Novel lipids and compositions for delivering therapeutic agents
Novel cationic lipids and lipid particles address the challenges of nucleic acid delivery by enhancing stability and reducing toxicity, achieving effective intracellular delivery and target protein regulation.
Patent Information
- Application Number
- JP2023136370
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2009-08-14
- Filing Date
- 2023-08-24
- Publication Date
- 2025-12-01
- Estimated Expiration
- 2029-11-10
AI Technical Summary
Current therapeutic nucleic acids face challenges such as susceptibility to nuclease digestion, limited intracellular delivery, and systemic toxicity, necessitating improved lipid-based delivery systems for enhanced stability and efficacy.
Development of novel cationic lipids and lipid particles with specific molar ratios and compositions, including neutral lipids and PEG-lipids, to encapsulate nucleic acids efficiently, protect them from degradation, and facilitate intracellular delivery while minimizing toxicity.
The novel lipid compositions enhance nucleic acid activity, increase therapeutic index, and reduce toxicity, enabling effective downregulation of target proteins and mRNA levels, and provide improved in vivo tolerability.
Smart Images

Figure 0007778118000077 
Figure 0007778118000078 
Figure 0007778118000079
Abstract
Description
[Technical Field]
[0001] government support The work described herein was performed, at least in part, with funding from the U.S. Government under Grant No. HHSN266200600012C awarded by the National Institute of Allergy and Infectious Diseases. Accordingly, the U.S. Government may have certain rights in this invention.
[0002] Priority claims This application claims priority to U.S. patent application Ser. No. 61 / 113,179, filed Nov. 10, 2008, U.S. patent application Ser. No. 61 / 154,350, filed Feb. 20, 2009, U.S. patent application Ser. No. 61 / 171,439, filed April 21, 2009, U.S. patent application Ser. No. 61 / 185,438, filed June 9, 2009, U.S. patent application Ser. No. 61 / 225,898, filed July 15, 2009, and U.S. patent application Ser. No. 61 / 234,098, filed August 14, 2009, the contents of each of which are incorporated herein by reference.
[0003] The present invention relates to the field of therapeutic drug delivery using lipid particles. Specifically, the present invention provides cationic lipids and lipid particles containing lipids that are advantageous for in vivo delivery of nucleic acids and for nucleic acid-lipid particle compositions suitable for in vivo therapeutic uses. In addition, the present invention provides methods for making these compositions and methods for using these compositions to introduce nucleic acids into cells, for example, to treat various disease states. [Background technology]
[0004] 2. Description of Related Art Therapeutic nucleic acids include, for example, small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, ribozymes, plasmids, immunostimulatory nucleic acids, antisense, antagomirs, antimirs, microRNA mimics, supermirs, U1 adapters, and aptamers. These nucleic acids act through various mechanisms. In the case of siRNA or miRNA, these nucleic acids can downregulate the intracellular levels of specific proteins through a process called RNA interference (RNAi). After siRNA or miRNA is introduced into the cytoplasm, these double-stranded RNA constructs can bind to a protein called RISC. The sense DNA of the siRNA or miRNA dissociates from the RISC complex, providing a template within the RISC that can recognize and bind mRNAs with sequences complementary to those of the bound siRNA or miRNA. Upon binding of the complementary mRNA, the RISC complex cleaves the mRNA and releases the cleaved strand. RNAi can provide downregulation of specific proteins by targeting the specific destruction of the corresponding mRNA that codes for protein synthesis.
[0005] Because siRNA and miRNA constructs can be synthesized using any nucleotide sequence for target protein, the therapeutic application of RNAi is very broad.To date, siRNA constructs have shown the ability to specifically down-regulate target protein in both in vitro and in vivo models.In addition, siRNA constructs are currently being evaluated in clinical studies.
[0006] However, two problems currently facing siRNA or miRNA constructs are their susceptibility to nuclease digestion in plasma and their limited ability to gain access to intracellular compartments where they can bind to RISC when administered systemically as free siRNA or miRNA. These double-stranded constructs can be stabilized by incorporating chemically modified nucleotide linkers, such as phosphothioate groups, into the molecule. However, these chemical modifications only provide limited protection from nuclease digestion and may reduce the activity of the construct. Intracellular delivery of siRNA or miRNA can be facilitated by using carrier systems such as polymers, cationic liposomes, or by chemically modifying the construct, for example by covalently attaching cholesterol molecules. However, improved delivery systems are needed to increase the potency of siRNA and miRNA molecules and reduce or eliminate the need for chemical modification.
[0007] Antisense oligonucleotides and ribozymes can also inhibit the translation of mRNA into protein. In the case of antisense constructs, these single-stranded deoxyribonucleotides have sequences complementary to the target protein mRNA and can bind to the mRNA through Watson-Crick base pairing. This binding either prevents translation of the target mRNA and / or induces RNase H digestion of the mRNA transcript. Consequently, antisense oligonucleotides offer great potential for specificity of action (i.e., downregulation of specific disease-related proteins). To date, these compounds have shown promise in several in vitro and in vivo models, including models of inflammatory disease, cancer, and HIV (reviewed in Agrawal, Trends in Biotech. 14:376-87 (1996)). Antisense can also affect cellular activity by specifically hybridizing to chromosomal DNA. Advanced human clinical evaluation of several antisense drugs is currently underway. Targets of these drugs include the bcl2 and apolipoprotein B genes and mRNA products.
[0008] Immunostimulatory nucleic acids include deoxyribonucleic acids and ribonucleic acids. In the case of deoxyribonucleic acids, specific sequences or motifs exhibit malformed immune stimulation in mammals. These sequences or motifs include CpG motifs, pyrimidine-rich sequences, and palindromic sequences. CpG motifs in deoxyribonucleic acids are thought to be specifically recognized by the endosomal receptor, Toll-like receptor 9 (TLR-9), which then triggers both innate and acquired immune stimulation pathways. Specific immunostimulatory ribonucleic acid sequences have also been reported. These RNA sequences are thought to induce immune activation by binding to Toll-like receptors 6 and 7 (TLR-6 and TLR-7). In addition, double-stranded RNA has also been reported to be immunostimulatory and is thought to activate TLR-3 by binding to TLR-3.
[0009] One well-known problem with the use of therapeutic nucleic acids relates to the stability of the phosphodiester internucleotide bond and the susceptibility of this linker to nucleases. The presence of exonucleases and endonucleases in serum leads to rapid digestion of nucleic acids with phosphodiester linkers, and therefore therapeutic nucleic acids may exhibit very short half-lives in the presence of serum or intracellularly. (Zelphati, O., et al., Antisense. Res. Dev. 3:323-338 (1993); and Thierry, AR, et al., pp147-161 in Gene Regulation: Biology of Antisense RNA and DNA (Eds. Erickson, RP and Izant, JG; Raven Press, NY (1992)). Due to these and other known problems, therapeutic nucleic acids currently under development do not use the basic phosphodiester chemistry found in natural nucleic acids.
[0010] This problem has been partially overcome by chemical modifications that reduce serum or intracellular digestion. Modifications in the internucleotide phosphodiester bond (e.g., using phosphorothioate, methylphosphonate, or phosphoramidate bonds), in the nucleotide base (e.g., 5-propynyl-pyrimidine), or in the sugar (e.g., 2'-modified sugar) have been tested (Uhlmann E., et al. Antisense: Chemical Modifications. Encyclopedia of Cancer, Vol. X., pp. 64-81, Academic Press Inc. (1997)). Others have attempted to improve stability using 2'-5' sugar linkages (see, e.g., U.S. Pat. No. 5,532,130). Other modifications have been attempted. However, none of these solutions have proven completely satisfactory, and in vivo free therapeutic nucleic acids still have limited efficacy.
[0011] Additionally, as noted above with respect to siRNA and miRNA, therapeutic nucleic acids have limited ability to cross cell membranes (see Vlassov, et al., Biochim. Biophys. Acta 1197:95-1082 (1994)), and concerns remain regarding systemic toxicity such as complement-mediated anaphylaxis, altered coagulation properties, and cytopenias (Galbraith, et al., Antisense Nucl. Acid Drug Des. 4:201206 (1994)).
[0012] In an attempt to improve efficacy, researchers have also used lipid-based carrier systems to deliver chemically modified or unmodified nucleic acids. In Zelphati, O. and Szoka, FC., J. Contr. Rel. 41:99-119 (1996), the authors refer to anionic (conventional) liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipid / antisense aggregates. Similarly, siRNA in cationic liposomes has been administered systemically, and these nucleic acid-lipid particles have been reported to provide improved downregulation of target proteins in mammals, including non-human primates (Zimmermann et al., Nature 441: 111-114 (2006)). Summary of the Invention [Problem to be solved by the invention]
[0013] Despite these advances, there remains a need in the art for improved lipid-therapeutic nucleic acid compositions suitable for general therapeutic use. Preferably, these compositions will encapsulate nucleic acids with high efficiency, have a high drug:lipid ratio, protect the encapsulated nucleic acid from degradation and clearance in serum, be suitable for systemic delivery, and provide for intracellular delivery of the encapsulated nucleic acid. In addition, these lipid-nucleic acid particles should be well tolerated and provide an adequate therapeutic index, such that treatment of patients with effective doses of nucleic acid is not associated with significant toxicity and / or risk to the patient. The present invention provides such compositions, methods of making the compositions, and methods of using the compositions to introduce nucleic acids into cells, including for treating disease. [Means for solving the problem]
[0014] The present invention provides novel cationic lipids, as well as lipid particles comprising same. These lipid particles can further comprise an active agent and can be used in accordance with related methods of the invention to deliver the active agent to cells.
[0015] In one aspect, the present invention provides a lipid having the structure of Formula XXXIII, a salt or isomer thereof: [ka] During the ceremony, R and R are each independently in each occurrence an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or -linker-ligand, R3 is H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10alkynyl, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand; and E is C(O)O or OC(O).
[0016] In another aspect, the present invention provides lipid particles comprising the lipids of the present invention. In some embodiments, the lipid particles further comprise a neutral lipid and a lipid capable of reducing particle aggregation. In one embodiment, the lipid particles consist essentially of (i) at least one lipid of the present invention, (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM, (iii) a sterol, e.g., cholesterol, and (iv) a PEG-lipid, e.g., PEG-DMG or PEG-DMA, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG-lipid. In one embodiment, the lipids of the present invention are optically pure.
[0017] In a further related embodiment, the present invention includes a lipid particle of the present invention further comprising a therapeutic agent. In one embodiment, the therapeutic agent is a nucleic acid. In one embodiment, the nucleic acid is a plasmid, an immunostimulatory oligonucleotide, a single-stranded oligonucleotide, such as an antisense oligonucleotide, an antagomir; a double-stranded oligonucleotide, such as an siRNA; an aptamer, or a ribozyme.
[0018] In yet another related embodiment, the present invention includes a pharmaceutical composition comprising the lipid particles of the present invention and a pharmaceutically acceptable excipient or diluent carrier.
[0019] In another related embodiment, the present invention further includes a method for regulating the expression of a target gene in a cell, the method comprising providing a lipid particle or pharmaceutical composition of the present invention to the cell. The target gene may be a wild-type gene. In another embodiment, the target gene contains one or more mutations. In certain embodiments, the method comprises specifically regulating the expression of a target gene containing one or more mutations. In certain embodiments, the lipid particle comprises a therapeutic agent selected from an immunostimulatory oligonucleotide; a single-stranded oligonucleotide, such as an antisense oligonucleotide or an antagomir; or a double-stranded oligonucleotide, such as an siRNA, an aptamer, or a ribozyme. In one embodiment, the nucleic acid is a plasmid encoding an siRNA, an antisense oligonucleotide, an aptamer, or a ribozyme.
[0020] In one embodiment of the present invention, the target gene is selected from the group consisting of Factor VII, Eg5, PCSK9, TPX2, apoB, SAA, TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene, MEKK gene, JNK gene, RAF gene, Erk1 / 2 gene, PCNA (p21) gene, MYB gene, JUN gene, FOS gene, BCL-2 gene, cyclin D gene, VEGF gene, EGFR gene, The mutation is selected from the group consisting of a cyclin A gene, a cyclin E gene, a WNT-1 gene, a beta-catenin gene, a c-MET gene, a PKC gene, an NFKB gene, a STAT3 gene, a survivin gene, a Her2 / Neu gene, a SORT1 gene, an XBP1 gene, a topoisomerase I gene, a topoisomerase II alpha gene, a p73 gene, a p21(WAF1 / CIP1) gene, a p27(KIP1) gene, a PPM1D gene, a RAS gene, a caveolin I gene, a MIB I gene, an MTAI gene, an M68 gene, a mutation in a tumor suppressor gene, a p53 tumor suppressor gene, and combinations thereof.
[0021] In another embodiment, the nucleic acid is a plasmid that encodes the polypeptide or a functional variant or fragment thereof, such that expression of the polypeptide or a functional variant or fragment thereof is increased.
[0022] In still further related embodiments, the invention includes methods for treating a disease or disorder characterized by overexpression of a polypeptide in a subject, comprising providing to the subject a lipid particle or pharmaceutical composition of the invention, wherein the therapeutic agent is selected from an siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing the siRNA, microRNA, or antisense oligonucleotide, and the siRNA, microRNA, or antisense RNA comprises a polynucleotide or its complement that specifically binds to a polynucleotide encoding the polypeptide.
[0023] In another related embodiment, the invention includes a method of treating a disease or disorder characterized by underexpression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the invention, wherein the therapeutic agent is a plasmid encoding the polypeptide or a functional variant or fragment thereof.
[0024] In a further embodiment, the invention includes a method of inducing an immune response in a subject, comprising providing to the subject a pharmaceutical composition of the invention, wherein the therapeutic agent is an immunostimulatory oligonucleotide. In certain embodiments, the pharmaceutical composition is provided to the patient in combination with a vaccine or antigen.
[0025] In related embodiments, the invention includes a vaccine comprising a lipid particle of the invention and an antigen associated with a disease or pathogen. In one embodiment, the lipid particle comprises an immunostimulatory nucleic acid or oligonucleotide. In certain embodiments, the antigen is a tumor antigen. In other embodiments, the antigen is a viral antigen, a bacterial antigen, or a parasitic antigen.
[0026] The present invention further includes methods for preparing the lipid particles and pharmaceutical compositions of the present invention, as well as kits useful for preparing these lipid particles and pharmaceutical compositions.
[0027] In another aspect, the invention provides a method for evaluating a composition comprising an agent, eg, a therapeutic or diagnostic agent, and a lipid of the invention. [Brief explanation of the drawings]
[0028] [Figure 1] FIG. 1 is a schematic diagram of an optically pure lipid with a targeting ligand attached. [Figure 2] FIG. 1 is a schematic representation of the lipid features of the present invention. [Figure 3A] 1 is a table showing EC50 and pKa values of exemplary lipids tested using the methods described in the Examples. [Figure 3B] See Figure 3A. DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention is based, in part, on the discovery of cationic lipids that offer advantages when used in lipid particles for in vivo delivery of therapeutic agents. In particular, as illustrated by the accompanying examples, the present invention provides nucleic acid-lipid particle compositions comprising cationic lipids according to the present invention. In some embodiments, the compositions described herein can provide enhanced nucleic acid activity and / or improved in vivo tolerability of the composition, thereby resulting in a significant increase in therapeutic index compared to previously described lipid-nucleic acid particle compositions. In addition, compositions and methods of use are disclosed that can provide reduced toxicity observed with certain therapeutic nucleic acid-lipid particles.
[0030] In some embodiments, the present invention provides improved compositions for delivering siRNA molecules.It is shown herein that these compositions are effective in downregulating protein levels and / or mRNA levels of target proteins.Furthermore, it is shown that the activity of these improved compositions depends on the presence of specific cationic lipids, and the molar ratio of cationic lipids in the formulation can affect activity.
[0031] The lipid particles and compositions of the present invention can be used for a variety of purposes, including delivering bound or encapsulated therapeutic agents to cells, both in vitro and in vivo. Accordingly, the present invention provides methods of treating a disease or disorder in a subject in need thereof by contacting the subject with lipid particles of the present invention bound to a suitable therapeutic agent.
[0032] As described herein, the lipid particles of the present invention are particularly useful for the delivery of nucleic acids, including, for example, siRNA molecules and plasmids.Therefore, the lipid particles and compositions of the present invention can be used to regulate the expression of target genes and proteins both in vitro and in vivo by contacting cells with the nucleic acid of the present invention that reduces target gene expression (for example, siRNA) or that can be used to increase the expression of desired proteins (for example, the plasmid that encodes desired proteins).
[0033] Various exemplary embodiments of the cationic lipids of the present invention and lipid particles and compositions comprising same, and their use to deliver therapeutic agents and modulate gene and protein expression, are described in further detail below.
[0034] lipids The present invention provides novel lipids with certain design features, as shown in Figure 2, which include at least one of the following: head groups with various pKa, cationic primary, secondary, and tertiary monoamines, diamines, and triamines, oligoamines / polyamines, low pKa head groups—imidazole and pyridine, guanidinium, anionic, zwitterionic, and hydrophobic tails that may contain symmetric and / or asymmetric chains, long and shorter chains, saturated and unsaturated chains, and backbones that include backbone glycerides and acyclic analogs, ethers, esters, phosphates and analogs, sulfonates and analogs, disulfides, pH-sensitive linkages such as acetals and ketals, imines and hydrazones, and cyclic, spiro, bicyclic, and polycyclic linkages with oximes.
[0035] The present invention provides novel lipids that are advantageously used in lipid particles of the invention for in vivo delivery of therapeutic agents to cells, including lipids having the following structure: In one embodiment, the lipid is a compound of Formula XXXIII, or a salt or isomer thereof: [ka] During the ceremony, R and R are each independently in each occurrence an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or -linker-ligand, R3 is H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10alkynyl, alkylheterocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand; and E is C(O)O or OC(O).
[0036] In one embodiment, R and R are each independently in each occurrence an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkoxy, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkenyloxy, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 Alkynyloxy or optionally substituted C 10 ~C 30 It is acyl.
[0037] In another embodiment, R3 is H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10alkynyl, optionally substituted alkylheterocycle, optionally substituted heterocycle-alkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkyl phosphorothioate, optionally substituted phosphorothioalkyl, optionally substituted alkyl phosphorodithioate, optionally substituted phosphorodithioalkyl, optionally substituted alkylphosphonate, optionally substituted phosphonoalkyl, optionally substituted amino, optionally substituted alkylamino, optionally substituted di(alkyl)amino, optionally substituted aminoalkyl, optionally substituted alkylaminoalkyl, optionally substituted di(alkyl)aminoalkyl, optionally substituted hydroxyalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), optionally substituted heteroaryl, optionally substituted heterocycle, or linker-ligand.
[0038] In one embodiment, the lipid is a compound of formula XXXIII, wherein E is C(O)O and R3 is: [ka] If R 1 and R 2 At the same time, it is not Linoleil.
[0039] In one embodiment, the lipid is a compound of formula XXXIII, wherein R3 is H, an optionally substituted C2-C 10 Alkenyl, optionally substituted C-C 10 The ligand is an alkynyl, an alkylheterocycle, an alkylphosphate, an alkylphosphorothioate, an alkylphosphorodithioate, an alkylphosphonate, an alkylamine, a hydroxyalkyl, an ω-aminoalkyl, an ω-(substituted)aminoalkyl, an ω-phosphoalkyl, an ω-thiophosphoalkyl, an optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), an optionally substituted mPEG (molecular weight: 120-40K), a heteroaryl, a heterocycle, or a linker-ligand.
[0040] In yet another embodiment, the lipid is a compound of formula XXXIII, wherein R and R are each independently in each occurrence an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or -linker-ligand.
[0041] In one aspect, the invention features a lipid of formula XXXVIII, or a salt or isomer thereof: [ka] During the ceremony, E is C(O)O or OC(O); R1 and R2 and R x is independently at each occurrence H, optionally substituted C1 to C 10 Alkyl, optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkynyl or optionally substituted C 10 ~C 30 acyl, or linker-ligand, where R, R, and R x At least one of them is not H, R3 is H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10alkynyl, alkylheterocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand; n is 0、 1, 2, or 3.
[0042] In one embodiment, the lipid is a compound of formula XXXIII, wherein E is C(O)O and R 3 but, [ka] If R1, R2, or R x One of R1, R2, or R x At the same time, it is not Linoleil.
[0043] In some embodiments, each of R and R independently in each occurrence is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or linker-ligand.
[0044] In some embodiments, R x is H or optionally substituted C1-C 10 It is alkyl.
[0045] In some embodiments, R x is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C30 Alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or linker-ligand.
[0046] In one embodiment, R and R are each independently selected from the group consisting of optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkoxy, optionally substituted C 10 ~C 30 Alkenyl, optionally substituted C 10 ~C 30 Alkenyloxy, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 Alkynyloxy or optionally substituted C 10 ~C 30 acyl, or -linker-ligand.
[0047] In one embodiment, R3 is independently at each occurrence H, optionally substituted C1-C 10 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10alkynyl, optionally substituted alkylheterocycle, optionally substituted heterocycle-alkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkyl phosphorothioate, optionally substituted phosphorothioalkyl, optionally substituted alkyl phosphorodithioate, optionally substituted phosphorodithioalkyl, optionally substituted alkylphosphonate, optionally substituted phosphonoalkyl, optionally substituted amino, optionally substituted alkylamino, optionally substituted di(alkyl)amino, optionally substituted aminoalkyl, optionally substituted alkylaminoalkyl, optionally substituted di(alkyl)aminoalkyl, optionally substituted hydroxyalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), optionally substituted heteroaryl, or optionally substituted heterocycle, or linker-ligand.
[0048] In one embodiment, E is —C(O)O— or —OC(O)—.
[0049] In one embodiment, Z' is -O-, -S-, -N(Q)-, or alkylene.
[0050] In some circumstances, R3 is ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, or ω-thiophosphoalkyl, each of which is optionally substituted. Examples of ω-(substituted)aminoalkyl groups include 2-(dimethylamino)ethyl, 3-(diisopropylamino)propyl, or 3-(N-ethyl-N-isopropylamino)-1-methylpropyl.
[0051] Cationic lipids containing unsaturated alkyl chains have been found to be particularly useful for forming lipid-nucleic acid particles with increased membrane fluidity. In one embodiment, at least one of R1 or R2 contains at least one, at least two, or at least three sites of unsaturation, e.g., double or triple bonds.
[0052] In one embodiment, only one of R1 or R2 contains at least one, at least two, or at least three sites of unsaturation.
[0053] In one embodiment, R1 or R2 both contain at least one, at least two, or at least three sites of unsaturation.
[0054] In one embodiment, R1 and R2 contain different numbers of unsaturation, for example, one of R1 and R2 has one site of unsaturation and the other has two or three sites of unsaturation.
[0055] In one embodiment, R1 and R2 both contain the same number of sites of unsaturation.
[0056] In one embodiment, R1 and R2 include different types of unsaturation, for example, the unsaturation of one of R1 and R2 is a double bond and the unsaturation of the other is a triple bond.
[0057] In one embodiment, R1 and R2 both contain the same type of unsaturation, for example, a double bond or a triple bond.
[0058] In one embodiment, at least one of R1 or R2 contains at least one double bond and at least one triple bond.
[0059] In one embodiment, only one of R1 or R2 contains at least one double bond and at least one triple bond.
[0060] In one embodiment, R1 and R2 both contain at least one double bond and at least one triple bond.
[0061] In one embodiment, R1 and R2 are both the same, for example, R1 and R2 are both linoleyl (C18), or R1 and R2 are both heptadec-9-enyl.
[0062] In one embodiment, R1 and R2 are different from each other.
[0063] In one embodiment, at least one of R1 and R2 is cholesterol.
[0064] In one embodiment, one of R1 and R2 is -linker-ligand.
[0065] In one embodiment, one of R1 and R2 is -linker-ligand, and the ligand is lipophilic.
[0066] In one embodiment, at least one of R1 or R2 contains at least one CH2 group, e.g., CHF or CF2, in which one or both Hs are replaced by F. In one embodiment, R1 and R2 both contain at least one CH2 group, e.g., CHF or CF2, in which one or two Hs are replaced by F.
[0067] In one embodiment, only one of R1 and R2 contains at least one CH2 group in which one or both H are replaced by F.
[0068] In one embodiment, at least one of R1 or R2 is terminated with CH2F, CHF2, or CF3. In one embodiment, R1 or R2 are both terminated with CH2F, CHF2, or CF3.
[0069] In one embodiment, at least one of R1 or R2 is -(CF2) y -Z''-(CH2) y -CH3, where each y is independently 1 to 10, and Z'' is O, S, or N(Q).
[0070] In one embodiment, R1 and R2 are both -(CF2) y -Z''-(CH2) y-CH3, where each y is independently 1 to 10, and Z'' is O, S, or N(Q).
[0071] In one embodiment, at least one of R1 or R2 is -(CF2) y -Z''-(CH2) y -CH3, where each y is independently 1 to 10, and Z'' is O, S, or N(Q).
[0072] In one embodiment, R1 and R2 are both -(CF2) y -Z''-(CH2) y -CH3, where each y is independently 1 to 10, and Z'' is O, S, or N(Q).
[0073] In one embodiment, at least one of R1 or R2 is -(CF2) y -(CF2) y -CF3, where each y is independently 1 to 10.
[0074] In one embodiment, both R1 or R2 are -(CF2) y -(CF2) y -CF3, where each y is independently 1 to 10.
[0075] In one embodiment, R3 is methyl, ethyl, a polyamine, -(CH2) h -heteroaryl, -(CH2) h -N(Q)2, -ON(Q)2, -(CH2) h -Z'-(CH2) h -heteroaryl, linker-ligand, -(CH2) h -hetercycle, and -(CH2) h -Z''-(CH2) h -heterocycle, wherein each h is independently 0-13, and Z'' is O, S, or N(Q).
[0076] In one embodiment, when Z is C(R3), at least one R3 is ω-aminoalkyl or ω-(substituted)aminoalkyl.
[0077] In one embodiment, when Z' is O, S, or alkyl, at least one R3 is ω-aminoalkyl or ω-(substituted)aminoalkyl.
[0078] In one embodiment, Q is a linker-ligand.
[0079] In one embodiment, the ligand is a fusogenic peptide.
[0080] In one embodiment, the lipid is a racemic mixture.
[0081] In one embodiment, the lipid is enriched in one diastereomer, eg, the lipid exhibits a diastereomeric excess of at least 95%, at least 90%, at least 80%, or at least 70%.
[0082] In one embodiment, the lipid is enriched in one enantiomer, for example, the lipid exhibits an enantiomeric excess of at least 95%, at least 90%, at least 80%, or at least 70%.
[0083] In one embodiment, the lipid is chirally pure, eg, a single optical isomer.
[0084] In one embodiment, the lipid is enriched in one optical isomer.
[0085] Where double bonds are present (e.g., carbon-carbon double bonds or carbon-nitrogen double bonds), isomerism in the configuration about the double bond may exist (i.e., cis / trans or E / Z isomerism). Where a double bond configuration is depicted in a chemical structure, it is understood that the corresponding isomers may also exist. The amount of isomers present may vary depending on the relative stabilities of the isomers and the energy required to convert between isomers. Thus, while some double bonds, for practical purposes, exist in only a single configuration, other double bonds may exist as an equilibrium mixture of inseparable configurations (e.g., where the relative stabilities are similar and the conversion energies are low).
[0086] The present invention includes synthesizing the lipids described herein in racemic as well as optically pure form.
[0087] In one embodiment, the cationic lipid is selected from the group consisting of the lipids shown in Table 1 below. [Table 1A] [Table 1B] [Table 1C] [Table 1D] [Table 1E]
[0088] Although not all diastereomers of the lipids are shown, one aspect of the invention provides all diastereomers, and therefore chirally pure lipids and diastereomerically enriched lipids are also part of the invention.
[0089] In one embodiment, R3 is -linker-ligand.
[0090] In certain embodiments, the lipid of the present invention is cationic lipid.As used herein, the term " cationic lipid " is intended to include the lipid that has one or two fatty acid or fatty alkyl chains and an amino head group (including alkylamino or dialkylamino group) that can be protonated at physiological pH to form cationic lipid.In some embodiments, cationic lipid is called " amino lipid ".
[0091] Other cationic lipids may include those with alternative fatty acid groups and other dialkylamino groups, including those with different alkyl substituents (e.g., N-ethyl-N-methylamino-, N-propyl-N-ethylamino-, etc.). In embodiments where R1 and R2 are both long-chain alkyl or acyl groups, they may be the same or different. Generally, lipids (e.g., cationic lipids) with less saturated acyl chains are easier to size, especially when the complex is sized to less than about 0.3 micrometers for sterilization by filtration. 10 ~C 20 Cationic lipids containing unsaturated fatty acids with carbon chain lengths in the range of 1 to 3 are typical. Other backbones can also be used to separate the amino group (e.g., the amino group of the cationic lipid) from the fatty acid or fatty alkyl portion of the cationic lipid. Suitable backbones are known to those skilled in the art.
[0092] In some embodiments, the cationic lipid of the present invention has at least one protonatable or deprotonatable group, so that the lipid is positively charged at or below physiological pH (e.g., pH 7.4) and neutral at a second pH, preferably at or above physiological pH. Such lipids are also referred to as cationic lipids. Of course, it will be understood that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or neutral lipid refers to the nature of the predominant species, and does not require that all of the lipid be in a charged or neutral form. Lipids that have multiple protonatable or deprotonatable groups or are zwitterionic are not excluded from use in the present invention.
[0093] In one embodiment, protonatable lipids (i.e., cationic lipids) according to the present invention have a pKa of the protonatable group in the range of about 4 to about 11. Typically, the lipids, when incorporated into lipid particles, will have a pKa of about 4 to about 7, e.g., about 5 to about 7, such as about 5.5 to 6.8. While such lipids are cationic at lower pH formulation stages, the particles will be largely (but not completely) surface neutralized at physiological pH, around pH 7.4. One benefit of a pKa in the range of about 4 to 7 is that at least some nucleic acid bound to the outer surface of the particles will lose its electrostatic interactions at physiological pH and be removed by simple dialysis, thus significantly reducing the particle's susceptibility to clearance. Measurement of the pKa of lipids within lipid particles can be performed, for example, using the fluorescent probe 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS) using the method described in Cullis et al. (1986) Chem Phys Lipids 40, 127-144.
[0094] In one embodiment, the formulation of the present invention is at least 75%, at least 80%, or at least 90% encapsulated.
[0095] In one embodiment, the formulation of the present invention further comprises an apolipoprotein. As used herein, the term "apolipoprotein" or "lipoprotein" refers to apolipoproteins and variants and fragments thereof known to those skilled in the art, as well as apolipoprotein agonists, analogs or fragments thereof, as described below.
[0096] Suitable apolipoproteins include, but are not limited to, ApoA-I, ApoA-II, ApoA-IV, ApoA-V, and ApoE, as well as active polymorphic forms, isoforms, variants, and mutants, and fragments or truncated forms thereof. In one embodiment, the apolipoprotein is a thiol-containing apolipoprotein. "Thiol-containing apolipoprotein" refers to an apolipoprotein, variant, fragment, or isoform that contains at least one cysteine residue. The most common thiol-containing apolipoprotein is ApoA-I Milano (ApoA-I Milano), which contains one cysteine residue. M ) and ApoA-I Paris (ApoA-I P) (Jia et al., 2002, Biochem. Biophys. Res. Comm. 297: 206-13; Bielicki and Oda, 2002, Biochemistry 41: 2089-96). ApoA-II, ApoE2, and ApoE3 are also thiol-containing apolipoproteins. Isolated ApoE and / or its active fragments and polypeptide analogs, including recombinantly produced forms thereof, are described in U.S. Patent Nos. 5,672,685; 5,525,472; 5,473,039; 5,182,364; 5,177,189; 5,168,045; and 5,116,739, the disclosures of which are incorporated herein by reference. ApoE3 is described in Weisgraber, et al., "Human E apoprotein heterogeneity: cysteine-arginine interchanges in the amino acid sequence of the apo-E isoforms," J. Biol. Chem. (1981) 256: 9077-9083; and Rall, et al., "Structural basis for receptor binding heterogeneity of apolipoprotein E from type III hyperlipoproteinemic subjects," Proc. Nat. Acad. Sci. (1982) 79: 4696-4700. See also GenBank accession number K00396.
