transfection of all components necessary for AAV vector production, with or without helper virus co-infection, from a vector genome containing, e.g., a transgene expression cassette flanked by ITRs, the AAVrep and AAVcap genes, and other viral helper genes necessary for AAV particle production, e.g., from an adenovirus. The process can be carried out in cultured eukaryotic host cells, followed by cell lysis and removal of cellular components and plasmid DNA, e.g., by enzymatic digestion, filtration, and / or centrifugation, and further purification, e.g., gradient density centrifugation and / or chromatography of the AAV viral vector particles. The AAV viral vector particles obtained by the process comprise a capsid protein (CAP) containing an inserted amino acid segment comprising one of the amino acid sequences selected from SEQ ID NOs: 1 to 53, C-terminal to amino acid 587 of the wild-type amino acid sequence of CAP.

[0029] Viral vector particles can be formulated for injection, for example, for direct injection into cardiac tissue, or for systemic injection, for example, intravenous (iv) injection.

[0030] The present invention will now be described by way of example and with reference to the drawings in which: [Brief explanation of the drawings]

[0031] [Figure 1] 1 is a scheme of the selection process used to identify CAPs with inserted amino acid segments of the present invention. [Figure 2] 1 shows the copy numbers of viral vector particles present in various cell types in experimental animals after systemic injection. [Figure 3] 1 shows the transduction efficiency and specificity of viral vector particles according to the present invention. [Figure 4A]1 shows the results of measuring neutralization of viral vector particles according to the present invention by human intravenous immunoglobulin (IVIG). [Figure 4B] 1 shows the results of measuring neutralization of viral vector particles according to the present invention by human intravenous immunoglobulin (IVIG). [Figure 5] 5A-5D: Shows the results of measuring neutralization of viral vector particles of the invention by sera from mice previously injected with either AAV2, AAV9 or viral vector particles according to the invention. [Figure 6] Figures 6A and 6B show the results of transduction efficiency by viral vectors in non-cardiomyocytes. Figure 6C shows the results of transduction efficiency by viral vectors in the presence or absence of heparin. Figure 6D shows thermostability data for viral vectors. Figure 6E shows cardiomyocyte transduction by viral vectors. [Figure 7] Figure 7A shows the experimental treatment scheme. Figures 7B to 7I show the in vivo effects of the viral vector of the present invention and a comparative vector in sham-operated and TAC-operated mice. Figures 7B to 7E show the results of echocardiography, Figure 7F shows the ratio of heart to tibia length, Figure 7G shows the expression level of H19, and Figures 7H and 7I show the copy number of H19 vector in cardiac and liver tissues. [Example]

[0032] Example: Identification of AAV2 viral vector particles with specificity for cardiomyocytes Generally, an initial library of AAV2 capsid mutant viral particles containing random amino acid segments inserted into CAP was generated. The inserted amino acid segments were encoded by nucleic acid constructs located between the segments encoding amino acids 587 and 588 of the wild-type CAP gene. Between the codons for amino acid 587 and 588 of wild-type CAP, the nucleic acid construct encoded an inserted amino acid sequence consisting of, from 5' to 3', a coding sequence for AAA as a linker sequence, a random 7-mer as the inserted amino acid sequence, and a coding sequence for AA as a linker sequence, resulting in the arrangement of each encoded amino acid sequence from N-terminus to C-terminus.

[0033] For the selection of cardiomyocyte-specific viral vector particles, 2-4 mice (male C57BL / 6N, 6-8 weeks old) were used. Here, cardiac pressure overload was artificially induced using a 26-gauge needle as described by Rockman et al., PNAS 88:8277-8281 (1991) (Non-Patent Document 4). These mice are also referred to as TAC mice. The resulting aortic valve stenosis due to transaortic aortic coarctation (TAC) was confirmed by echocardiography, and then the virus / vector particles were injected. Mice were injected with 0.66 x 10 11 ~1x10 11 Treatment was once by tail vein injection with 1 / vector particle.

[0034] The use of TAC mice as this mouse model in the in vivo selection process is believed to support the identification of AAV2 capsid mutant viral vector particles that contain an inserted amino acid section in the CAP, which leads to increased tropism, particularly for hypertrophic cardiomyocytes.Therefore, this viral vector particle is suitable for use in the treatment of cardiac tissue, particularly for targeting cardiomyocytes in the hypertrophic disease stage.At the same time, in vivo selection in mice allows the identification of capsid mutant AAV particles that reduce tropism for the liver and therefore lead to more efficient cardiomyocyte-specific transgene delivery and transgene expression, for example, increased cardiomyocyte-specific transgene delivery and transgene expression compared with wild-type AAV9.In this process, for the initial library, viral particles containing Rep and Cap genes are used, and in the further selection process, the Rep coding sequence is replaced with an expression cassette of EGFP DNA.

[0035] As a representative transgene, the coding sequence of EGFP (enhanced green fluorescent protein) was used.

