Method and kit for determining the efficiency of plasma separation from whole blood

A real-time PCR assay using short and long amplicons addresses the precision and cost issues in plasma separation assessment, ensuring accurate plasma separation evaluation by analyzing DNA fragment ratios.

JP7738921B2Active Publication Date: 2025-09-16NUCLEIX LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023179659
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-02-21
Filing Date
2023-10-18
Publication Date
2025-09-16
Estimated Expiration
2039-02-20

AI Technical Summary

Technical Problem

Existing methods for assessing plasma separation from whole blood are tedious, expensive, and lack precision, leading to noise and inaccuracy in circulating cell-free DNA analysis due to plasma contamination by DNA from white blood cells.

Method used

A real-time PCR assay using co-amplification of short and long amplicons (70-150 base pairs and 350-600 base pairs, respectively) to determine plasma separation efficiency based on the difference in amplification levels, eliminating the need for absolute DNA quantification and standard curves.

Benefits of technology

Provides a simple, cost-effective, and accurate method to assess plasma separation efficiency without compromising sensitivity, quality, and accuracy, by analyzing the ratio of short to long DNA fragments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007738921000001
    Figure 0007738921000001
  • Figure 0007738921000002
    Figure 0007738921000002
  • Figure 0007738921000003
    Figure 0007738921000003
Patent Text Reader

Abstract

To provide a method for evaluating whether a plasma sample is sufficiently separated from the cellular fraction of whole blood.SOLUTION: Methods and kits for determining the efficiency of plasma separation from whole blood are provided, using real-time PCR amplification of two amplicons, namely, a short amplicon of e.g. 70-150 bps (base pairs) and a long amplicon of e.g. 350-600 bps. The separation efficiency is determined based on the difference in amplification patterns of the two amplicons.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a real-time PCR assay for assessing whether a plasma sample is sufficiently separated from the cellular fraction of whole blood, which is advantageous for diagnostic tests requiring access to circulating cell-free DNA. [Background technology]

[0002] Circulating cell-free DNA (cfDNA) is DNA released into the blood circulation from both normal and tumor cells. The origin of cfDNA in blood is not fully understood, but it is thought to be related to apoptosis, necrosis, and active release from cells. While the presence of cfDNA in blood has been known for decades, its true diagnostic potential has only recently been understood, leading to increased interest in cfDNA detection and analysis. For example, fetal cfDNA present in maternal blood is now being used for noninvasive prenatal diagnosis, and clinical studies are underway using tumor-derived cfDNA as a surrogate marker for cancer patients.

[0003] Analysis of cfDNA requires first separating plasma (containing cfDNA) from whole blood. Traditionally, plasma has been separated from blood by centrifugation or filtration. New microfluidic methods are now emerging. After separation, cfDNA can be further purified by extraction before further analysis.

[0004] Effective separation of cfDNA from the cellular fraction of blood is crucial for the quality of cfDNA analysis. Plasma contamination by DNA released from white blood cells during blood collection and plasma processing reduces the proportion of cfDNA in the sample, increasing noise and inaccuracy in cfDNA analysis. Separation efficiency is typically assessed by measuring blood cell counts, either manually using a hemocytometer or automatically using a flow cytometer. However, such methods have many drawbacks; some are tedious and expensive, and others lack precision.

[0005] Studies have shown that circulating cfDNA is mostly fragments less than 300 base pairs in length, or even less than 200 base pairs (Chan et al., 2004, Clinical Chemistry, 50(1):88-92), while DNA from leukocytes is mostly fragments longer than 10 kbs.

[0006] Gel electrophoresis, which separates DNA based on molecular size, has been proposed to determine separation efficiency by detecting the presence of long versus short DNA fragments. However, such methods require large amounts of DNA, which is the greatest challenge when working with circulating cell-free DNA.

[0007] Norton et al. (2013, Clinical Biochemistry, 46:1561-1565) studied the ability of stabilizers to prevent cell-free DNA (cfDNA) contamination with cellular genomic DNA (gDNA) during storage and shipping of blood samples. Contamination by gDNA was assessed using digital PCR. Specifically, digital PCR technology was used to quantify contaminating gDNA by amplifying a 420-base-pair DNA fragment from the β-actin gene. A second digital PCR assay was used to quantify cfDNA by amplifying a shorter β-actin amplicon of 136 base pairs. These assays were used to determine the quality of plasma cfDNA samples and assess the degree of gDNA contamination.

[0008] There is a need for improved methods and kits for determining the efficiency of plasma separation from whole blood that are simple to operate, cost-effective, and accurate. Summary of the Invention

[0009] In some embodiments, the present invention provides methods and kits for determining the efficiency of plasma separation from whole blood using quantitative PCR amplification of two amplicons, i.e., a short amplicon, e.g., 70-150 base pairs, and a long amplicon, e.g., 350-600 base pairs. Separation efficiency is determined based on the difference in amplification levels of the two amplicons. Advantageously, separation efficiency is determined without absolute DNA quantification and / or determination of the copy number of any gene / locus.