[0097] In certain embodiments, the apolipoprotein may be in its mature form, its preproapolipoprotein form, or its proapolipoprotein form. ProApoA-I and mature ApoA-I (if available) (Duverger et al., 1996, Arterioscler. Thromb. Vasc. Biol. 16(12):1424-29), ApoA-I Milano (Klon et al., 2000, Biophys. J. 79:(3)1679-87; Franceschini et al., 1985, J. Biol. Chem. 260: 1632-35), ApoA-I Paris (Daum et al., 1999, J. Mol. Med. 77:614-22), ApoA-II (Shelness et al., 1985, J. Biol. Chem. 260(14):8637-46; Shelness et al., 1984, J. Biol. Chem. Homodimers and heterodimers of ApoA-IV (Duverger et al., 1991, Euro. J. Biochem. 201(2):373-83), ApoA-IV (Duverger et al., 1991, Euro. J. Biochem. 201(2):373-83), and ApoE (McLean et al., 1983, J. Biol. Chem. 258(14):8993-9000) may also be used within the scope of the present invention.
[0098] In some embodiments, the apolipoprotein may be a fragment, variant, or isoform of an apolipoprotein. The term "fragment" refers to any apolipoprotein having an amino acid sequence shorter than that of a native apolipoprotein, where the fragment retains the activity of the native apolipoprotein, including its lipid-binding properties. "Variant" refers to a substitution or alteration in the amino acid sequence of an apolipoprotein, where the substitution or alteration, e.g., addition or deletion of amino acid residues, does not eliminate the activity of the native apolipoprotein, including its lipid-binding properties. Thus, variants can include proteins or peptides having substantially the same amino acid sequence as the native apolipoproteins provided herein, in which one or more amino acid residues have been conservatively replaced with chemically similar amino acids. Examples of conservative substitutions include replacing at least one hydrophobic residue, such as isoleucine, valine, leucine, or methionine, with another residue. Similarly, for example, the present invention contemplates the substitution of at least one hydrophilic residue, such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine (see U.S. Pat. Nos. 6,004,925, 6,037,323, and 6,046,166). The term "isoform" refers to a protein having the same, greater, or partial function and similar, identical, or partial sequence, which may or may not be the product of the same gene, and is usually tissue-specific (Weisgraber 1990, J. Lipid Res. 31(8):1503-11; Hixson and Powers 1991, J. Lipid Res. 32(9):1529-35; Lackner et al., 1985, J. Biol. Chem. 260(2):703-6; Hoeg et al., 1986, J. Biol. Chem. 261(9):3911-4; Gordon et al., 1984, J. Biol. Chem. 259(1):468-74; Powell et al., 1987, Cell 50(6):831-40; Aviram et al. al., 1998, Arterioscler. Thromb. Vase. Biol.18(10):1617-24; Aviram et al., 1998, J. Clin. Invest. 101(8):1581-90; Billecke et al., 2000, Drug Metab. Dispos. 28(11):1335-42; Draganov et al., 2000, J. Biol. Chem. 275(43):33435-42; Steinmetz and Utermann 1985, J. Biol. Chem. 260(4):2258-64; Widler et al., 1980, J. Biol. Chem. 255(21):10464-71; Dyer et al., 1995, J. Lipid Res. 36(1):80-8; Sacre et al., 2003, FEBS Lett. 540(1-3):181-7; Weers, et al., 2003, Biophys. Chem. 100(1-3):481-92; Gong et al., 2002, J. Biol. Chem. 277(33):29919-26; Ohta et al., 1984, J. Biol. Chem. 259(23):14888-93, and U.S. Patent No. 6,372,886).
[0099] In some embodiments, the methods and compositions of the present invention involve the use of chimeric apolipoprotein constructs. For example, the chimeric apolipoprotein construct may be composed of an apolipoprotein domain with high lipid binding capacity linked to an apolipoprotein domain with ischemia-reperfusion protective properties. The chimeric apolipoprotein construct may be a construct that contains distinct regions within an apolipoprotein (i.e., a homologous construct), or the chimeric construct may be a construct that contains distinct regions that differ between apolipoproteins (i.e., a heterologous construct). Compositions containing chimeric constructs can also include segments that are apolipoprotein variants or segments designed to have specific characteristics (e.g., lipid binding, receptor binding, enzymatic, enzyme-activating, antioxidant, or redox properties) (Weisgraber 1990, J. Lipid Res. 31(8):1503-11; Hixson and Powers 1991, J. Lipid Res. 32(9):1529-35; Lackner et al., 1985, J. Biol. Chem. 260(2):703-6; Hoeg et al., 1986, J. Biol. Chem. 261(9):3911-4; Gordon et al., 1984, J. Biol. Chem. 259(1):468-74; Powell et al., 1987, Cell 50(6):831-40; Aviram et al., 1998, Arterioscler. Thromb. Vasc. Biol. 18(10):1617-24;Aviram et al., 1998, J. Clin. Invest. 101(8):1581-90;Billecke et al., 2000, Drug Metab. Dispos. 28(11):1335-42;Draganov et al. al., 2000, J. Biol. Chem. 275(43):33435-42;Steinmetz and Utermann 1985, J. Biol. Chem. 260(4):2258-64;Widler et al., 1980, J. Biol. Chem.255(21):10464-71;Dyer et al., 1995, J. Lipid Res. 36(1):80-8;Sorenson et al., 1999, Arterioscler. Thromb. Vasc. Biol. 19(9):2214-25;Palgunachari 1996, Arterioscler. Throb. Vasc. Biol. 16(2):328-38: Thurberg et al., J. Biol. Chem. 271(11):6062-70; Dyer 1991, J. Biol. Chem. 266(23):150009-15; Hill 1998, J. Biol. Chem. 273(47):30979-84). .
[0100] Apolipoproteins used in the present invention also include recombinant, synthetic, semi-synthetic, or purified apolipoproteins. Methods for obtaining apolipoproteins or their equivalents used in the present invention are well known in the art. For example, apolipoproteins may be isolated from plasma or natural products, for example, by density gradient centrifugation or immunoaffinity chromatography, or may be produced synthetically, semi-synthetically, or using recombinant DNA techniques known to those skilled in the art (e.g., Mulugeta et al., 1998, J. Chromatogr. 798(1-2): 83-90; Chung et al., 1980, J. Lipid Res. 21(3):284-91; Cheung et al., 1987, J. Lipid Res. 28(8):913-29; Persson, et al., 1998, J. Chromatogr. 711:97-109; U.S. Patent Nos. 5,059,528, 5,834,596, 5,876,968, and 5,721,114; and WO 86 / 04920 and WO 87 / 02062).
[0101] The apolipoproteins used in the present invention include ApoA-I, ApoA-I Milano (ApoA-I M), ApoA-I Paris (ApoA-I P Further included are apolipoprotein agonists, such as peptides and peptide analogs that mimic the activity of ApoA-II, ApoA-IV, and ApoE. For example, the apolipoprotein may be any of those described in U.S. Patent Nos. 6,004,925, 6,037,323, 6,046,166, and 5,840,688, the contents of which are incorporated herein by reference in their entireties.
[0102] Apolipoprotein agonist peptides or peptide analogs can be synthesized or produced using any peptide synthesis technique known in the art, such as those described in U.S. Patent Nos. 6,004,925, 6,037,323, and 6,046,166. For example, peptides can be prepared using the solid-phase synthesis technique first described by Merrifield (1963, J. Am. Chem. Soc. 85:2149-2154). Other peptide synthesis techniques can be found in Bodanszky et al., Peptide Synthesis, John Wiley & Sons, 2d Ed., (1976), and other literature readily available to those skilled in the art. A summary of polypeptide synthesis techniques can be found in Stuart and Young, Solid Phase Peptide Synthesis, Pierce Chemical Company, Rockford, Ill., (1984). Peptides can also be synthesized by solution techniques such as those described in The Proteins, Vol. II, 3d Ed., Neurath et al., Eds., pp. 105-237, Academic Press, New York, NY (1976). Suitable protecting groups for use in various peptide syntheses are described in the aforementioned publications as well as in McOmie, Protective Groups in Organic Chemistry, Plenum Press, New York, NY (1973). The peptides of the invention can also be prepared, for example, by chemical or enzymatic cleavage from a larger portion of apolipoprotein AI.
[0103] In some embodiments, the apolipoprotein may be a mixture of apolipoproteins. In one embodiment, the apolipoprotein may be a homogeneous mixture, i.e., a single type of apolipoprotein. In another embodiment, the apolipoprotein may be a heterogeneous mixture of apolipoproteins, i.e., a mixture of two or more different apolipoproteins. An embodiment of a heterogeneous mixture of apolipoproteins may include, for example, a mixture of apolipoproteins derived from animal sources and apolipoproteins derived from semi-synthetic sources. In some embodiments, the heterogeneous mixture may include, for example, a mixture of ApoA-I and ApoA-I Milano. In some embodiments, the heterogeneous mixture may include, for example, a mixture of ApoA-I Milano and ApoA-I Paris. Suitable mixtures for use in the methods and compositions of the present invention will be apparent to those skilled in the art.
[0104] When the apolipoprotein is obtained from a natural source, the apolipoprotein can be obtained from a plant or animal source. When the apolipoprotein is obtained from an animal source, the apolipoprotein can be derived from any species. In some embodiments, the apolipoprotein can be obtained from an animal source. In some embodiments, the apolipoprotein can be obtained from a human source. In a preferred embodiment of the present invention, the apolipoprotein is derived from the same species as the individual to whom the apolipoprotein is administered.
[0105] lipid particles The present invention also provides lipid particles comprising one or more of the above-described cationic lipids. Lipid particles include, but are not limited to, liposomes. As used herein, a liposome is a structure having a lipid-containing membrane surrounding an aqueous interior. Liposomes may have one or more lipid membranes. The present invention contemplates both single-layered liposomes, referred to as unilamellar membranes, and multilamellar liposomes, referred to as multilamellar membranes. Additionally, when complexed with nucleic acids, the lipid particles may be lipoplexes, consisting of a cationic lipid bilayer sandwiched between layers of DNA, as described, for example, by Felgner in Scientific American.
[0106] The lipid particles of the present invention may further comprise one or more additional lipids and / or other components, such as cholesterol. Other lipids may be included in the liposome compositions of the present invention for various purposes, such as preventing lipid oxidation or binding ligands to the liposome surface. Any of a number of lipids, including amphipathic, neutral, cationic, and anionic lipids, may be present in the liposomes of the present invention. Such lipids may be used alone or in combination. Specific examples of additional lipid components that may be present are described below.
[0107] Additional components that may be present in the lipid particles of the present invention include bilayer stabilizing components such as polyamide oligomers (see, e.g., U.S. Pat. No. 6,320,017), peptides, proteins, surfactants, lipid derivatives such as PEG conjugated to phosphatidylethanolamine and PEG conjugated to ceramide (see, U.S. Pat. No. 5,885,613).
[0108] In certain embodiments, the lipid particles include one or more of a second amino lipid or cationic lipid, a neutral lipid, a sterol, and a lipid selected to reduce aggregation of the lipid particles during formation, which may be the result of steric stabilization of the particles to prevent charge-induced aggregation during formation.
[0109] Examples of lipids that reduce particle aggregation during formation include polyethylene glycol (PEG)-modified lipids, monosialoganglioside Gm1, and polyamide oligomers ("PAOs") (such as those described in U.S. Pat. No. 6,320,017). Other compounds with uncharged, hydrophilic, sterically hindering moieties that prevent aggregation during formulation, such as PEG, Gm1, or ATTA, can also be conjugated to lipids for use in the methods and compositions of the present invention. ATTA lipids are described, for example, in U.S. Pat. No. 6,320,017, and PEG-lipid conjugates are described, for example, in U.S. Pat. Nos. 5,820,873, 5,534,499, and 5,885,613. Typically, the concentration of the lipid component selected to reduce aggregation is about 1-15% (based on the mole percent of lipid).
[0110] Specific examples of PEG-modified lipids (or lipid-polyoxyethylene conjugates) useful in the present invention can have various "tethered" lipid moieties for fixing PEG moieties to the surface of lipid vesicles.Examples of suitable PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (such as PEG-CerC14 or PEG-CerC20) described in co-pending US patent application Ser. No. 08 / 486,214, which is incorporated herein by reference, PEG-modified dialkylamine, and PEG-modified 1,2-diacyloxypropan-3-amine.In particular, PEG-modified diacylglycerol and dialkylglycerol are preferred.
[0111] In embodiments where a sterically bulky moiety such as PEG or ATTA is attached to the lipid anchor, the choice of lipid anchor will depend on the type of bond the conjugate will have with the lipid particle. It is well known that mPEG (molecular weight 2000)-diastearoylphosphatidylethanolamine (PEG-DSPE) remains associated with liposomes until the particles are cleared from the circulation, possibly for several days. Other conjugates, such as PEG-CerC20, have similar retention capabilities. However, PEG-CerC14 exhibits a T of less than 60 minutes when in contact with serum in some assays.1 / 2 They rapidly exchange and exit the formulation. As exemplified in U.S. Patent Application No. 08 / 486,214, at least three characteristics affect the exchange rate: acyl chain length, acyl chain saturation, and sterically hindered head group size. Compounds with suitable variations in these characteristics may be useful in the present invention. For some therapeutic applications, it may be preferable for the PEG-modified lipid to be rapidly lost from the nucleic acid-lipid particle in vivo, and therefore the PEG-modified lipid will have a relatively short lipid anchor. For other therapeutic applications, it may be preferable for the nucleic acid-lipid particle to exhibit a longer plasma circulation lifetime, and therefore the PEG-modified lipid will have a relatively longer lipid anchor.
[0112] It should be noted that anti-aggregation compounds do not necessarily require lipid binding to function properly. Free PEG or free ATTA in solution may be sufficient to prevent aggregation. If the particles are stable after formulation, the PEG or ATTA can be removed by dialysis before administration to a subject.
[0113] When present in lipid particles, the neutral lipid may be any of a number of lipid species that exist in either an uncharged or neutral zwitterionic form at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebroside. The selection of neutral lipids for use in the particles described herein is generally guided by considerations such as liposome size and liposome stability in the bloodstream. Preferably, the neutral lipid component is a lipid with two acyl groups (i.e., diacylphosphatidylcholine and diacylphosphatidylethanolamine). Lipids with acyl chain groups of various chain lengths and various degrees of saturation are available or can be isolated or synthesized by well-known techniques. In one group of embodiments, C 10 ~C 20 Preferred are lipids containing saturated fatty acids having carbon chain lengths in the range of C10 ~C 20 Lipids with mono- or di-saturated fatty acids having carbon chain lengths in the range of 0.1 to 1.0 are used. In addition, lipids with a mixture of saturated and unsaturated fatty acid chains can be used. Preferably, the neutral lipid used in the present invention is DOPE, DSPC, POPC, DPPC, or any related phosphatidylcholine. The neutral lipid useful in the present invention may also be composed of sphingomyelin, dihydrosphingomyelin, or phospholipids with other head groups such as serine and inositol.
[0114] The sterol component of the lipid mixture, if present, may be any sterol conventionally used in the art of liposome, lipid vesicle, or lipid particle preparation. A preferred sterol is cholesterol.
[0115] In addition to those specifically mentioned above, other cationic lipids that carry a net positive charge near physiological pH can also be included in the lipid particles of the present invention.Such cationic lipids include but are not limited to: N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC"); N-(2,3-dioleyloxy) propyl-N,NN-triethylammonium chloride ("DOTMA"); N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"); N-(2,3-dioleyloxy) propyl)-N,N,N-trimethylammonium chloride ("DOTAP"); 1,2-dioleyloxy-3-trimethylaminopropane chloride salt ("DOTAP.Cl"); 3-(N-(N',N'-dimethylaminoethane)-carbamoyl) cholesterol (" DC-Chol"), N-(1-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoroacetate ("DOSPA"), dioctadecylamidoglycylcarboxyspermine ("DOGS"), 1,2-dileoyl-sn-3-phosphoethanolamine ("DOPE"), 1,2-dioleoyl-3-dimethylammonium propane ("DODAP"), N,N-dimethyl-2,3-dioleyloxy)propylamine ("DODMA"), and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"). Additionally, many commercially available cationic lipid preparations can be used, such as, for example, LIPOFECTIN (containing DOTMA and DOPE, available from GIBCO / BRL) and LIPOFECTAMINE (containing DOSPA and DOPE, available from GIBCO / BRL). In certain embodiments, the cationic lipid is an amino lipid.
[0116] Anionic lipids suitable for use in the lipid particles of the present invention include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, and other anionic modifying groups attached to neutral lipids.
[0117] In many embodiments, amphipathic lipids are included in the lipid particles of the present invention. "Amphipathic lipid" refers to any suitable lipid material in which the hydrophobic portion of the lipid material is oriented toward the hydrophobic phase and the hydrophilic portion is oriented toward the aqueous phase. Such compounds include, but are not limited to, phospholipids, aminolipids, and sphingolipids. Representative phospholipids include sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatdylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, or dilinoleoylphosphatidylcholine. Other phosphorus-deficient compounds, such as sphingolipids, glycosphingolipid families, diacylglycerols, and -acyloxyacids, can also be used. In addition, such amphipathic lipids can be readily mixed with other lipids, such as triglycerides and sterols.
[0118] Also suitable for inclusion in the lipid particles of the present invention are programmable fusion lipids. Such lipid particles exhibit little tendency to fuse with cell membranes and deliver their payload until a predetermined signal event occurs. This allows the lipid particles to distribute more uniformly after injection into an organism or disease site before initiating fusion with cells. The signal event can be, for example, a change in pH, temperature, ionic environment, or time. In the latter case, fusion-delaying or "cloaking" components, such as ATTA-lipid conjugates or PEG-lipid conjugates, can simply be exchanged over time to leave the lipid particle membrane. By the time the lipid particles are properly distributed in the body, they have lost sufficient cloaking agent to become fusogenic. When using other signal events, it is desirable to select a signal associated with the disease site or target cells, such as an increase in temperature at an inflammatory site.
[0119] In some embodiments, it may be desirable to target the lipid particles of the present invention using a cell type or tissue-specific targeting moiety. The use of various targeting moieties, such as ligands, cell surface receptors, glycoproteins, vitamins (e.g., riboflavin), and monoclonal antibodies, to target lipid particles has previously been described (see, e.g., U.S. Pat. Nos. 4,957,773 and 4,603,044). The targeting moiety may comprise an entire protein or a fragment thereof. Targeting mechanisms generally require that the targeting agent be positioned on the surface of the lipid particle so that the targeting moiety is available for interaction with the target, e.g., a cell surface receptor. A variety of different targeting agents and methods are known and available in the art, including, for example, those described in Sapra, P. and Allen, TM, Prog. Lipid Res. 42(5):439-62 (2003); and Abra, RM et al., J. Liposome Res. 12:1-3, (2002).
[0120] The use of lipid particles, i.e., liposomes, whose surfaces are coated with hydrophilic polymer chains such as polyethylene glycol (PEG) chains has been proposed (Allen, et al., Biochimica et Biophysica Acta 1237: 99-108 (1995); DeFrees, et al., Journal of the American Chemistry Society 118: 6101-6104 (1996); Blume, et al., Biochimica et Biophysica Acta 1149: 180-184 (1993); Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); U.S. Patent No. 5,013,556; Zalipsky, Bioconjugate Chemistry 4: 296-299 (1993); Zalipsky, FEBS Letters 353: 71-74 (1994); Zalipsky, in Stealth Liposomes Chapter 9 (Lasic and Martin, Eds) CRC Press, Boca Raton FL (1995)). In one approach, a ligand, such as an antibody, is attached to the polar head group of the lipid forming the lipid particle to make the lipid particle targetable. In another approach, the targeting ligand is attached to the distal end of the PEG chains that form the hydrophilic polymer coating (Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); Kirpotin et al., FEBS Letters 388: 115-118 (1996)).
[0121] Standard methods can be used to attach targeting agents. For example, derivatized lipophilic compounds such as phosphatidylethanolamine or lipid-derivatized bleomycin, which can be activated to attach targeting agents, can be used. Antibody-targeted liposomes can be constructed, for example, using liposomes incorporating protein A (see Renneisen, et al., J. Bio. Chem., 265:16337-16342 (1990) and Leonetti, et al., Proc. Natl. Acad. Sci. (USA), 87:2448-2451 (1990)). Other examples of antibody conjugation are disclosed in U.S. Patent No. 6,027,726, the teachings of which are incorporated herein by reference. Examples of targeting moieties can also include other proteins specific for cellular components, including antigens associated with neoplasms or tumors. Proteins used as targeting moieties can be covalently attached to liposomes (see Heath, Covalent Attachment of Proteins to Liposomes, 149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987)). Other targeting methods include the biotin-avidin system.
[0122] In one exemplary embodiment, the lipid particles comprise a mixture of cationic lipids of the present invention, neutral lipids (other than cationic lipids), a sterol (e.g., cholesterol), and a PEG-modified lipid (e.g., PEG-DMG or PEG-DMA). In some embodiments, the lipid mixture consists of, or consists essentially of, the cationic lipids of the present invention, neutral lipids, cholesterol, and the PEG-modified lipid. In a further preferred embodiment, the lipid particles consist of, or consist essentially of, the above lipid mixture in a molar ratio of about 20-70% amino lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15% PEG-modified lipid.
[0123] In one embodiment, the lipid particles comprise at least two lipids disclosed herein. For example, a mixture of cationic lipids can be used in the lipid particles, the mixture comprising 20-60% total lipid content on a molar basis.
[0124] In certain embodiments, the lipid particles consist essentially of or consist of a cationic lipid selected from Table 1, DSPC, Chol, and either PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid, DSPC, in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0125] Therapeutic Agent-Lipid Particle Compositions and Formulations The present invention includes compositions comprising lipid particles of the present invention and an active agent, wherein the active agent is bound to the lipid particle. In certain embodiments, the active agent is a therapeutic agent. In certain embodiments, the active agent is encapsulated within the aqueous interior of the lipid particle. In other embodiments, the active agent is present within one or more lipid layers of the lipid particle. In other embodiments, the active agent is bound to the external or internal lipid surface of the lipid particle.
[0126] As used herein, "complete encapsulation" indicates that the nucleic acid in the particles is not significantly degraded after contact with serum or nuclease assays that would significantly degrade free nucleic acid. In a completely encapsulated system, preferably, less than 25% of the particle nucleic acid is degraded in a treatment that would normally degrade 100% of free nucleic acid, more preferably, less than 10% of the particle nucleic acid is degraded, and most preferably, less than 5% of the particle nucleic acid is degraded. Alternatively, complete encapsulation can be determined by the Oligreen® assay. Oligreen® is an ultrasensitive fluorescent nucleic acid stain for quantifying oligonucleotides and single-stranded DNA in solution (available from Invitrogen Corporation, Carlsbad, California). Complete encapsulation also indicates that the particles are serum stable, i.e., do not rapidly degrade into their constituent components upon in vivo administration.
[0127] As used herein, an active agent includes any molecule or compound capable of exerting a desired effect on a cell, tissue, organ, or subject. Such an effect may be, for example, biological, physiological, or cosmetic. An active agent may be any type of molecule or compound, including, for example, nucleic acids, peptides, and polypeptides, including, for example, antibodies, such as polyclonal antibodies, monoclonal antibodies, and antibody fragments; humanized antibodies, recombinant antibodies, recombinant human antibodies, and Primatized™ antibodies; cytokines, growth factors, apoptotic factors, differentiation inducers, cell surface receptors and their ligands; hormones; and small molecules, including small organic molecules or compounds.
[0128] In one embodiment, the active agent is a therapeutic agent, or a salt or derivative thereof. Therapeutic agent derivatives may be therapeutically active themselves or may be prodrugs that become active upon further modification. Thus, in one embodiment, a therapeutic agent derivative retains some or all of the therapeutic activity compared to the unmodified agent, and in another embodiment, the therapeutic agent derivative lacks therapeutic activity.
[0129] In various embodiments, therapeutic agents include any therapeutically effective agent or drug, such as anti-inflammatory compounds, antidepressants, stimulants, analgesics, antibiotics, contraceptives, antipyretics, vasodilators, antiangiogenic agents, cytovascular agents, signal transduction inhibitors, cardiovascular agents, e.g., antiarrhythmic agents, vasoconstrictors, hormones, and steroids. In one embodiment, the therapeutic agent is an oncology drug, also known as an anti-tumor drug, anti-cancer drug, tumor drug, or antineoplastic drug. Examples of oncology drugs that can be used in accordance with the present invention include, but are not limited to, the following: adriamycin, alkeran, allopurinol, altretamine, amifostine, anastrozole, araC, arsenic trioxide, azathioprine, bexarotene, biCNU, bleomycin, intravenous busulfan, oral busulfan, capecitabine (Xeloda), carboplatin, carmustine, CCNU, celecoxib, chlorambucil, cisplatin ... cyclosporin A, cytarabine, cytosine arabinoside, daunorubicin, cytoxan, daunorubicin, dexamethasone, dexrazoxane, dodetaxel, doxorubicin, DTIC, epirubicin, estramustine, etoposide phosphate, etoposide and VP-16, exemestane, FK506, fludarabine, fluorouracil, 5-FU, gemcitabine (Gemzar), gemtuzumab-ozogamicin , goserelin acetate, hydrrea, hydroxyurea, idarubicin, ifosfamide, imatinib mesylate, interferon, irinotecan (Camptostar, CPT-111), letrozole, leucovorin, leustatin, leuprolide, levamisole, litretinoin, megastrol, melphalan, L-PAM, mesna, methotrexate, methoxsalen, mithramycin, mitomycin, mitoxantrone , nitrogen mustard, paclitaxel, pamidronate, pegademase, pentostatin, porfimer sodium, prednisone, rituximab, streptozocin, STI-571, tamoxifen, taxotere, temozolamide, teniposide, VM-26, topotecan (Hycamtin), toremifene, tretinoin, ATRA, valrubicin, velban, vinblastine, vincristine, VP16, and vinorelbine. Other examples of oncology drugs that can be used in accordance with the present invention are ellipticine and ellipticine analogs or derivatives, epothilones, intracellular kinase inhibitors, and camptothecin.
[0130] Nucleic acid-lipid particles In some embodiments, the lipid particles of the present invention are bound to nucleic acids, resulting in nucleic acid-lipid particles. In certain embodiments, the nucleic acid is fully encapsulated in the lipid particles. As used herein, the term "nucleic acid" is intended to include any oligonucleotide or polynucleotide. Fragments containing up to 50 nucleotides are generally referred to as oligonucleotides, while longer fragments are referred to as polynucleotides. In certain embodiments, the oligonucleotides of the present invention are 15 to 50 nucleotides in length.
[0131] In the context of the present invention, the terms "polynucleotide" and "oligonucleotide" refer to a polymer or oligomer of nucleotide or nucleoside monomers composed of natural bases, sugars, and intersugar (backbone) linkages. The terms "polynucleotide" and "oligonucleotide" also refer to polymers or oligomers comprising non-naturally occurring monomers or portions thereof which function similarly. Such modified or substituted oligonucleotides are often preferred over natural forms because of properties such as, for example, enhanced cellular uptake and increased stability in the presence of nucleases.
[0132] The nucleic acid present in the lipid-nucleic acid particles of the present invention includes all known forms of nucleic acid. The nucleic acid used herein may be single-stranded DNA or RNA, double-stranded DNA or RNA, or a DNA-RNA hybrid. Examples of double-stranded DNA include structural genes, genes containing regulatory and termination regions, and self-replicating systems such as viral DNA or plasmid DNA. Examples of double-stranded RNA include siRNA and other RNA interference reagents. Single-stranded nucleic acids include, for example, antisense oligonucleotides, ribozymes, microRNAs, and triplex-forming oligonucleotides. The nucleic acid present in the lipid-nucleic acid particles of the present invention may contain one or more of the oligonucleotide modifications described below.
[0133] Nucleic acids of the present invention may be of various lengths, which may generally depend on the particular form of the nucleic acid. For example, in certain embodiments, a plasmid or gene may be about 1,000 to 100,000 nucleotide residues in length. In certain embodiments, an oligonucleotide may be in the range of about 10 to 100 nucleotides in length. In various related embodiments, single-stranded, double-stranded, and triple-stranded oligonucleotides may be in the range of about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, or about 20 to about 30 nucleotides in length.
[0134] In certain embodiments, an oligonucleotide (or strand thereof) of the present invention specifically hybridizes to or is complementary to a target polynucleotide. The terms "specifically hybridizable" and "complementary" are used to indicate a sufficient degree of complementarity such that stable, specific binding occurs between the DNA or RNA target and the oligonucleotide. It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable if there is a sufficient degree of complementarity to avoid nonspecific binding of the oligonucleotide to non-target sequences under conditions where specific binding is desired, i.e., physiological conditions in the case of in vivo assays or therapeutic treatments, or conditions under which the assay is performed in the case of in vitro assays. Thus, in other embodiments, the oligonucleotide contains one, two, or three base substitutions, e.g., mismatches, compared to the region of the gene or mRNA sequence to which it targets or to which it specifically hybridizes.
[0135] RNA interference nucleic acid In certain embodiments, the nucleic acid-lipid particle of the present invention is combined with RNA interference (RNAi) molecules.The RNA interference method using RNAi molecules can be used to disrupt the expression of target gene or polynucleotide.Small interfering RNA (siRNA) has essentially replaced antisense ODN and ribozyme as the next generation of targeting oligonucleotide drugs under development.
[0136] SiRNAs are RNA duplexes, typically 16–30 nucleotides long, that can bind to a cytoplasmic multiprotein complex known as the RNAi-induced silencing complex (RISC). RISC loaded with siRNA mediates the degradation of homologous mRNA transcripts, and siRNAs can therefore be designed to knock down protein expression with high specificity. Unlike other antisense technologies, siRNAs function through a natural mechanism that evolved to control gene expression through non-coding RNA. This is generally believed to be the reason why their activity is more potent in vitro and in vivo than either antisense ODNs or ribozymes. Various RNAi reagents, including siRNAs targeting clinically relevant targets, are currently in pharmaceutical development, as described, for example, in de Fougerolles, A. et al., Nature Reviews 6:443–453 (2007).
[0137] Although the first RNAi molecules described were RNA:RNA hybrids containing both RNA sense and RNA antisense strands, it has now been demonstrated that DNA sense:RNA antisense hybrids, RNA sense:DNA antisense hybrids, and DNA:DNA hybrids can mediate RNAi (Lamberton, JS and Christian, AT, (2003) Molecular Biotechnology 24:111-119). Thus, the present invention encompasses the use of RNAi molecules containing any of these different types of double-stranded molecules. In addition, it is understood that RNAi molecules can be used and introduced into cells in a variety of forms. Thus, as used herein, RNAi molecules encompass any and all molecules capable of inducing an RNAi response in a cell, including, but not limited to: double-stranded oligonucleotides comprising two separate strands, i.e., a sense strand and an antisense strand, such as small interfering RNA (siRNA); double-stranded oligonucleotides comprising two separate strands joined together by a non-nucleotidyl linker; oligonucleotides comprising a hairpin loop of complementary sequences that form a double-stranded region, such as shRNAi molecules; and expression vectors that express one or more polynucleotides capable of forming a double-stranded polynucleotide, either alone or in combination with another polynucleotide.
[0138] As used herein, " single-stranded siRNA compound " refers to the siRNA compound that is composed of a single molecule.Single-stranded siRNA compound comprises a double-stranded region formed by intrastrand pairing, and can be or comprise, for example, hairpin or panhandle structure.Single-stranded siRNA compound can be antisense with respect to target molecule.
[0139] The single-stranded siRNA compound can be long enough to enter RISC and participate in RISC-mediated target mRNA cleavage.The single-stranded siRNA compound is at least 14 nucleotides long, and in other embodiments, at least 15, 20, 25, 29, 35, or 50 nucleotides long.In some embodiments, the single-stranded siRNA compound is less than 200, 100, or 60 nucleotides long.
[0140] Hairpin siRNA compounds may have a double-stranded region that is equal to or at least 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. The double-stranded region may be 200, 100, or 50 nucleotide pairs in length or less. In some embodiments, the double-stranded region ranges from 15-30, 17-23, 19-23, and 19-21 nucleotide pairs in length. The hairpin may have a single-stranded overhang or terminal unpaired region. In some embodiments, the overhang is 2-3 nucleotides in length. In some embodiments, the overhang is on the sense side of the hairpin, and in some embodiments, on the antisense side of the hairpin.