[0036] An AAV library of viral vector particles was produced from the plasmid pool by calcium phosphate transfection of HEK293 cells followed by iodixanol gradient purification of the viral vector particles. Vector particle titers were determined by quantitative PCR using cap-specific or EGFP-specific primers.

[0037] The in vivo selection process consisted of three sequential selection steps. In the first selection step, an initial library of viral particles was injected into mice 53 days after TAC. Three days later, cardiac tissue was fractionated to isolate cardiomyocytes. To this end, mice were anesthetized with 4% isoflurane in oxygen in an inhalation chamber. The animals were fixed in a supine position on a hot plate (37°C), and anesthesia was maintained with a breathing mask (2% isoflurane in oxygen). The skin was incised, and an incision was made between the two tracheal trabeculae, through which a cannula was inserted. The tube was then secured with thread and connected to an artificial ventilation system. After disinfection of the chest, the skin was cut along a 2-3 cm length parallel to the rib arch, the abdomen and chest were opened, and any bleeding was gently wiped away. Next, the aorta was located, lifted, and gently transected. A blunt-tip cannula was inserted through the hole and secured with thread. Hearts were immediately retrogradely perfused in mice with pre-warmed perfusion buffer (113 mM NaCl, 4.7 mM KCl, 0.6 mM KH2PO4, 0.6 mM Na2HPO4, 1.2 mM MgSO4-7H2O, 0.032 mM phenol red, 12 mM NaHCO3, 10 mM KHCO3, 10 mM HEPES, 30 mM taurine, 0.1% glucose, 10 mM 2,3-butanedione monoxime) for 3 min, then removed from the mouse and perfused for an additional 3 min with perfusion buffer, followed by pre-warmed digestion buffer (113 mM NaCl, 4.7 mM KCl, 0.6 mM KH2PO4, 0.6 mM Na2HPO4, 1.2 mM MgSO4-7H2O, 0.032 mM phenol red, 12 mM NaHCO3, 10 mM KHCO3, 10 mM HEPES, 30 mM taurine, 0.1% glucose, 10 mM 2,3-butanedione monoxime). The atria were removed and the ventricles were dissected in 2.5 ml of warm digestion buffer and mechanically dissociated by shearing through a 1 ml syringe.Collagenase II digestion was stopped by adding 2.5 ml of stop buffer (113 mM NaCl, 4.7 mM KCl, 0.6 mM KH2PO4, 0.6 mM Na2HPO4, 1.2 mM MgSO4-7H2O, 0.032 mM phenol red, 12 mM NaHCO3, 10 mM KHCO3, 10 mM HEPES, 30 mM taurine, 0.1% glucose, 10 mM 2,3-butanedione monoxime, 12.5 μM CaCl2, 10% FBS) to the cell suspension. The resulting cell suspension was filtered through a 100 μm cell strainer, and the filter was washed with 1–2 ml of AMCF medium (10.8 g / L MEM HBS (Bioconcept) containing NEAA, 4.2 mM NaHCO3, 2 ng / ml vitamin B12, 1% penicillin / streptomycin (100 U / ml; 100 μg / ml), 10% FBS, pH 7.3). The appearance of rod-shaped cardiomyocytes was evaluated under a microscope. Cardiomyocytes were allowed to settle for 10 min at room temperature (RT). The cardiomyocyte pellet (CMC fraction) was washed in phosphate-buffered saline (PBS), centrifuged at 900 × g for 5 min at 4 °C, frozen in liquid nitrogen, and stored at −80 °C. The remaining supernatant was centrifuged at 30 × g for 3 min at room temperature to remove residual cardiomyocytes. The cell pellet containing the residual cardiomyocytes was discarded, and the supernatant containing the remaining cardiac cell types was further processed. During library selection, if other specific cardiac cell types, such as fibroblasts or endothelial cells, were not required, the supernatant was centrifuged at 430 × g to pellet all non-cardiomyocytes, and the pellet was frozen in liquid nitrogen and stored at −80 ° C. Alternatively, if cardiac fibroblasts and endothelial cells were required (for vector copy and expression analysis of individual vector variants), the cell pellet containing the non-myocyte fraction was dissolved in AMCF medium (10.8 g / L MEM HBS (Bioconcept) containing NEAA, 4.2 mM NaHCO , 2 ng / ml vitamin B , 1% penicillin / streptomycin (100 U / ml; 100 μg / ml), 10% FBS, pH 7.3) and pre-seeded onto 10 cm Petri dishes and placed in a 1% CO incubator for 1 hour.The adherent cells (cardiac fibroblasts) were washed twice with PBS, after which 2 ml of PBS was added to the dish, and the cells were collected using a cell scraper and centrifuged at 900 × g for 5 minutes at 4 °C. The pellet was frozen in liquid nitrogen and stored at -80 °C. The non-fibroblast fraction, the supernatant of the previous seeding step containing non-myocytes, was then centrifuged at 430 × g for 5 minutes at 4 °C. The resulting cell pellet was resuspended in 80 μl of MACS buffer (MACS bovine serum albumin stock solution diluted 1:20 in auto-MACS rinse solution, both Miltenyi Biotec), mixed with 20 μl of CD146 MACS beads (Miltenyi Biotec), and incubated for 15 minutes at 4 °C. Afterwards, 2 ml of MACS buffer was added, the cell suspension was thoroughly mixed, and centrifuged at 430 × g for 5 minutes at 4 °C. The cell pellet was resuspended in MACS buffer and transferred to a pre-washed MACS separation column. After three washing steps with MACS buffer, the separation column was removed from the magnetic field. The EC fraction was collected by rinsing the column three times with 500 μl of MACS buffer and centrifuging at 900 × g for 5 minutes at 4 ° C. The pellet was frozen in liquid nitrogen and stored at -80 ° C.