[0010] Most of the DNA in the plasma fraction of blood is short fragments of cell-free DNA, up to approximately 300 base pairs in length. If the plasma fraction is not sufficiently separated from the cellular components of blood, the plasma will also contain DNA derived from white blood cells. Most of the latter are long fragments, typically 10 Kb or longer. Therefore, the presence of long fragments of DNA in a plasma sample provides an indication of the efficiency of plasma separation from whole blood.

[0011] In the method disclosed herein, short amplicons and long amplicons from the tested plasma sample are co-amplified, and amplification patterns are analyzed.In the method disclosed herein, in the plasma sample that is sufficiently separated from blood cell fraction, significant differences in the amplification levels of the two amplicons are observed, and short amplicons are amplified more efficiently than long amplicons.Without being bound by any theory or mechanism of action, the difference in amplification levels reflects the ratio of short cell-free DNA to long DNA from leukocytes in the tested plasma sample, and therefore indicates the efficiency of plasma separation.

[0012] Advantageously, differences in amplification levels are calculated between amplicons co-amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions). This setup makes the methods disclosed herein insensitive to various "noise" factors, such as changes in template DNA concentration, PCR conditions, and the presence of impurities / inhibitors. It should be noted that the methods of the present invention do not require absolute quantification of DNA and / or determination of the copy number of any gene / locus at any time. Therefore, the actual amount, concentration, and / or copy number of any genomic locus is not relevant to the methods of the present invention. Therefore, the methods disclosed herein eliminate the need for standard curves and / or additional tedious steps involved in absolute quantification, thereby providing a simple and cost-effective procedure without compromising sensitivity, quality, and / or accuracy. Furthermore, by employing real-time PCR, the method is effective for any concentration of template DNA and does not require template dilution or other adjustments.

[0013] According to one aspect, the present invention provides a method for determining the efficiency of plasma separation from whole blood, the method comprising: (a) obtaining DNA from a plasma sample; (b) By PCR co-amplification (i) a first amplification product of 70 to 150 base pairs from a first genomic locus using a first primer pair; (ii) generating a second amplification product of at least 350 base pairs from a second genomic locus using a second primer pair; and (c) calculating a signal intensity for each of the first and second amplification products; (d) determining that the plasma sample is separated when the difference between the signal intensities exceeds a predetermined threshold; The first and second amplification products produce distinct signal intensity differences for plasma DNA and whole blood DNA, providing a method.

[0014] In some embodiments, step (b) is performed using real-time PCR. In some embodiments, when step (b) is performed using real-time PCR, the method further comprises adding a fluorescent probe for specifically detecting the first and second amplification products.

[0015] In some embodiments, when step (b) is performed using real-time PCR, the signal intensity is a quantification cycle (Cq), and the plasma samples are determined to be separated based on the difference (ΔCq) between the Cq values ​​of the first amplification product and the second amplification product. In some embodiments, the plasma samples are determined to be separated when ΔCq (Cq(2) - Cq(1)) exceeds a predetermined threshold ΔCq.

[0016] In some embodiments, the first and second primer pairs are of equal efficiency.

[0017] In some embodiments, the first amplification product is between 100 and 150 base pairs.

[0018] In some embodiments, the second amplification product is 350 to 700 base pairs. In some embodiments, the second amplification product is 350 to 650 base pairs. In some embodiments, the second amplification product is 350 to 550 base pairs.

[0019] In some embodiments, the first amplification product comprises a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 10. Each possibility is represented by a separate embodiment of the invention. In some embodiments, the first amplification product comprises the sequence set forth in SEQ ID NO: 1 or It consists of the sequence shown in SEQ ID NO: 10. Each possibility represents a separate embodiment of the present invention.

[0020] In some embodiments, the second amplification product comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9. Each possibility is represented by a separate embodiment of the invention. In some embodiments, the second amplification product comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9. It consists of the sequence shown in SEQ ID NO: 9. Each possibility represents a separate embodiment of the present invention.

[0021] In some embodiments, the first and second amplification products comprise the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In some particular embodiments, the first and second amplification products consist of the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0022] In some embodiments, the plasma sample is derived from a human blood sample.

[0023] According to a further aspect, the present invention provides a kit for determining the efficiency of plasma separation from whole blood, comprising: (i) a first primer pair for generating a first amplification product of 70 to 150 base pairs from a first genomic locus by PCR; (ii) a second primer pair for generating by PCR a second amplification product of at least 350 base pairs from a second genomic locus; and (iii) probes for detecting the first and second amplification products and determining the signal intensity for each amplification product; The first and second amplification products produce distinct signal intensity differences for plasma DNA and whole blood DNA, the kit provides.

[0024] In some embodiments, the kit further includes instructions for correlating the signal intensity difference and the level of separation. In some embodiments, the instructions provide a threshold signal intensity difference between the first amplification product and the second amplification product, above which the plasma sample is determined to be separated. In some specific embodiments, the instructions provide a threshold ΔCq(Cq(2)-Cq(1)), above which the plasma sample is determined to be separated.

[0025] In some embodiments, the probe is a fluorescently labeled oligonucleotide probe.

[0026] In some embodiments, the first and second primer pairs are of equal efficiency.

[0027] In some embodiments, the first amplification product is between 100 and 150 base pairs.

[0028] In some embodiments, the second amplification product is 350 to 700 base pairs. In some embodiments, the second amplification product is 350 to 650 base pairs. In some embodiments, the second amplification product is 350 to 550 base pairs.