[0141] A "double-stranded siRNA compound," as used herein, is an siRNA compound that contains multiple, and in some cases two, strands, where interstrand hybridization is capable of forming a region of double-stranded structure.
[0142] The antisense strand of a double-stranded siRNA compound may be equal to or at least 14, 15, 16, 17, 18, 19, 25, 29, 40, or 60 nucleotides in length. The antisense strand of a double-stranded siRNA compound may be 200, 100, or 50 nucleotides or less in length. Ranges may include 17-25, 19-23, and 19-21 nucleotides in length. As used herein, the term "antisense strand" refers to the strand of an siRNA compound that is sufficiently complementary to a target molecule, e.g., a target RNA.
[0143] The sense strand of a double-stranded siRNA compound may be equal to or at least 14, 15, 16, 17, 18, 19, 25, 29, 40, or 60 nucleotides in length. The sense strand of a double-stranded siRNA compound may be up to 200, 100, or 50 nucleotides in length. Ranges may be 17-25, 19-23, and 19-21 nucleotides in length.
[0144] The double-stranded portion of a double-stranded siRNA compound may be equal to or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotides in length. The double-stranded portion of a double-stranded siRNA compound may be up to 200, 100, or 50 nucleotides in length. Ranges may be 15-30, 17-23, 19-23, and 19-21 nucleotides in length.
[0145] In many embodiments, the siRNA compounds are large enough that they can be cleaved by endogenous molecules, such as Dicer, to produce smaller siRNA compounds, eg, siRNAs agents.
[0146] The sense and antisense strands may be selected so that the double-stranded siRNA compound contains a single-stranded or unpaired region at one or both ends of the molecule. Thus, the double-stranded siRNA compound contains a sense and antisense strand that are paired and contain overhangs, for example, one or two 5'-overhangs or 3'-overhangs, or 3'-overhangs of 1 to 3 nucleotides. The overhangs may be the result of one strand being longer than the other, or may be the result of two strands of the same length being staggered. Some embodiments will have at least one 3'-overhang. In one embodiment, both ends of the siRNA molecule will have a 3'-overhang. In some embodiments, the overhang is two nucleotides.
[0147] In some embodiments, the length of the double-stranded region is 15 to 30, or 18, 19, 20, 21, 22, and 23 nucleotides in length, e.g., in the range of the ssiRNA compounds discussed above. The ssiRNA compounds may be similar in length and structure to the products processed from long dsiRNAs by natural Dicer. Also included are embodiments in which the two strands of the ssiRNA compound are linked, e.g., covalently linked. Hairpins or other single-stranded structures that provide the necessary double-stranded region and 3' overhang are also within the scope of the invention.
[0148] The siRNA compounds described herein, including double-stranded siRNA compounds and single-stranded siRNA compounds, can mediate the silencing of target RNA, for example, mRNA, for example, the transcript of a gene encoding a protein.For convenience, this mRNA is also referred to herein as the mRNA to be silenced.This gene is also referred to as target gene.Generally, the RNA to be silenced is an endogenous gene or a pathogen gene.In addition, RNA other than mRNA, for example, tRNA and viral RNA, can also be targeted.
[0149] As used herein, the phrase "mediate RNAi" refers to the ability to silence target RNA in a sequence-specific manner.Without wishing to be bound by theory, it is believed that silencing uses the RNAi mechanism or process and guide RNA, for example, ssiRNA compounds of 21-23 nucleotides.
[0150] In one embodiment, the siRNA compound is "sufficiently complementary" to the target RNA, for example, the target mRNA, so that the siRNA compound silences the production of the protein encoded by the target mRNA. In another embodiment, the siRNA compound is "exactly complementary" to the target RNA, for example, the target RNA, so that the siRNA compound anneals to form a hybrid that is exclusively made by Watson-Crick base pairing in the exact complementary region. The "sufficiently complementary" target RNA can include an internal region (e.g., at least 10 nucleotides) that is exactly complementary to the target RNA. Furthermore, in some embodiments, the siRNA compound specifically discriminates between single nucleotide differences. In this case, the siRNA compound mediates RNAi only when exact complementarity is found in that region (e.g., within 7 nucleotides of the single nucleotide difference).
[0151] microRNA MicroRNAs (miRNAs) are a highly conserved class of small RNA molecules that are transcribed from DNA in the genomes of animals and plants but are not translated into proteins. Processed miRNAs are single-stranded, approximately 17–25 nucleotide (nt) RNA molecules that are incorporated into the RNA-induced silencing complex (RISC) and have been identified as key regulators of development, cell proliferation, apoptosis, and differentiation. They are thought to play a role in regulating gene expression by binding to the 3'-untranslated region of specific mRNAs. RISC mediates downregulation of gene expression through translational inhibition, transcript cleavage, or both. RISC is also involved in transcriptional silencing in the nuclei of a wide range of eukaryotic organisms.
[0152] To date, a large number of miRNA sequences have been identified, and the number is growing; illustrative examples of these can be found, for example, in "miRBase: microRNA sequences, targets and gene nomenclature" Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. NAR, 2006, 34, Database Issue, D140-D144; "The microRNA Registry" Griffiths-Jones S. NAR, 2004, 32, Database Issue, D109-D111, and also at http: / / microrna.sanger.ac.uk / sequences / .
[0153] antisense oligonucleotides In one embodiment, the nucleic acid is an antisense oligonucleotide directed against a target polynucleotide. The term "antisense oligonucleotide" or simply "antisense" is intended to include oligonucleotides complementary to a target polynucleotide sequence. Antisense oligonucleotides are single strands of DNA or RNA complementary to a selected sequence, e.g., a target gene mRNA. Antisense oligonucleotides are thought to inhibit gene expression by binding to complementary mRNA. Binding to the target mRNA can lead to inhibition of gene expression either by binding to it and thereby preventing translation of the complementary mRNA or by leading to degradation of the target mRNA. Antisense DNA can be used to target a specific complementary (coding or non-coding) RNA. If binding occurs, the DNA / RNA hybrid can be degraded by the enzyme RNase H. In certain embodiments, antisense oligonucleotides contain about 10 to about 50 nucleotides, more preferably about 15 to about 30 nucleotides. The term also encompasses antisense oligonucleotides that may not be exactly complementary to the desired target gene. Thus, the present invention can be utilized when non-target specific activity with the antisense is found, or when an antisense sequence containing one or more mismatches with the target sequence is most preferred for a particular use.
[0154] Antisense oligonucleotides have been demonstrated to be effective targeted inhibitors of protein synthesis, and as a result, can be used to specifically inhibit protein synthesis by target genes. The efficacy of antisense oligonucleotides for inhibiting protein synthesis has been well established. For example, the synthesis of polygalactauronase and type 2 muscarinic acetylcholine receptors are inhibited by antisense oligonucleotides directed against their respective mRNA sequences (U.S. Patent Nos. 5,739,119 and 5,759,829). Further examples of antisense inhibition include nuclear protein cyclins, multidrug resistance genes (MDG1), ICAM-1, E-selectin, STK-1, striatal GABA receptors, and the like. A This has been demonstrated for the human EGF receptor and human EGF (Jaskulski et al., Science. 1988 Jun 10;240(4858):1544-6; Vasanthakumar and Ahmed, Cancer Commun. 1989;1(4):225-32; Peris et al., Brain Res Mol Brain Res. 1998 Jun 15;57(2):310-20; U.S. Patent Nos. 5,801,154; 5,789,573; 5,718,709, and 5,610,288). Furthermore, it has been described that antisense constructs can be used to inhibit and treat various abnormal cell proliferations (e.g., cancer) (U.S. Patent Nos. 5,747,470, 5,591,317, and 5,783,683).
[0155] Methods for generating antisense oligonucleotides are known in the art and can be readily adapted to generate antisense oligonucleotides targeting any polynucleotide sequence. The selection of an antisense oligonucleotide specific for a given target sequence depends on the selected target sequence, and the determination of secondary structure, T mAntisense oligonucleotides can be selected based on their relative ability to avoid forming dimers, hairpins, or other secondary structures that would reduce or inhibit specific binding to the target mRNA in host cells. Highly preferred target sites in mRNA include sequences substantially complementary to the region at or near the AUG translation initiation codon and the 5' region of the mRNA. Analysis of these secondary structures and considerations for target site selection can be performed, for example, using v.4 of OLIGO primer analysis software (Molecular Biology Insights) and / or BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids Res. 1997, 25(17):3389-402).
[0156] Antagomir Antagomirs are RNA-like oligonucleotides that incorporate various modifications related to pharmacological properties, such as RNAse protection and enhanced tissue and cellular uptake. Antagomirs are distinguished from normal RNAs by, for example, complete 2'-O-methylation of the sugars, a phosphorothioate backbone, and, for example, a cholesterol moiety at the 3' end. Antagomirs can be used to efficiently silence endogenous miRNAs by forming a duplex containing the antagomir and the endogenous miRNA, thereby preventing miRNA-induced gene silencing. An example of antagomir-mediated miRNA silencing is the silencing of miR-122, as described in Krutzfeldt et al., Nature, 2005, 438: 685-689, the entire contents of which are expressly incorporated herein by reference. Antagomir RNA can be synthesized using standard solid-phase oligonucleotide synthesis protocols. See U.S. Patent Application Nos. 11 / 502,158 and 11 / 657,341, the disclosures of each of which are incorporated herein by reference.
[0157] Antagomirs may include ligand-linked monomer subunits and monomers for oligonucleotide synthesis. Exemplary monomers are described in U.S. Patent Application No. 10 / 916,185, filed August 10, 2004. Antagomirs may have a ZXY structure, such as those described in International Application No. PCT / US2004 / 07070, filed March 8, 2004. Antagomirs may be complexed with an amphipathic moiety. Exemplary amphipathic moieties for use with oligonucleotide agents are described in International Application No. PCT / US2004 / 07070, filed March 8, 2004.
[0158] Aptamers Aptamers are nucleic acid or peptide molecules that bind with high affinity and specificity to a particular molecule of interest (Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). DNA or RNA aptamers have been successfully generated that bind to a number of different substances, from large proteins to small organic molecules. See Eaton, Curr. Opin. Chem. Biol. 1:10-16 (1997); Famulok, Curr. Opin. Struct. Biol. 9:324-9 (1999); and Hermann and Patel, Science 287:820-5 (2000). Aptamers may be RNA- or DNA-based and may include riboswitches. Riboswitches are portions of mRNA molecules that can directly bind to small target molecules, and target binding affects gene activity. Thus, the mRNA containing the riboswitch is directly involved in controlling its own activity depending on the presence or absence of its target molecule. Generally, aptamers are engineered through several rounds of in vitro selection, or similarly, SELEX (systematic evolution of ligands by exponential enrichment), to bind to various molecular targets, such as small molecules, proteins, nucleic acids, and even cells, tissues, and organisms. Aptamers can be prepared by any known method, including synthetic, recombinant, and purified methods, and can be used alone or in combination with other aptamers specific for the same target. Furthermore, as described in more detail herein, the term "aptamer" specifically includes "second aptamers" that contain consensus sequences derived from comparing multiple known aptamers for a given target.
[0159] Ribozymes According to another embodiment of the present invention, the nucleic acid-lipid particle is conjugated to a ribozyme, which is an RNA molecular complex containing a specific catalytic domain with endonuclease activity (Kim and Cech, Proc Natl Acad Sci U.S.A. 1987 Dec;84(24):8788-92; Forster and Symons, Cell. 1987 Apr 24;49(2):211-20). For example, many ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphates on an oligonucleotide substrate (Cech et al., Cell. 1981 Dec;27(3 Pt 2):487-96; Michel and Westhof, J Mol Biol. 1990 Dec 5;216(3):585-610; Reinhold-Hurek and Shub, Nature. 1992 May 14;357(6374):173-6). This specificity results from the requirement that the substrate bind, through specific base-pairing interactions, to the ribozyme's internal guide sequence ("IGS") prior to chemical reaction.
[0160] At least six base variants of natural enzymatic RNAs are currently known. Each is capable of catalyzing the hydrolysis of trans-positioned RNA phosphodiester bonds (and thus cleaving other RNA molecules) under physiological conditions. Generally, enzymatic nucleic acids act by first binding to a target RNA. Such binding occurs via the target binding portion of the enzymatic nucleic acid, which is held in close proximity to the enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds to the target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cleave the target RNA. This strategic cleavage of the target RNA destroys the target RNA's ability to direct synthesis of the encoded protein. After binding and cleaving its RNA target, the enzymatic nucleic acid is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
[0161] The enzymatic nucleic acid molecule may be configured, for example, with a hammerhead, hairpin, hepatitis delta virus, group I intron, or RNaseP RNA (binding to an RNA guide sequence), or Neurospora VS RNA motif. Specific examples of hammerhead motifs are described by Rossi et al. Nucleic Acids Res. 1992 Sep 11; 20(17):4559-65. Examples of hairpin motifs are described by Hampel et al. (European Patent Application Publication No. 0360257), Hampel and Tritz, Biochemistry 1989 Jun 13; 28(12):4929-33; Hampel et al., Nucleic Acids Res. 1990 Jan 25; 18(2):299-304; and U.S. Patent No. 5,631,359. An example of a Hepatitis virus motif is described in Perrotta and Been, Biochemistry. 1992 Dec 1;31(47):11843-52; an example of an RNase P motif is described in Guerrier-Takada et al., Cell. 1983 Dec;35(3 Pt 2):849-57; a Neurospora VS RNA ribozyme motif is described in Collins (Saville and Collins, Cell. 1990 May 18;61(4):685-96; Saville and Collins, Proc Natl Acad Sci U.S. A. 1991 Oct 1;88(19):8826-30; Collins and Olive, Biochemistry. 1993 Mar 23;32(11):2795-9); and an example of a Group I intron is described in U.S. Pat. No. 4,987,071. An important feature of the enzymatic nucleic acid molecules used in accordance with this invention is that they have a specific substrate binding site complementary to one or more regions of the target gene DNA or RNA, and have nucleotide sequences within or surrounding that substrate binding site that confer RNA cleavage activity to the molecule. Thus, ribozyme constructs need not be limited to the particular motifs referred to herein.
[0162] Methods for generating ribozymes targeted to any polynucleotide sequence are known in the art. Ribozymes can be designed as described in WO 93 / 23569 and WO 94 / 02595, each of which is specifically incorporated herein by reference, and synthesized as described therein for in vitro and in vivo testing.
[0163] Ribozyme activity can be optimized by altering the length of the ribozyme binding arms or by chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (WO 92 / 07065; WO 93 / 15187; WO 91 / 03162; EP 92110298.4; U.S. Pat. No. 5,334,711; and WO 94 / 13688, which describe various chemical modifications that can be made to the sugar portion of enzymatic RNA molecules), by modifications that enhance their efficacy in cells, and by removing stem II bases to shorten RNA synthesis time and reduce chemical requirements.
[0164] Immunostimulatory Oligonucleotides The nucleic acids bound to the lipid particles of the present invention may be immunostimulatory, including immunostimulatory oligonucleotides (ISS; single-stranded or double-stranded) capable of inducing an immune response when administered to a subject, which may be a mammal or other patient. ISSs include, for example, palindromes associated with hairpin secondary structures (see Yamamoto S., et al. (1992) J. Immunol. 148: 4072-4076), or CpG motifs, as well as other known ISS features (such as multiple G domains, see WO 96 / 11266).
[0165] The immune response may be an innate immune response or an adaptive immune response. The immune system is further divided into the innate immune system and the acquired adaptive immune system of vertebrates, the latter of which is further divided into humoral and cellular components. In certain embodiments, the immune response may be mucosal.
[0166] In certain embodiments, the immunostimulatory nucleic acid is only immunostimulatory when administered in combination with a lipid particle, and is not immunostimulatory when administered in its free form. According to the present invention, such oligonucleotides are considered to be immunostimulatory.
[0167] Immunostimulatory nucleic acids are considered non-sequence-specific if they are not required to specifically bind to and reduce expression of a target polynucleotide in order to elicit an immune response. Thus, certain immunostimulatory nucleic acids may contain sequences that correspond to regions of a native gene or mRNA, yet still be considered non-sequence-specific immunostimulatory nucleic acids.
[0168] In one embodiment, the immunostimulatory nucleic acid or oligonucleotide comprises at least one CpG dinucleotide. The oligonucleotide or CpG dinucleotide may be unmethylated or methylated. In another embodiment, the immunostimulatory nucleic acid comprises at least one CpG dinucleotide having a methylated cytosine. In one embodiment, the nucleic acid comprises a single CpG dinucleotide, wherein the cytosine of the CpG dinucleotide is methylated. In a particular embodiment, the nucleic acid comprises the sequence 5'TAACGTTGAGGGGCAT3'. In an alternative embodiment, the nucleic acid comprises at least two CpG dinucleotides, wherein at least one cytosine of the CpG dinucleotide is methylated. In a further embodiment, each cytosine of the CpG dinucleotides in the sequence is methylated. In another embodiment, the nucleic acid comprises multiple CpG dinucleotides, wherein at least one of the CpG dinucleotides comprises a methylated cytosine.
[0169] In one particular embodiment, the nucleic acid comprises the sequence 5'TTCCATGACGTTCCTGACGT 3'. In another particular embodiment, the nucleic acid sequence comprises the sequence 5'TCCATGA C GTTCCTGA C GT3', and the two underlined cytosines are methylated. In certain embodiments, the ODN is selected from the group consisting of ODN #1, ODN #2, ODN #3, ODN #4, ODN #5, ODN #6, ODN #7, ODN #8, and ODN #9 shown below. [Table 2A] [Table 2B]
[0170] Further specific nucleic acid sequences of oligonucleotides (ODN) suitable for use in the compositions and methods of the present invention are described in Raney et al., Journal of Pharmacology and Experimental Therapeutics, 298:1185-1192 (2001). In some embodiments, the ODN used in the compositions and methods of the present invention has a phosphodiester ("PO") backbone or a phosphorothioate ("PS") backbone, and / or at least one methylated cytosine residue in a CpG motif.
[0171] Decoy oligonucleotides Because transcription factors recognize relatively short binding sequences even in the absence of surrounding genomic DNA, short oligonucleotides carrying the consensus binding sequence of a specific transcription factor can be used as a tool to manipulate gene expression in living cells. This strategy involves delivering such "decoy oligonucleotides" into cells, which are then recognized and bound by the target factor. The decoy occupies the DNA binding site of the transcription factor, preventing the transcription factor from subsequently binding to the promoter region of the target gene. Decoys can be used as therapeutic agents to either inhibit the expression of genes activated by the transcription factor or to upregulate genes repressed by the binding of the transcription factor. An example of the use of decoy oligonucleotides can be found in Mann et al., J. Clin. Invest., 2000, 106: 1071-1075, which is expressly incorporated herein by reference in its entirety.
[0172] Supermir A supermir refers to a single-stranded, double-stranded, or partially double-stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), or both, or modifications thereof, that has a nucleotide sequence substantially identical to an miRNA and antisense with respect to its target. The term includes oligonucleotides composed of natural nucleobases, sugars, and covalent internucleoside (backbone) linkages, but containing at least one non-natural moiety that functions similarly. Such modified or substituted oligonucleotides are preferred over natural forms because of desirable properties such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, and increased stability in the presence of nucleases. In a preferred embodiment, a supermir does not contain sense DNA, and in another preferred embodiment, a supermir does not significantly self-hybridize. The supermirs featured in the present invention may have secondary structure but are substantially single-stranded under physiological conditions. A substantially single-stranded supermir is single-stranded to the extent that less than about 50% (e.g., less than about 40%, 30%, 20%, 10%, or 5%) of the supermir forms a duplex with itself. A supermir may contain a hairpin segment, e.g., a sequence that can self-hybridize, preferably at the 3' end, to form a double-stranded region, e.g., the double-stranded region is at least 1, 2, 3, or 4 nucleotides, preferably 8, 7, 6, or less than n nucleotides, e.g., 5 nucleotides. The double-stranded region may be connected by a linker, e.g., a nucleotide linker, e.g., 3, 4, 5, or 6 dTs, e.g., modified dTs. In another embodiment, a supermir forms a duplex with a shorter oligo, e.g., 5, 6, 7, 8, 9, or 10 nucleotides in length, e.g., at one or both of the 3' and 5' ends, at the non-terminal or middle of the supermir.
[0173] miRNA mimics miRNA mimics represent a class of molecules that can be used to mimic the gene silencing capabilities of one or more miRNAs. Thus, the term "microRNA mimic" refers to synthetic non-coding RNAs that can enter the RNAi pathway and regulate gene expression (i.e., miRNAs cannot be obtained by purification from endogenous miRNA sources). miRNA mimics can be designed as mature molecules (e.g., single-stranded) or mimic precursors (e.g., pri- or pre-miRNAs). miRNA mimics may be composed of nucleic acids (modified or modified nucleic acids), including, but not limited to, RNA, modified RNA, DNA, modified DNA, locked nucleic acids, or oligonucleotides containing 2'-O, 4'-C ethylene-bridged nucleic acids (ENA), or any combination of the above (including DNA-RNA hybrids). Additionally, miRNA mimics can contain conjugates that can affect delivery, intracellular compartmentalization, stability, specificity, functionality, strand usage, and / or efficacy. In one design, miRNA mimics are double-stranded molecules (e.g., having a double-stranded region about 16 to about 31 nucleotides in length) that contain one or more sequences that share identity with the mature strand of a given miRNA. Modifications may include 2' modifications (including 2'-O-methyl and 2'F modifications) on one or both strands of the molecule, as well as internucleotide modifications (e.g., phorphorthioate modifications) that enhance nucleic acid stability and / or specificity. In addition, miRNA mimics may contain overhangs. Overhangs may consist of 1 to 6 nucleotides at the 3' or 5' end of either strand and may be modified to enhance stability or functionality. In one embodiment, the miRNA mimic comprises a double-stranded region of 16-31 nucleotides and one or more of the following chemical modification patterns: the sense DNA contains 2'-O-methyl modifications of the 1st and 2nd (counting from the 5' end of the sense oligonucleotide) nucleotides and all Cs and Us; the antisense strand modifications may include 2'F modifications of all Cs and Us, phosphorylation of the 5' end of the oligonucleotide, and a stabilized internucleotide linkage attached to the 2nd nucleotide 3' overhang.
[0174] Anti-mir or miRNA inhibitors The terms "anti-mir," "microRNA inhibitor," "miR inhibitor," or "inhibitor" are synonymous and refer to oligonucleotides or modified oligonucleotides that interfere with the activity of specific miRNAs. Generally, inhibitors are nucleic acids or modified nucleic acids, including oligonucleotides containing essentially RNA, modified RNA, DNA, modified DNA, locked nucleic acids (LNA), or any combination of the above. Modifications include 2'-modifications (including 2'-0 alkyl modifications and 2'F modifications) and internucleotide modifications (e.g., phosphorothioate modifications) that can affect delivery, stability, specificity, intracellular compartmentalization, or efficacy. In addition, miRNA inhibitors can include conjugates that can affect delivery, intracellular compartmentalization, stability, and / or efficacy. Inhibitors can be in various configurations, including single-stranded, double-stranded (RNA / RNA or RNA / DNA duplexes), and hairpin structures. Generally, microRNA inhibitors contain one or more sequences or portions of sequences that are complementary or partially complementary to the mature strand(s) of the targeted miRNA. In addition, miRNA inhibitors may also contain additional sequences located 5' and 3' of the sequence that is the reverse complement of the mature miRNA. The additional sequences may be the reverse complement of the sequence adjacent to the mature miRNA in the pri-miRNA from which the mature miRNA is derived, or the additional sequences may be any sequence (having a mixture of A, G, C, or U). In some embodiments, one or both of the additional sequences are any sequence capable of forming a hairpin. Thus, in some embodiments, the sequence that is the reverse complement of the miRNA is flanked on the 5' and 3' sides by hairpin structures. When double-stranded, microRNA inhibitors may contain mismatches between nucleotides on opposite strands. Additionally, the microRNA inhibitor may be conjugated to a binding moiety to facilitate intracellular uptake of the inhibitor. For example, the microRNA inhibitor may be conjugated to cholesteryl 5-(bis(4-methoxyphenyl)(phenyl)methoxy)-3 hydroxypentylcarbamate, which allows passive uptake of the microRNA inhibitor into cells.MicroRNA inhibitors, including hairpin miRNA inhibitors, are described in detail in Vermeulen et al., "Double-Stranded Regions Are Essential Design Components of Potent Inhibitors of RISC Function," RNA 13: 723-730 (2007), and in International Publication Nos. 2007 / 095387 and 2008 / 036825, each of which is incorporated herein by reference in its entirety. A person skilled in the art can select the sequence of a desired miRNA from a database and design an inhibitor useful in the methods disclosed herein.
[0175] U1 Adapter The U1 adaptor is a bifunctional oligonucleotide having a targeting domain that interrupts the polyA site and is complementary to a site in the terminal exon of the target gene, and a "U1 domain" that binds to the U1 small nuclear RNA component of the U1 snRNP (Goraczniak, et al., 2008, Nature Biotechnology, 27(3), 257-263, which is expressly incorporated herein by reference in its entirety). The U1 snRNP is a ribonucleoprotein complex that functions primarily to direct the initial step of spliceosome formation by binding to pre-mRNA exon-intron boundaries (Brown and Simpson, 1998, Annu Rev Plant Physiol Plant MoI Biol 49:77-95). Nucleotides 2-11 at the 5' end of the U1 snRNA base pair with the 5' ss of the pre-mRNA. In one embodiment, the oligonucleotide of the present invention is a U1 adaptor. In one embodiment, the U1 adaptor can be administered in combination with at least one other iRNA agent.
[0176] Oligonucleotide Modification Unmodified oligonucleotides may not be optimal for some applications, for example, they may be susceptible to degradation by, for example, cellular nucleases. Nucleases can hydrolyze nucleic acid phosphodiester bonds. However, chemical modification of oligonucleotides can confer improved properties, for example, making the oligonucleotide more stable to nucleases.
[0177] Because oligonucleotides are polymers of subunits or monomers, many of the modifications described below, such as modifications of the base, sugar, phosphate moiety, or non-bridging oxygen of the phosphate moiety, occur at repeated positions within the oligonucleotide. It is not necessary for all positions of a given oligonucleotide to be uniformly modified, and in fact, multiple modifications described above can be incorporated into a single oligonucleotide, or even into a single nucleoside within the oligonucleotide.
[0178] In some cases, modifications will occur at all of the target positions of an oligonucleotide, but in many, and indeed most, cases, modifications will not occur at all of the target positions. For example, modifications may occur only at the 3' or 5' terminal position, only in internal regions, or only in terminal regions, such as the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of an oligonucleotide. Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in the double-stranded region of a double-stranded oligonucleotide, or only in the single-stranded region of a double-stranded oligonucleotide. For example, phosphorothioate modifications at non-bridging oxygen positions may occur only at one or both ends, only in terminal regions, such as the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of the strand, or in double-stranded and single-stranded regions, especially at the ends. The 5' end(s) may be phosphorylated.
[0179] A modification described herein can be the only modification or type of modification contained in a plurality of nucleotides, or a modification can be combined with one or more other modifications described herein. The modifications described herein can also be combined in an oligonucleotide, for example, different nucleotides of an oligonucleotide have different modifications described herein.
[0180] In some embodiments, it is particularly preferred, for example, to enhance stability, to include specific nucleobases in the overhang, or to include modified nucleotides or nucleotide surrogates in the single-stranded overhang, e.g., the 5'-overhang or the 3'-overhang, or both. For example, it may be desirable to include purine nucleotides in the overhang. In some embodiments, all or some of the bases in the 3'- or 5'-overhang will be modified by the modifications described herein. Modifications include, for example, the use of modifications at the 2'OH group of the ribose sugar, e.g., the use of deoxyribonucleotides, e.g., deoxythymidine, instead of ribonucleotides, and modifications at the phosphate group, e.g., the use of phosphothioate modifications. The overhang need not be homologous to the target sequence.
[0181] Specific modifications are discussed in more detail below.
[0182] phosphate group Phosphate group is a negatively charged species.The charge is equally distributed between two non-bridging oxygen atoms.However, phosphate group can be modified by replacing one of oxygen with a different substituent.One result of this modification to RNA phosphate backbone can be increased resistance of oligoribonucleotide to nucleic acid degradation.Therefore, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce a modification that results in either an uncharged linker or a charged linker with asymmetric charge distribution.
[0183] Examples of modified phosphate groups include phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate, and phosphotriester. In some embodiments, one of the non-bridging phosphate oxygen atoms of the phosphate backbone moiety can be replaced with any of the following: S, Se, BR3 (R is hydrogen, alkyl, aryl), C (i.e., alkyl group, aryl group, etc.), H, NR2 (R is hydrogen, alkyl, aryl), or OR (R is alkyl or aryl). The phosphorous atom of an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygens with one of the above atoms or atom groups imparts chirality to the phosphorous atom; in other words, the phosphorous atom of the modified phosphate group is an asymmetric center. The asymmetric phosphorous atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp).
[0184] In phosphorodithioates, both non-bridging oxygens are replaced with sulfur. The phosphorus center of phosphorodithioates is achiral, which eliminates the formation of oligoribonucleotide diastereomers. Therefore, without wishing to be bound by theory, modifications of both non-bridging oxygens that eliminate the chiral center, such as the formation of phosphorodithioates, may be desirable in that they cannot produce diastereomeric mixtures. Thus, the non-bridging oxygens may independently be any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl).
[0185] Phosphate linkers can also be modified by substituting the bridging oxygen (i.e., the oxygen that connects the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Substitution can occur at either or both of the linking oxygens. When the bridging oxygen is the 3'-oxygen of the nucleoside, substitution with carbon is preferred. When the bridging oxygen is the 5'-oxygen of the nucleoside, substitution with nitrogen is preferred.
[0186] Phosphate group substitution The phosphate group can be replaced with a non-phosphorus-containing linking moiety. Without wishing to be bound by theory, it is believed that because the charged phosphodiester group is the reactive center for nucleic acid degradation, replacing it with a neutral structural mimic should confer enhanced nuclease stability. Furthermore, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce a modification in which the charged phosphate group is replaced with a neutral moiety.
[0187] Examples of moieties that can replace the phosphate group include: methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Preferred replacements include methylenecarbonylamino and methylenemethylimino groups.
[0188] Modified phosphate linkages in which at least one of the oxygens attached to the phosphate is replaced, or in which the phosphate group is replaced with a non-phosphite group, are also referred to as "non-phosphodiester backbone linkages."
[0189] Ribophosphate backbone substitution Oligonucleotide mimetic backbones can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Without wishing to be bound by theory, it is believed that the absence of a repeatedly charged backbone reduces the binding of proteins that recognize polyanions (e.g., nucleases). Furthermore, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce modifications in which bases are replaced with neutral surrogate backbones. Examples include mophilino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates. A preferred surrogate is a PNA surrogate.
[0190] sugar modification Modified RNAs can include modifications of all or some of the sugar groups of ribonucleic acids. For example, the 2' hydroxyl group (OH) can be modified or replaced with many different "oxy" or "deoxy" substituents. Without being bound by theory, enhanced stability is predicted because the hydroxyl can no longer deprotonate to form a 2'-alkoxide ion. The 2'-alkoxide may catalyze decomposition by intramolecular nucleophilic attack on the linker atom. Furthermore, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce alterations that do not allow alkoxide formation at the 2' position.
[0191] Examples of "oxy"-2' hydroxyl group modifications include: alkoxy or aryloxy (OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), (O(CHCHO) nCH2CH2OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is linked, for example by a methylene bridge, to the 4' carbon of the same ribose sugar; O-amine (amine = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino), and aminoalkoxy, (O(CH2) n AMINE, (e.g., amine = NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino). It is noteworthy that oligonucleotides containing only methoxyethyl groups (MOE), (OCH2CH2OCH3, PEG derivatives) exhibit nuclease stability comparable to those modified with the robust phosphorothioate modification.