[0038] DNA was isolated from the cell fraction using a DNeasy Blood and Tissue kit (obtained from Qiagen, Hilden, Germany) according to the manufacturer's instructions. To reclone the inserted amino acid sequence of the CAP gene of viral particles accumulated in cardiomyocytes, viral vector DNA was amplified by PCR using primers located on either side of the coding sequence of the inserted amino acid sequence (forward primer SEQ ID NO: 57, reverse primer SEQ ID NO: 58), and a secondary library of viral vector particles was generated from these recloned CAP gene sequences.

[0039] For the second selection step, the rep gene was replaced in the secondary library with an expression cassette encoding EGFP. During production of viral vector particles from the secondary library, the rep protein-coding sequence was supplied in trans by plasmid transfection. The rep-encoding nucleotide sequence was provided on a separate plasmid, which was further used during transfection for AAV vector production. For packaging, the vector genomes of the secondary library contained AAV2 inverted terminal repeats (ITRs) on both sides. The viral vector particles from the secondary library were injected 42 days after TAC, and cardiomyocytes and non-myocytes were harvested 2 weeks later. Subsequently, DNA amplification was performed to reclone the nucleic acid sequence encoding the inserted amino acid sequence, which further accumulated in the cardiomyocytes. The recloned amino acid sequences were used to generate a tertiary library, selected in the same manner as in the previous second selection round.

[0040] The selection process is shown in Figure 1, where the target cells are cardiomyocytes, and liver tissue was analyzed as the major off-target tissue of AAV vectors to assess specificity for cardiomyocytes.

[0041] After three rounds of selection, sublibraries were isolated from the cardiomyocyte fraction, the non-myocellular cardiac fraction, and the liver tissue. DNA from these sublibraries after three rounds of selection was analyzed by next-generation sequencing on a 454 pyrosequencing platform (GS Junior, Roche Diagnostics) using a cap-specific primer (forward primer SEQ ID NO: 57). Sequencing data identified the coding sequence of a cardiomyocyte-enriched variant encoding the inserted amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 53 within the cap gene.

[0042] To produce individual capsid-modified vector particles selected from the previously performed AAV peptide display library selection, oligonucleotides encoding the inserted amino acid sequence and flanking portions were used to individually generate viral vector particles with cap proteins containing one of the inserted amino acid sequences. The oligonucleotides for each cap gene encoding one of the inserted amino acid sequences were cloned into the helper plasmid pRC'99 as described by Zhang et al., Hum. Gene Ther., pp. 1284-1296 (2019) (Non-Patent Document 5).

[0043] Viral vector particles according to the invention containing a CAP with an inserted amino acid section of SEQ ID NO: 1 had a CAP of SEQ ID NO: 54, and CAPs with an inserted amino acid section of SEQ ID NO: 11 had a CAP of SEQ ID NO: 55.

[0044] Both wild-type and capsid-modified variant AAV viral vector particles containing a CAP with an inserted amino acid segment according to the present invention, as well as wild-type AAV9 particles, were produced by calcium phosphate transfection of HEK293 cells, followed by purification of the viral vector particles by iodixanol gradient purification. Individual viral vectors containing one of the inserted amino acid sequences were produced as viral vectors encoding EGFP under the control of a CMV promoter in a self-complementary genome conformation (scEGFP). Briefly, the process involved transfecting HEK293 cells with a vector genome plasmid (a CMV promoter and EGFP coding sequence flanked by AAV2 ITRs), each helper plasmid (containing the wild-type AAV2 cap gene (with the inserted amino acid segment, if applicable) and rep gene), and an adenovirus helper plasmid (containing the adenovirus helper functions required for AAV vector production) for AAV vector production, followed by purification of the vector particles by iodixanol gradient centrifugation.

[0045] Genomic titers of vector production were determined by quantitative PCR using primers specific for the EGFP coding sequence.