[0029] In some embodiments, the first amplification product comprises a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 10. In some embodiments, the first amplification product consists of the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 10.

[0030] In some embodiments, the second amplification product comprises a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9. In some embodiments, the second amplification product consists of the sequence set forth in SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9.

[0031] In some embodiments, the first and second amplification products comprise the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In some particular embodiments, the first and second amplification products consist of the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0032] In some embodiments, the first primer pair is SEQ ID NO: 3 (forward) and SEQ ID NO: 4 (reverse).

[0033] In some embodiments, the second primer pair is SEQ ID NO: 5 (forward) and SEQ ID NO: 6 (reverse).

[0034] In some embodiments, the first primer pair is SEQ ID NO:3 (forward) and SEQ ID NO:4 (reverse), and the second primer pair is SEQ ID NO:5 (forward) and SEQ ID NO:6 (reverse).

[0035] These and further aspects and features of the present invention will become apparent from the following detailed description, examples and claims. [Brief explanation of the drawings]

[0036] [Figure 1A-C] Exemplary quantitative PCR plots of short ("JOE") and long ("FAM") amplification products in DNA samples from plasma (A), leukocyte-contaminated plasma (B), and DNA from whole blood (C). DETAILED DESCRIPTION OF THE INVENTION

[0037] The present invention relates to determining the efficiency of plasma separation from the cellular fraction of whole blood using real-time PCR amplification of two amplicons: a short amplicon of 70-150 base pairs and a long amplicon of at least 350 base pairs.

[0038] The DNA contained in plasma ("plasma DNA") is mostly cell-free DNA, typically containing DNA fragments less than 300 base pairs in length. In contrast, the DNA in whole blood ("whole blood DNA") is mostly DNA released from white blood cells, typically containing DNA fragments greater than 10 Kb. The difference in DNA content between plasma and whole blood in terms of the ratio of short to long DNA fragments allows for the establishment of different amplification patterns of short and long amplicons and the determination of the separation efficiency of plasma samples from the cellular components of blood.

[0039] As used herein, the terms "cell-free DNA" and "circulating cell-free DNA" (abbreviated "cfDNA") are used interchangeably and refer to DNA molecules that circulate freely in the blood. Most cell-free DNA molecules are less than 400 base pairs in length, even less than 300 base pairs, or even less than 200 base pairs in length.

[0040] As used herein, the terms "leukocyte-derived DNA," "leukocyte DNA," "contaminating leukocyte DNA," and the like refer to DNA released from leukocytes. Leukocyte DNA is composed mostly of DNA fragments 10 kb or greater in length.

[0041] As used herein, phrases such as "determining plasma separation efficiency," "determining that a plasma sample has been separated," and "determining that a plasma sample has been sufficiently / efficiently separated" are used interchangeably and refer to determining that the level of contaminating leukocyte DNA in the plasma is such that it does not interfere with the analysis of cell-free DNA. Different diagnostic applications involving the analysis of cell-free DNA may require different levels of plasma purity (i.e., may be characterized by different acceptable levels of leukocyte DNA contamination). Therefore, the threshold above which a plasma sample is determined to be separated, such as the threshold ΔCq between short and long amplicons amplified by the present invention, may differ for different assays. The threshold may be set based on the requirements of a particular diagnostic assay.

[0042] Selection of the first and second genomic loci and design of primers to generate short and long amplicons The assay for assessing the quality of plasma separation disclosed herein involves duplex PCR using primers that generate a short amplicon (e.g., about 100 base pairs) from a first genomic locus and a long amplicon (e.g., about 500 base pairs) from a second genomic locus. The short and long amplicons generate different signal intensities for plasma DNA and whole blood DNA, such as different ΔCq values ​​for plasma DNA and whole blood DNA.

[0043] The DNA in plasma is not simply fragmented genomic DNA, but a biased representation of the genome, with some genomic loci being under-represented and others being over-represented relative to whole blood DNA. Pairs of short and long amplicons that produce different ΔCq values ​​for plasma DNA and whole blood DNA include pairs of short and long amplicons from genomic loci that are equally represented in plasma DNA, and pairs of short and long amplicons in which the long amplicon is from a genomic locus that is under-represented in plasma DNA compared to the genomic locus of the short amplicon.

[0044] When such pairs of loci are amplified with primers of the same efficiency, the difference in their amplification levels reflects the ratio of short to long DNA fragments in the sample; the lower the amplification level of the long amplicons, the smaller the amount of long DNA fragments in the sample, and accordingly the better the plasma separation.

[0045] Thus, in some embodiments, the first and second genomic loci are equally represented in plasma DNA. In additional embodiments, the second locus is under-represented in plasma DNA compared to the first locus. According to some embodiments, the method includes: (a) obtaining DNA from a plasma sample; (b) generating, by PCR co-amplification, a first amplification product of 70 to 150 base pairs from the first genomic locus using a first primer pair and a second amplification product of at least 350 base pairs from the second genomic locus using a second primer pair, wherein the first and second genomic loci are equally represented in plasma DNA or the second genomic locus is under-represented in plasma DNA compared to the first locus; (c) calculating signal intensities for each of the first and second amplification products; and (d) determining that the plasma sample is separated when the difference between the signal intensities exceeds a predetermined threshold.