[0192] "Deoxy" modifications include: hydrogen (i.e., the deoxyribose sugar, particularly associated with overhangs in partially ds RNA); halo (e.g., fluoro); amino (e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CHCHNH) n CH2CH2-amine (amine = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino), -NHC(O)R (R = alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; mercapto; alkylthioalkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted, for example, with an amino function. Preferred substituents are 2'-methoxyethyl, 2'-OCH3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.
[0193] The sugar group can also contain one or more carbons with the opposite stereochemical configuration to that of the corresponding carbon of ribose. Thus, oligonucleotides can contain, for example, nucleotides containing arabinose as the sugar. The monomer can have an alpha linkage at the 1' position of the sugar, such as an alpha-nucleoside. Oligonucleotides can also contain "abasic" sugars that lack a C-1' nucleobase. These abasic sugars can also contain modifications at one or more of the constituent sugar atoms. Oligonucleotides can also contain one or more sugars that are L-form, such as L-nucleosides.
[0194] terminal modification The 3' and 5' ends of the oligonucleotide may be modified. Such modifications may occur at the 3' end, the 5' end, or both ends of the molecule. They may include modification or replacement of the entire terminal phosphate or one or more atoms of the phosphate group. For example, the 3' and 5' ends of the oligonucleotide may be attached to a labeling moiety, such as a fluorophore (e.g., pyrene, TAMRA, fluorescein, Cy3, or Cy5 dye), or other functional molecular entity, such as a protecting group (e.g., sulfur-, silicon-, boron-, or ester-based). The functional molecular entity may be attached to the sugar via the phosphate group and / or a linker. The terminal atom of the linker may be attached to or replace the binding atom of the phosphate group or the binding atom of the C-3' or C-5', O, N, S, or C group of the sugar. Alternatively, the linker may be attached to or replace the terminal atom of a nucleotide surrogate (e.g., PNA).
[0195] When a linker / phosphate functional molecular entity-linker / phosphate sequence is inserted between the two strands of a dsRNA, this sequence can take the place of the hairpin RNA loop of a hairpin RNA agent.
[0196] Terminal modifications useful for regulatory activity include modification of the 5' end with a phosphate or phosphate analog. For example, in a preferred embodiment, the antisense strand of the dsRNA is 5' phosphorylated or contains a phosphoryl analog at the 5' prime end. 5'-phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications include the following: 5'-monophosphate ((HO)2(O)PO-5'); 5'-diphosphate ((HO)2(O)POP(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)PO-(HO)(O)POP(HO)(O)-O-5'); 5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO)(O)PO-(H O)(O)POP(HO)(O)-O-5'; 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)PO-5'); 5'-monodithiophosphate (phosphorodithioate; (HO)(HS)( further any combination of oxygen / sulfur substituted monophosphates, diphosphates, and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)PO-5'), 5'-alkylphosphonates (R = alkyl = methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-), (OH)2(O)P-5'-CH2-), 5'-alkyl ether phosphonates (R = alkyl ether = methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g., RP(OH)(O)-O-5'-).
[0197] Terminal modifications may also be useful for monitoring distribution, in which case preferred groups added include fluorophores (e.g., fluorscein), Alexa dyes such as Alexa 488. Terminal modifications may also be useful for enhancing uptake, useful modifications for this purpose include cholesterol. Terminal modifications may also be useful for crosslinking an RNA agent to another moiety, useful modifications for this purpose include mitomycin C.
[0198] Nucleic acid bases Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or substituted to provide RNA with improved properties. For example, nuclease-resistant oligoribonucleotides can be prepared using these bases, or synthetic and natural nucleic acid bases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine), as well as any one of the modifications described above. Alternatively, substituted or modified analogs of any of the above bases can be used, such as the "unusual bases," "modified bases," "unnatural bases," and "universal bases" described herein.Examples include, but are not limited to, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines, and 2-aminopropyladenine, 5-propynyluracil, and 5- N-2, N-6, and O-6 substituted purines including propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, N6,N6-dimethyladenine, 2,6-diaminopurine, 5-aminoallyluracil, N3-methyluracil, substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N 4-acetylcytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated bases. Additional purines and pyrimidines include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in the Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990, and those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613.
[0199] cationic groups Modifications to oligonucleotides may include attaching one or more cationic groups to the sugar, base, and / or phosphorus atoms of the phosphate or modified phosphate backbone moiety. The cationic group may be attached to any substitutable atom of a natural, unusual, or universal base. Preferred positions are those that do not interfere with hybridization, i.e., the hydrogen bonding interactions required for base pairing. The cationic group may be attached, for example, via the C2' position of the sugar or an analogous position on a cyclic or acyclic sugar surrogate. Cationic groups may include, for example, protonated amino groups derived from O-amines (amine = NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino); aminoalkoxy, for example, O(CH) namine) (e.g., amine = NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino); amino (e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or NH(CHCHNH) n CH2CH2-amine (amine = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino).
[0200] Position within the oligonucleotide Some modifications may be preferably included in oligonucleotides at specific positions, such as at the internal position of the chain or at the 5' or 3' end of the oligonucleotide.Modification of oligonucleotides at preferred positions can confer preferred properties to the agent.For example, specific modifications at preferred positions can confer optimal gene silencing properties or increased resistance to endonuclease or exonuclease activity.
[0201] One or more nucleotides of the oligonucleotide may have a 2'-5' linkage. One or more nucleotides of the oligonucleotide may have an inverse linkage, for example, a 3'-3', 5'-5', 2'-2', or 2'-3' linkage.
[0202] The double-stranded oligonucleotide contains at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide in which the uridine is a 2'-modified nucleotide, or a terminal 5'-uridine-guanine-3' (5'-UG-3') dinucleotide in which the 5'-uridine is a 2'-modified nucleotide, or a terminal 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide in which the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5'-uridine-guanine-3' (5'-UG-3') dinucleotide in which the 5'-uridine is a 2'-modified nucleotide. or a terminal 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide where the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide where the 5'-cytidine is a 2'-modified nucleotide, or a terminal 5'-uridine-cytidine-3' (5'-UC-3') dinucleotide where the 5'-uridine is a 2'-modified nucleotide. Double-stranded oligonucleotides containing these modifications are particularly stabilized against endonuclease activity.
[0203] General literature The oligoribonucleotides and oligoribonucleosides used in the present invention can be synthesized by solid-phase synthesis. See, for example, "Oligonucleotide Synthesis, a Practical Approach," Ed. M. J. Gait, IRL Press, 1984; "Oligonucleotides and Analogues, A Practical Approach," Ed. F. Eckstein, IRL Press, 1991 (especially Chapter 1, Modern Machine-Aided Methods of Oligodeoxyribonucleotide Synthesis; Chapter 2, Oligoribonucleotide Synthesis; Chapter 3, 2'-O-Methyloligoribonucleotides: Synthesis and Applications; Chapter 4, Phosphorothioate Oligonucleotides; Chapter 5, Synthesis of Oligonucleotide Phosphorodithioates; Chapter 6, Synthesis of Oligo-2'-Deoxyribonucleoside Methylphosphonates; and Chapter 7, Oligodeoxynucleotides Containing Modified Bases). Other particularly useful synthetic procedures, reagents, protecting groups, and reaction conditions are described in the following references: Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Beaucage, SL and Iyer, RP, Tetrahedron, 1992, 48, 2223-2311; and Beaucage, SL and Iyer, RP, Tetrahedron, 1993, 49, 6123-6194, or references cited therein. Modifications described in WO 00 / 44895, WO 01 / 75164, or WO 02 / 44321 can be used herein. The disclosures of all publications, patents, and published patent applications cited herein are incorporated by reference.
[0204] Phosphate Group Literature The preparation of phosphinate oligoribonucleotides is described in U.S. Patent No. 5,508,270. The preparation of alkylphosphonate oligoribonucleotides is described in U.S. Patent No. 4,469,863. The preparation of phosphoramidite oligoribonucleotides is described in U.S. Patent No. 5,256,775 or U.S. Patent No. 5,366,878. The preparation of phosphotriester oligoribonucleotides is described in U.S. Patent No. 5,023,243. The preparation of boranophosphate oligoribonucleotides is described in U.S. Patent Nos. 5,130,302 and 5,177,198. The preparation of 3'-deoxy-3'-amino phosphoramidate oligoribonucleotides is described in U.S. Patent No. 5,476,925. 3'-Deoxy-3'-methylenephosphonate oligoribonucleotides are described in An, H, et al. J. Org. Chem. 2001, 66, 2789-2801. The preparation of sulfur-bridged nucleotides is described in Sproat et al. Nucleosides Nucleotides 1988, 7,651 and Crossick et al. Tetrahedron Lett. 1989, 30, 4693.
[0205] Sugar group literature Modifications to 2' modifications can be found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and all references therein. Specific modifications to ribose can be found in the following references: 2'-fluoro (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841), 2'-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), "LNA" (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310).
[0206] Phosphate group substitution literature Methylenemethylimino-linked oligoribonucleosides, also specified herein as MMI-linked oligoribonucleosides; methylenedimethylhydrazo-linked oligoribonucleosides, also specified herein as MDH-linked oligoribonucleosides; methylenecarbonylamino-linked oligoribonucleosides, also specified herein as amide-3-linked oligoribonucleosides; methylenecarbonylamino-linked oligoribonucleosides, also specified herein as amide-4-linked oligoribonucleosides; Ethylene aminocarbonyl-linked oligoribonucleosides and mixed backbone compounds, for example, having alternating MMI and PO or PS linkages, can be prepared as described in U.S. Patent Nos. 5,378,825, 5,386,023, 5,489,677, and International Application Nos. PCT / US92 / 04294 and PCT / US92 / 04305 (published as WO 92 / 20822 and WO 92 / 20823, respectively). Formacetal- and thioformacetal-linked oligoribonucleosides can be prepared as described in U.S. Patent Nos. 5,264,562 and 5,264,564. Ethylene oxide-linked oligoribonucleosides can be prepared as described in U.S. Patent No. 5,223,618. Siloxane substitutions are described in Cormier, JF et al. Nucleic Acids Res. 1988, 16, 4583. Carbonate substitutions are described in Tittensor, JRJ Chem. Soc. C 1971, 1933. Carboxymethyl substitutions are described in Edge, MD et al. J. Chem. Soc. Perkin Trans. 1 1972, 1991. Carbamate substitutions are described in Stirchak, EP Nucleic Acids Res. 1989, 17, 6129.
[0207] Phosphate-ribose backbone substitution literature Cyclobutyl sugar surrogate compounds can be prepared as described in U.S. Patent No. 5,359,044. Pyrrolidine sugar surrogates can be prepared as described in U.S. Patent No. 5,519,134. Morpholino sugar surrogates can be prepared as described in U.S. Patent Nos. 5,142,047 and 5,235,033, and other related patent disclosures. Peptide nucleic acids (PNAs) are known per se and can be prepared according to any of the various procedures cited in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They can also be prepared according to U.S. Patent No. 5,539,083.
[0208] Terminal modification literature Terminal modifications are described in Manoharan, M. et al. Antisense and Nucleic Acid Drug Development 12, 103-128 (2002) and references therein.
[0209] Nucleobase literature N-2 substituted purine nucleoside amidites can be prepared as described in U.S. Pat. No. 5,459,255. 3-Deazapurine nucleoside amidites can be prepared as described in U.S. Pat. No. 5,457,191. 5,6-substituted pyrimidine nucleoside amidites can be prepared as described in U.S. Pat. No. 5,614,617. 5-Propynylpyrimidine nucleoside amidites can be prepared as described in U.S. Pat. No. 5,484,908.
[0210] Linker The term "linker" refers to an organic moiety that connects two parts of a compound. Linkers typically include a direct bond or an atom such as oxygen or sulfur, NR 1 , C(O), C(O)NH, SO, SO2, SO2NH, or substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkynyl units such as chains of atoms, such as alkylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, etc., where one or more methylenes are selected from the group consisting of O, S, S(O), SO, N(R 1 )2, C(O), a cleavable bond, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic, wherein R1 is hydrogen, acyl, aliphatic, or substituted aliphatic.
[0211] In one embodiment, the linker is -[(PQR) q -X-(P'-Q'-R') q’ ] q’’ -T-, wherein P, R, T, P', R', and T are each independently selected at each occurrence from absent, CO, NH, O, S, OC(O), NHC(O), CH, CHNH, CHO; NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CH=NO, [ka] [ka] [ka] [ka] [ka] is heterocyclyl, Q and Q' are each independently in each occurrence absent, -(CH2) n -, -C(R 1 )(R 2 )(CH2) n -, -(CH2) n C(R 1 )(R 2 )-, -(CH2CH2O) m CH2CH2- or -(CH2CH2O) m CH2CH2NH-, X is absent or a cleavable linking group; R a is H or an amino acid side chain, R 1 and R 2 is each independently in each occurrence H, CH, OH, SH, or N(RN )2, R N is independently in each occurrence H, methyl, ethyl, propyl, isopropyl, butyl, or benzyl; q, q', and q'' are each independently in each occurrence 0 to 20, and the repeat units may be the same or different; n is independently in each occurrence 1 to 20; and m is independently in each occurrence 0 to 50.
[0212] In one embodiment, the linker comprises at least one cleavable linking group.
[0213] In some embodiments, the linker is a branched linker. The branch point of a branched linker may be at least trivalent, but may also be a tetravalent, pentavalent, or hexavalent atom or group exhibiting such multiple valencies. In some embodiments, the branch point is -N, -N(Q)-C, -OC, -SC, -SS-C, -C(O)N(Q)-C, -OC(O)N(Q)-C, -N(Q)C(O)-C, or -N(Q)C(O)OC, where Q is independently H or optionally substituted alkyl at each occurrence. In other embodiments, the branch point is glycerol or a glycerol derivative.
[0214] Cleavable Linking Group A cleavable linking group is one that is sufficiently stable outside a cell, but upon entering a target cell, is cleaved to release the two moieties held together by the linker. In preferred embodiments, the cleavable linking group is cleaved at least 10-fold, and preferably at least 100-fold, more rapidly within a target cell or under a first reference condition (e.g., which can be selected to mimic or represent conditions found in blood or serum) than in the subject's blood or under a second reference condition (e.g., which can be selected to mimic or represent conditions found in blood or serum). Cleavable linking groups are sensitive to cleaving agents, such as pH, redox potential, or the presence of degradative molecules. Generally, cleaving agents are more prevalent or found at higher levels or activity inside cells than in serum or blood. Examples of such degradative agents include: redox agents that are selective for a particular substrate or that do not have substrate specificity, such as oxidizing or reducing enzymes, or reducing agents present in cells, such as mercaptans, that can degrade redox-cleavable linking groups by reduction; esterases; agents that can create endosomes or acidic environments, such as those that result in a pH of 5 or less; enzymes that can hydrolyze or degrade acid-cleavable linking groups by acting as general acids, peptidases (which may be substrate-specific), and phosphatases.
[0215] Cleavable linking groups, such as disulfide bonds, may be pH-sensitive. While the pH of human serum is 7.4, the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of about 5.0. Some linkers have cleavable linking groups that are cleaved at a preferred pH, thereby releasing the cationic lipid from the ligand into the cell interior or to a desired compartment of the cell.
[0216] The linker can include a cleavable linking group that can be cleaved by a specific enzyme. The type of cleavable linking group incorporated into the linker can depend on the target cell. For example, a liver-targeting ligand can be attached to a cationic lipid via a linker containing an ester group. Liver cells are rich in esterase, so the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterase. Other cell types that are rich in esterase include lung, renal cortex, and testicular cells.
[0217] When targeting cell types that are rich in peptidases, such as hepatocytes and synovial cells, linkers containing peptide bonds can be used.
[0218] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate cleavable linking group. It may also be desirable to test the candidate cleavable linking group for its ability to resist cleavage in blood or upon contact with other non-target tissues. Thus, the relative susceptibility to cleavage between a first condition and a second condition can be determined, where the first is selected to exhibit cleavage in target cells and the second is selected to exhibit cleavage in other tissues or biological fluids, such as blood or serum. Evaluation can be performed in a cell-free system, in cells, in cell culture, in organ or tissue culture, or in whole animals. It may be useful to perform initial evaluations in cell-free or culture conditions and confirm by further evaluation in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least 2, 4, 10, or 100 times more rapidly in cells (or under in vitro conditions selected to mimic intracellular conditions) than in blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0219] Redox-cleavable linking groups One class of cleavable linking groups is redox-cleavable linking groups, which are cleaved upon reduction or oxidation. One example of a reductively cleavable linking group is a disulfide linking group (—SS—). To determine whether a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or whether it is suitable for use with, for example, a particular iRNA moiety and a particular targeting agent, one can consult the methods described herein. For example, candidates can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rate that would be observed in cells, e.g., target cells. Candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In preferred embodiments, candidate compounds are cleaved at most 10% in blood. In preferred embodiments, useful candidate compounds are degraded at least 2, 4, 10, or 100 times more rapidly in cells (or under in vitro conditions selected to mimic intracellular conditions) than in blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of a candidate compound can be determined using standard enzyme kinetic assays under conditions selected to mimic the intracellular medium and compared to conditions selected to mimic the extracellular medium.
[0220] Phosphate-Based Cleavable Linking Groups Phosphate-based cleavable linking groups are cleaved by agents that decompose or hydrolyze phosphate groups. An example of an agent that cleaves cellular phosphate groups is an enzyme such as an intracellular phosphatase. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, and -OP(S)(Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.
[0221] Acid-cleavable linking groups An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.5, or 5.0 or less) or by an agent such as an enzyme that can act as a general acid. In cells, certain low-pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for the acid-cleavable linking group. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups may have the general formula -C=NN-, C(O)O, or -OC(O). A preferred embodiment is when the carbon bonded to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.
[0222] Ester-based linking groups Ester-based cleavable linking groups are cleaved by enzymes such as intracellular esterases and amidases. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable linking groups have the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.
[0223] Peptide-Based Cleavage Groups Peptide-based cleavable linking groups are cleaved by enzymes such as intracellular peptidases and proteases. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to give rise to oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include amide groups (-C(O)NH-). Amide groups may be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to give rise to peptides and proteins. Peptide-based cleavable groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give rise to peptides and proteins, and do not include the entire amide functionality. Peptide-based cleavable linking groups have the general formula -NHCHR A C(O)NHCHR B C(O)- and R A and R B are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.
[0224] Ligand A wide variety of entities can be attached to the oligonucleotides and lipids of the invention. Preferred moieties are ligands, attached directly or indirectly through an intervening tether, preferably covalently.
[0225] In a preferred embodiment, the ligand changes the distribution, targeting or life span of the molecule into which it is incorporated. In a preferred embodiment, the ligand provides enhanced affinity to a selected target, for example, a molecule, a cell or cell type, a compartment, for example, a cell or organ compartment, a tissue, an organ, or a region of the body, compared to, for example, a species in which such a ligand is not present. A ligand that provides enhanced affinity to a selected target is also called a targeting ligand. A preferred ligand for binding to the lipid of the present invention is a targeting ligand.
[0226] Some ligands may have endosomal properties. The endosomal ligand promotes endosomal lysis and / or transport of the compositions of the present invention or their components from the endosome to the cell cytoplasm. The endosomal ligand may be a polyanionic peptide or peptidomimetic that exhibits pH-dependent membrane activity and fusogenicity. In some embodiments, the endosomal ligand is presumed to adopt its active conformation at endosomal pH. An "active" conformation is one in which the endosomal ligand promotes endosomal lysis and / or transport of the compositions of the present invention or their components from the endosome to the cell cytoplasm. Exemplary endosomal ligands include GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 2964-2972), EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586), and their derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In certain embodiments, the endosomal component may contain a chemical group (e.g., an amino acid) that undergoes a change in charge or protonation in response to a change in pH. The endosomal component may be linear or branched. Exemplary primary sequences of peptide-based endosomal ligands are shown in Table 4. [Table 3]
[0227] Preferred ligands can improve the transport, hybridization, and specificity properties, and can also improve the nuclease resistance of the resulting natural or modified oligoribonucleotides or polymer molecules comprising any combination of monomers and / or natural or modified ribonucleotides described herein.
[0228] Ligands can generally include therapeutic modifiers, e.g., to enhance uptake; diagnostic compounds or reporter groups, e.g., to monitor distribution; cross-linking agents; and nuclease-resistance-conferring moieties. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetics.
[0229] Ligands may include natural substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids, or oligonucleotides (e.g., aptamers). Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, (N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide copolymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha-helical peptides.
[0230] The ligand can also include a targeting group, such as a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody, that binds to a specified cell type, e.g., kidney cells. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetyl-gulucosamine, multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate ester, vitamin B12, biotin, RGD peptide, RGD peptidomimetic, or aptamer. Table 5 provides some examples of targeting ligands and their associated receptors. [Table 4]
[0231] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithium, and the like. acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine), and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl-substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0232] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules with specific affinity for a co-ligand, or antibodies, e.g., antibodies that bind to a specified cell type, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, or non-peptide species, such as aptamers. Ligands can be, for example, lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-κB.
[0233] The ligand can be a substance, e.g., a drug, that can increase cellular uptake of an iRNA agent, e.g., by disrupting the cytoskeleton of a cell, e.g., by disrupting cellular microtubules, microfilaments, and / or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0234] For example, a ligand can increase cellular uptake of an iRNA agent by activating an inflammatory response. Exemplary ligands that may have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma interferon.
[0235] In one embodiment, the ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand allows the conjugate to distribute to target tissues, such as non-renal target tissues in the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules capable of binding to HSA can also be used as ligands. For example, neproxin or aspirin can be used. The lipid or lipid-based ligand can (a) increase the resistance of the conjugate to degradation, (b) increase targeting and transport to target cells or cell membranes, and / or (c) be used to regulate binding to serum proteins, such as HSA.
[0236] Lipid-based ligand can be used to regulate (for example, control) the binding of conjugate to target tissue.For example, lipid or lipid-based ligand that binds more strongly to HSA is less likely to target kidney, and therefore less likely to be removed from the body.Lipid or lipid-based ligand that binds less strongly to HSA can be used to target conjugate to kidney.
[0237] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity so that the conjugate preferably distributes to non-renal tissues. However, the affinity is preferably not so strong that HSA-ligand binding is irreversible.
[0238] In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, so that the conjugate will preferably distribute to the kidney. Other moieties that target kidney cells can be used instead of or in addition to the lipid-based ligand.
[0239] In another embodiment, the ligand is a moiety, such as a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., malignant or non-malignant, such as cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low-density lipoprotein (LDL), and high-density lipoprotein (HDL).
[0240] In another embodiment, the ligand is a cell-penetrating agent, preferably a helical cell-penetrating agent. Preferably, the agent is amphipathic. Exemplary agents are peptides such as tat or antennopedia. When the agent is a peptide, modifications can be made, including peptidyl mimetics, invertomers, non-peptide or pseudo-peptide bonds, and the use of D-amino acids. Preferably, the helical agent is an alpha-helical agent, preferably having a lipophilic phase and a lipophobic phase.
[0241] The ligand may be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into defined three-dimensional structures similar to natural peptides. The peptide or peptidomimetic moiety may be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length (see, e.g., Table 6). [Table 5]
[0242] The peptide or peptidomimetic may be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety may be a dendrimeric peptide, a conformation-regulating peptide, or a cross-linked peptide. Alternatively, the peptide moiety may contain a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, which has the amino acid sequence AAVALLPAVLLALLAP. RFGF analogs containing hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP) may also be targeting moieties. The peptide moiety may also be a "delivery" peptide capable of transporting large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, the sequence (GRKKRRQRRRPPQ) derived from the HIV Tat protein and the sequence (RQIKIWFQNRRMKWKK) derived from the Drosophila Antennapedia protein have been found to function as delivery peptides. The peptide or peptidomimetic may be encoded by a random sequence of DNA, such as peptides identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptidomimetic linked to the iRNA agent by the incorporated monomer unit is a cell-targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion may have structural modifications, such as those that increase stability or direct conformational properties. Any of the structural modifications described below can be used.
[0243] The RGD peptide moiety can be used to target tumor cells, such as endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate targeting of iRNA agents to tumors in various other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Preferably, RGD peptides will facilitate targeting of iRNA agents to the kidney. RGD peptides may be linear or cyclic and may be modified, for example, glycosylated or methylated, to facilitate targeting to specific tissues. For example, glycosylated RGD peptides can be α- V iRNA agents can be delivered to tumor cells that express β3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).
[0244] Peptides can be used that target markers that are abundant on proliferating cells. For example, RGD-containing peptides and peptidomimetics target cancer cells, particularly α v Cells that display β3 integrin can be targeted. Therefore, RGD peptides, cyclic peptides containing RGD, RGD peptides containing D-amino acids, as well as synthetic RGD mimics can be used. In addition to RGD, α v Other moieties that target β3 integrin ligands can be used. Generally, such ligands can be used to control cell proliferation and angiogenesis. Preferred conjugates of this type of ligand that target PECAM-1, VEGF, or other oncogenes, e.g., oncogenes, are described herein.
[0245] A "cell-penetrating peptide" is capable of penetrating cells, e.g., microbial cells such as bacterial cells or fungal cells, or mammalian cells such as human cells. Microbial cell-penetrating peptides may be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins, or bactenecins), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidin). Cell-penetrating peptides may also contain a nuclear localization signal (NLS). For example, a cell-penetrating peptide may be a bisected amphipathic peptide such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen.
[0246] In one embodiment, the targeting peptide attached to the iRNA agent and / or carrier oligomer may be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides include, but are not limited to, cecropin, lycotoxin, paradaxin, buforin, CPF, bombinin-like peptide (BLP), cathelicidin, ceratotoxin, S. clava peptide, hagfish intestinal antimicrobial peptide (HFIAP), magainin, brevinin-2, dermaseptin, melittin, pleurocidin, H2A peptide, Xenopus peptide, esculentinis-1, and caerin. Preferably, multiple factors will be considered to maintain the integrity of helix stability. For example, a maximum number of helix-stabilizing residues (e.g., leu, ala, or lys) will be used, and a minimum number of helix-destabilizing residues (e.g., proline, or cyclic monomer units) will be used. Capping residues will be considered (e.g., Gly is an exemplary N-capping residue, and / or C-terminal amidation can be used to provide additional H-bonds to stabilize the helix). Salt bridge formation between oppositely charged residues separated at positions i±3 or i±4 can provide stability. For example, cationic residues such as lysine, arginine, homoarginine, ornithine, or histidine can form salt bridges with anionic residues such as glutamate or aspartate.
[0247] Peptide and peptidomimetic ligands include ligands comprising natural or modified peptides, e.g., D or L peptides; α, β, or γ peptides; N-methyl peptides; azapeptides; peptides with one or more amide bonds, i.e., peptide bonds, replaced by one or more urea, thiourea, carbamate, or sulfonylurea bonds; or cyclic peptides.
[0248] The targeting ligand can be any ligand capable of targeting a specific receptor. Examples include folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters such as GalNAc clusters, mannose clusters, and galactose clusters, or apatamers. A cluster is a combination of multiple sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands. The ligand can also be based on a nucleic acid, such as an aptamer. The aptamer can be unmodified or have any combination of the modifications disclosed herein.
[0249] Endosomal release agents include imidazoles, poly- or oligoimidazoles, PEI, peptides, fusogenic peptides, polycaboxylates, polycations, masked oligo- or polycations or anions, acetals, polyacetals, ketals / polyketyals, orthoesters, polymers with masked or unmasked cationic or anionic charges, dendrimers with masked or unmasked cationic or anionic charges.
[0250] PK modulator refers to a pharmacokinetic modulator. PK modulators include lipophilics, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing multiple phosphorothioate linkages are also known to bind to serum proteins. Therefore, short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g., oligonucleotides of about 5, 10, 15, or 20 bases, are also applicable as ligands (e.g., as PK-modulating ligands) in the present invention.
[0251] In addition, aptamers that bind to serum components (eg, serum proteins) are also applicable to the present invention as PK-regulating ligands.
[0252] Other ligands applicable to the present invention are described in the following co-pending U.S. patent application Ser. No. 10 / 916,185, filed Aug. 10, 2004; U.S. patent application Ser. No. 10 / 946,873, filed Sep. 21, 2004; U.S. patent application Ser. No. 10 / 833,934, filed Aug. 3, 2007; U.S. patent application Ser. No. 11 / 115,989, filed Apr. 27, 2005, and U.S. patent application Ser. No. 11 / 944,227, filed Nov. 21, 2007, which are incorporated by reference in their entireties for all purposes.
[0253] When multiple ligands are present, the ligands may all have the same properties, all may have different properties, or some may have different properties while others have the same properties, for example, the ligands may have targeting properties, may have endosomotropic activity, or may have PK modulating properties.
[0254] In preferred embodiments, the ligands all have different properties. The ligands can be attached to the oligonucleotide at various locations, for example, at the 3'-end, 5'-end, and / or internal positions. In preferred embodiments, the ligand is attached to the oligonucleotide via an intervening tether. The ligand or tethered ligand may be present on the monomer when the monomer is incorporated into a growing chain. In some embodiments, the ligand may be incorporated by being attached to a "precursor" monomer after the "precursor" monomer is incorporated into a growing chain. For example, an amino-terminated tether (i.e., no ligand attached), such as TAP-(CH2) n Monomers bearing an NH can be incorporated into a growing sense or antisense strand. In a subsequent operation, after the precursor monomer has been incorporated into the strand, a ligand bearing an electrophilic group, such as a pentafluorophenyl ester or aldehyde group, can then be attached to the precursor monomer by coupling the electrophilic group of the ligand with the terminal nucleophilic group of the tether of the precursor monomer.
[0255] In the case of double-stranded oligonucleotides, the ligand can be attached to one or both strands. In some embodiments, the double-stranded iRNA agent contains a ligand attached to the sense strand. In other embodiments, the double-stranded iRNA agent contains a ligand attached to the antisense strand.
[0256] In some embodiments, the ligand can be attached to the nucleobase, sugar moiety, or internucleoside linkage of a nucleic acid molecule. The linkage to a purine nucleobase or its derivative can occur at any position, including endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-position of a purine nucleobase is attached to a linking moiety. The linkage to a pyrimidine nucleobase or its derivative can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be substituted with a linking moiety. The linkage to the sugar moiety of a nucleoside can occur at any carbon atom. Examples of carbon atoms of the sugar moiety that can be attached to a linking moiety include the 2', 3', and 5' carbon atoms. The 1' position of an abasic residue, for example, can also be attached to a linking moiety. The internucleoside linkage can also carry a linking moiety. In the case of phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithioate, and phosphoramidate), the linking moiety can be attached directly to the phosphorus atom or to an O, N, or S atom that is attached to the phosphorus atom. In the case of amine- or amide-containing internucleoside linkages (e.g., PNA), the linking moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.
[0257] There are numerous methods for preparing conjugates of oligomeric compounds. Generally, oligomeric compounds are conjugated to conjugation moieties by contacting a reactive group (e.g., OH, SH, amine, carboxyl, aldehyde, etc.) of the oligomeric compound with a reactive group of the conjugation moiety. In some embodiments, one reactive group is electrophilic and the other is nucleophilic.
[0258] For example, the electrophilic group can be a carbonyl-containing functionality, and the nucleophilic group can be an amine or thiol. Methods for conjugating nucleic acids and related oligomeric compounds, with and without linking groups, are described in detail in literature, such as, for example, Manoharan in Antisense Research and Applications, Crooke and LeBleu, eds., CRC Press, Boca Raton, Fla., 1993, Chapter 17, which is incorporated herein by reference in its entirety.
[0259] Representative United States patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, the following: U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; and 5,414,077. No. 5,486,603; No. 5,512,439; No. 5,578,718; No. 5,608,046; No. 4,587 ,044;No.4,605,735;No.4,667,025;No.4,762,779;No.4,789,737;No.4, 824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,082,830; No. 5,112,963 No. 5,149,782; No. 5,214,136; No. 5,245,022; No. 5,254,469; No. 5,258 ,506;No.5,262,536;No.5,272,250;No.5,292,873;No.5,317,098;No.5, 371,241, No. 5,391,723; No. 5,416,203, No. 5,451,463; No. 5,510,475; No. 5,510,475; No. 5,512,667; No. 5,514,785; No. 5,565,552; No. 5,567,810; No. 5,574,142 ; Same No. 5,585,481; Same No. 5,587,371; Same No. 5,595,726; Same No. 5,597,696; Same No. 5,599,9 No. 23; No. 5,599,928; No. 5,672,662; No. 5,688,941; No. 5,714,166; No. 6,15 No. 3,737; No. 6,172,208; No. 6,300,319; No. 6,335,434; No. 6,335,437; No. 6 , 395,437; 6,444,806; 6,486,308; 6,525,031; 6,528,631;No. 6,559,279; each of which is incorporated herein by reference.