[0046] The copy numbers of viral vector particles present in various tissues of experimental animals for the example of a CAP containing an inserted amino acid segment of SEQ ID NO: 1 or SEQ ID NO: 11 show that viral vector particles containing a CAP according to the present invention have high specificity for cardiomyocytes, particularly in relation to hepatocytes, compared to, for example, wild-type AAV9.

[0047] AAV vector copy number analysis was performed by determining the absolute gene copy numbers of Ptbp2 (polypyrimidine tract-binding protein 2; 2 copies per diploid genome) and EGFP by qPCR in cardiac cell samples and organ tissues, respectively, using the absolute standard curve method. Multiplex TaqMan probe-based qPCR detection was performed in a 384-well format using TaqMan Fast Advance Master Mix (Thermo Fisher Scientific), TaqMan Copy Number Assay for EGFP (Thermo Fisher Scientific; FAM fluorescently labeled), Ptbp2 primers (forward: TCTCCATTCCCTATGTTCATGC (SEQ ID NO: 59), reverse: GTTCCCGCAGAATGGTGAGGTG (SEQ ID NO: 60)), and the JOE fluorescently labeled Ptbp2 probe (5'[JOE]-ATGTTCCTCGGACCAACTTG-[BHQ1]3' (SEQ ID NO: 61)). Each qPCR reaction contained a final concentration of 1x TaqMan Fast Advance Master Mix, 1x EGFP TaqMan Copy Number Assay, 150 nM Ptbp2 TaqMan probe, 330 nM primers (forward and reverse) and 2 μl of DNA sample in a total volume of 10 μl. The DNA sample was used to generate an absolute copy number standard curve (5x10 molecules). 5 , 5x10 4 , 5x10 3, 5x10 2 , 5x10 1 The plasmids included either linearized plasmid DNA (containing one copy of Ptbp2 and EGFP per plasmid) for 1000 ng / μl (1 copy / μl), or pre-diluted DNA at a concentration of 15 ng / μl.

[0048] qPCR was performed in a QuantStudio Real-Time PCR System (ThermoFisher Scientific) using the following protocol: initial activation at 50°C for 2 minutes and 95°C for 20 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds, primer / probe annealing and extension at 56°C for 20 seconds, and fluorescent signal detection at 65°C for 20 seconds. The vector copy number (VCN) in diploid cells was calculated by the following formula: VCN = amount (EGFP) / amount (Ptbp2) × 2.

[0049] The expression level of EGFP, which represents effector gene, shows that the viral vector particle of the present invention has high specificity of effector gene expression in cardiomyocytes.The expression level of transgene is equivalent to that of the same transgene delivered by wild-type AAV9.However, compared with AAV9, the vector particle of the present invention shows reduced expression in liver tissue, which is the main off-target.

[0050] Expression of the exemplary transgene EGFP was analyzed by quantitative reverse transcription PCR (qrtPCR) in cardiac cell types obtained by cardiac fractionation and liver tissue collected 2 weeks after viral vector injection. Results were generally normalized for RNA input relative to TATA box-binding protein (Tbp) transcripts. Specifically, reverse transcription of 65–500 ng of total RNA was performed using the Biozym cDNA Synthesis Kit (Biozym) according to the manufacturer's instructions. For organ tissue samples, a second DNase digestion was performed directly prior to reverse transcription by incubating 500 ng of total RNA with 0.684 μl DNase (1:10 dilution, RNase-Free DNase Set (Qiagen)), 1.15 μl RDD buffer (RNase-Free DNase Set (Qiagen)), and 0.144 μl RNasin Ribocluclease Inhibitor (Promega) in a total volume of 11.5 μl for 30 min at 37°C. The reaction was stopped by adding 0.23 μl of 62.5 mM EDTA and incubating at 65°C for 5 minutes. 11.5–11.73 μl of diluted RNA solution (with or without a second DNase digestion) containing 65–500 ng of RNA was reverse transcribed using 4 μl of 5x cDNA synthesis buffer, 2 μl of dNTP Mix (10 mM each), 1 μl of hexamer primer (25 μM), 0.5 μl of RNase inhibitor (40 U / μl), and 1 μl of reverse transcriptase. The reaction mixture was incubated at 30°C for 10 minutes, followed by 55°C for 60 minutes. Finally, the enzyme was heat-inactivated at 99°C for 5 minutes. Prior to qPCR, the cDNA samples were diluted with 2 volumes of nuclease-free HO (1:3 dilution) and stored at -20°C.