[0046] In some embodiments, the methods of the invention include: (a) obtaining DNA from a plasma sample; (b) generating, by real-time PCR amplification, a first amplification product of 70-150 base pairs from a first genomic locus using a first primer pair and a second amplification product of at least 350 base pairs from a second genomic locus using a second primer pair, wherein the first and second genomic loci are equally represented in the plasma DNA or the second genomic locus is under-represented in the plasma DNA compared to the first locus; (c) calculating a Cq value for each of the first and second amplification products; and (d) determining that the plasma sample is separated when ΔCq(Cq(2) - Cq(1)) exceeds a predetermined threshold ΔCq.

[0047] In some embodiments, provided herein are methods of analyzing a plasma sample, including: (a) obtaining DNA from the plasma sample; (b) generating by real-time PCR amplification a first amplification product of 70-150 base pairs from a first genomic locus using a first primer pair and a second amplification product of at least 350 base pairs from a second genomic locus using a second primer pair, wherein the first and second genomic loci are equally represented in the plasma DNA or the second genomic locus is under-represented in the plasma DNA compared to the first locus; (c) determining a Cq value for each of the first and second amplification products; and optionally (d) calculating ΔCq(Cq(2)-Cq(1)), wherein the first and second amplification products generate different ΔCqs for the plasma DNA and the whole blood DNA.

[0048] Selection of two genomic loci that are equally represented in cell-free plasma DNA and design of short and long amplicons from these loci can be performed, for example, as follows. 1. Select a random pair of genomic loci. For example, loci with GC content between 30 and 60% may be selected. 2. Design primer pairs for amplification that will generate short (approximately 100 base pairs) amplicons. 3. Determine the efficiency of primer pairs in PCR on whole blood DNA in singleplex (individual) reactions. Methods for determining primer efficiency are known in the art. For example, the efficiency of a primer pair can be determined by (i) selecting a specific concentration of primers, (ii) performing real-time PCR reactions with serial dilutions of template DNA (e.g., whole blood DNA) (e.g., determining the Cq value for each reaction (each dilution), (ii) creating a standard curve by plotting the Cq value against the logarithm of the starting amount of template for each dilution, (iv) calculating the slope of the standard curve, and (v) determining the reaction efficiency based on the slope. Typically, efficiency is calculated using the formula: efficiency = 10 -1 / 勾配Amplification efficiency is frequently expressed as a percentage, i.e., the percent of template amplified in each cycle. To calculate the percentage, apply the formula: % efficiency = (efficiency - 1) x 100. 4. Eliminate pairs of genomic loci for which the primers are not equally efficient and continue with pairs of genomic loci for which the primers are equally efficient. 5. For each pair of genomic loci, compare the copy number of the locus in the plasma DNA and eliminate pairs with different copy numbers (in other words, eliminate pairs with representation bias in the plasma DNA where one of the loci is over-represented in the plasma DNA compared to the other, and select pairs with equivalent representation in the plasma DNA). Assessment of copy number differences in plasma DNA may be performed, for example, by (i) quantitatively amplifying genomic loci from plasma DNA and from whole blood DNA using primers selected in the previous step that amplify short amplicons from each locus with comparable efficiency, (ii) calculating the ΔCq between the two loci for each DNA sample (plasma DNA or whole blood DNA), and (iii) determining the copy number difference according to the ΔCq in plasma DNA versus the ΔCq in whole blood DNA. 6. For pairs of selected genomic loci found to be equally represented in plasma DNA in the previous step, design primers for a long (>350 base pairs) amplicon to one of the genomic loci in the pair. 7. Determine the efficiency of long amplicon primers on whole blood DNA as above. 8. Calibrate the efficiency of the short and long amplicon primers until the same efficiency is achieved. Efficiency can be altered by slightly changing the primer sequence, for example, by adding / removing bases from the 5' or 3' end of the primer. Alternatively or additionally, primer concentrations can be adjusted to achieve comparable efficiencies.

[0049] The resulting primers amplify with equal efficiency (albeit using amplicons of different sizes) two genomic loci that are equally represented in plasma DNA.

[0050] Design of pairs of short and long amplicons, where the long amplicon is derived from a genomic locus that is under-represented in plasma DNA compared to the genomic locus of the short amplicon, can be performed, for example, as follows. 1. Select a random pair of genomic loci. 2. Design primer pairs for amplification that will generate short (approximately 100 base pairs) amplicons. 3. Determine the efficiency of the primers in PCR on whole blood DNA in singleplex (individual) reactions as described above. 4. Eliminate pairs of genomic loci for which the primers are not equally efficient and continue with pairs of genomic loci for which the primers are equally efficient. 5. For each pair of genomic loci, compare the copy numbers of the loci in the plasma DNA (as above) and select pairs with different copy numbers in which one of the loci is under-represented in the plasma DNA compared to the other. 6. For the selected pair of loci, design primers for long (>350 base pairs) amplicons for genomic loci found to be under-represented relative to the others. 7. Determine the efficiency of long amplicon primers on whole blood DNA as above. 8. Calibrate the efficiency of the short and long amplicon primers until the same efficiency is achieved. Efficiency can be altered by slightly changing the primer sequence, for example, by adding or deleting bases from the 5' or 3' end of the primer. Alternatively or additionally, primer concentrations can be adjusted to achieve comparable efficiencies.