[0260] Characterization of nucleic acid-lipid particles In one embodiment, the present invention relates to a method and composition for producing lipid-encapsulated nucleic acid particles in which nucleic acid is encapsulated within a lipid layer. Such nucleic acid-lipid particles incorporating siRNA oligonucleotides are characterized using various biophysical parameters, including: (1) drug-to-lipid ratio; (2) encapsulation efficiency; and (3) particle size. A high drug-to-lipid ratio, high encapsulation efficiency, good nuclease resistance and serum stability, and controllable particle size, generally a diameter of less than 200 nm, are desirable. In addition, the properties of the nucleic acid polymer are important because nucleic acid modifications to confer nuclease resistance often only provide limited resistance but add to the cost of therapeutic drugs. Unless otherwise specified, these criteria are calculated herein as follows:
[0261] The nucleic acid to lipid ratio is the amount of nucleic acid in a specific preparation volume divided by the amount of lipid in the same volume. This can be based on moles per mole, weight per weight, or weight per mole. For the final ready-to-administer formulation, the nucleic acid:lipid ratio is calculated after removing as much external nucleic acid as possible using dialysis, chromatography, and / or enzyme (e.g., nuclease) digestion.
[0262] Encapsulation efficiency refers to the drug-to-lipid ratio of the starting mixture divided by the drug-to-lipid ratio of the final administration-qualified formulation. This is a measure of relative efficiency. For an absolute efficiency measure, the total amount of nucleic acid added to the starting mixture that ultimately becomes the administration-qualified formulation can also be calculated. The amount of lipid lost during the formulation process can also be calculated. Efficiency is a measure of formulation waste and cost.
[0263] Size refers to the size (diameter) of the particles formed. Size distribution can be determined using quasi-elastic light scattering (QELS) on a Nicomp Model 370 Submicrometer Particle Sizer. Particles less than 200 nm are preferred for distribution in vascularized (leaky) tissues, such as neoplasms and sites of inflammation.
[0264] Pharmaceutical Composition The lipid particles of the present invention, particularly when combined with a therapeutic agent, can be formulated as pharmaceutical compositions further comprising a pharmaceutically acceptable diluent, excipient, or carrier, such as, for example, saline or phosphate buffer, selected according to the route of administration and standard pharmaceutical practice.
[0265] In certain embodiments, pharmaceutical compositions comprising lipid-nucleic acid particles of the present invention are prepared by standard techniques and further comprise a pharmaceutically acceptable carrier. Generally, normal saline is used as a pharmaceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, 0.9% saline, and 0.3% glycine, which contain glycoproteins such as albumin, lipoproteins, and globulins for enhanced stability. For compositions comprising saline or other salt-containing carriers, the carrier is preferably added after lipid particle formation. Thus, after the lipid-nucleic acid composition is formed, the composition can be diluted with a pharmaceutically acceptable carrier, such as normal saline.
[0266] The resulting pharmaceutical product can be sterilized by conventional and well-known sterilization techniques.Then, the aqueous solution can be packaged for use or filtered under aseptic conditions and freeze-dried, and the freeze-dried preparation is mixed with a sterile aqueous solution before administration.The composition can contain pharmaceutically acceptable auxiliary substances required to approximate physiological conditions, such as pH adjusting agents and buffering agents and osmotic pressure adjusting agents, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc.In addition, the lipid suspension can contain a lipid protecting agent to protect lipids from free radicals and lipid peroxidation damage during storage.Lipophilic free radical quenchers, such as α-tocopherol and water-soluble iron-specific chelators such as ferrioxamine, are suitable.
[0267] The concentration of lipid particles or lipid-nucleic acid particles in pharmaceutical formulations can vary widely, i.e., less than about 0.01%, typically about 0.05-5%, or at least about 0.05-5% up to 10-30% by weight, and will be selected primarily based on fluid volume, viscosity, and the particular method of administration selected. For example, increasing the concentration can reduce the fluid load associated with treatment. This may be particularly desirable for patients with atherosclerosis-related congestive heart failure or severe hypertension. Alternatively, complexes comprised of irritating lipids can be diluted to low concentrations to reduce inflammation at the administration site. In one group of embodiments, the nucleic acid has a label attached to it and will be used for diagnosis (by indicating the presence of complementary nucleic acid). In this case, the amount of complex administered will depend on the particular label used, the disease state being diagnosed, and the clinician's judgment, but will generally be about 0.01 to about 50 mg per kilogram of body weight, preferably about 0.1 to about 5 mg per kilogram of body weight.
[0268] As discussed above, the lipid-therapeutic agent (e.g., nucleic acid) particles of the present invention may be prepared using polyethylene glycol (PEG)-modified phospholipids, PEG-ceramides, or ganglioside G. M1Modified lipids or other lipids effective in preventing or limiting aggregation may also be included. The addition of such components does not simply prevent complex aggregation. Rather, it can also increase circulation longevity and provide a means for increasing delivery of lipid-nucleic acid compositions to target tissues.
[0269] The present invention also provides lipid-therapeutic agent compositions in the form of kits. The kits will typically consist of compartmentalized containers for housing the various components of the kit. The kits will contain the particles or pharmaceutical compositions of the present invention, preferably in dehydrated or concentrated form, along with instructions for their rehydration or dilution and administration. In some embodiments, the particles include an active agent, while in other embodiments, the particles do not include an active agent.
[0270] Manufacturing method The methods and compositions of the present invention utilize specific cationic lipids, the synthesis, preparation, and characterization of which are described below or in the accompanying Examples. Additionally, the present invention provides methods for preparing lipid particles, including lipid particles conjugated to a therapeutic agent, e.g., a nucleic acid. In the methods described herein, a mixture of lipids is mixed with a buffered aqueous solution of nucleic acid to produce an intermediate mixture containing nucleic acid encapsulated in lipid particles, where the encapsulated nucleic acid is present at a nucleic acid / lipid ratio of about 3% to about 25% by weight, preferably 5% to 15% by weight. The intermediate mixture can optionally be sized to obtain lipid-encapsulated nucleic acid particles, in which the lipid portion is preferably a unilamellar vesicle having a diameter of about 30 to 150 nm, more preferably about 40 to 90 nm. The pH is then raised to neutralize at least a portion of the surface charge of the lipid-nucleic acid particles, thereby providing an at least partially surface-neutralized lipid-encapsulated nucleic acid composition.
[0271] As mentioned above, some of these cationic lipids are amino lipids that are charged at a pH below the pKa of the amino group and are essentially neutral at a pH above the pKa of the amino group. These cationic lipids are called titratable cationic lipids and can be used in the formulations of the present invention using a two-step process. First, lipid vesicles can be formed at a lower pH using titratable cationic lipids and other vesicle components in the presence of nucleic acid. In this way, the vesicles will encapsulate and capture the nucleic acid. Next, the surface charge of the newly formed vesicles can be neutralized by increasing the pH of the medium to a level above the pKa of the titratable cationic lipid, i.e., above physiological pH. Particularly advantageous aspects of this process include both the easy removal of any surface-adsorbed nucleic acid and the resulting nucleic acid delivery vehicle with a neutral surface. Liposomes or lipid particles with a neutral surface are expected to avoid rapid clearance from the circulation and avoid certain toxicities associated with cationic liposome formulations. Further details regarding the use of such titratable cationic lipids in the formulation of nucleic acid-lipid particles are provided in U.S. Pat. No. 6,287,591 and U.S. Pat. No. 6,858,225, which are incorporated herein by reference.
[0272] It is further noted that the vesicles thus formed provide formulations with a high nucleic acid content and uniform vesicle size, with the vesicles having a size ranging from about 30 to about 150 nm, more preferably from about 30 to about 90 nm.
[0273] Without intending to be bound by any particular theory, it is believed that the highly efficient encapsulation of nucleic acids is the result of electrostatic interactions at low pH. At acidic pH (e.g., pH 4.0), the vesicle surface is charged and binds to a portion of the nucleic acid through electrostatic interactions. When the external acidic buffer is exchanged for a more neutral buffer (e.g., pH 7.5), the surface of the lipid particles or liposomes is neutralized, allowing for the removal of any external nucleic acid. More detailed information on the formulation process is provided in various publications (e.g., U.S. Patent No. 6,287,591 and U.S. Patent No. 6,858,225).
[0274] In view of the above, the present invention provides methods for preparing lipid / nucleic acid formulations. In the methods described herein, a mixture of lipids is mixed with a buffered aqueous solution of nucleic acid to produce an intermediate mixture containing nucleic acid encapsulated in lipid particles, e.g., the encapsulated nucleic acid is present at a nucleic acid / lipid ratio of about 10% to about 20% by weight. The intermediate mixture can be optionally sized to obtain lipid-encapsulated nucleic acid particles, in which the lipid portion is preferably unilamellar vesicles with a diameter of 30 to 150 nm, more preferably about 40 to 90 nm. The pH is then raised to neutralize at least a portion of the surface charge of the lipid-nucleic acid particles, thereby providing an at least partially surface-neutralized lipid-encapsulated nucleic acid composition.
[0275] In certain embodiments, the lipid mixture comprises at least two lipid components: a first lipid component of the invention selected from lipids having pKas such that the lipid is cationic at pHs below its pKa and neutral at pHs above its pKa, and a second lipid component selected from lipids that prevent particle aggregation during lipid-nucleic acid particle formation. In certain embodiments, the amino lipid is a novel cationic lipid of the invention.
[0276] When preparing the nucleic acid-lipid particles of the present invention, the lipid mixture is typically a lipid solution in an organic solvent.Then, this lipid mixture can be dried to form a thin film or freeze-dried to form a powder before being hydrated with an aqueous buffer solution to form liposomes.Alternatively, in a preferred method, the lipid mixture can be solubilized in a water-miscible alcohol such as ethanol, and adding this ethanolic solution to an aqueous buffer solution will cause spontaneous liposome formation.In most embodiments, alcohol is used in the form that it is commercially available.For example, ethanol can be used as absolute ethanol (100%) or 95% ethanol, with the remainder being water.This method is described in more detail in U.S. Patent No. 5,976,567.
[0277] In one exemplary embodiment, the lipid mixture is a mixture of cationic lipids, neutral lipids (other than the cationic lipids), a sterol (e.g., cholesterol), and a PEG-modified lipid (e.g., PEG-DMG or PEG-DMA) in an alcohol solvent. In a preferred embodiment, the lipid mixture consists essentially of cationic lipids, neutral lipids, cholesterol, and a PEG-modified lipid in an alcohol, more preferably ethanol. In a further preferred embodiment, a first solution consists essentially of the lipid mixture described above, in a molar ratio of about 20-70% cationic lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15% PEG-modified lipid. In yet a further preferred embodiment, the first solution consists essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, more preferably in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0278] According to the present invention, the lipid mixture is mixed with an aqueous buffer solution, which may contain nucleic acids. The aqueous buffer solution is typically a solution in which the buffer has a pH below the pKa of the protonatable lipid in the lipid mixture. Examples of suitable buffers include citrate, phosphate, acetate, and MES. A particularly preferred buffer is citrate buffer. Preferred buffers have an anion range of 1-1000 mM, depending on the chemistry of nucleic acid encapsulation, and optimization of the buffer concentration may be important to achieve high loading levels (see, e.g., U.S. Pat. Nos. 6,287,591 and 6,858,225). Alternatively, purified water acidified to pH 5-6 with chloride or sulfate may be useful. In this case, it may be appropriate to dialyze the particles to remove ethanol, increase the pH, or add 5% glucose or another non-ionic solute, which will balance the osmotic potential across the particle membrane when mixed with a pharmaceutically acceptable carrier such as normal saline. The amount of nucleic acid in the buffer may vary, but will typically be from about 0.01 mg / mL to about 200 mg / mL, more preferably from about 0.5 mg / mL to about 50 mg / mL.
[0279] A mixture of lipids and a buffered aqueous solution of therapeutic nucleic acid are mixed to provide an intermediate mixture. The intermediate mixture is typically a mixture of lipid particles with encapsulated nucleic acid. In addition, the intermediate mixture may contain some nucleic acid bound to the surface of the lipid particles (liposomes or lipid vesicles) due to ionic attraction between the negatively charged nucleic acid and the positively charged lipids on the lipid particle surface (the amino lipid or other lipids constituting the first protonatable lipid component are positively charged in a buffer having a pH below the pKa of the protonatable group of the lipid). In one group of preferred embodiments, the mixture of lipids is an alcoholic solution of lipids, and the volume of each solution is adjusted upon mixing so that the resulting alcohol content is about 20% to about 45% by volume. The method of mixing the mixture can include any of a variety of processes and often depends on the scale of the formulation to be produced. For example, if the total volume is about 10-20 mL or less, the solutions can be mixed in a test tube and stirred together using a vortex mixer. Large-scale processes can be carried out in suitable production-scale glassware.
[0280] Optionally, lipid-encapsulated therapeutic agent (e.g., nucleic acid) complexes, produced by mixing a buffered aqueous solution of the lipid mixture and therapeutic agent (e.g., nucleic acid), can be sized to achieve a desired size range and a relatively narrow lipid particle size distribution. Preferably, the compositions provided herein can be sized to an average diameter of about 70 to about 200 nm, more preferably about 90 to about 130 nm. Several techniques can be used to size liposomes to the desired size. One sizing method is described in U.S. Pat. No. 4,737,323, incorporated herein by reference. Sonication of a liposome suspension, either by bath sonication or probe sonication, progressively reduces the size to small unilamellar vesicles (SUVs) less than about 0.05 micrometers in size. Homogenization is another method that relies on shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, multilamellar vesicles are recirculated through a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 micrometers, is observed. In both methods, particle size distribution can be monitored by conventional laser-beam particle size determination. In the case of the particular method herein, an extrusion method is used to obtain uniform vesicle sizes.
[0281] By extruding the liposome composition through a small-pore polycarbonate membrane or an asymmetric ceramic membrane, a relatively well-defined particle size distribution is obtained. Typically, the suspension is circulated through the membrane one or more times until the desired liposome complex particle size distribution is achieved. Liposomes can be extruded through successively smaller pore membranes to achieve a stepwise reduction in liposome size. In some cases, the lipid-nucleic acid composition formed can be used without any sizing.
[0282] In certain embodiments, the method of the present invention further comprises a step of neutralizing at least some of the surface charge of the lipid portion of the lipid-nucleic acid composition. By at least partially neutralizing the surface charge, unencapsulated nucleic acid is released from the lipid particle surface and can be removed from the composition using conventional techniques. Preferably, unencapsulated surface-adsorbed nucleic acid is removed from the resulting composition by buffer exchange. For example, replacing citrate buffer (about pH 4.0, used to form the composition) with HEPES-buffered saline (HBS, pH about 7.5) solution results in neutralization of the liposome surface and release of nucleic acid from the surface. The released nucleic acid can then be removed by chromatography using standard methods, followed by switching to a buffer with a pH above the pKa of the lipid used.
[0283] Optionally, lipid vesicles (i.e., lipid particles) can be formed by hydration in an aqueous buffer and sized using one of the methods described above before the addition of nucleic acid. As described above, the aqueous buffer should have a pH below the pKa of the amino lipid. A nucleic acid solution can then be added to these sized, preformed vesicles. To enable nucleic acid encapsulation into such "preformed" vesicles, the mixture should contain an alcohol, such as ethanol. In the case of ethanol, it should be present at a concentration of about 20% (w / w) to about 45% (w / w). In addition, it may be necessary to warm the mixture of preformed vesicles and nucleic acid in the aqueous buffer-ethanol mixture to a temperature of about 25°C to about 50°C, depending on the composition of the lipid vesicles and the nature of the nucleic acid. It will be apparent to those skilled in the art that optimizing the encapsulation process to achieve the desired level of nucleic acid in the lipid vesicles requires manipulating variables such as ethanol concentration and temperature. Examples of conditions suitable for nucleic acid encapsulation are provided in the Examples. Once the nucleic acid is encapsulated within the preformed vesicles, the external pH can be raised to at least partially neutralize the surface charge, after which unencapsulated surface-adsorbed nucleic acid can be removed as described above.
[0284] How to use The lipid particles of the present invention can be used to deliver therapeutic agents to cells in vitro or in vivo. In certain embodiments, the therapeutic agent is a nucleic acid that is delivered to cells using the nucleic acid-lipid particles of the present invention. The following description of various methods using the lipid particles and related pharmaceutical compositions of the present invention is exemplified by descriptions of nucleic acid-lipid particles, but it is understood that these methods and compositions can be easily adapted to the delivery of any therapeutic agent to treat any disease or disorder that may benefit from such treatment.
[0285] In some embodiments, the present invention provides methods for introducing nucleic acids into cells. Preferred nucleic acids for introduction into cells are siRNAs, immunostimulatory oligonucleotides, plasmids, antisense oligonucleotides, and ribozymes. These methods can be carried out by contacting the particles or compositions of the present invention with cells for a period of time sufficient for intracellular delivery to occur.
[0286] The compositions of the present invention can be adsorbed to almost any cell type. Upon adsorption, the nucleic acid-lipid particles can either be endocytosed by a portion of the cell, exchange lipids with the cell membrane, or fuse with the cell. The translocation or uptake of the nucleic acid portion of the complex can occur via any one of these pathways. While not intending to limit the scope of the present invention, it is believed that in the case of particles taken up by cells via endocytosis, the particles subsequently interact with the endosomal membrane, possibly resulting in destabilization of the endosomal membrane through the formation of a non-bilayer phase, leading to the introduction of the encapsulated nucleic acid into the cytoplasm. Similarly, if the particles fuse directly with the cell plasma membrane, upon fusion, the liposome membrane is integrated into the cell membrane and the liposomal contents mix with the intracellular fluid. Contact of the cells with the lipid-nucleic acid composition, when performed in vitro, will occur in a biologically compatible medium. The concentration of the composition can vary widely depending on the particular application, but is generally from about 1 μM to about 10 mM. In one embodiment, treatment of cells with lipid-nucleic acid compositions will generally be carried out at physiological temperatures (about 37°C) for about 1 to 24 hours, preferably about 2 to 8 hours. For in vitro applications, delivery of nucleic acids can be to any cells grown in culture, and the cells can be of plant or animal origin, vertebrate or invertebrate origin, and of any tissue or type. In a preferred embodiment, the cells will be animal cells, more preferably mammalian cells, and most preferably human cells.
[0287] In one group of embodiments, the lipid-nucleic acid particle suspension comprises about 10 3 ~about 10 5 cells / mL, more preferably about 2 x 10 4 The suspension is added to 60-80% confluent plated cells having a cell density of 1000 cells / mL. The concentration of the suspension added to the cells is preferably about 0.01-20 μg / mL, more preferably about 1 μg / mL.
[0288] In another embodiment, the lipid particles of the present invention can be used to deliver nucleic acids to cells or cell lines (e.g., tumor cell lines). Non-limiting examples of such cell lines include HELA (ATCC Cat N: CCL-2), KB (ATCC Cat N: CCL-17), HEP3B (ATCC Cat N: HB-8064), SKOV-3 (ATCC Cat N: HTB-77), HCT-116 (ATCC Cat N: CCL-247), HT-29 (ATCC Cat N: HTB-38), PC-3 (ATCC Cat N: CRL-1435), A549 (ATCC Cat N: CCL-185), and MDA-MB-231 (ATCC Cat N: HTB-26).
[0289] Typical applications include knocking down or silencing specific cellular targets using well-known procedures for providing intracellular delivery of siRNA. Alternatively, applications include delivery of DNA or mRNA sequences encoding therapeutically useful polypeptides. In this way, treatment of genetic diseases by providing defective gene products or by not providing gene products (e.g., for Duchenne dystrophy, see Kunkel, et al., Brit. Med. Bull. 45(3):630-643 (1989) and for cystic fibrosis, see Goodfellow, Nature 341:102-103 (1989)) is provided. Other uses of the compositions of the present invention include introducing antisense oligonucleotides into cells (see Bennett, et al., Mol. Pharm. 41:1023-1033 (1992)).
[0290] Alternatively, the compositions of the present invention can be used to deliver nucleic acids to cells in vivo using methods known to those skilled in the art.For the delivery of DNA or mRNA sequences, the intravenous delivery of cytomegalovirus (CMV)-chloramphenicol acetyltransferase (CAT) expression plasmid using DOTMA-DOPE complexes is described in Zhu et al., Science 261:209-211 (1993), which is incorporated herein by reference.Hyde et al., Nature 362:250-256 (1993), which is incorporated herein by reference, describes the delivery of the cystic fibrosis transmembrane conductance regulator (CFTR) gene to the pulmonary airway epithelium and alveoli of mice using liposomes. Brigham, et al., Am. J. Med. Sci. 298:278-281 (1989), incorporated herein by reference, describes the in vivo transfection of mouse lungs with a functional prokaryotic gene encoding the intracellular enzyme chloramphenicol acetyltransferase (CAT). Thus, the compositions of the present invention can be used to treat infectious diseases.
[0291] For in vivo administration, the pharmaceutical composition is preferably administered parenterally, i.e., intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly. In certain embodiments, the pharmaceutical composition is administered intravenously or intraperitoneally by bolus injection. For an example, see U.S. Patent No. 5,286,634 to Stadler et al., which is incorporated herein by reference. Intracellular nucleic acid delivery is also discussed in Straubringer, et al., Methods in Enzymology, Academic Press, New York. 101:512-527 (1983); Mannino, et al., Biotechniques 6:682-690 (1988); Nicolau, et al., Crit. Rev. Ther. Drug Carrier Syst. 6:239-271 (1989), and Behr, Acc. Chem. Res. 26:274-278 (1993). Still other methods of administering lipid-based therapeutics are described, for example, in Rahman et al., U.S. Pat. No. 3,993,754; Sears, U.S. Pat. No. 4,145,410; Papahadjopoulos et al., U.S. Pat. No. 4,235,871; Schneider, U.S. Pat. No. 4,224,179; Lenk et al., U.S. Pat. No. 4,522,803; and Fountain et al., U.S. Pat. No. 4,588,578.
[0292] Alternatively, pharmaceutical agents may be contacted with target tissue by applying the formulation directly to the tissue. Application may be topical, "open," or "closed" procedures. "Topical" refers to application of the pharmaceutical agent directly to tissues exposed to the environment, such as the skin, oropharynx, and ear canal. An "open" procedure involves incising the patient's skin and directly visualizing the underlying tissue to which the pharmaceutical agent is to be applied. This is typically accomplished through a surgical procedure, such as a thoracotomy to access the lungs, a laparotomy to access the abdominal organs, or other direct surgical access to the target tissue. A "closed" procedure is an invasive procedure in which the internal target tissue is not directly visualized but is accessed by inserting instruments through a small wound in the skin. For example, the formulation can be administered to the peritoneum by needle lavage. Similarly, pharmaceutical agents can be administered to the meninges or spinal cord by intravenous infusion during a lumbar puncture followed by appropriate positioning of the patient for spinal anesthesia or spinal metrazamide imaging, as is commonly done. Alternatively, the formulation can be administered through an endoscopy device.
[0293] Lipid-nucleic acid compositions can also be administered by aerosol inhaled into the lungs (see Brigham, et al., Am. J. Sci. 298(4):278-281 (1989)) or by direct injection at the site of disease (Culver, Human Gene Therapy, MaryAnn Liebert, Inc., Publishers, New York. pp.70-71 (1994)).
[0294] The methods of the present invention can be practiced in a variety of hosts, with preferred hosts including mammalian species such as humans, non-human primates, dogs, cats, cattle, horses, and sheep.
[0295] Dosage of the lipid-therapeutic agent particles of the present invention will depend on the ratio of lipid to therapeutic agent and the opinion of the prescribing physician based on the age, weight, and condition of the patient.
[0296] In one embodiment, the present invention provides methods for modulating the expression of a target polynucleotide or polypeptide. These methods generally involve contacting cells with lipid particles of the present invention that are linked to a nucleic acid capable of modulating the expression of the target polynucleotide or polypeptide. As used herein, the term "modulate" refers to altering the expression of a target polynucleotide or polypeptide. In different embodiments, modulation can mean increasing or enhancing, or decreasing or reducing. Methods for measuring the expression level of a target polynucleotide or polypeptide are known and available in the art, including, for example, methods using reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry. In certain embodiments, the expression level of a target polynucleotide or polypeptide is increased or decreased by at least 10%, 20%, 30%, 40%, 50%, or more than 50% compared to an appropriate control value.
[0297] For example, if increased polypeptide expression is desired, the nucleic acid may be an expression vector containing a polynucleotide encoding the desired polypeptide. On the other hand, if decreased polynucleotide or polypeptide expression is desired, the nucleic acid may be, for example, an antisense oligonucleotide, siRNA, or microRNA containing a polynucleotide sequence that specifically hybridizes with a polynucleotide encoding a target polypeptide, thereby disrupting expression of the target polynucleotide or polypeptide. Alternatively, the nucleic acid may be a plasmid that expresses such an antisense oligonucleotide, siRNA, or microRNA.
[0298] In a specific embodiment, the present invention provides a method for modulating the expression of a polypeptide by a cell, comprising providing to the cell lipid particles consisting or consisting essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, wherein the lipid particles are associated with a nucleic acid capable of modulating the expression of the polypeptide. In a specific embodiment, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol % cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0299] In certain embodiments, the therapeutic agent is selected from an siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing an siRNA, a microRNA, or an antisense oligonucleotide, wherein the siRNA, microRNA, or antisense RNA comprises a polynucleotide or its complement that specifically binds to a polynucleotide encoding a polypeptide, thereby reducing expression of the polypeptide.
[0300] In other embodiments, the nucleic acid is a plasmid that encodes the polypeptide or a functional variant or fragment thereof, such that expression of the polypeptide or a functional variant or fragment thereof is increased.
[0301] In related embodiments, the invention includes a method of treating a disease or disorder characterized by overexpression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the invention, wherein the therapeutic agent is selected from an siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing the siRNA, microRNA, or antisense oligonucleotide, and wherein the siRNA, microRNA, or antisense RNA comprises a polynucleotide or a complement thereof that specifically binds to a polynucleotide encoding the polypeptide.
[0302] In one embodiment, the pharmaceutical composition comprises lipid particles consisting essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, wherein the lipid particles are conjugated with a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0303] In another related embodiment, the invention includes a method of treating a disease or disorder characterized by underexpression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the invention, wherein the therapeutic agent is a plasmid encoding the polypeptide or a functional variant or fragment thereof.
[0304] In one embodiment, the pharmaceutical composition comprises lipid particles consisting essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, wherein the lipid particles are conjugated with a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0305] The present invention further provides a method for inducing an immune response in a subject, the method comprising providing a pharmaceutical composition of the present invention to the subject, wherein the therapeutic agent is an immunostimulatory oligonucleotide. In some embodiments, the immune response is a humoral or mucosal immune response. In one embodiment, the pharmaceutical composition comprises lipid particles consisting of or consisting essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, wherein the lipid particles are conjugated with a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.
[0306] In a further embodiment, the pharmaceutical composition is provided to a subject in combination with a vaccine or antigen. Thus, the present invention provides vaccines comprising the lipid particles of the present invention, which themselves comprise an immunostimulatory oligonucleotide and are also conjugated to an antigen to which an immune response is desired. In certain embodiments, the antigen is a tumor antigen or associated with an infectious agent, such as a virus, bacteria, or parasite.
[0307] Various tumor antigens, infectious agent antigens, and antigens associated with other diseases are well known in the art, and examples are described in the references cited herein. Examples of antigens suitable for use in the present invention include, but are not limited to, polypeptide antigens and DNA antigens. Specific examples of antigens are hepatitis A, hepatitis B, smallpox, polio, anthrax, influenza, typhoid, tetanus, measles, rotavirus, diphtheria, pertussis, tuberculosis, and rubella antigens. In a preferred embodiment, the antigen is a recombinant hepatitis B antigen. In another aspect, the antigen is a recombinant hepatitis A antigen. In another aspect, the antigen is a tumor antigen. Examples of such tumor-associated antigens are MUC-1, EBV antigen, and Burkitt's lymphoma-associated antigen. In a further aspect, the antigen is a recombinant tyrosinase-related protein tumor antigen antigen. Those skilled in the art will be aware of other antigens suitable for use in the present invention.
[0308] Tumor-associated antigens suitable for use in the subject invention include both mutated and non-mutated molecules that may represent a single tumor type, may be shared by several types of tumors, and / or may be exclusively expressed or overexpressed in tumor cells compared with normal cells. In addition to proteins and glycoproteins, tumor-specific patterns of expression of carbohydrates, gangliosides, glycolipids, and mucins have also been described. Exemplary tumor-associated antigens for use in the subject cancer vaccines include protein products of oncogenes, tumor suppressor genes, and other genes with mutations or rearrangements unique to tumor cells, reactivated embryonic gene products, oncofetal antigens, tissue-specific (but not tumor-specific) differentiation antigens, growth factor receptors, cell surface carbohydrate residues, foreign viral proteins, and numerous other self proteins.
[0309] Specific embodiments of tumor-associated antigens include, for example, mutated antigens such as the Ras p21 proto-oncogene, the tumor suppressor p53, and the BCR-abl oncogene, and the protein products of CDK4, MUM1, caspase 8, and beta-catenin; overexpressed antigens such as galectin 4, galectin 9, carbonic anhydrase, aldolase A, PRAME, Her2 / neu, ErbB-2, and KSA; oncofetal antigens such as alpha-fetoprotein (AFP), human chorionic gonadotropin (hCG); Mart 1 / Melan autoantigens such as carcinoembryonic antigen (CEA) and melanocyte differentiation antigens such as A, gp100, gp75, tyrosinase, TRP1, and TRP2; prostate-associated antigens such as PSA, PAP, PSMA, PSM-P1, and PSM-P2; reactivated embryonic gene products such as MAGE1, MAGE3, MAGE4, GAGE1, GAGE2, BAGE, RAGE, and other cancer-testis antigens such as NY-ESO1, SSX2, and SCP1; mucins such as Muc-1 and Muc-2; gangliosides such as GM2, GD2, and GD3, neutral glycolipids and glycoproteins such as Lewis(y) and globo-H; and glycoproteins such as Tn, Thompson-Freidenreich antigen (TF), and sTn. Also included herein as tumor-associated antigens are whole cells and tumor cell lysates, and immunogenic portions thereof, as well as immunoglobulin idiotypes expressed in monoclonal proliferations of B lymphocytes for use against B-cell lymphomas.
[0310] Pathogens include, but are not limited to, infectious agents, such as viruses, that infect mammals, and more particularly humans. Examples of infectious viruses include, but are not limited to, the following: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also known as HTLV-III, LAV, or HTLV-III / LAV, or HIV-III; and other isolates such as HIV-LP); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis virus, rubella virus); Flaviridae (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronoviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Phylloviridae Family Mycoviridae (e.g., Ebola virus); Family Paramyxoviridae (e.g., parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Family Orthomyxoviridae (e.g., influenza virus); Family Bungaviridae (e.g., hantavirus, bungavirus, phlebovirus, and nairovirus); Family Arenaviridae (hemorrhagic fever viruses); Family Reoviridae (e.g., reovirus, orbivirus, and rotavirus); Family Birnaviridae; Family Hepadnaviridae (hepatitis B virus); Family Parvoviridae (parvovirus); Family Papovaviridae (papillomavirus, polyomavirus); Family Adenoviridae (most adenoviruses); Family Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpesvirus); Family Poxviridae (smallpox virus, vaccinia virus, poxvirus); and Family Iridoviridae (e.g., African swine fever virus).and unclassifiable viruses (e.g., agents of spongiform encephalopathy, agents of delta hepatitis (thought to be a defective satellite of hepatitis B virus), agents of non-A, non-B hepatitis (Class I = internally transmitted; Class 2 = parenterally transmitted (i.e., hepatitis C)); Norwalk and related viruses, and astroviruses);
[0311] Gram-negative and Gram-positive bacteria also serve as antigens in vertebrates. Such Gram-positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram-negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include, but are not limited to, Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria species (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes, pyogenes (group A Streptococcus), Streptococcus agalactiae (group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species, Enterococcus species, Haemophilus influenzaeinfluenzae, Bacillus antracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia, and Actinomyces israelli.