[0051] qPCR measurements were performed using iQ SYBR Green Supermix (Biorad) in a 384-well format according to the manufacturer's instructions. A reaction mixture consisting of 5 μl of iQ SYBR Green Supermix, 0.05 μl of ROX Reference Dye diluted 1:50 (Thermo Scientific), 0.025 μl of Precision Blue™ Real-Time PCR Dye (BioRad), 0.5 μl of premixed primers (10 μM forward and 10 μM reverse primers), 2.45 μl of nuclease-free HO, and 2 μl of cDNA (diluted 1:3 after cDNA synthesis) was mixed and the qPCR protocol was performed using a Viia™ 7 Real-Time PCR System (ThermoFisher). The PCR was performed in a Biosciences Scientific using the following protocol: initial activation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, primer annealing at 60°C for 30 seconds, and extension at 72°C for 40 seconds, followed by 45 cycles of melting curve generation with fluorescence detection from 95°C to 55°C for 10 seconds at 0.5°C intervals to ensure amplification of a single PCR amplicon. EGFP expression in cardiac cell fractions and mouse organs was analyzed by the relative standard method. The same 1:5 serial dilutions of the pooled EGFP-expressing sample were included in all qPCR measurements to obtain relative standard values ​​for all samples.

[0052] Figure 2 shows the average copy number (VCN) of viral vector particles in cells and organs isolated from experimental animals, namely, cardiac myocytes (CMC), liver, skeletal muscle (sk), kidney, and spleen. Viral vector particles, shown top to bottom, are indicated left to right in the graph. Animals are indicated as sham-operated (sham) or with surgically induced aortic coarctation (TAC). The results show that CAPs containing the inserted amino acid segment THGTPAD (SEQ ID NO: 1) (AAV2-THGTPAD) and CAPs containing the inserted amino acid segment NLPGSGD (SEQ ID NO: 11) (AAV2-NLPGSGD) confer copy numbers similar to wild-type AAV9 (AAV9) and higher than wild-type AAV2 (AAV2) in cardiac myocytes, and lower than wild-type AAV2 and AAV9 in the liver. This indicates increased specificity of CAPs containing inserted amino acid segments according to the present invention for cardiomyocytes over wild-type AAV serotypes AAV2 and AAV9. In contrast, CAPs with inserted amino acid segments having the sequence LPSRPSL (SEQ ID NO: 62, for comparison) have lower copy numbers in cardiomyocytes and higher copy numbers in the liver, indicating lower tropism for cardiomyocytes.

[0053] The transduction efficiency and transduction specificity of viral vector particles according to the present invention were analyzed by introducing a viral vector containing a CAP with an inserted amino acid segment of SEQ ID NO:1 (CAP of SEQ ID NO:54) or a CAP with an inserted amino acid segment of SEQ ID NO:11 (CAP of SEQ ID NO:55), and for comparison, wild-type AAV2 or wild-type AAV9, or a CAP containing an inserted amino acid segment of SEQ ID NO:62. The viral vector particles contained an EGFP expression cassette. The viral vector particles were injected into sham-operated or TAC-operated mice (2-4 animals each) 6 weeks after surgery. Two weeks after viral vector particle injection, EGFP expression was determined by qRT-PCR in cardiomyocytes, cardiac fibroblasts (CFs), and cardiac endothelial cells (ECs) differentiated from cardiac tissue, in skeletal muscle cells (skeleton muscle), liver, kidney, and spleen.

[0054] Figure 3A shows a schematic representation of the analysis process. Figure 3B shows the results of detecting EGFP expression normalized to Tbp expression (relative expression (EGFP / Tbp)) in sham-operated mice (sham) or TAC-operated mice (TAC) separately for each vector: wild-type AAV2 (AAV2), wild-type AAV9 (AAV9), viral vector particles with a CAP containing an inserted amino acid segment of SEQ ID NO: 1 (AAV2-THGTPAD), viral vector particles with a CAP containing an inserted amino acid segment of SEQ ID NO: 11 (AAV2-NLPGSGD), or comparative vector particles with a CAP containing an inserted amino acid segment of SEQ ID NO: 62. These experimental combinations are shown in two columns, top to bottom, in Figure 3B, and are shown in this order from left to right for various cell types. The results show that vector particles according to the present invention in cardiomyocytes produce higher transgene expression than wild-type AAV2 and similar expression to wild-type AAV9 in cardiomyocytes of sham-operated and TAC-operated mice, and lower transgene expression than wild-type AAV9 in the liver, a major off-target organ.

[0055] Figure 3C shows EGFP expression normalized to Tbp expression in cardiac myocytes (CMCs) compared to expression in liver for the vectors AAV2, AAV9, AAV2-THGTPAC, and AAV2-NLPGSGD, combined for results from sham-operated and TAC-operated animals, and separately for sham and TAC for the comparative CAP (AAV2-LPSRPSL) containing the inserted amino acid segment SEQ ID NO: 62. Data are provided for AAV2 and AAV9 (wild-type capsid), as well as for viral vector particles with a CAP containing the inserted amino acid segment SEQ ID NO: 1 (AAV2-THGTPAD) and a vector with a CAP containing the inserted amino acid segment SEQ ID NO: 11 (AAV2-NLPGSGD), and for the comparative vector (SEQ ID NO: 62). Based on exemplary CAPs containing inserted amino acid segments, this shows that AAV2-based viral vector particles containing a CAP with an inserted amino acid segment according to the present invention result in a significant increase in the expression specificity of the effector molecule encoded by the viral vector particle in cardiomyocytes, e.g., a significant increase compared to wild-type AAV2 and AAV9, and a significant increase compared to a comparative CAP containing an inserted amino acid segment of SEQ ID NO: 62.