[0051] As detailed above, the efficiency of primer / PCR reaction can be measured by known methods (for example, by generating a standard curve and calculating the efficiency based on the slope of the standard curve) and can be expressed as a number or a percentage. As used herein, the term "equivalent efficiency" in relation to amplification efficiency / primer efficiency refers to exactly the same efficiency (for example, the same percentage efficiency), and also refers to a difference in efficiency of up to 5%. "Equivalently efficient primers" encompasses adjusting the primer sequence and / or concentration in the reaction to achieve equivalent efficiency. Primers with equivalent efficiency advantageously avoid bias in results due to primer efficiency.

[0052] As used herein, the term "equally represented in plasma DNA" in reference to a genomic locus refers to a genomic locus that has the same copy number in plasma DNA. This term includes exactly the same representation (i.e., exact copy number), and also includes up to a 5% difference in representation. The term "underrepresented in plasma DNA" referring to a specific locus compared to another locus refers to this specific locus having a lower copy number in plasma DNA compared to other loci. This term indicates a difference in representation of more than 5%.

[0053] Copy number can be measured by known methods, for example, as detailed above.

[0054] The CG content of the amplified sequences may be taken into consideration when designing short and long amplification products for use in the methods of the invention, for example, in some embodiments, the CG content of each amplification product is less than 50%.

[0055] Plasma sample processing As used herein, the terms "whole blood" and "blood" refer to a blood sample that has not been fractionated and contains both cellular components (red blood cells, white blood cells, and platelets) and fluid components.

[0056] The term "plasma" refers to the liquid that remains after a whole blood sample has been subjected to a separation process to remove blood cells.

[0057] According to some embodiments, the plasma sample analyzed using the methods of the present invention is derived from a human subject. According to some embodiments, the plasma sample is derived from a subject having a malignant disease, such as a specific type of cancer, or a subject suspected of having one or more types of malignant disease, such as cancer. According to additional embodiments, the plasma sample is derived from a healthy subject. As used herein, the term "healthy subject" refers to a subject who has not been diagnosed with a malignant disease, such as a specific type of cancer, and / or a subject who is not suspected of having cancer, and / or a subject who is unlikely to suffer from cancer.

[0058] The plasma sample may be a sample separated from whole blood using any separation method, exemplary procedures are described in the Examples section below, and the plasma sample may be a freshly isolated sample or a sample that has been stored for a period of time before analysis.

[0059] The terms "DNA from," "DNA obtained from," and the like refer to DNA isolated from a plasma sample (e.g., extracted from plasma using methods known in the art), as well as to a plasma sample intact, i.e., a plasma sample containing DNA.

[0060] In some embodiments, the methods of the invention include providing a plasma sample. In some embodiments, the methods of the invention include providing DNA from the plasma sample.

[0061] Generation of amplification products The methods disclosed herein, according to some embodiments, include co-amplifying a 70-150 base pair amplicon from a first genomic locus using a first primer pair and a 350-650 base pair amplicon from a second genomic locus using a second primer pair.

[0062] The first and second amplification products of the present invention are generated by amplification using pairs of reverse and forward primers designed as known in the art to specifically generate each amplification product.

[0063] The length of the first (short) amplification product is typically 70 to 150 base pairs, for example, 80 to 150 base pairs, 100 to 150 base pairs, or 100 to 130 base pairs. Each possibility is represented by a separate embodiment of the present invention.

[0064] The length of the second (longer) amplification product is at least 350 base pairs, typically 350-750 base pairs, 350-650 base pairs, 350-600 base pairs, 350-550 base pairs, or 400-500 base pairs, each possibility being represented by a separate embodiment of the present invention.

[0065] In some embodiments, the first amplification product comprises the sequence set forth in SEQ ID NO: 1. In some embodiments, the first amplification product consists of the sequence set forth in SEQ ID NO: 1. In some embodiments, the first amplification product comprises the sequence set forth in SEQ ID NO: 10. In some embodiments, the first amplification product consists of the sequence set forth in SEQ ID NO: 10.

[0066] In some embodiments, the second amplification product comprises the sequence set forth in SEQ ID NO: 2. In some embodiments, the second amplification product consists of the sequence set forth in SEQ ID NO: 2. In some embodiments, the second amplification product comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the second amplification product consists of the sequence set forth in SEQ ID NO: 7. In some embodiments, the second amplification product comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the second amplification product consists of the sequence set forth in SEQ ID NO: 8. In some embodiments, the second amplification product comprises the sequence set forth in SEQ ID NO: 9. In some embodiments, the second amplification product consists of the sequence set forth in SEQ ID NO: 9.

[0067] In some embodiments, the first and second amplification products comprise the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In further embodiments, the first and second amplification products consist of the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0068] In some embodiments, the primer pair that amplifies the first amplification product is SEQ ID NO: 3 (forward) and SEQ ID NO: 4 (reverse).

[0069] In some embodiments, the primer pair that amplifies the second amplification product is SEQ ID NO: 5 (forward) and SEQ ID NO: 6 (reverse).