[0312] Further examples of pathogens include, but are not limited to, infectious fungi that infect mammals, more specifically humans, including, but not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. Examples of infectious parasites include malaria parasites such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax. Other infectious organisms (i.e., protists) include Toxoplasma gondii. In one embodiment, the formulations of the present invention can be used to silence or modulate target genes, including, but not limited to, FVII, Eg5, PCSK9, TPX2, apoB, SAA, TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene, MEKK gene, JNK gene, RAF gene, Erk1 / 2 gene, PCNA (p21) gene, MYB gene, JUN gene, FOS gene, BCL-2 gene, and cytochrome P450 gene. Clin D gene, VEGF gene, EGFR gene, cyclin A gene, cyclin E gene, WNT-1 gene, beta-catenin gene, c-Met gene, PKC gene, NFKB gene, STAT3 gene, survivin gene, Her2 / Neu gene, SORT1 gene, XBP1 gene, topoisomerase I gene, topoisomerase II alpha gene, p73 gene, p21(WAF1 / CIP1) gene, p27(KIP1) gene, PPM1D gene, RAS gene, caveolin I gene, MIB I gene, MTAI gene, M68 gene, tumor suppressor gene, p53 tumor suppressor gene, p53 family member DN-p63, pRb tumor suppressor gene, APC1 tumor suppressor gene, BRCA1 tumor suppressor gene, PTEN tumor suppressor gene, mLL fusion gene, BCR / ABL fusion gene, TEL / AML1 fusion gene, EW / FLI1 fusion gene, TLS / FUS1 fusion gene, PAX3 / FKHR fusion gene, AML1 / ETO fusion gene, alpha v-integrin gene, Flt-1 receptor gene, tubulin gene, human papillomavirus gene, human papillomavirus replication genes required for hepatitis A virus replication, human immunodeficiency virus genes, genes required for human immunodeficiency virus replication, hepatitis A virus genes, genes required for hepatitis A virus replication, hepatitis B virus genes, genes required for hepatitis B virus replication, hepatitis C virus genes, genes required for hepatitis C virus replication, hepatitis D virus genes, genes required for hepatitis D virus replication, hepatitis E virus genes, genes required for hepatitis E virus replication, hepatitis F virus genes, genes required for hepatitis F virus replication, hepatitis G virus genes, genes required for hepatitis G virus replication, hepatitis H virus genes,Genes required for hepatitis H virus replication, Respiratory syncytial virus genes, Genes required for respiratory syncytial virus replication, Herpes simplex virus genes, Genes required for herpes simplex virus replication, Herpes cytomegalovirus genes, Genes required for herpes cytomegalovirus replication, Herpes Epstein-Barr virus genes, Genes required for herpes Epstein-Barr virus replication, Kaposi's sarcoma-associated herpesvirus genes, Genes required for Kaposi's sarcoma-associated herpesvirus replication, JC virus genes, Human genes required for JC virus replication, Myxovirus genes, Genes required for myxovirus gene replication, Rhinovirus genes, Genes required for rhinovirus replication, Coronavirus genes, Genes required for coronavirus replication, West Nile virus genes, West Nile virus Genes required for virus replication, St. Louis encephalitis genes, Genes required for St. Louis encephalitis replication, Tick-borne encephalitis virus genes, Genes required for tick-borne encephalitis virus replication, Murray Valley encephalitis virus genes, Genes required for Murray Valley encephalitis virus replication, Dengue virus genes, Genes required for dengue virus replication, Simian virus 40 genes, Genes required for simian virus 40 replication, Human T-cell lymphotropic virus genes, Genes required for human T-cell lymphotropic virus replication, Moloney murine leukemia virus genes, Genes required for Moloney murine leukemia virus replication, Encephalomyocarditis virus genes, Genes required for encephalomyocarditis virus replication, Measles virus genes, Genes required for measles virus replication, Varicella zoster (Vericella zoster) virus gene, gene required for varicella-zoster virus replication, adenovirus gene, gene required for adenovirus replication, yellow fever virus gene, gene required for yellow fever virus replication, poliovirus gene, gene required for poliovirus replication, poxvirus gene, gene required for poxvirus replication, Plasmodium gene, gene required for Plasmodium gene replication, Mycobacterium ulcerans gene, gene required for Mycobacterium ulcerans replication, Mycobacterium tuberculosis gene, gene required for Mycobacterium tuberculosis gene, Mycobacterium leprae gene, gene required for Mycobacterium leprae replication, Staphylococcus aureus gene, gene required for Staphylococcus aureus replication, Streptococcus pneumoniae gene,Genes required for Streptococcus pneumoniae replication, Streptococcus pyogenes genes, genes required for Streptococcus pyogenes replication, Chlamydia pneumoniae genes, genes required for Chlamydia pneumoniae replication, Mycoplasma pneumoniae genes, genes required for Mycoplasma pneumoniae replication, integrin genes, selectin genes, complement system genes, chemokine genes, chemokine receptor genes, GCSF genes, Gro1 genes, Gro2 genes, Gro3 genes, PF4 gene, MIG gene, proplatelet basic protein gene, MIP-1I gene, MIP-1J gene, RANTES gene, MCP- 1 gene, MCP-2 gene, MCP-3 gene, CMBKR1 gene, CMBKR2 gene, CMBKR3 gene, CMBKR5v, AIF-1 gene, I-309 gene, genes for components of ion channels, genes for neurotransmitter receptors, genes for neurotransmitter ligands, amyloid family genes, presenilin genes, HD gene, DRPLA gene, SCA1 gene, SCA2 gene, MJD1 gene, CACNL1A4 gene, SCA7 gene, SCA8 gene, alleles found in LOH cells, or one allele of a polymorphic gene.
[0313] definition "Alkyl" means a straight-chain or branched, acyclic or cyclic saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms. Representative saturated straight-chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, and n-hexyl; representative saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, and isopentyl. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl; representative unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl.
[0314] "Alkenyl" refers to an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyl includes both cis and trans isomers. Representative straight-chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, and 2,3-dimethyl-2-butenyl.
[0315] "Alkynyl" means any alkyl or alkenyl as defined above further containing at least one triple bond between adjacent carbons. Representative straight-chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, and 3-methyl-1 butynyl.
[0316] The term "acyl" refers to a carbonyl group substituted with hydrogen, alkyl, partially saturated or fully saturated cycloalkyl, partially saturated or fully saturated heterocycle, aryl, and heteroaryl. For example, acyl includes (C1-C20)alkanoyl (e.g., formyl, acetyl, propionyl, butyryl, valeryl, caproyl, t-butylacetyl, etc.), (C3-C20)cycloalkylcarbonyl (e.g., cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, etc.), heterocyclic carbonyl (e.g., pyrrolidinylcarbonyl, pyrrolid-2-one-5-carbonyl, etc.), and the like. thiophenyl-2-carbonyl, thiophenyl-3-carbonyl, furanyl-2-carbonyl, furanyl-3-carbonyl, 1H-pyrroyl-2-carbonyl, 1H-pyrroyl-3-carbonyl, benzo[b]thiophenyl-2-carbonyl, and the like.
[0317] The term "aryl" refers to an aromatic monocyclic, bicyclic, or tricyclic hydrocarbon ring system, in which any ring atom may be substituted. Examples of aryl moieties include, but are not limited to, phenyl, naphthyl, anthracenyl, and pyrenyl.
[0318] "Heterocycle" means a 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic ring that is either saturated, unsaturated, or aromatic and contains one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the nitrogen and sulfur heteroatoms are optionally oxidized and the nitrogen heteroatom is optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be bonded via any heteroatom or carbon atom. Heterocycle includes heteroaryl, as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperidinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, and tetrahydrothiopyranyl, and the like.
[0319] The term "heteroaryl" refers to an aromatic 5- to 8-membered monocyclic, 8- to 12-membered bicyclic, or 11- to 14-membered tricyclic ring system having 1 to 3 heteroatoms in the monocyclic ring, 1 to 6 heteroatoms in the bicyclic ring, or 1 to 9 heteroatoms in the tricyclic ring, wherein the heteroatoms are selected from O, N, or S (e.g., carbon atoms and 1 to 3, 1 to 6, or 1 to 9 N, O, or S heteroatoms in the monocyclic, bicyclic, or tricyclic ring, respectively), wherein any ring atom may be optionally substituted. The heteroaryl groups described herein can also contain fused rings that share a common carbon-carbon bond. The term "alkylheterocyle" refers to a heteroaryl in which at least one of the ring atoms is substituted with an alkyl, alkenyl, or alkynyl.
[0320] The term "substituted" refers to the replacement of one or more hydrogen radicals of a given structure with the radical of a specified substituent, including, but not limited to, halo, alkyl, alkenyl, alkynyl, aryl, heterocyclyl, thiol, alkylthio, oxo, thioxy, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl, carboxyalkyl, alkoxycarbonylalkyl, aminocarbonylalkyl, acyl, aralkoxycarbonyl, carboxylic acid, sulfonic acid, sulfonyl, phosphonic acid, aryl, heteroaryl, heterocyclic, and aliphatic. It is understood that a substituent may be further substituted. Exemplary substituents include amino, alkylamino, dialkylamino, and cyclic amino compounds.
[0321] "Halogen" means fluoro, chloro, bromo, and iodo.
[0322] The terms "alkylamine" and "dialkylamine" refer to -NH(alkyl) and -N(alkyl)2 radicals, respectively.
[0323] The term "alkyl phosphate" refers to -OP(Q')(Q'')-OR, where Q' and Q'' are each independently O, S, N(R), optionally substituted alkyl, or alkoxy, and R is optionally substituted alkyl, ω-aminoalkyl, or ω-(substituted)aminoalkyl.
[0324] The term "alkylphosphorothioate" refers to an alkyl phosphate where at least one of Q' or Q'' is S.
[0325] The term "alkylphosphonate" refers to an alkyl phosphate where at least one of Q' or Q'' is alkyl.
[0326] The term "hydroxyalkyl" refers to an --O-alkyl radical.
[0327] The term "alkylheterocycle" refers to an alkyl in which at least one methylene is replaced with a heterocycle.
[0328] The term "ω-aminoalkyl" refers to an -alkylNH radical, and the term "ω-(substituted)aminoalkyl" refers to an ω-aminoalkyl in which at least one of the H or N is replaced with an alkyl.
[0329] The term "ω-phosphoalkyl" refers to -alkyl-OP(Q')(Q'')-OR, where Q' and Q'' are each independently O or S, and R is an optionally substituted alkyl.
[0330] The term "ω-thiophosphoalkyl" refers to an ω-phosphoalkyl where at least one of Q' or Q'' is S.
[0331] In some embodiments, the methods of the present invention may require the use of protecting groups. Protecting group methods are well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, TW et. al., Wiley-Interscience, New York City, 1999). Briefly, a protecting group in the context of the present invention is any group that reduces or eliminates undesired reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during a specific reaction and then removed to restore the original functional group. In some embodiments, an "alcohol protecting group" is used. An "alcohol protecting group" is any group that reduces or eliminates undesired reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.
[0332] The compounds of the invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples.
[0333] Examples Example 1: Synthesis of methanesulfonic acid octadeca-9,12-dienyl ester 2 Scheme 1 [ka] To a solution of alcohol 1 (26.6 g, 100 mmol) in dichloromethane (100 mL), triethylamine (13.13 g, 130 mmol) was added, and the solution was cooled in an ice bath. To this cooled solution, a solution of mesyl chloride (12.6 g, 110 mmol) in dichloromethane (60 mL) was added dropwise. After the addition was complete, the reaction mixture was warmed to ambient temperature and stirred overnight. TLC of the reaction mixture indicated completion. The reaction mixture was diluted with dichloromethane (200 mL), washed with water (200 mL), saturated NaHCO3 (200 mL), brine (100 mL), and dried (NaSO4). The organic layer was concentrated to give the crude product, which was purified by column chromatography (silica gel) using 0–10% Et2O in hexanes. The pure product fractions were combined and concentrated to give the pure product 2 (30.6 g, 89%) as a colorless oil. 1 H NMR (CDCl3, 400MHz) δ=5.42~5.21(m, 4H), 4.20(t, 2H), 3.06(s, 3H), 2.79(t, 2H), 2.19~2.00(m, 4H), 1.90~1.70(m, 2H), 1.06~1.18(m, 18H), 0.88(t, 3H). 13 C NMR(CDCl3)δ=130.76, 130.54, 128.6, 128.4, 70.67, 37.9, 32.05, 30.12, 29 .87, 29.85, 29.68, 29.65, 29.53, 27.72, 27.71, 26.15, 25.94, 23.09, 14.60. MS:C 19 H 36 Calculated molecular weight of O3S: Calculated value 344.53, Measured value 343.52 (MH - ).
[0334] Synthesis of 18-bromooctadeca-6,9-diene 3 Mesylate 2 (13.44 g, 39 mmol) was dissolved in anhydrous ether (500 mL) and MgBr.EtO complex (30.7 g, 118 mmol) was added under argon. The mixture was refluxed under argon for 26 h, after which TLC showed the reaction was complete. The reaction mixture was diluted with ether (200 mL), ice water (200 mL) was added to the mixture, and the layers were separated. The organic layer was washed with 1% aqueous KCO (100 mL), brine (100 mL), and dried (anhydrous NaSO). The organic layer was concentrated to give the crude product, which was purified by column chromatography (silica gel) using 0–1% EtO in hexane to isolate bromo 3 (12.6 g, 94%) as a colorless oil. 1 H NMR (CDCl3, 400MHz) δ=5.41~5.29(m, 4H), 4.20(d, 2H), 3.40(t, J=7Hz, 2H), 2.77(t, J=6.6 Hz, 2H), 2.09~2.02(m, 4H), 1.88~1.00(m, 2H), 1.46~1.27(m, 18H), 0.88(t, J=3.9Hz, 3H). 13 C NMR(CDCl3)δ=130.41, 130.25, 128.26, 128.12, 34.17, 33.05, 31.75, 29.8 2, 29.57, 29.54, 29.39, 28.95, 28.38, 27.42, 27.40, 25.84, 22.79, 14.28.
[0335] Synthesis of 18-cyanooctadeca-6,9-diene 4 To a solution of the mesylate (3.44 g, 10 mmol) in ethanol (90 mL), a solution of KCN (1.32 g, 20 mmol) in water (10 mL) was added, and the mixture was refluxed for 30 min. After which, TLC of the reaction mixture indicated completion of the reaction. Ether (200 mL) was then added to the reaction mixture, followed by water. The reaction mixture was extracted with ether, and the combined organic layers were washed with water (100 mL), brine (200 mL), and dried. Concentration of the organic layer afforded the crude product, which was purified by column chromatography (0–10% EtO in hexanes). The pure product 4 was isolated as a colorless oil (2 g, 74%). 1H NMR (CDCl3, 400MHz) δ=5.33~5.22(m, 4H), 2.70(t, 2H), 2.27~2.23(m, 2H), 2.00~1.95(m, 4H), 1.61~1.54(m, 2H), 1.39~1.20(m, 18H), 0.82(t, 3H). 13 C NMR(CDCl3)δ=130.20, 129.96, 128.08, 127.87, 119.78, 70.76, 66.02, 32.52, 29.82, 29.57, 29.33, 29.24, 29.19, 29.12, 28.73, 28.65, 27.20, 27.16, 25.62, 25.37, 22.56, 17.10, 14.06. MS:C 19 H 33 Calculated molecular weight of N: Calculated value 275.47, Measured value 276.6 (MH - ).
[0336] Synthesis of heptatriaconta-6,9,28,31-tetraen-19-one 7 Freshly activated Mg turnings (0.144 g, 6 mmol) were added to a flame-dried 500 mL 2NRB flask and fitted with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with argon, and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 3 (1.65 g, 5 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, 2 mg of iodine was added, and immediate discoloration was observed, confirming the formation of the Grignard reagent), and the ether reflux was initiated. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) was dissolved in anhydrous ether (20 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed, and the reaction mixture was stirred at ambient temperature overnight. The reaction was quenched by the dropwise addition of 10 mL of acetone followed by ice-cold water (60 mL). The reaction mixture was treated with aqueous H2SO4 (10% by volume, 200 mL) until the solution was homogeneous and the layers were separated. The aqueous phase was extracted with ether (2 x 100 mL). The combined ether layers were dried (Na2SO4) and concentrated to give the crude product, which was purified by column chromatography (silica gel, 0-10% ether in hexane). Evaporation of the pure product fractions gave the pure ketone 7 as a colorless oil (2 g, 74%). 1 H NMR (CDCl3, 400MHz) δ=5.33~5.21(m, 8H), 2.69(t, 4H), 2.30(t, 4H), 2.05~1.95(m, 8H), 1.55~1.45(m, 2H), 1.35~1.15(m, 18H), 0.82(t, 3H). 13 C NMR(CDCl3)δ=211.90, 130.63, 130.54, 128.47, 128.41, 43.27, 33.04, 32. 01, 30.93, 29.89, 29.86, 29.75, 29.74, 27.69, 26.11, 24.35, 23.06, 14.05. MS:C 37 H 66 Calculated molecular weight of O: Calculated value 526.92, Found value 528.02 (M+H + ).
[0337] Example 2. Alternative synthesis of ketone 7 Scheme 2 [ka] Synthesis of compound 6b Freshly activated Mg turnings (2.4 g, 100 mmol) were added to a flame-dried 500 mL RB flask and fitted with a magnetic stir bar, an addition funnel, and a reflux condenser. The apparatus was degassed and vented with argon, and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 3 (26.5 g, 80.47 mmol) was dissolved in anhydrous ether (50 mL) and added to the addition funnel. Approximately 5 mL of this ether solution was added to the Mg turnings with vigorous stirring. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, 5 mg of iodine was added, and immediate discoloration was observed, confirming the formation of the Grignard reagent), and the ether reflux was initiated. The remainder of the bromide solution was added dropwise while maintaining the reaction at a gentle reflux by cooling the flask in water. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled in an ice bath. Ethyl formate (2.68 g, 36.2 mmol) was dissolved in anhydrous ether (40 mL), transferred to an addition funnel, and added dropwise to the stirring reaction mixture. An exothermic reaction was observed, and the reaction mixture began to reflux. After the reaction began, the remainder of the ethereal formic acid solution was added rapidly as a stream, and the reaction mixture was stirred at ambient temperature for an additional 1 h. The reaction was quenched by the dropwise addition of 10 mL of acetone, followed by ice-cold water (60 mL). The reaction mixture was treated with aqueous H2SO4 (10% by volume, 300 mL) until the solution became homogeneous and the layers separated. The aqueous phase was extracted with ether (2 × 100 mL). The combined ether layers were dried (Na2SO4) and concentrated to give the crude product, which was purified by column chromatography (silica gel, 0–10% ether in hexane). Concentration of the slightly less polar fractions gave the formate 6a (1.9 g) and evaporation of the pure product fractions gave the pure product 6b as a colorless oil (14.6 g, 78%).
[0338] Synthesis of compound 7 To a solution of alcohol 6b (3 g, 5.68 mmol) in CHCl (60 mL) was added freshly activated 4A molecular sieves (50 g). Powdered PCC (4.9 g, 22.7 mmol) was added portionwise over a 20 min period. The mixture was stirred for an additional 1 h. (Note: Prolonged reaction times are associated with lower yields, so careful reaction monitoring is necessary to obtain good yields.) TLC of the reaction mixture was then performed every 10 min (5% ether in hexanes). After completion of the reaction, the reaction mixture was filtered through a pad of silica gel, and the residue was washed with CHCl (400 mL). The filtrate was concentrated, and the crude product thus obtained was further purified by column chromatography (silica gel, 1% EtO in hexanes) to isolate pure product 7 (2.9 g, 97%) as a colorless oil. 1 H NMR (CDCl3, 400MHz) δ=5.33~5.21(m, 8H), 2.69(t, 4H), 2.30(t, 4H), 2.05~1.95(m, 8H), 1.55~1.45(m, 2H), 1.35~1.15(m, 18H), 0.82(t, 3H). 13 C NMR(CDCl3)δ=211.90, 130.63, 130.54, 128.47, 128.41, 43.27, 33.04, 32. 01, 30.93, 29.89, 29.86, 29.75, 29.74, 27.69, 26.11, 24.35, 23.06, 14.05. MS:C 37 H 66 Calculated molecular weight of O: Calculated value 526.92, Found value 528.02 (M+H + ).
[0339] Example 3. Synthesis of unsymmetrical ketones 25 and 27 Scheme 3 [ka] Synthesis of heptatriaconta-6,9,28-trien-19-one 25 Freshly activated Mg turnings (132 mg, 0.0054 mmol) were added to a dry 50 mL 2NRB flask and fitted with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with nitrogen, and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 24 (1.8 g, 0.0054 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane), and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled to 10–15 °C in an ice bath. Cyanide 4 (0.5 g, 0.0018 mmol) was dissolved in dry THF (5 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed, and the reaction mixture was refluxed (at 70 °C) for 12 h before being quenched with ammonium chloride solution. The solution was then treated with 25% HCl solution until it became homogeneous and the layers were separated. The aqueous phase was extracted with ether (2 x 100 mL). The combined ether layers were dried and concentrated to give the crude product, which was purified by column chromatography. Evaporation of the pure product fractions gave the pure ketone 25 as a colorless oil. Yield: 0.230 g (24%). 1 H-NMR (CDCl3, 400MHz): δ=5.37~5.30(m, 6H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H) , 2.05~1.95 (m, 8H), 1.56~1.52 (m, 4H), 1.35~1.25 (m, aliphatic proton), 0.89~0.85 (t, 6H). IR(cm-1):2924, 2854, 1717, 1465, 1049, 721.
[0340] Synthesis of heptatriaconta-6,9-dien-19-one 27 Freshly activated Mg turnings (0.144 g, 6 mmol) were added to a flame-dried 500 mL 2NRB flask and fitted with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with argon, and 10 mL of anhydrous ether was added to the flask via syringe. Commercially available bromide 26 (2.65 g, 5 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask via syringe. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) was dissolved in anhydrous ether (20 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed, and the reaction mixture was stirred overnight at ambient temperature. The reaction was quenched by the dropwise addition of 10 mL of acetone followed by ice-cold water (60 mL). The reaction mixture was treated with aqueous HSO (10% by volume, 200 mL) until the solution was homogeneous and the layers were separated. The aqueous phase was extracted with ether (2 × 100 mL). The combined ether layers were dried (NaSO) and concentrated to give the crude product, which was purified by column chromatography to give pure ketone 27 as a colorless oil. H-NMR (CDCl, 400 MHz): δ = 5.42–5.30 (m, 4H), 2.79–2.78 (t, 2H), 2.40–2.37 (t, 4H), 2.08–2.03 (m, 4H), 1.58–1.54 (m, 4H), 1.36–1.26 (br m, aliphatic protons), 0.91–0.87 (t, 6H). IR(cm-1):2924, 2854, 1716, 1465, 1375, 721.
[0341] Example 4.C 12 Synthesis of unsymmetrical chain-linked ketones Scheme 4 [ka] Freshly activated Mg turnings (175 mg, 0.0072 mmol) were added to a dry 50 mL 2NRB flask and fitted with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with nitrogen, and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 28 (1.5 g, 0.006 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane), and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled to 10–15 °C in an ice bath. Cyanide 4 (1 g, 0.0036 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed, and the reaction mixture was refluxed for 12 h before being quenched with ammonium chloride solution. The solution was then treated with 25% HCl solution until it became homogeneous and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to give the crude product, which was purified by column chromatography. Evaporation of the pure product fractions gave the pure ketone 29 as a colorless oil. Yield: 0.65 g (26%). 1 H~NMR(δppm): 5.388~5.302(m, 4H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H), 2.04~2.01(m, 4H), 1.34~1.18(m, 36H), 0.89~0.85(m, 6H). IR(cm -1 ):3009, 2920, 2851, 1711(C=O), 1466, 1376, 1261.
[0342] Example 5.C 10 Synthesis of unsymmetrical chain-linked ketone 31 Scheme 5 [ka] Freshly activated Mg turnings (266 mg, 0.0109 mmol) were added to a dry 50 mL 2NRB flask and fitted with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with nitrogen, and 10 mL of anhydrous ether was added to the flask via syringe. Bromide (2.43 g, 0.0109 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane), and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35 °C for 1 h and then cooled to 10–15 °C in an ice bath. Cyanide (1 g, 0.0036 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed, and the reaction mixture was stirred at ambient temperature for 2 h. THF (4 mL) was added to the reaction mixture, which was then warmed to 45-50°C for 4 hours until the cyano derivative was completely consumed. The reaction was quenched by adding 3 mL of acetone, followed by ice-cold water, dropwise. The reaction mixture was then treated with 25% HCl solution until the solution became homogeneous and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to give the crude product, which was purified by column chromatography. Evaporation of the pure product fractions gave the pure ketone as a colorless oil. Yield: 0.93 g (61%). 1 H-NMR (δppm): 5.37~5.302(m, 4H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H), 2 .05~2.00(m, 4H), 1.55~1.52(m, 2H), 1.35~1.24(m, 34H), 0.89~0.84(m6H). IR(cm -1 ):3009, 2925, 2854, 1717(C=O), 1465, 1376.
[0343] Example 6. Synthesis of cholesterol-bearing asymmetric ketone 33 Scheme 6 [ka] Using a procedure similar to that used for the synthesis of ketone 31, cholesteryl chloride was converted to the corresponding magnesium chloride followed by addition to linoleyl cyanide to give ketone 33.
[0344] Example 7. Synthesis of cholesterol-bearing asymmetric ketone 35 Scheme 7 [ka] Treatment of cholesterol chloroformate with 3-bromopropylamine gave bromide 34, which was converted to the corresponding Grignard reagent 34a, which, upon treatment with linoleyl cyanide, gave the corresponding unsymmetrical ketone 35 in good yield.
[0345] Example 8. Synthesis of unsymmetrical ketone 40 Scheme 8 [ka]
[0346] Synthesis of compound 37 To a 500 mL two-necked RBF containing LiAlH (1.02 g, 0.0269 mol) was added anhydrous THF (20 mL) at room temperature under a nitrogen atmosphere. The suspension was stirred at room temperature for 1 h and then cooled to 0 °C. To this mixture, a solution of compound 1 (5 g, 0.01798 mol) in anhydrous THF (50 mL) was slowly added while maintaining the internal temperature at 0 °C. After the addition was complete, the reaction mixture was warmed to ambient temperature and stirred for 1 h. The reaction progress was monitored by TLC. Upon completion of the reaction, the mixture was cooled to 0 °C and quenched with saturated aqueous NaSO. The reaction mixture was stirred for 30 min, and the solid that formed was filtered through a celite bed and washed with ethyl acetate (100 mL). The filtrate and washings were combined and evaporated on a rotary evaporator to give compound 37 as a colorless liquid, which was used directly in the next step without any purification. Yield: (4.5 g, 95%) 1H NMR (400MHz, CDCl3)δ=5.39~5.28(m, 6H), 3.64~3.61(t, 2H), 2.81~2.78(t, 4H), 2 .10~2.01(m, 4H), 1.59~1.51(m, 2H), 1.29~1.22(m, aliphatic proton), 0.98~0.94(t, 3H).
[0347] Synthesis of compound 38 Compound 37 (14 g, 0.0530 mol) was dissolved in DCM (300 mL) in a 500 mL two-neck RBF and cooled to 0 °C. To this solution, triethylamine (29.5 mL, 0.2121 mol) was slowly added under an inert atmosphere. The reaction mixture was then stirred for 10-15 minutes, and to it, mesyl chloride (6.17 mL, 0.0795 mol) was slowly added. After the addition was complete, the reaction mixture was allowed to warm to ambient temperature and stirred for 20 hours. The reaction was monitored by TLC. Upon completion, the reaction mixture was diluted with water (200 mL), stirred for several minutes, and the organic layer was separated. The organic phase was further washed with brine (1 × 70 mL), dried over NaSO, and the solvent was removed on a rotary evaporator to give crude compound 38 as a brown oil, which was used directly in the next reaction. Yield: (17 g, 93%). 1 H NMR (400MHz, CDCl3)δ=5.39~5.31(m, 6H), 4.22~4.19(t, 2H), 2.99(s, 3H), 2.81~2.78(m , 4H), 2.08~2.01(m, 4H), 1.75.1.69(m, 2H), 1.39~1.29(m, aliphatic proton), 0.98~0.94(t, 3H).
[0348] Synthesis of compound 39 Mesylate 38 (10 g, 0.2923 mol) was dissolved in anhydrous ether (300 mL) in a 1000 mL two-neck RBF and MgBr. EtO complex (22.63 g, 0.0877 mol) was added to it under a nitrogen atmosphere. The resulting mixture was then heated to reflux for 26 h. After completion of the reaction (by TLC), the reaction mixture was diluted with ether (300 mL) and ice water (200 mL), and the ether layer was separated. The organic layer was then washed with 1% aqueous KCO (100 mL) and then brine (80 mL). The organic phase was then dried over anhydrous NaSO, and the solvent was evaporated under reduced pressure to give the crude material, which was chromatographed on silica gel (60-120 mesh) using 0-1% ethyl acetate in hexane as the eluent to give the desired compound 39 as an oil. Yield: (7 g, 73%). 1 H NMR (400MHz, CDCl3)δ=5.39~5.31(m, 6H), 3.41~3.37(t, 2H), 2.81~2.78(m, 4H), 2 .08~2.02(m, 4H), 1.86~1.80(m, 2H), 1.42~1.29(m, aliphatic proton), 0.98~0.94(t, 3H).
[0349] Synthesis of unsymmetrical ketone 40 Freshly activated Mg turnings (0.88 g, 0.03636 mol) were added to a flame-dried 500 mL two-neck RBF equipped with a magnetic stir bar and reflux condenser. The apparatus was degassed and vented with argon, and ether (150 mL) was added. The reaction was initiated by the initial addition of a few drops of bromo compound 4 (11.89 g, 0.03636 mol) in 50 mL of ether. (Note: A catalytic amount of 1,2-dibromoethane was also added to accelerate the formation of the Grignard reagent.) At the start of the reaction, the remaining solution of the bromo compound was slowly added to the refluxing ether solution. After the addition was complete, the reaction mixture was refluxed at 40 °C for 1.5 h. It was then cooled to 10 °C, and linoleyl cyanide 4 (5 g, 0.01818 mol) in 30 mL of dry ether was added dropwise. The resulting mixture was then heated to reflux at 40 °C for 20 h. The progress of the reaction was monitored by TLC. After complete consumption of the cyano derivative 40 (by TLC), the mixture was cooled to room temperature and quenched with 30 mL of acetone, followed by ice-water (50 mL). The solution was further acidified with 10% HCl solution, and the ether layer was separated. The aqueous phase was further extracted with diethyl ether (2 × 100 mL). After drying over anhydrous NaSO, the solvent was removed to give the crude ketone, which was purified by silica gel column chromatography (100–200 mesh) using 0–5% ether in hexane as the eluent to give the title compound 40 as a pale yellow oil. Yield: (4.8 g, 50.5%). 1 H NMR (400MHz, CDCl3)δ=5.38~5.28(m, 10H), 2.80~2.74(m, 6H), 2.38~2.34(t, 4H), 2.08~2.0 0(m, 8H), 1.55~1.52(m, 4H), 1.35~1.26(m, aliphatic proton), 0.98~0.94(t, 3H), 0.89~0.85(t, 3H). HPLC-98.04%.