[0056] To test the persistence of viral vector particles according to the present invention in serum containing human intravenous immunoglobulin (IVIG), the neutralizing activity of IVIG serum was tested. Viral vector particles containing the CAP according to the present invention and wild-type serotype AAV2 vector particles were incubated with various dilutions of IVIG serum in 1 mL of DMEM cell culture medium (supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin). Viral vector particles were used in the absence of IVIG, i.e., in cell culture medium alone, at a concentration sufficient to transfect 30-40% of cells to express EGFP (30-40% of cells were EGFP-positive), which was also used as a positive control. Viral vector particles were incubated in cell culture medium with or without IVIG serum at room temperature for 1 hour and then added to HEK293 cells cultured in 12-well plates. After 48 hours of incubation under cell culture conditions, HEK293 cells were analyzed by fluorescence-activated cell sorting (FACS) to determine the percentage of EGFP-positive cells.

[0057] Figure 4A shows the FACS results, where the percentage of EGFP-positive cells was normalized to the percentage determined for the positive control (pos.CRL) = 1. It was found that wild-type AAV2 (AAV2) and comparative viral vector particles (AAV2-LPS) containing a CAP with SEQ ID NO: 62 as the inserted amino acid segment were neutralized in highly diluted IVIG serum more quickly than viral vector particles of the present invention containing, for example, an inserted amino acid segment of SEQ ID NO: 1 (AAV2-THG) or an inserted amino acid segment of SEQ ID NO: 11 (AAV2-NLP). Figure 4B shows a graph of IC50 values ​​derived from the data in Figure 4A.

[0058] Production of viral vector particles according to the invention was performed as described herein for expression and vector copy number analysis in mouse tissues.

[0059] Figures 5A-D show the FACS results, where the percentage of EGFP-positive cells was normalized to the percentage determined for the positive control (pos.CRL) = 1. Mouse serum from mice previously injected with wild-type AAV9 (AAV9) only neutralizes AAV9, while AAV2 and the viral vector particles of the present invention are found to transduce cells regardless of the presence of this serum. Similarly, mouse serum from mice previously injected with wild-type AAV2 (AAV2) only neutralizes AAV2, while AAV9 and the viral vector particles of the present invention retain their ability to transduce cells. It is noteworthy that serum from mice previously injected with AAV-NLP exhibits poor neutralizing capacity, resulting in neutralization of AAV2 and the viral vector particles of the present invention only at low serum dilutions. Similarly, serum from mice previously injected with AAV-THG exhibits poor neutralizing capacity, resulting in weak neutralization of only wild-type AAV2 at low serum dilutions.

[0060] In vitro characterization of the AAV2 viral particles of the present invention is shown in Figure 6. Various amounts of vector were used to transduce Hek293 cells in a 12-well format. The genome titers of the vectors used in this assay were in a comparable range. Transduction efficiency was determined by fluorescence-activated cell sorting (FACS) for EGFP-positive cells 48 hours after transduction (n=3). Figure 6A shows the transduction efficiency of the AAV2 viral vectors of the present invention, AAV2-THGTPAD (containing the inserted amino acid section of SEQ ID NO: 1) and AAV2-NLPGSGD (containing the inserted amino acid section of SEQ ID NO: 11), as well as wild-type AAV2 and AAV2-LPSRPSL (containing the comparative inserted amino acid section of SEQ ID NO: 62). Based on the data in Figure 6A, Figure 6B shows the calculated ratio of infectious particles (for Hek293 cells) per vector genome, where genome titers were determined by qPCR (quantitative PCR). The results show that the comparative vector AAV2-LPSRPSL exhibits lower infectivity than wild-type AAV2 in these cells, and that the vector according to the present invention exhibits significantly reduced infectivity in these non-target cells.

[0061] Figure 6C shows the results of a heparin competition assay, in which heparin forms a soluble analog of HSPG, a putative receptor for viral vectors. AAV vectors and wild-type AAV2 were preincubated with heparin and then transduced into Hek293 cells to investigate heparin sulfate proteoglycan (HSPG)-dependent cell entry. Transduction efficiency was determined by FACS for EGFP-positive cells 48 hours after transduction (n=3). The results show that heparin did not affect transduction by the vectors of the present invention, but did affect transduction by the comparative vectors AAV2 and AAV2-LPSRPSL. This suggests that cell entry of the vectors of the present invention occurs independently of HSPG.