[0070] In plasma samples contaminated with high levels of leukocyte DNA, both short and long DNA fragments are found in the sample, resulting in efficient amplification of both short and long amplicons. Plasma samples that are well separated from the cellular fraction of blood primarily (or exclusively) contain short cell-free DNA fragments. In such samples, short amplicons are amplified more efficiently than long amplicons. The better the separation of a plasma sample, the better the amplification of short amplicons compared to long amplicons, as reflected, for example, by an increase in the delta Cq value (Cq(long)-Cq(short)) between the Cq of the long amplicon and the Cq of the short amplicon after quantitative real-time PCR.

[0071] As used herein, the terms "genomic locus" and "locus" are interchangeable and refer to a DNA sequence at a specific location on a chromosome. A specific location may be identified by the location of the molecule, i.e., the number of start and end base pairs on the chromosome. A variant of a DNA sequence at a given genomic location is called an allele. Alleles of a locus are located at the same site on a homologous chromosome. A locus includes gene sequences and other genetic elements (e.g., intergenic sequences).

[0072] As used herein, "amplification" refers to an increase in the copy number of one or more nucleic acid sequences of interest. Amplification is typically carried out by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture that may contain a DNA template, a polymerase (usually Taq polymerase), dNTPs, primers, and an appropriate buffer supplemented with a probe (if necessary), as known in the art.

[0073] As used herein, the term "polynucleotide" includes a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The term "oligonucleotide" is also used herein to include a polymeric form of nucleotides, typically up to 100 bases in length.

[0074] The terms "amplification product" and "amplicon" are used interchangeably and collectively refer to nucleic acid molecules of a specific target sequence that are produced and accumulated in an amplification reaction. This term generally refers to nucleic acid molecules generated by PCR using a given set of amplification primers.

[0075] As used herein, "primer" defines an oligonucleotide that can anneal (hybridize) with a target sequence, thereby generating a double-stranded region that can serve as a starting point for DNA synthesis under appropriate conditions.The term "primer pair" refers to a pair of oligonucleotides that are selected to be used together in amplifying a selected nucleic acid sequence by one of several types of amplification processes, preferably PCR.As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0076] Primers may be of any suitable length depending on the specific assay format and specific needs. In some embodiments, primers may comprise at least 15 nucleotides in length, preferably 19 to 25 nucleotides in length. Primers may be adapted to be particularly suitable for a selected nucleic acid amplification system. As is generally known in the art, oligonucleotide primers may be designed by taking into account the melting point of their hybridization with their target sequence.

[0077] The methods disclosed herein involve the simultaneous amplification of multiple target sequences (first and second amplification products) in the same reaction mixture, a process known as multiplex amplification or co-amplification. This process requires the simultaneous use of two primer pairs. As is known in the art, primers may be designed to function at the same annealing temperature during amplification. In some embodiments, primers with similar melting temperatures (Tm) are used in the methods disclosed herein. A Tm variation of approximately 3-5°C is considered acceptable for primers used in pools.

[0078] According to some embodiments, amplification of genomic loci is carried out using real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), with simultaneous amplification and detection of amplification products.

[0079] In some embodiments, detection of amplification products in RT-PCR may be achieved using polynucleotide probes, usually fluorescently labeled polynucleotide probes.

[0080] As used herein, the terms "polynucleotide probe" and "oligonucleotide probe" are interchangeable and refer to a labeled polynucleotide that is complementary to a specific subsequence within the nucleic acid sequence of a locus of interest, e.g., within the first (short) and second (long) genomic loci described herein. In some embodiments, detection is achieved using TaqMan assays based on combined reporter and quencher molecules (Roche Molecular Systems Inc.). In such assays, polynucleotide probes have a fluorescent moiety (fluorophore) attached to their 5' end and a quencher attached to their 3' end. During PCR amplification, polynucleotide probes selectively hybridize to target sequences on a template, and as the polymerase replicates the template, the 5'-nuclease activity of the polymerase also cleaves the polynucleotide probe. When the polynucleotide probe is intact, the proximity of the quencher and fluorescent moiety typically results in low background fluorescence levels. When the polynucleotide probe is cleaved, the quencher is separated from the fluorescent moiety, resulting in an increase in fluorescence intensity. The fluorescent signal correlates with the amount of amplification product, ie, the signal increases as amplification product accumulates.

[0081] As used herein, "selectively hybridize" (and "selective hybridization," "specifically hybridize," and "specific hybridization") refers to binding, duplexing, or hybridizing of a nucleic acid molecule (such as a primer or probe) preferentially to a particular complementary nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions under which a nucleic acid molecule hybridizes preferentially to its target sequence and to a lesser extent to other non-target sequences, or does not hybridize at all to other non-target sequences. "Stringent hybridization" in the context of nucleic acid hybridization is sequence-dependent and will vary under different conditions, as is known in the art.

[0082] Polynucleotide probes may vary in length. In some embodiments, polynucleotide probes may comprise 15-30 bases. In additional embodiments, polynucleotide probes may comprise 25-30 bases. In some embodiments, polynucleotide probes may comprise 20-30 bases, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases. Each possibility is represented by a separate embodiment of the present invention.