[0350] Example 9. Oligonucleotide Synthesis: All oligonucleotides were synthesized on an AKTA oligopilot synthesizer. Oligonucleotides were synthesized using RNA phosphoramidites with standard protecting groups: 5'-O-dimethoxytrityl-N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-ON, N'-diisopropyl-2-cyanoethyl phosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-ON, N'-diisopropyl-2-cyanoethyl phosphoramidite, 5'-O-dimethoxytrityl-N2-isobutryl-2'-t-butyldimethylsilyl-guanosine-3'-ON, N'-diisopropyl-2-cyanoethyl phosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-ON, N'-diisopropyl-2-cyanoethyl phosphoramidite (Pierce Nucleic Acids). Technologies). 2'-F phosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-fluro-cytidine-3'-ON,N'-diisopropyl-2-cyanoethyl-phosphoramidite, and 5'-O-dimethoxytrityl-2'-fluro-uridine-3'-ON,N'-diisopropyl-2-cyanoethyl-phosphoramidite were purchased from Promega. All phosphoramidites were used at 0.2 M concentration in acetonitrile (CH3CN) except for guanosine, which was used at 0.2 M concentration in 10% THF / ANC (vol / vol). A 16 min coupling / recycle time was used. The activating agent was 5-ethylthiotetrazole (0.75 M, American International Chemicals), and for PO oxidation, iodine / water / pyridine was used, and for PS oxidation, PADS (2%) in 2,6-lutidine / ACN (1:1 vol / vol) was used.
[0351] 3'-ligand-linked chains were synthesized using solid supports containing the corresponding ligands. For example, the introduction of cholesterol units into the sequence was carried out using hydroxyprolinol-cholesterol phosphoramidite. Cholesterol was attached to trans-4-hydroxyprolinol via a 6-aminohexanoate bond to obtain the hydroxyprolinol-cholesterol moiety. 5'-Terminal Cy-3 and Cy-5.5 (fluorophore)-labeled siRNAs were synthesized using the corresponding Quasar-570 (Cy-3) phosphoramidites purchased from Biosearch Technologies. Attachment of ligands to the 5'-terminus or internal positions was achieved using appropriately protected ligand-phosphoramidite building blocks by long-term coupling of a 0.1 M phosphoramidite solution in anhydrous CH3CN to the solid-bound oligonucleotide for 15 minutes in the presence of 5-(ethylthio)-1H-tetrazole activator. Oxidation of internucleotide phosphites to phosphate esters was performed using standard iodine-water as reported (1) or by treating the coupled oligonucleotides with tert-butyl hydroperoxide / acetonitrile / water (10:87:3) with a 10-minute oxidation wait time. Phosphorothioates were introduced by oxidation of phosphites to phosphorothioates using sulfur transfer reagents such as DDTT (purchased from AM Chemicals), PADS, or Beaucage reagent. Cholesterol phosphoramidite was synthesized in-house and used at a concentration of 0.1 M in dichloromethane. The coupling time for cholesterol phosphoramidite was 16 minutes.
[0352] After synthesis was completed, the support was transferred to a 100 mL glass bottle (VWR). The oligonucleotides were cleaved from the support while simultaneously deprotecting the base and phosphate groups using 80 mL of an ethanolic ammonia mixture [ammonia:ethanol (3:1)] at 55°C for 6.5 hours. The bottle was briefly cooled on ice, after which the ethanolic ammonia mixture was filtered into a new 250 mL bottle. The CPG was washed with 2 × 40 mL volumes of ethanol / water (1:1 v / v). The volume of the mixture was then reduced to approximately 30 mL using a roto-vap. The mixture was then frozen in a dyne and dried under reduced pressure using a speed vac.
[0353] The dry residue was resuspended in 26 mL of triethylamine, triethylamine trihydrofluoride (TEA.3HF), or pyridine-HF and DMSO (3:4:6) and heated to 60 °C for 90 min to remove the tert-butyldimethylsilyl (TBDMS) group at the 2'-position. The reaction was then quenched with 50 mL of 20 mM sodium acetate, the pH was adjusted to 6.5, and the mixture was stored in a freezer until purification.
[0354] Oligonucleotides are analyzed by high performance liquid chromatography (HPLC) before purification, with the choice of buffer and column depending on the sequence and / or the nature of the attached ligand.
[0355] Ligand-conjugated oligonucleotides were purified by preparative reverse-phase HPLC. Unconjugated oligonucleotides were purified by anion-exchange HPLC on a TSK gel column packed in-house. The buffers were 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (Buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN, 1 M NaBr (Buffer B). Fractions containing full-length oligonucleotides were pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted oligonucleotide was diluted with water to 150 μl and then pipetted into specialized vials for CGE and LC / MS analysis. Compounds were finally analyzed by LC-ESMS and CGE.
[0356] For siRNA preparation, equimolar amounts of sense and antisense strands were heated to 95°C for 5 minutes in 1x PBS and slowly cooled to room temperature. The integrity of the duplex was confirmed by HPLC analysis. [Table 6]
[0357] Example 10: Serum stability assay of siRNA An initial sequence-based stability selection medium-throughput assay was performed using the "total staining" method. To perform the assay, siRNA duplexes were incubated in 90% human serum at 37°C. Samples of the reaction mixture were quenched at various time points (0, 15, 30, 60, 120, and 240 min) and subjected to electrophoretic analysis (Figure 1). RNA cleavage over time provided information about the susceptibility of the siRNA duplexes to serum nuclease degradation.
[0358] Radiolabeled dsRNA and serum stability assays were used to further characterize siRNA cleavage events. First, either the sense or antisense strand of the siRNA duplex was cleaved. 32 The 5'-ends were labeled with P. The labeled siRNA duplexes were incubated with 90% human serum at 37°C, and samples of the solution were removed at time intervals to quench the reaction. The samples were analyzed by electrophoresis.
[0359] Example 11: In vivo evaluation of FVII using liposomes derived from cationic lipids In vivo rodent factor VII and ApoB silencing experiments. C57BL / 6 mice (Charles River Labs, Massachusetts) and Sprague-Dawley rats (Charles River Labs, Massachusetts) received either saline or siRNA in the desired formulation via tail vein injection at a volume of 0.01 mL / g. At various time points post-dose, animals were anesthetized by isofluorane inhalation, and blood was collected by retro-orbital bleeding into serum separator tubes. Serum levels of factor VII protein in the samples were determined using a chromogenic assay (Coaset Factor VII, DiaPharma Group, Ohio, or Biophen FVII, Aniara Corporation, Ohio) according to the manufacturer's protocol. A standard curve was generated using serum collected from saline-treated animals. For experiments evaluating liver mRNA levels, animals were sacrificed at various time points post-dose, and livers were harvested and flash-frozen in liquid nitrogen. Frozen liver tissue was ground into a powder. Tissue lysates were prepared and hepatic mRNA levels of Factor VII and apoB were determined using a branched DNA assay (QuantiGene Assay, Panomics, CA).
[0360] Example 12. Preparation of 1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-DMG) [ka] Preparation of IVa 1,2-Di-O-tetradecyl-sn-glyceride Ia (30 g, 61.80 mmol) and N,N'-succinimidylcarbonate (DSC, 23.76 g, 1.5 equiv.) were combined in dichloromethane (DCM, 500 mL) and stirred on an ice-water mixture. Triethylamine (TEA, 25.30 mL, 3 equiv.) was added to the stirred solution, and the reaction mixture was then stirred overnight at ambient temperature. The progress of the reaction was monitored by TLC. The reaction mixture was diluted with DCM (400 mL), and the organic layer was washed with water (2 × 500 mL) and aqueous NaHCO3 (500 mL), followed by standard workup. The resulting residue was dried under high vacuum at ambient temperature overnight. The crude carbonate IIa thus obtained was dried, then dissolved in dichloromethane (500 mL), and stirred on an ice bath. To this stirred solution, mPEG 2000 -NH2 (III, 103.00 g, 47.20 mmol, purchased from NOF Corporation, Japan) and anhydrous pyridine (Py, 80 mL, excess) were added under argon. The reaction mixture was then stirred at ambient temperature overnight. The solvent and volatiles were removed under reduced pressure, and the residue was dissolved in DCM (200 mL) and loaded onto a silica gel column packed with ethyl acetate. The column was eluted first with ethyl acetate and then with a 5-10% methanol gradient in dichloromethane to afford the desired PEG-lipid IVa as a white solid (105.30 g, 83%). 1 H NMR (CDCl3, 400MHz) δ=5.20~5.12(m, 1H), 4.18~4.01(m, 2H), 3.80~3.70(m, 2H), 3.70~3.20(m, -O-CH2-CH2-O-, PEG-CH2), 2.10~2.01(m, 2H), 1.70~1.60(m, 2H), 1.56~1.45(m, 4H), 1.31~1.15(m, 48H), 0.84(t, J=6.5Hz, 6H). MS actual value range: 2660~2836.
[0361] Preparation of IVb 1,2-Di-O-hexadecyl-sn-glyceride Ib (1.00 g, 1.848 mmol) and DSC (0.710 g, 1.5 equiv.) were combined in dichloromethane (20 mL) and cooled to 0 °C in an ice-water mixture. Triethylamine (1.00 mL, 3 equiv.) was added, and the reaction was stirred overnight. The reaction was monitored by TLC, diluted with DCM, washed with water (twice), NaHCO3 solution, and dried over sodium sulfate. The solvent was removed under reduced pressure, and the resulting residue of IIb was kept under high vacuum overnight. This compound was used directly in the next reaction without further purification. MPEG 2000 -NHIII (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and IIb (0.702 g, 1.5 equiv.) were dissolved in dichloromethane (20 mL) under argon. The reaction was cooled to 0 °C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by TLC. The solvent and volatiles were removed under reduced pressure, and the residue was purified by chromatography (initial ethyl acetate, then 5-10% MeOH / DCM as gradient elution) to give the desired compound IVb as a white solid (1.46 g, 76%). 1 H NMR (CDCl3, 400MHz) δ=5.17(t, J=5.5Hz, 1H), 4.13(dd, J=4.00Hz, 11.00Hz, 1H), 4.05(dd, J=5.00Hz, 11.00Hz, 1H), 3.82~3.75(m, 2H), 3.7 0~3.20(m, -O-CH2-CH2-O-, PEG-CH2), 2.05~1.90(m, 2H), 1.80~1.70(m, 2H), 1.61~1.45(m, 6H), 1.35~1.17(m, 56H), 0.85(t, J=6.5Hz, 6H). MS actual value range: 2716~2892.
[0362] Preparation of IVc 1,2-Di-O-octadecyl-sn-glyceride Ic (4.00 g, 6.70 mmol) and DSC (2.58 g, 1.5 eq.) were combined in dichloromethane (20 mL) and cooled to 0°C with an ice-water mixture. Triethylamine (2.75 mL, 3 eq.) was added and the reaction was stirred overnight. The reaction was monitored by TLC, diluted with DCM, washed with water (twice), NaHCO3 solution, and dried over sodium sulfate. The solvent was removed under reduced pressure, and the residue was kept under high vacuum overnight. This compound was used directly in the next reaction without further purification. MPEG 2000 -NH2III (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and IIc (0.760 g, 1.5 equiv.) were dissolved in dichloromethane (20 mL) under argon. The reaction was cooled to 0 °C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by TLC. The solvent and volatiles were removed under reduced pressure, and the residue was purified by chromatography (ethyl acetate, followed by 5-10% MeOH / DCM as gradient elution) to give the desired compound IVc as a white solid (0.92 g, 48%). 1 H NMR (CDCl3, 400MHz) δ=5.22~5.15(m, 1H), 4.16(dd, J=4.00Hz, 11.00Hz, 1H), 4.06(dd, J=5.00Hz, 11.00Hz, 1H), 3.81~3.75(m, 2 H), 3.70~3.20(m, -O-CH2-CH2-O-, PEG-CH2), 1.80~1.70(m, 2H), 1.60~1.48(m, 4H), 1.31~1.15(m, 64H), 0.85(t, J=6.5Hz, 6H). MS actual value range: 2774~2948.
[0363] Example 13: [ka] Synthesis of 2005: To a solution of 2004 (50 g, 95 mmol) in DCM (400 mL) under an Ar atmosphere, TEA (53 mL, 378 mmol) and DMAP (1.2 g, 9.5 mmol) were added and stirred at room temperature under an Ar atmosphere. The reaction was cooled to -5 °C, and a solution of mesyl chloride (15 mL, 190 mmol) in DCM (100 mL) was added slowly at a temperature below -5 °C and allowed to warm to room temperature after the addition. After 30 min (TLC), the reaction was quenched with ice-cold water (20 mL). The organic layer was separated, washed with 1 N HCl (30 mL), water, brine, dried over sodium sulfate, and evaporated under reduced pressure to give the pure product (55 g, 95.5%) as a yellow liquid. 1H NMR (400MHz, CDCl3): δ0.89(t, 6H, J=6.8), 1.2~1.5(m, 36H), 1.67(m, 4H), 2.05(q, 8H, J1=6.8, J2=6.8), 2.77(t, 4H, J=6.4), 2.99(s, 3H), 4.71(m, 1H), and 5.36(m, 8H).
[0364] Synthesis 2006: To a solution of 2005 (50 g, 82 mmol) in DMF (500 mL) under an argon atmosphere, NaN (27 g, 410 mmol) was added and heated to 70 °C, maintaining that temperature for 4 h (TLC). The mixture was diluted with water and extracted with ethyl acetate (3 × 250 mL). The organic layer was washed with water, brine, dried over NaSO, and evaporated under reduced pressure to give the crude product, which was purified by silica gel chromatography using hexane / ethyl acetate as the eluent. The product was eluted with 2% ether in hexane to give 2006 (36 g, 86%) as a pale yellow liquid. 1 H NMR (400MHz, CDCl3): δ0.90(t, 8H), 1.30(m, 36H), 1.49(t, 4H, J=6.4Hz), 2.0 4(q, 8H, J1=7.6, J2=14Hz), 2.77(t, 4H, J=6.4Hz), 3.22(m, 1H), 5.34(m, 8H). 13 C NMR (400 MHz, CDCl): δ 14.1, 22.5, 25.6, 26.1, 27.2, 29.2, 29.3, 29.45, 29.65, 31.5, 34.1, 63.1, 127.9, and 130.1. IR (KBr): 2098.
[0365] Example 14 siRNA Formulation Using Preformed Vesicles Particles containing cationic lipids were fabricated using a preformed vesicle method. Cationic lipids, DSPC, cholesterol, and PEG lipids were solubilized in ethanol at a molar ratio of 40 / 10 / 40 / 10, respectively. The lipid mixture was added to a buffered aqueous solution (50 mM citric acid, pH 4) to final ethanol and lipid concentrations of 30% (vol / vol) and 6.1 mg / mL, respectively, and allowed to equilibrate at room temperature for 2 minutes before extrusion. The hydrated lipids were extruded through two stacked 80 nm pore size filters (Nuclepore) at 22°C using a Lipex Extruder (Northern Lipids, Vancouver, BC) until vesicle diameters of 70–90 nm were obtained, as determined by Nicomp analysis. This typically required one to three passes. For some cationic lipid mixtures that did not form small vesicles, hydrating the lipid mixture in a lower pH buffer (50 mM citric acid, pH 3) to protonate the phosphate groups of the DSPC headgroups helped to form stable 70–90 nm vesicles.
[0366] FVII siRNA (solubilized in 50 mM citric acid, pH 4, aqueous solution containing 30% ethanol) was added to vesicles pre-equilibrated to 35°C with mixing at a rate of approximately 5 mL / min. After a final target siRNA / lipid ratio of 0.06 (wt / wt) was achieved, the mixture was incubated at 35°C for an additional 30 min to allow vesicle reconstitution and encapsulation of FVII siRNA. The ethanol was then removed, and the external buffer was replaced with PBS (155 mM NaCl, 3 mM NaHPO, 1 mM KHPO, pH 7.5) by either dialysis or tangential flow diafiltration. The final encapsulated siRNA-to-lipid ratio was determined after removing unencapsulated siRNA using a size-exclusion or ion-exchange spin column.
[0367] Example 15: In vivo determination of the efficacy of novel lipid formulations Test formulations were initially evaluated for FVII knockdown in 7-9 week-old, 15-25 g female C57Bl / 6 mice at doses of 0.1, 0.3, 1.0, and 5.0 mg / kg, with three mice per treatment group. All studies included animals receiving either phosphate-buffered saline (PBS, control group) or the benchmark formulation. The formulations were diluted to the appropriate concentration in PBS immediately prior to testing. Mice were weighed, and the appropriate dose volume was calculated (10 μl / g body weight). Test and benchmark formulations, as well as PBS (for control animals), were administered intravenously via the lateral tail vein. After 24 hours, animals were anesthetized with an intraperitoneal injection of ketamine / xylazine, and 500-700 μl of blood was collected by cardiac puncture into serum separator tubes (BD Microtainer). Blood was centrifuged at 2,000 × g for 10 minutes at 15°C, and serum was collected and stored at -70°C until analysis. Serum samples were thawed at 37°C for 30 minutes, diluted with PBS, and aliquoted into 96-well assay plates. Factor VII levels were assessed using a chromogenic assay (Biophen FVII kit, Hyphen BioMed) according to the manufacturer's instructions and absorbance measured on a microplate reader equipped with a 405 nm wavelength filter. Plasma FVII levels were quantified, and the ED50 (the dose resulting in a 50% reduction in plasma FVII levels compared to control animals) was calculated using a standard curve generated from pooled serum samples from control animals. Formulations of interest showing high levels of FVII knockdown (ED50 << 0.1 mg / kg) were retested in an independent study at a lower dose range to confirm efficacy and establish an ED50.
[0368] FIG. 3 provides a table showing the EC50s of exemplary compounds tested using this method.
[0369] Example 15A: Determination of pKa of formulated lipids The pKa values of various ionizable cationic lipids were determined essentially as described (Eastman et al., 1992, Biochemistry 31:4262-4268) using 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS), a fluorescent probe that is nonfluorescent in water but detectably fluorescent upon membrane binding. Vesicles composed of cationic lipid / DSPC / CH / PEG-c-DOMG (40:10:40:10 molar ratio) were diluted to 0.1 mM in buffers (130 mM NaCl, 10 mM CH3COONH4, 10 mM ME, 10 mM HEPES) at various pHs ranging from 2 to 11. An equal volume of aqueous TNS solution (1 μM final) was added to the diluted vesicles, and after a 30-second equilibration period, the fluorescence of the TNS-containing solution was measured at excitation and emission wavelengths of 321 nm and 445 nm, respectively. The pKa of the cationic lipid-containing vesicles was determined by plotting the measured fluorescence against the pH of the solution and fitting the data to a sigmoidal curve using the commercially available graphing program IgorPro.
[0370] FIG. 3 provides a table showing the pKa of exemplary compounds that were tested using this method.
[0371] Example 16: Synthesis of guanidinium-conjugated lipids Guanidinium Analogues Preparation of Compound 7204 [ka] Pyrazolecarboxamidine, HCl, DIPEA Preparation of compound 7013: A mixture of 1,2,4-butanetriol (7012, 21.2 g, 200 mmol, 5.0 equiv.), dilinoleyl ketone (21.0 g, 40.0 mmol, 1.0 equiv.), and p-toluenesulfonic acid (0.76 g, 4.0 mmol, 0.1 equiv.) in toluene was refluxed overnight under Dean-stock conditions. After completion of the reaction, it was cooled, the solvent was evaporated, and the mixture was purified by column chromatography using a gradient of hexane and ethyl acetate (15%) to give the desired ketal (7013) as an oil in 47% yield. 1 H NMR (400MHz, CDCl3) δ5.48~5.24(m, 8H), 4.32~4.17(m, 1H), 4.08(dd, J=7.8, 6.1, 1H), 3.86~3.74(m, 2H), 3.53(t, J=8.0, 1H), 2.77( t, J=6.4, 4H), 2.30~2.19(m, 1H), 2.05(q, J=6.8, 8H), 1.88~1.75(m, 2H), 1.69~1.51(m, 4H), 1.42~1.19(m, 36H), 0.89(t, J=6.8, 6H). C 41 H 74 Calculated mass of O3: 614.5; measured mass: 637.3 (+Na).
[0372] Synthesis of compound 7201: To a solution of compound 7013 (11.6 g, 18.9 mmol, 1.0 equiv.) and triethylamine (5.45 mL, 37.7 mmol, 2.0 equiv.) in dichloromethane at 0 °C, a solution of methanesulfonyl chloride (1.74 mL, 22.67 mmol, 1.2 equiv.) was added dropwise, and the reaction was continued at room temperature for 1 h. After completion of the reaction, the mixture was washed with water and brine, and the combined organics were dried over MgSO. The concentrated mixture was purified by column chromatography using a gradient of hexane and ethyl acetate (20%) to give the pure mesylated derivative (7201) as an oil in 93% yield. 1H NMR (400MHz, CDCl3) δ5.48~5.22(m, 8H), 4.35(qd, J=10.0, 4.9, 2H), 4.25~4.14(m, 1H), 4.13~4.03(m, 1H), 3.53(t, J=7.6, 1H) ), 3.02(s, 3H), 2.77(t, J=6.4, 4H), 2.13~1.85(m, 10H), 1.57(dd, J=18.2, 9.2, 4H), 1.44~1.15(m, 36H), 0.89(t, J=6.7, 6H). C 42 H 76 The calculated mass of O5S is 693.1; the measured mass is 693.2.
[0373] Synthesis of compound 7202: To a solution of compound 7201 (2.0 g, 3.0 mmol, 1.0 equiv) in DMF, solid NaN (0.98 g, 15.0 mmol, 5.0 equiv) was added and the reaction was continued at 65 °C until completion. The reaction mixture was poured into ice water and extracted with ethyl acetate. The combined organics were dried over NaSO, concentrated, and purified by column chromatography using hexane and ethyl acetate (5%) as a gradient to give the pure azido (7202) derivative in 89% yield. 1 H NMR (400MHz, CDCl3) δ5.53~5.19(m, 8H), 4.21~3.97(m, 2H), 3.57~3.29(m, 3H), 2.76(t, J=6.4, 4 H), 2.04(q, J=6.8, 8H), 1.80(m, 2H), 1.66~1.43(m, 4H), 1.40~1.07(m, 36H), 0.88(t, J=6.8, 6H). C 41 H 73 The calculated mass of N3O2 is 640.0; the measured mass is 612.5 (-N2).
[0374] Synthesis of compound 7203: To a solution of compound 7202 (1.7 g, 2.65 mmol, 1.0 equiv) in anhydrous tetrahydrofuran, a 1 M solution of LAH (3.98 mL, 3.98 mmol, 1.5 equiv) was added dropwise at 0 °C. The reaction was continued at room temperature, and after completion of the reaction, it was slowly quenched with a saturated solution of Na2SO4 at 0 °C. The compound was extracted into excess ethyl acetate, and the organic layer was washed with brine, dried over Na2SO4, concentrated, and further dried under reduced pressure to give the pure amine (7203) in 90% yield, which was used directly without further purification. 1 H NMR (400MHz, CDCl3) δ5.51~5.16(m, 8H), 4.13(dd, J=9.3, 3.6, 1H), 4.03(dd, J=7.5, 6.1, 1H), 3.46(t, J=7 .8, 1H), 2.96~2.67(m, 6H), 2.20~1.92(m, 8H), 1.82~1.49(m, 6H), 1.46~1.12(m, 38H), 0.88(t, J=6.8, 6H). C 41 H 75 The calculated mass value of NO2 is 614.0; the measured value is 614.5.
[0375] Synthesis of compound 7204 (ALNY-232): To a solution of amine 7203 (0.61 g, 1.0 mmol, 1.0 equiv.) and DIPEA (1.84 mL, 10.0 mmol, 10.0 equiv.) in a mixed solvent (DCM:DMF), 1H-pyrazole-1-carboxamidine hydrochloride (1.46 g, 10.0 mmol, 10.0 equiv.) was added in several portions at room temperature under an argon atmosphere. The reaction was continued overnight, and upon completion, the mixture was poured onto ice and extracted with ethyl acetate. The combined organics were washed with water, brine, dried over Na2SO4, and purified by preparative chromatography to give 0.16 g (25%) of the pure guanidine derivative (7204). 1H NMR (400MHz, CDCl3) δ11.76(s, 1H), 7.99(t, J=6.3, 1H), 7.44(s, 2H), 5.48~ 5.20(m, 8H), 4.24~4.00(m, 2H), 3.54(dd, J=7.3, 6.2, 1H), 3.32(d, J=3.0, 2 H), 3.09(dt, J=10.5, 5.3, 1H), 2.76(t, J=6.5, 4H), 2.03(q, J=6.8, 8H), 1.9 0~1.77(m, 1H), 1.76~1.49(m, 6H), 1.48~1.05(m, 34H), 0.87(dd, J=6.8, 6H). 13 C NMR (101MHz, CDCL3) δ158.96, 130.41, 130.36, 130.33, 128.18, 128.14, 113.52, 77.54, 77.22, 76.90, 76.60, 72.36, 69.54, 46.09, 38.39, 37 .68, 37.01, 34.09, 31.74, 30.10, 29.92, 29.78, 29.76, 29.56, 29.55, 29.53, 27.47, 27.46, 27.41, 25.84, 24.37, 24.12, 22.79, 14.31, 8.86. C 42 H 77 The calculated mass of N3O2 is 656.0; the measured value is 656.2.
[0376] Example 17: Synthesis of ester-linked lipids Ester analogues Scheme 1 [ka] experiment Compound 7002: Magnesium (711 mg, 29.25 mmol) was placed in a round-bottom flask. THF (30 mL) and 2-3 mg of I2 were added. The mixture was warmed to 50 °C, and oleyl bromide (7001, 6.46 g, 19.50 mmol) was slowly added. Upon addition of approximately 1 mL of oleyl bromide, the formation of the Grignard reagent began. After the remaining oleyl bromide was added, the Grignard reagent was slowly stirred at room temperature for 60 min, and then slowly added to a solution of 1,1'-carbonyldiimidazole (1.54 g, 9.51 mmol) in THF (100 mL) at -50 °C. The reaction mixture was stirred at -50 °C for 30 min and then at room temperature for 60 min. The reaction was quenched with 40 mL of saturated aqueous NH4Cl, and the mixture was extracted with Et2O and HO. The organic layer was dried over anhydrous MgSO4, filtered, and concentrated. The crude material was purified by silica gel column chromatography (0-5% EtO in hexanes) to give compound 7002 (2.70 g, 5.09 mmol, 53%, eluted with 5% EtOAc in hexanes). f =0.48). C 37 H 71 Molecular weight of O (M+H) + Calculated value 531.55, actual value 531.5.
[0377] Compound 7003: To a solution of compound 7002 (1.36 g, 2.56 mmol) in THF (25 mL) was added 1 M lithium aluminum hydride in THF (5.12 mL, 5.12 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 3 h. The reaction was quenched with saturated aqueous NaSO (20 mL) and then extracted with EtO and HO. The organic layer was dried over anhydrous MgSO, filtered, and concentrated. The crude material was purified by silica gel column chromatography (0-5% EtO in hexanes) to give compound 7003 (942 mg, 1.77 mmol, 69%, eluted with 5% EtOAc in hexanes). f =0.26).
[0378] Compound 7004: To a solution of compound 7003 (940 mg, 1.76 mmol) and 4-(dimethylamino)butyric acid hydrochloride (355 mg, 2.12 mmol) in CHCl (15 mL) was added diisopropylethylamine (0.920 mL, 5.28 mmol), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (406 mg, 2.12 mmol), and DMAP (43 mg, 0.352 mmol). The reaction mixture was stirred at room temperature for 14 hours. The reaction mixture was diluted with CHCl (100 mL) and washed with saturated aqueous NaHCO (50 mL). The organic layer was dried over MgSO, filtered, and concentrated. The crude material was purified by silica gel column chromatography (0-5% MeOH in CH2Cl2) to give compound 7004 (817 mg, 1.26 mmol, 72%, eluted with 5% MeOH in CH2Cl2). f =0.29). C 43 H 84 Molecular weight of NO2 (M+H) + Calculated value 646.65, actual value 646.5.
[0379] Scheme 4 [ka] Compound 7017: To a stirred solution of ketone 7016 (1.5 g, 2.84 mmol, 1.0 equiv) in methanol and THF (2:1) was added solid NaBH (0.16 g, 4.26 mmol, 1.5 equiv) in several portions at 0 °C, and the reaction was continued at room temperature until completion. The reaction was quenched by dropwise addition of 2 N HCl solution at ice-cold temperature, the organic solvent was evaporated, redissolved in ethyl acetate, washed with water and brine, and the combined organics were dried over MgSO, concentrated, and purified by column chromatography using a hexane:ethyl acetate (20%) gradient to give pure alcohol 7017 in 94% (1.42 g) yield. 1 C 37 H70 Calculated mass of O: 530.5; measured mass: 531.5.
[0380] Compound 7018: Prepared using similar experimental conditions as used for compound 7010, using alcohol 7017 (1.42 g, 2.68 mmol, 1.0 equiv), N,N-dimethylaminobutyric acid hydrochloride (0.53 g, 3.21 mmol, 1.2 equiv), DIPEA (1.48 mL, 8.0 mmol, 3.0 equiv), EDCI (0.56 g, 2.94 mmol, 1.1 equiv), DMAP (0.065 g, 0.53 mmol, 0.1 equiv) in DCM to give 1.34 g (78%) of pure product 7018. 1 H NMR (400MHz, CDCl3) δ5.47~5.20(m, 8H), 4.92~4.77(m, 1H), 2.76(t, J=6.3, 2H), 2.28(dt, J=16.6, 7.5, 4H), 2 .20(s, 6H), 2.08~1.89(m, 8H), 1.83~1.70(m, 2H), 1.48(d, J=5.2, 4H), 1.38~1.16(m, 40H), 0.91~0.80(m, 6H). 13 C NMR (101MHz, CDCL3) δ173.61, 130.51, 130.40, 130.35, 130.13, 130.05, 128.16, 128.13, 77.55, 77.23, 76.91, 74.46, 59.18, 45.68, 34.36, 32.84, 32.69, 32.13, 31.75, 29.99, 29 .92, 29.89, 29.78, 29.76, 29.72, 29.67, 29.58, 29.54, 29.52, 29.40, 29.36, 27.45, 27.43, 25.84, 25.57, 23.39, 22.91, 22.80, 14.36, 14.31. Calculated mass of C43H81NO2: 643.6; measured mass: 644.5. Scheme 5 [ka]
[0381] Compound 7020: Prepared using similar experimental conditions used for compound 7017 using ketone 57 (0.75 g, 1.43 mmol, 1.0 equiv) in methanol and THF (2:1) with the addition of solid NaBH (0.08 g, 2.14 mmol, 1.5 equiv) in methanol:THF to give 0.63 g (84%) of pure alcohol 7020. 1 H NMR (400MHz, CDCl3) δ5.48~5.20(m, 10H), 3.57(s, 1H), 2.88~2.65(m, 6H), 2.06(dq, J =14.0, 7.1, 8H), 1.50~1.18(m, 35H), 0.96(t, J=7.5, 3H), 0.88(dd, J=12.8, 6.2, 3H).C 37 H 66 Calculated mass of O: 526.5; measured mass: 527.5.
[0382] Compound 7021: Prepared by similar experimental conditions used for compound 7010 using alcohol 7020 (0.62 g, 1.18 mmol, 1.0 equiv), N,N-dimethylaminobutyric acid hydrochloride (0.23 g, 1.41 mmol, 1.2 equiv), DIPEA (0.65 mL, 3.54 mmol, 3.0 equiv), EDCI (0.24 g, 1.3 mmol, 1.1 equiv), DMAP (0.028 g, 0.23 mmol, 0.1 equiv) in DCM to give 0.63 g (84%) of pure product 7021. 1 H NMR (400MHz, CDCl3) δ5.46~5.19(m, 8H), 4.91~4.78(m, 1H), 2.85~2.68(m, 6H), 2.29(dt, J=15.2, 7.5, 4H), 2.20(s, 6H), 2.1 1~1.95(m, 8H), 1.78(dd, J=14.8, 7.5, 2H), 1.49(d, J=5.5, 4H), 1.40~1.17(m, 32H), 0.96(t, J=7.5, 3H), 0.87(t, J=6.8, 3H). 13C NMR (101MHz, CDCl3) δ168.17, 126.73, 125.15, 124.98, 124.93, 123.06, 123.0 4, 122.75, 122.72, 122.43, 121.91, 72.13, 71.81, 71.49, 69.04, 53.75, 40.25 , 28.95, 27.27, 26.33, 24.47, 24.45, 24.36, 24.33, 24.29, 24.15, 24.10, 22.0 5, 22.04, 22.00, 20.42, 20.41, 20.32, 20.15, 17.96, 17.38, 15.35, 9.08, 8.88. C 43 H 77 Calculated mass of NO2: 639.6; measured mass: 640.5. Scheme 6 [ka]
[0383] Compound 7023: To a solution of compound 7022 in a 2:1 methanol:ethyalcetate mixed solvent, 10% Pd / C was added, the vacuum was removed, the mixture was purged with argon, and the cycle was repeated (2x), and finally purged with H. The reaction was continued overnight at room temperature under H. After completion of the reaction, the mixture was filtered through a small pad of Celite, washed with ethyl acetate, evaporated, and purified by column chromatography using a gradient of dichloromethane:methanol (5%) to give pure compound 7023 in the form of a white solid in 64% yield (0.64 g). 1 H NMR (400MHz, CDCl3) δ5.37(s, 0H), 4.85(p, J=6.2, 1H), 2.29(dt, J=14.8, 7.5, 4H), 2.21 (s, 6H), 1.84~1.71(m, 2H), 1.49(d, J=5.4, 4H), 1.36~1.13(m, 64H), 0.87(t, J=6.8, 6H). 13C NMR (101 MHz, cdcl) δ 173.58, 77.54, 77.22, 76.91, 74.49, 59.17, 45.64, 34.36, 32.83, 32.70, 32.15, 29.92, 29.88, 29.81, 29.78, 29.58, 25.55, 23.36, 22.91, 14.33. Calculated mass for C43H87NO2: 649.6; found: 650.8.