[0062] The thermal stability of AAV vector particles was assayed by subjecting the vector particles to various temperatures for 15 minutes, followed by dot blotting using the A20 antibody, which is specific for detecting assembled capsid proteins of intact AAV vector particles. The results are shown in Figure 6D, showing that capsid stability is lower for both the comparative vector AAV2-LPSRPSL and the viral vector of the present invention than for wild-type AAV2. However, while the comparative vector AAV2-LPSRPSL is the least stable variant, showing partial degradation at 57.9 ° C, the vector of the present invention showed very similar stability, with partial capsid degradation starting at 60.7 ° C, and the onset of degradation of the variant capsid only began at 63.4 ° C.

[0063] Figure 6E shows the results of a cross-species activity assay. Human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMCs) were transfected with an AAV vector expressing scEGFP at 2x10 3 The cells were transduced at a vector particle-to-cell ratio of 0.01 to 0.01. EGFP expression was assessed by fluorescence microscopy (scale bar = 100 μm) 7 days after transduction (n = 3). The results demonstrate that the viral vectors of the present invention transduce cardiomyocytes.

[0064] The following mouse experimental data demonstrate the therapeutic efficacy and liver detargeting of the viral vectors of the present invention for the examples of AAV2-THGTPAD and AAV2-NLPGSGD. Taking advantage of the observation that AAV9-based delivery of the long non-coding RNA (lncRNA) H19 reverses pathological cardiac hypertrophy in TAC mouse models, H19 was packaged into AAV9, AAV2-THGTPAD, and AAV2-NLPGSGD, as shown diagrammatically in Figure 7A, and injected into mice 4 weeks after induction of TAC. 10Because only 1 viral genome (vg) per mouse was injected, the data indicate that a low dose of viral vector was sufficient for transduction due to improved cardiomyocyte tropism. Echocardiographic functional assessment 4 weeks after AAV treatment showed significant rescue in left ventricular ejection fraction for both AAV2-THGTPAD-H19 and AAV2-NLPGSGD-H19, but not AAV9-H19, compared with the AAV9 null control group (Figure 7B). This coincided with lower left ventricular mass (Figure 7C), rescued cardiac dimensions (Figures 7D, 7E), and a lower heart weight-to-tibia length ratio (Figure 7F) in AAV2-THGTPAD-H19- and AAV2-NLPGSGD-H19-treated mice. The AAV9-H19-treated group showed a clear trend toward therapeutic rescue for all parameters, but this did not reach statistical significance. H19 expression analysis after cardiac interpretation showed the expected reduction of H19 in AAV2-THGTPAD-H19, AAV2-NLPGSGD-H19, and AAV9-H19-treated mice, with cardiac hypertrophy only partially rescued (Figure 7G, likely due to low vector doses associated with a dilution effect in non-cardiomyocytes). Nevertheless, H19 copy number analysis showed a strong increase for all variants compared with the AAV9 blank control (Figure 7H). Notably, while AAV9-H19 strongly accumulated in the liver, H19 copy numbers in AAV2-THGTPAD-H19- and AAV2-NLPGSGD-H19-treated mice were comparable to those in the sham and AAV9 blank control groups (Figure 7I). The present application relates to the invention described in the claims, but may also include the following as other aspects. 1. An AAV2 viral vector particle comprising a nucleic acid construct for an effector molecule, characterized in that the AAV2 viral vector particle comprises a capsid protein (CAP) containing an inserted amino acid segment comprising one of the amino acid sequences selected from SEQ ID NOs: 1 to 53 at the C-terminus of amino acid 587, 588, or 453 of the wild-type amino acid sequence of CAP of SEQ ID NO: 56. 2. The AAV2 viral vector particle according to claim 1, characterized in that a linker sequence of 1 to 4 amino acids is located between amino acid 587, 588, or 453 of the N-terminal segment of CAP and the N-terminal amino acid of the inserted amino acid segment. 3. The AAV2 viral vector particle according to 1 or 2 above, characterized in that a linker sequence of 1 to 3 amino acids is located between the C-terminus of the inserted amino acid section and the N-terminal amino acid of the remaining C-terminal portion of the CAP. 4. An AAV2 viral vector particle according to any one of 1 to 3 above, characterized in that the remaining C-terminal portion of the CAP is amino acids 588 to 735, or amino acids 589 to 735, or amino acids 454 to 735 of SEQ ID NO: 56. 5. An AAV2 viral vector particle according to any one of 1 to 4 above, characterized by the mutations R585A (amino acid 585 from Arg to Ala) and R588A (amino acid 588 from Arg to Ala). 6. An AAV2 viral vector particle according to any one of 1 to 5 above for use in the treatment of a disease or defect of cardiomyocytes, or in the treatment of a disease or defect of muscle myocytes or skeletal muscle cells. 7. An AAV2 viral vector particle for use in treating a disease or defect of cardiomyocytes as described in 6 above, characterized in that the vector particle contains a nucleic acid construct comprising an effector sequence. 8. An AAV2 viral vector particle for use in treating a disease or defect of cardiomyocytes according to 6 or 7 above, characterized in that the effector sequence is an expression cassette encoding an effector molecule. 9. An AAV2 viral vector particle for use in treating a disease or defect of cardiomyocytes according to any one of 6 to 8 above, wherein the disease or defect is cardiac hypertrophy, myocardial infarction, cardiotoxicity or heart failure. 10. AAV2 vector particles for use in the treatment of a disease or defect of cardiomyocytes according to any one of 6 to 9 above, wherein the treatment is in vivo or ex vivo transduction of cardiomyocytes. 11. AAV2 viral vector particles for use in treating a disease or defect of cardiomyocytes described in any one of 6 to 10 above, wherein the person receiving the viral vector particles has antibodies that neutralize wild-type AAV2 and / or antibodies that neutralize AAV9. 12. A method for producing AAV2 viral vector particles by delivery of components for AAV vector production in cultured eukaryotic cells, followed by cell lysis and removal of cellular components and plasmid DNA, and further purification of the AAV viral vector particles, wherein the AAV2 viral vector particles comprise a capsid protein (CAP) containing an inserted amino acid segment comprising one of the amino acid sequences selected from SEQ ID NO:1 to SEQ ID NO:53 at the C-terminus of amino acid 587, or at the C-terminus of amino acid 588, or at the C-terminus of amino acid 453 of the wild-type amino acid sequence of CAP. 13. A method for treating heart disease, including heart defects, comprising administering the AAV2 vector particle described in any one of 1 to 11 above to a patient diagnosed with heart disease or heart defects.