[0083] Polynucleotide probes may be designed to bind to either strand of the template. Additional considerations include the Tm of the polynucleotide probe being compatible with the primer probe. Computer software may be used to design primers and probes.

[0084] As noted above, the methods disclosed herein involve the simultaneous amplification of multiple target sequences in the same reaction mixture. Polynucleotide probes labeled with different fluorescent colors may be used to distinguish between the multiple target sequences being amplified in parallel.

[0085] In some embodiments, the polynucleotide probes form fluorophore / quencher pairs known in the art, including, for example, FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0086] In some embodiments, the dye combination may be compatible with the RT-PCR thermocycler of choice.

[0087] In some embodiments, fluorescence may be monitored during each PCR cycle to provide an amplification plot showing the change in fluorescent signal from the probe as a function of cycle number.

[0088] In the context of RT-PCR, the following terms are used: "Quantification cycle" ("Cq") refers to the cycle number at which fluorescence increases above a threshold fluorescence, set automatically by the software or manually by the user. In some embodiments, the threshold fluorescence may be constant for all amplicons or may be set in advance before running the amplification and detection. In other embodiments, the threshold fluorescence may be defined separately for each amplicon after a run based on the maximum fluorescence level detected for that amplicon during the amplification cycle. In some embodiments, the threshold fluorescence may be above baseline fluorescence and / or above background noise, as well as a value within the exponential growth phase of the amplification plot. "Baseline" refers to the early cycles of PCR where there is little or no change in fluorescence.

[0089] Computer software may be used to analyze the amplification plot and determine the baseline, threshold and Cq.

[0090] In the plasma component that is sufficiently separated from cellular components and has no cellular DNA or residual cellular DNA, there is practically no template DNA for amplifying long amplicons.After PCR using the first and second primer pairs, short amplicons are amplified with high efficiency, but when long amplicons exist, a very small amount of amplification product is formed.In the amplification plot, the Cq value of short amplicons (amplification products are detected after a relatively small number of amplification cycles) is low, and the Cq value of long amplicons (amplification products are detected after a relatively large number of amplification cycles) is high.

[0091] In plasma samples contaminated with cellular genomic DNA, the higher the degree of contamination, the lower the Cq values ​​of the longer amplicons.

[0092] The difference between the Cq of the short amplicon and the Cq of the long amplicon indicates the quality of separation of the plasma sample.

[0093] Determining the efficiency of the separation The efficiency of plasma separation is determined based on the difference in signal intensity, such as the difference in Cq values ​​between short and long amplification products after real-time PCR.

[0094] The term " signal intensity " used herein refers to the measure that reflects the amount of sequence-specific amplification product, which corresponds to the amount of the original copy of target sequence.However, signal intensity may not indicate the actual amount of amplification product / target sequence, and may not include the calculation of the absolute amount of amplification product / target sequence.Therefore, in some embodiments, to calculate the signal intensity of amplification product, standard curve or reference DNA is not used, because it is not necessary to calculate the actual amount of DNA itself.

[0095] In some embodiments, amplification and detection of the amplicon is carried out by RT-PCR, where the signal intensity of a particular amplicon is represented by the Cq calculated for this amplicon.

[0096] In some embodiments, if there is no amplification or negligible amplification, Cq is determined to be "infinity." In some embodiments, in such cases, the value of delta Cq is set to 14.

[0097] In some embodiments, calculating the difference between the signal intensities of the first and second amplification products in the DNA sample comprises determining the Cq of each locus and calculating the difference between the Cq values ​​(ΔCq). In some embodiments, calculating the difference between the signal intensities of the two amplification products is performed by calculating Cq(long)-Cq(short).

[0098] For example, suppose the first (short) Cq of the first amplification product is "25" and the second (long) Cq of the second amplification product is "30": Cq(long)-Cq(short) is "5".

[0099] In some embodiments, computer software is used to calculate the difference between the Cq of the amplification products.

[0100] In some embodiments, the calculated delta Cq indicates that the tested plasma sample is sufficiently separated from whole blood if the calculated delta Cq exceeds a predetermined threshold delta Cq.

[0101] "Threshold delta Cq" refers to the delta Cq that distinguishes between well-separated plasma samples and insufficiently or unseparated plasma samples. The threshold is typically set to reflect leukocyte DNA contamination below a certain amount or percentage that does not interfere with cell-free DNA analysis. As noted above, various diagnostic applications involving cell-free DNA analysis may require different levels of plasma purity (i.e., may be characterized by different acceptable levels of leukocyte DNA contamination). For example, in some embodiments, the separated plasma sample contains less than 50% contaminating leukocyte DNA, less than 40% contaminating leukocyte DNA, less than 30% contaminating leukocyte DNA, less than 20% contaminating leukocyte DNA, less than 10% contaminating leukocyte DNA, less than 5% contaminating leukocyte DNA, or less than 1% contaminating leukocyte DNA. Each possibility is illustrated by a separate embodiment of the present invention.

[0102] The threshold ΔCq above which a plasma sample is determined to be separated may be set based on the requirements of a particular diagnostic assay.

[0103] For example, in some embodiments, the threshold ΔCq is 1 cycle, reflecting a 50:50 ratio between contaminating leukocyte DNA and cell-free DNA in the sample.