[0384] Example 18: Ester synthesis. Scheme 1: Synthesis of M series (esters) [ka] DLin-M-C1-DMA DLin-M-C1-DMA. A solution of dilinolenylmethanol (0.50 g), N,N-dimethylglycine (0.53 g), 4-N,N-dimethylaminopyridine (0.60 g), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.50 g) in methylene chloride (5 mL) was stirred at room temperature. The reaction was monitored by TLC. Upon complete conversion of the dilinolenylmethanol, the reaction mixture was washed with dilute hydrochloric acid and then with dilute sodium bicarbonate solution. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent removed. The residue was passed through a silica gel column using a 0-3% methanol / methylene chloride elution gradient to give DLin-M-C1-DMA (0.35 g) as a colorless oil. 1 HNMR:(CDCl3)δ0.91(t;J=6.8Hz;6H);2.07(m;8H);2.42(s;6H);2.79(t;J=6.5Hz;4H);3.21(s;2H);4.97(m;1H);5.37(m;8H)
[0385] DLin-M-C4-DMA [ka] N,N-Dimethyl-5-aminopentanoic acid. Bromovaleric acid (2 g) was dissolved in aqueous dimethylamine and stirred overnight at room temperature. The solvent was removed on a rotary evaporator, and the residue was treated with an aqueous solution containing 1 equivalent of sodium bicarbonate. The solvent was removed, and the residue was suspended in ethanol and filtered. The solvent was removed from the filtrate, and the residue was suspended in methylene chloride and resuspended. After filtration, the solvent was removed from the filtrate to give an oil (1.3 g), which slowly crystallized on storage.
[0386] DLin-M-C4-DMA; as described for DLin-M-C1-DMA using N,N-dimethyl-5-aminopentanoic acid. 1 HNMR:(CDCl3)δ0.91(t;J=6.9Hz;6H);1.67(m;2H);2.07(m;8H);2.32(s;6H);2.37(m;4H);2.79(t;J=6.5Hz;4H);4.88(m;1H);5.37(m;8H)
[0387] DLin-M-C5-DMA [ka] N,N-dimethyl-6-aminobutanoic acid; as described for N,N-dimethyl-5-aminopentanoic acid using 6-bromobutanoic acid. DLin-M-C5-DMA; as described for DLin-M-C1-DMA using N,N-dimethyl-6-aminobutanoic acid. 1 HNMR:(CDCl3)δ0.91(t;J=6.9Hz;6H);1.66(m);2.07(m;8H);2.31(t;J=7.5Hz;2H);2.39(s;6H);2.47(bm;2H);4.88(m;1H);5.37(m;8H)
[0388] DLen-K5-C2-DMA [ka] Len-Br. A solution of linolenyl mesylate (2.2 g) and lithium bromide (2.5 g) in acetone (25 mL) was stirred overnight at room temperature. Methylene chloride was added, and the solution was washed twice with water. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent removed. The residue was passed through a silica gel column using a 0-2% ethyl acetate / hexane elution gradient to give Len-Br (2.1 g) as a colorless oil.
[0389] DLen-M-formate. A solution of Len-Br (2.1 g) in anhydrous diethyl ether (60 mL) was treated with magnesium sulphate (180 mg) overnight at reflux. The solution was allowed to cool, and ethyl formate (0.5 mL) was added dropwise. The reaction mixture was stirred at room temperature for 3 hours. Aqueous sulfuric acid (5%, 40 mL) was added, and the solution was extracted with diethyl ether. The organic fraction was washed with brine, dried over anhydrous magnesium sulphate, filtered, and the solvent removed. The residue was passed through a silica gel column using a 0-3% ethyl acetate / hexane elution gradient to give DLen-M-formate as a colourless oil.
[0390] DLen-M. The crude DLen-M-formate prepared above was treated with 5% sodium hydroxide solution in water / ethanol (10 mL, 10:90 v / v) for 30 min. The solution was diluted with water and extracted with methylene chloride. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent removed. The residue was passed through a silica gel column using a 0-10% ethyl acetate / hexane elution gradient to give DLen-M as a colorless oil.
[0391] DLen-ketone. A solution of DLEN-M (prepared above) in methylene chloride (20 mL) was treated with chlorochrome pyridinium (1 g) at room temperature for 2 hours. Diethyl ether (50 mL) was added, and the resulting suspension was passed through a silica gel bed (2x). The solvent was removed, and the residue was passed through a silica gel column using a 0-2% ethyl acetate / hexane gradient to give DLen-ketone (0.57 g) as a colorless oil.
[0392] DLen-K5-C2-OH. A solution of DLen-ketone (0.57 g), pyridinium p-toluenesulfonate (0.10 g), and butane-1,2,4-triol (0.50 g) in toluene (100 mL) was refluxed overnight in a Dean-Stark apparatus. The reaction mixture was partitioned between methylene chloride and brine. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using methylene chloride to give DLen-K5-C2-OH (0.52 g) as a colorless oil.
[0393] Procedure 09-028 (Apr. 17, 2009): DLen-K5-C2-OM. A solution of DLen-K5-C2-OH (0.52 g) in methylene chloride (20 mL) was treated with methanesulfonyl anhydride (0.40 g) and triethylamine (0.7 mL) at room temperature overnight. The organic fraction was washed with brine, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was used in the subsequent reaction without further purification.
[0394] DLen-K5-C2-DMA. A solution of crude DLen-K5-C2-OM in 2.0 M dimethylamine in THF (15 mL) was stirred at room temperature for 2 days. The solvent was removed by rotary evaporation, and the residue was passed through silica gel using a 0-6% methanol / methylene chloride gradient to give DLen-K5-C2-DMA (0.34 g) as a colorless oil. 1 HNMR:(CDCl3)δ0.95(t;J=7.5Hz;6H);1.56(m;4H);1.70(m;1H);1.81(m;1H);2.05(m;8H);2.27(s;6 H);2.36(m;1H);2.46(m;1H);2.79(t;J=6.0Hz;8H);3.27(t;J=7.2Hz;1H);4.06(m;2H);5.34(m;12H)
[0395] DO-K5-C2-DMA [ka] O-Br; as described for Len-Br using oleyl mesylate. DO-M-formate; as described for DLen-M-formate using O-Br. DO-M; as described for DLen-M using DO-M-formate. DO ketone; as described for DLen-ketone using DO-M. DO-K5-C2-OH; as described for DLen-K5-C2-OH using DO-ketone. DO-K5-C2-OM; DO-K5-C2-OH as described for DLen-K5-C2-OM. DO-K5-C2-DMA; as described for DLen-K5-C2-DMA using DO-K5-C2-OM. 1 HNMR:(CDCl3)δ0.86(t;J=6.8Hz;6H);1.55(m;4H);1.64(m;1H);1.79(ddd;J=12.6Hz, J'=11.2Hz, J”=6.2Hz;1H);1.99(m;8H);2.20(s;6H);2 .26(ddd;J=12.2Hz, J'=9.5Hz;J"=5.9Hz;1H);2.38(ddd;J=11.9Hz, J'=9.7Hz, J"=5.6Hz;1H);3.46(t;J=7.3Hz;1H);4.05(m;2H);5.32(m;4H)
[0396] DLin-M-C3-A [ka] Procedure 09-071 (July 14, 2009): DLin-M-C3-A. A solution of dilinolenylmethanol (0.51 g), N-BOC-4-aminobutyric acid (0.53 g), 4-N,N-dimethylaminopyridine (0.39 g), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.30 g) in methylene chloride (5 mL) was stirred overnight at room temperature. The reaction mixture was washed with dilute hydrochloric acid. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was treated with triflouroacetic acid (2 mL) for 1 hour at room temperature. The solution was diluted with methylene chloride and washed with water, followed by aqueous sodium bicarbonate. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-10% methanol / methylene chloride elution gradient to give DLin-M-C3-A (0.45 g) as a colorless oil. 1 HNMR:(CDCl3)δ0.87(t;J=6.8Hz;6H);1.75(p;J=7.3Hz;2H);2.03(m;8H);2.32(t;J=7.4Hz;2H);2.75(m;6H);4.84(p;J=6.2Hz;1H);5.35(m;8H)
[0397] DLin-M-C3-MA [ka] DLin-M-C3-Br. A solution of dilinolenylmethanol (0.5 g) in methylene chloride (20 mL) was treated with 4-bromobutyryl chloride (1 mL) and triethylamine (1 mL) overnight at room temperature with stirring. The reaction mixture was diluted with water, acidified with hydrochloric acid, and extracted with methylene chloride. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The crude DLin-M-C3-Br was used in subsequent reactions without further purification.
[0398] Procedure 09-061 (June 16, 2009): DLin-M-C3-MA. A solution of DLin-M-C3-Br (0.51 g) was treated with a solution of methylamine in THF / methylene chloride (50 mL; 20 / 30 v / v) at room temperature. The reaction was monitored by TLC. Upon completion of the reaction, the solvent was removed on a rotary evaporator. The residue was partitioned between methylene chloride and dilute hydrochloric acid. The organic phase was washed with dilute aqueous sodium bicarbonate, dried over anhydrous magnesium sulfate, filtered, and the solvent removed. The residue was passed through a silica gel column using a 0-4% methanol / methylene chloride elution gradient to give DLin-M-C3-MA (0.31 g) as a colorless oil. 1 HNMR:(CDCl3)δ0.87(t;J=6.9Hz;6H);1.82(m;2H);2.03(m;8H);2.33(t;J=7.4Hz;2H);2. 43(s;3H);2.62(t;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);4.84(p;J=6.3Hz;1H);5.35(m;8H)
[0399] DLin-M-C3-EA [ka] DLin-M-C3-EA; as described for DLin-M-C3-MA using ethylamine. 1 HNMR:(CDCl3)δ0.87(t;J=6.8Hz;6H);1.10(t;J=7.1Hz;3H);1.82(p;J=7.3Hz;2H);2.03(m;8H);2.33(t;J=7.4 Hz;2H);2.65(q;J=7.0Hz;4H);2.62(t;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);4.84(p;J=6.3Hz;1H);5.33(m;8H)
[0400] DLin-M-C3-IPA [ka] DLin-M-C3-IPA; as described for DLin-M-C3-MA using isopropylamine. 1 HNMR:(CDCl3)δ0.87(t;J=6.8Hz;6H);1.03(d;J=6.2Hz;6H);1.78(p;J=7.3Hz;2H);2.03(m;8H );2.32(t;J=7.4Hz;2H);2.60(t;J=7.3Hz;2H);2.77(m;5H);4.84(p;J=6.2Hz;1H);5.34(m;8H)
[0401] DLin-M-C3-DEA (ED50 = 0.3) [ka] DLin-M-C3-DEA; as described for DLin-M-C3-MA using diethylamine.
[0402] DLin-M-C3-DIPA (ED50=4.5) [ka] DLin-M-C3-DIPA; as described for DLin-M-C3-MA using diisopropylamine.
[0403] DLin-M-C3-MIPA [ka] DLin-M-C3-MIPA; as described for DLin-M-C3-MA using methylisopropylamine.
[0404] DLin-M-C3-EIPA [ka] DLin-M-C3-EIPA; as described for DLin-M-C3-MA using ethylisopropylamine. 1HNMR:(CDCl3)δ0.87(t;J=6.8Hz;6H);0.94(d;J=6.2Hz;6H);0.99(t;J=7.1Hz;3H);1.71(m;2H);2.03(m;8H);2.30 (t;J=7.3Hz;2H);2.37(m;2H);2.43(q;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);2.90(m;1H);4.84(m;1H);5.34(m;8H)
[0405] DLin-M-C3-MEA [ka] DLin-M-C3-MEA; as described for DLin-M-C3-MA using methylethylamine. 1 HNMR:(CDCl3)δ0.87(t;J=6.9Hz;6H);1.02(t;J=7.2Hz;3H);1.77(m;2H);2.03(m;8H);2.19 (s;3H);2.30(m;4H);2.39(q;J=7.2Hz;2H);2.75(t;J=6.5Hz;4H);4.84(m;1H);5.34(m;8H)
[0406] Example 19: Synthesis of 2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6S-C1-DMA); [ka] 1. Synthesis of Linoleyl Bromide(II) A mixture of linoleyl methanesulfonate (26.6 g, 77.2 mmol) and lithium bromide (30.5 g, 350 mmol) in acetone (350 mL) was stirred under nitrogen for 2 days. The resulting suspension was filtered, and the solid was washed with acetone. The filtrate and washings were combined, and the solvent was evaporated. The resulting residue was treated with water (300 mL). The aqueous phase was extracted with ether (3 × 150 mL). The combined ether phase was washed with water (200 mL), brine (200 mL), and dried over anhydrous NaSO. Evaporation of the solvent afforded 29.8 g of a yellowish oil. The crude product was purified by column chromatography on silica gel (230-400 mesh, 700 mL) and eluted with hexane. This afforded 20.8 g (82%) of linoleyl bromide (II).
[0407] 2. Synthesis of Dilinoleylmethyl Formate (III) To a suspension of Mg turnings (1.64 g, 67.4 mmol) with one crystal of iodine in 500 mL of anhydrous ether under nitrogen, a solution of linoleyl bromide (II, 18.5 g, 56.1 mmol) in 250 mL of anhydrous ether was added at room temperature. The resulting mixture was refluxed overnight under nitrogen. The mixture was cooled to room temperature. To the cloudy mixture under nitrogen, ethyl formate (4.24 g, 57.2 mmol) was added dropwise. Upon addition, the mixture was stirred overnight at room temperature. The mixture was treated with 10% aqueous H2SO4 (250 mL). The ether phase was separated, and the aqueous phase was extracted with ether (150 mL). The combined organic phase was washed with water (400 mL), brine (300 mL), and then dried over anhydrous Na2SO4. Evaporation of the solvent afforded 17.8 g of a yellowish oil as crude product (III). The crude product was used directly in the next step without further purification.
[0408] 3. Synthesis of dilinoleylmethanol(IV) The crude dilinoleyl methyl formate (III, 17.8 g) and KOH (3.75 g) were stirred overnight at room temperature in 85% EtOH under nitrogen. Upon completion of the reaction, most of the solvent was evaporated. The resulting mixture was poured into 150 mL of 5% HCl solution. The aqueous phase was extracted with ether (2 × 150 mL). The combined ether extracts were washed with water (2 × 100 mL), brine (100 mL), and dried over anhydrous NaSO. Evaporation of the solvent afforded 20.0 g of dilinoleyl methanol (IV) as a yellowish oil. The crude product was purified by column chromatography on silica gel (230–400 mesh, 700 mL) and eluted with a gradient of 0–5% ethyl acetate in hexane. This afforded 9.6 g of dilinoleyl methanol (IV).
[0409] 4. Synthesis of dilinoleyl ketone (V) To a mixture of dilinoleylmethanol (4.0 g, 7.2 mmol) and anhydrous potassium carbonate (0.4 g) in 100 mL of CHCl was added pyridinium chlorochromate (PCC, 4.0 g, 19 mmol). The resulting suspension was stirred at room temperature for 2 h. Ether (300 mL) was then added to the mixture, and the resulting brown suspension was filtered through a pad of silica gel (150 mL). The silica gel pad was further washed with ether (3 × 75 mL). The ether filtrate and washings were combined. Evaporation of the solvent afforded 5.1 g of an oily residue as a crude product. The crude product was purified by column chromatography on silica gel (230–400 mesh, 200 mL) and eluted with 0–4% ethyl acetate in hexane. This afforded 3.0 g (79%) of dilinoleyl ketone (V).
[0410] 5. Synthesis of 2,2-Dilinoleyl-5-hydroxymethyl)-[1,3]-dioxane (VI) A mixture of dilinoleyl ketone (V, 1.05 g, 2.0 mmol), 2-hydroxymethyl-1,3-propanediol (490 mg, 4.2 mmol), and pyridinium p-toluenesulfonate (100 mg, 0.4 mmol) in 150 mL of toluene was refluxed overnight under nitrogen using a Dean-Stark apparatus to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 × 100 mL), brine (100 mL), and dried over anhydrous NaSO. Evaporation of the solvent gave a pale oil (1.2 g). The crude product was purified by column chromatography on silica gel (230–400 mesh, 100 mL) using a 0–5% methanol gradient in dichloromethane as the eluent. This afforded 0.93 g of pure VI as a pale oil.
[0411] 6. Synthesis of 2,2-dilinoleyl-5-methanesulfonylmethyl-[1,3]-dioxane (VII) To a solution of 2,2-dilinoleyl-5-hydroxymethyl-[1,3]-dioxane (VI, 0.93 g, 1.5 mmol) and dry triethylamine (290 mg, 2.9 mmol) in 50 mL of anhydrous CHCl was added methanesulfonyl anhydride (400 mg, 2.3 mmol) under nitrogen. The resulting mixture was stirred at room temperature overnight. The organic phase was washed with water (2 × 75 mL), brine (75 mL), and dried over anhydrous NaSO. Evaporation of the solvent gave 1.0 g of a pale oil. The crude product was used in the next step without further purification.
[0412] 7. Synthesis of 2,2-dilinoleyl-5-dimethylaminomethyl)-[1,3]-dioxane (DLin-K6S-C1-DMA) To the above crude material (VII, 1.0 g) under nitrogen, 20 mL of dimethylamine (2.0 M) in THF was added. The resulting mixture was stirred at room temperature for 7 days. Evaporation of the solvent gave an oily residue. Column chromatography on silica gel (230-400 mesh, 100 mL) using a 0-3% methanol gradient in chloroform as the eluent gave 150 mg of the product DLin-K6S-C1-DMA as a pale oil. 1 H NMR (400MHz, CDCl3)δ:5.24~5.51(8, m, 4×CH=CH), 4.04(2H, dd, 2×OCH), 3.75(2H, dd OCH), 2.7~2.9(2H, br, NCH2), 2.78(4H, t, 2×C=C-CH2-C=C), 2.57(6H, s, 2×NCH3), 1.95~2.17(9H, q, 4× allyl CH2 and CH), 1.67~1.95 (2H, m, CH2), 1.54~1.65 (4H, m, 2×CH2), 1.22~1.45 (32H, m), 0.90 (6H, t, 2×CH3)ppm.
[0413] Example 20: Synthesis of 2,2-dilinoleyl-5-dimethylaminobutyl-[1,3]-dioxane (DLin-K6S-C4-DMA) [ka] This compound was synthesized as a pale oil in a manner similar to that of Example 19, where 2-hydroxymethyl-1,3-propanediol was replaced with 2-hydroxybutyl-1,3-propanediol. 1 H NMR (400MHz, CDCl3)δ:5.24~5.45(8, m, 4×CH=CH), 3.79(2H, dd, 2×OCH)), 3.50(2H, dd OCH), 2.76(4H, t, 2×C=C-CH2-C=C), 2.37(2H, t, NCH2), 2.31(6H, s, 2×NCH3), 2.04(8H, q, 4× Allyl C H2), 1.63~1.90(3H, m, ), 1.45~1.62(4H, m, 2×CH2), 1.22~1.45(36H, m), 0.90(6H, t, 2×CH3)ppm.
[0414] Example 21: Synthesis of 2,2-dilinoleyl-5-dimethylaminoethyl-[1,3]-dioxane (DLin-K6S-C2-DMA) [ka] This compound was synthesized as a pale oil in a manner similar to that of Example 19, where 2-hydroxymethyl-1,3-propanediol was replaced with 2-hydroxyethyl-1,3-propanediol. 1 H NMR (400MHz, CDCl3)δ:5.25~5.45(8, m, 4×CH=CH), 3.87(2H, dd, 2×OCH)), 3.55(2H, dd OCH), 2.75(4H, t, 2×C=C-CH2-C=C), 2.45~2.60(2H, br, NCH2), 2.40(6H, s, 2×NCH3), 2.03(8H, q, 4× Allyl CH2), 1.73~1.86(1H, m), 1.56~1.72(6H, m, 2×CH2), 1.22~1.45(32H, m), 0.90(6H, t, 2×CH3)ppm.
[0415] Example 22: Synthesis of 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxane (DLin-K6A-C2-DMA) [ka] 1. Synthesis of 1,3,5-pentanetriol (II) Diethyl 3-hydroxyglutarate (I, 1.0 g, 4.9 mmol) in anhydrous THF (10 mL) was added dropwise to a suspension of LiAlH in anhydrous THF (110 mL) under nitrogen with a cold water bath. Upon addition, the cold water bath was removed, and the suspension was stirred at room temperature for 2 days. The resulting mixture was quenched by very slowly adding 13 mL of brine with an ice-water bath. A white suspension formed, and the mixture was stirred at room temperature overnight. The solid was filtered and washed with THF. The filtrate and washings were combined, and the solvent was evaporated to give 0.70 g of a pale oil. Column chromatography of the crude product (230–400 mesh SiO, 100 mL, 0–12% methanol gradient in chloroform) gave 0.54 g of II as a colorless oil.
[0416] 2. Synthesis of 2,2-dilinoleyl-4-(2-hydroxyethyl)-[1,3]-dioxane (IV) A mixture of dilinoleyl ketone (III, 0.80 g, 1.5 mmol), 1,3,5-pentanetriol (II, 0.54 g, 4.5 mmol), and pyridinium p-toluenesulfonate (60 mg, 0.24 mmol) in 150 mL of toluene was refluxed overnight under nitrogen using a Dean-Stark apparatus to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 × 75 mL), brine (75 mL), and dried over anhydrous NaSO. Evaporation of the solvent gave a pale oil (1.1 g). The crude product was purified by column chromatography on silica gel (230–400 mesh, 75 mL) using 0–3% methanol in dichloromethane as the eluent. This afforded 0.75 g (79%) of pure IV as a colorless oil.
[0417] 3. Synthesis of 2,2-dilinoleyl-4-(2-methanesulfonylethyl)-[1,3]-dioxane (V) To a solution of 2,2-dilinoleyl-4-(2-hydroxyethyl)-[1,3]-dioxane (IV, 0.75 g, 1.2 mmol) and dry triethylamine (0.58 g, 5.7 mmol) in 40 mL of anhydrous CHCl was added methanesulfonyl anhydride (0.50 g, 2.9 mmol) under nitrogen. The resulting mixture was stirred at room temperature overnight. The organic phase was washed with water (2 × 50 mL), brine (50 mL), and dried over anhydrous NaSO. Evaporation of the solvent gave 0.80 g of a pale oil as crude product. The crude product was used in the next step without further purification.
[0418] 4. Synthesis of 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxane (DLin-K6A-C2-DMA) To the above crude material (V, 0.80 g) under nitrogen, 15 mL of dimethylamine (2.0 M) in THF was added. The resulting mixture was stirred at room temperature for 6 days. The solid was filtered. The solvent was evaporated to give an oily residue. Column chromatography on silica gel (230-400 mesh, 100 mL) using a 0-6% methanol gradient in dichloromethane as the eluent afforded 0.70 g of the product DLin-K6A-C2-DMA as a pale oil. 1 H NMR (400MHz, CDCl3)δ: 5.28~5.45(8, m, 4×CH=CH), 3.85~4.0(2H, m, 2×OCH), 3.78(1H, dd, OCH), 2.78(4H, t, 2×C=C-CH2-C=C), 2.55~2.90(2H, br, NCH2), 2.47(6H, s, 2×NCH3), 2.05(8H, q, 4×Allyl CH2), 1.65~1.90(4H, m, CH2), 1.47~1.65(4H, m, CH2), 1.1~1.65(36H, m), 0.90(6H, t, 2×CH3)ppm.
[0419] Example 23: Synthesis of 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxane (DLin-K6A-C3-DMA) [ka] 1. Synthesis of 1,3,6-hexanetriol (II) Diethyl β-ketoadipate (I, 1.86 g, 8.6 mmol) was added dropwise to a suspension of LiAlH in anhydrous THF (90 mL) under nitrogen in an ice-water bath. Upon addition, the ice-water bath was removed, and the suspension was stirred overnight at room temperature. The resulting mixture was quenched by very slowly adding 10 mL of brine in the ice-water bath. A white suspension formed, and the mixture was stirred overnight at room temperature. The solid was filtered and washed with THF, followed by EtOH (2 × 50 mL). The filtrate and washings were combined, and the solvent was evaporated to give 0.90 g of a pale oil. Column chromatography of the crude product (230–400 mesh SiO, 100 mL, 0–10% methanol gradient in dichloromethane) afforded 0.70 g of II as a colorless oil.
[0420] 2. Synthesis of 2,2-dilinoleyl-4-(3-hydroxypropyl)-[1,3]-dioxane (IV) A mixture of dilinoleyl ketone (III, 1.80 g, 3.4 mmol), 1,3,6-hexanetriol (II, 0.50 g, 3.7 mmol), and pyridinium p-toluenesulfonate (100 mg, 0.40 mmol) in 120 mL of toluene was refluxed under argon for 3 h using a Dean-Stark apparatus to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 × 50 mL), brine (50 mL), and dried over anhydrous NaSO. Evaporation of the solvent gave a pale oil (2.0 g). The crude product was purified by column chromatography on silica gel (230–400 mesh, 50 mL) using a 0–3% methanol gradient in dichloromethane as the eluent. This afforded 0.90 g (41%) of pure IV as a colorless oil.
[0421] 3. Synthesis of 2,2-dilinoleyl-4-(3-methanesulfonylpropyl)-[1,3]-dioxane (V) To a solution of 2,2-dilinoleyl-4-(3-hydroxypropyl)-[1,3]-dioxane (IV, 0.97 g, 1.5 mmol) and dry triethylamine (0.44 g, 4.3 mmol) in 60 mL of anhydrous CHCl was added methanesulfonyl anhydride (0.60 g, 3.5 mmol) under argon. The resulting mixture was stirred overnight at room temperature. The organic phase was washed with water (2 × 30 mL), brine (30 mL), and dried over anhydrous MgSO. Evaporation of the solvent gave 1.1 g of a pale oil as crude product. The crude product was used in the next step without further purification.
[0422] 4. Synthesis of 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxane (DLin-K6A-C3-DMA) To the above crude material (V, 1.1 g) under argon was added 20 mL of dimethylamine (2.0 M) in THF. The resulting mixture was stirred at room temperature for 5 days. The solid was filtered. The solvent was evaporated to give an oily residue. Column chromatography on silica gel (230-400 mesh, 40 mL) using a 0-7% methanol gradient in dichloromethane as the eluent afforded 0.85 g of the product DLin-K6A-C3-DMA as a pale oil. 1 H NMR (400MHz, CDCl3)δ:5.25~5.45(8, m, 4×CH=CH), 3.7~4.0(3H, m, 3×OCH), 2.77(4H, t, 2×C=C-CH2-C=C), 2.5~2.8(2H, br, NCH2), 2.5(6 H, s, 2×NCH3), 2.05(8H, q, 4×Allyl CH2), 1.65~1.90(4H, m, 2×CH2), 1.40~1.65(4H, m, 2×CH2), 1.1~1.65(38H, m), 0.90(6H, t, 2×CH3)ppm.
[0423] Example 24: Synthesis of 2,2-diarachidonyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DAra-K5-C2-DMA) [ka] Synthesis of arachidonyl(II) bromide A mixture of arachidonyl methanesulfonate (1.0 g, 2.7 mmol) and magnesium bromide (2.2 g, 12 mmol) in anhydrous ether (40 mL) was stirred under argon for 2 days. The resulting suspension was filtered, and the solid was washed with ether (2 × 10 mL). The filtrate and washings were combined, and the solvent was evaporated. The resulting residue was treated with hexane (50 mL). The solid was filtered, and the solvent was evaporated to give an oily residue. The crude product was purified by column chromatography on silica gel (230-400 mesh, 30 mL) and eluted with hexane. This afforded 1 g of arachidonyl bromide (II) as a colorless oil.
[0424] 2. Synthesis of Diarachidonyl Methyl Formate (III) To a solution of arachidonyl bromide (II, 1 g, 3 mmol) in anhydrous ether (30 mL), Mg turnings (78 mg, 3.2 mmol) were added, followed by one crystal of iodine. The resulting mixture was refluxed under nitrogen for 10 h. The mixture was cooled to room temperature. To the cloudy mixture under nitrogen, ethyl formate (0.25 mL) was added, and the resulting mixture was stirred at room temperature overnight. To the mixture, 20 mL of 10% aqueous H2SO4 was added. The ether phase was separated, and the aqueous phase was extracted with ether (30 mL). The combined organic phase was washed with water (2 × 25 mL), brine (25 mL), and then dried over anhydrous Na2SO4. Evaporation of the solvent afforded 1.1 g of a pale oil as crude product (III). The crude product was purified by column chromatography on silica gel (230–400 mesh, 40 mL) and eluted with a gradient of 0–3% ethyl acetate in hexane. This ga...
Claims
1. It has the following structure: 【Chemistry 1】 During the ceremony, E is C(O)O or OC(O); R 1 and R 2 is each independently in each occurrence an optionally substituted C8-C 10 Alkyl, optionally substituted C 10 ~C 30 alkyl, or optionally substituted C 10 ~C 30 alkenyl, provided that R x is H; R 3 is an optionally substituted di(alkyl)aminoalkyl; n is 0, However, R 3 is 2-(dimethylamino)ethyl, and R 1 , R 2 , and R X If one of is H, then R 1 , R 2 , and R X the remainder of which is also a lipid particle comprising a lipid, or a salt, diastereomer, or enantiomer thereof, which is not linoleyl, and a therapeutic agent.
2. The lipid particle of claim 1 , further comprising a neutral lipid and a lipid capable of reducing aggregation.
3. 3. The lipid particle of claim 2, wherein the lipid capable of reducing aggregation is a PEG-lipid.
4. The lipid particle of claim 1 , wherein the therapeutic agent is a nucleic acid.
5. The lipid particle of claim 4 , wherein the nucleic acid is selected from the group consisting of siRNA and antisense oligonucleotides.
6. The lipid particle of claim 4 , wherein the nucleic acid is siRNA.
7. The lipid particle of claim 4 , wherein the nucleic acid is mRNA.
8. A pharmaceutical composition comprising the lipid particles of claim 1 and a pharmaceutically acceptable excipient, carrier, or diluent.
9. A composition for modulating the expression of a target gene in a cell, comprising the lipid particle of any one of claims 1, 6 and 7.
10. The lipid particle of claim 2 , wherein the neutral lipid is a phospholipid.
11. The lipid particle of claim 2 , wherein the particle further comprises a sterol.
12. The lipid particle of claim 11 , wherein the sterol is cholesterol.
13. R 1 and R 2 However, each independently, C8 to C 10 alkyl, and R X The lipid particle of any one of claims 1, 7 and 11, wherein is H.
Citation Information
Patent Citations
Liquid softening and finishing agent
JP1996199479A
Liquid soft finishing agent composition
JP1996232168A
New quaternary ammonium salt and softening agent composition containing the same
JP1996301822A
Liquid softener composition
JP1997105076A
Lipid-containing drug delivery complexes and methods for their production
JP2004535388A
Cited By
Novel lipids and compositions for delivery of therapeutics
JP2025133742A