Claims

1. An AAV2 viral vector particle comprising a nucleic acid construct for an effector molecule, wherein the AAV2 viral vector particle comprises a capsid protein (CAP) containing an inserted amino acid segment comprising one of the amino acid sequences selected from SEQ ID NOs: 1 to 53 at the C-terminus of amino acid 587, 588, or 453 of the wild-type amino acid sequence of CAP of SEQ ID NO: 56, and is neutralized by human intravenous immunoglobulin (IVIG) to a significantly lesser extent than wild-type AAV2.

2. 2. The AAV2 viral vector particle according to claim 1, wherein a linker sequence of 1 to 4 amino acids is located between amino acid 587, 588, or 453 of the N-terminal segment of CAP and the N-terminal amino acid of the inserted amino acid segment.

3. 3. The AAV2 viral vector particle according to claim 1, wherein a linker sequence of 1 to 3 amino acids is located between the C-terminus of the inserted amino acid section and the N-terminal amino acid of the remaining C-terminal portion of the CAP.

4. The AAV2 viral vector particle according to any one of claims 1 to 3, wherein the remaining C-terminal portion of the CAP is amino acids 588 to 735, or amino acids 589 to 735, or amino acids 454 to 735 of SEQ ID NO:

56.

5. 5. The AAV2 viral vector particle of any one of claims 1 to 4, characterized by the mutations R585A (amino acid 585 from Arg to Ala) and R588A (amino acid 588 from Arg to Ala).

6. 6. An AAV2 viral vector particle according to any one of claims 1 to 5 for use in the treatment of a disease or defect of cardiomyocytes, or in the treatment of a disease or defect of muscle myocytes or skeletal muscle cells.

7. 7. An AAV2 viral vector particle for use in treating a cardiomyocyte disease or defect according to claim 6, characterized in that the vector particle contains a nucleic acid construct comprising an effector sequence.

8. 8. An AAV2 viral vector particle for use in treating a disease or defect of cardiomyocytes according to claim 7, characterized in that the effector sequence is an expression cassette encoding an effector molecule.

9. The AAV2 viral vector particle for use in treating a disease or defect of cardiomyocytes according to any one of claims 6 to 8, wherein the disease or defect is cardiac hypertrophy, myocardial infarction, cardiotoxicity or heart failure.

10. 10. AAV2 vector particles for use in the treatment of cardiomyocyte diseases or defects according to any one of claims 6 to 9, wherein said treatment is in vivo or ex vivo transduction of cardiomyocytes.

11. 11. An AAV2 viral vector particle for use in treating a cardiomyocyte disease or defect according to any one of claims 6 to 10, wherein a recipient of the viral vector particle has antibodies that neutralize wild-type AAV2 and / or antibodies that neutralize AAV9.

12. 1. A method for producing AAV2 viral vector particles by delivery of components for AAV vector production in cultured eukaryotic cells, followed by cell lysis and removal of cellular components and plasmid DNA, and further purification of the AAV viral vector particles, wherein the AAV2 viral vector particles comprise a capsid protein (CAP) containing an inserted amino acid segment comprising one of the amino acid sequences selected from SEQ ID NOs: 1 to 53 at the C-terminus of amino acid 587, 588, or 453 of the wild-type amino acid sequence of CAP, and are neutralized to a significantly lesser extent by human intravenous immunoglobulin (IVIG) compared to wild-type AAV2.