[0104] In some embodiments, the threshold ACq is about 1 cycle. In some embodiments, the threshold ACq is at least 1 cycle. In additional embodiments, the threshold ACq is at least 2 cycles. In yet additional embodiments, the threshold ACq is at least 3 cycles. In yet additional embodiments, the threshold ACq is at least 4 cycles.

[0105] In some embodiments, determining the threshold ΔCq includes (i) spiking plasma samples with varying amounts of buffy coat or whole blood DNA to obtain a series of plasma samples with varying degrees of leukocyte DNA contamination, (ii) performing real-time PCR on pairs of short amplicons for each sample and long amplicons for each sample and determining the Cq of each amplicon for each sample, and (iii) calculating the ΔCq for each sample (with each degree of leukocyte DNA contamination) and determining the threshold according to the maximum contamination allowed by the particular assay / application.

[0106] In some embodiments, the methods of the present invention include providing a threshold delta Cq.

[0107] In some embodiments, the threshold is a statistically significant value. Often, statistical significance is determined by comparing two or more populations and determining a confidence interval (CI) and / or p-value. In some embodiments, a statistically significant value refers to a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, with preferred p-values ​​being less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001. Each possibility is represented by a separate embodiment of the present invention. According to some embodiments, the threshold p-value is at most 0.05.

[0108] As used herein, the term "about," when referring to a measurable value, is meant to include a variation of + / - 10%, more preferably + / - 5%, even more preferably + / - 1%, and even more preferably + / - 0.1% from the specified value.

[0109] Kits and Systems In some embodiments, provided herein are kits for determining the efficiency of plasma separation from whole blood according to the methods of the present invention.

[0110] In an additional embodiment, provided herein is a system for determining the efficiency of plasma separation from whole blood according to the methods of the present invention.

[0111] In some embodiments, the kit includes a pair of primers for amplifying a first amplification product of 70-150 base pairs from a first genomic locus and a second amplification product of at least 350 base pairs from a second genomic locus, means for detecting the first and second amplification products, and instructions for performing a determination of plasma separation efficiency by a method disclosed herein. In some embodiments, the instructions may be electronic instructions.

[0112] In some embodiments, the instructions may provide a threshold delta Cq above which the plasma sample is determined to be separated.

[0113] In some embodiments, the instructions may include directions for performing the method steps described herein.

[0114] In some embodiments, the instructions may include instructions for indicating the correlation between delta Cq and separation.

[0115] In some embodiments, the instructions may include instructions for performing the determination of plasma separation using computer software stored on a computer-readable medium, the computer software instructing a computer processor to determine plasma separation based on a difference in signal intensities of the first and second amplification products.

[0116] In some embodiments, the kit may further include a computer-readable medium storing computer software that instructs a computer processor to determine plasma separation based on a difference in signal intensities of the first and second amplification products.

[0117] In some embodiments, the systems of the invention include (i) a first primer pair for generating a first amplification product of 70 to 150 base pairs by PCR from a first genomic locus, (ii) a second primer pair for generating a second amplification product of at least 350 base pairs by PCR from a second genomic locus, (iii) probes for detecting the first and second amplification products and determining the signal intensity of each amplification product, and (iv) computer software stored on a computer-readable medium that instructs a computer processor to determine plasma separation based on the difference in signal intensities of the first and second amplification products.

[0118] In some embodiments, the computer software of the present invention causes a computer processor to perform the steps of determining the signal intensity for each of the first and second amplification products and calculating the difference between the signal intensities. In some embodiments, the computer software further instructs the computer processor to compare the calculated difference with a predetermined threshold and output whether the plasma sample has been separated based on the comparison. In some embodiments, the computer software may instruct the computer processor to calculate at least one of Cq and delta Cq.

[0119] In some embodiments, the computer software receives input parameters or raw data from the real-time PCR run. In some embodiments, the computer software directs the computer processor to analyze the real-time PCR run to determine signal intensities (Cqs) and signal intensity differences (ΔCq).

[0120] Computer software includes processor-executable instructions stored on a non-transitory computer-readable medium. Computer software may also include stored data. The computer-readable medium is a tangible computer-readable medium such as a compact disc (CD), a magnetic storage device, an optical storage device, a random access memory (RAM), a read-only memory (ROM), or any other tangible medium.

[0121] In some embodiments, the system includes a processor configured to determine plasma separation based on a comparison of the calculated signal intensity difference between the first and second amplification products to a threshold signal intensity difference.

[0122] In some embodiments, the system includes a machine that performs the generation of the amplification product, such as a real-time PCR machine.

[0123] In some embodiments, the kit or system includes fluorescently labeled oligonucleotide probes complementary to subsequences within the first and second amplification products for detecting the first and second amplification products.

[0124] In some embodiments, the kit or system includes first and second primer pairs, each designed to selectively amplify a fragment of a genome to generate first and second amplification products, as described herein.

[0125] In some embodiments, the first primer pair is SEQ ID NO: 3 (forward) and SEQ ID NO: 4 (reverse).

[0126] In some embodiments, the second primer pair is SEQ ID NO: 5 (forward) and SEQ ID NO: 6 (reverse).

[0127] In some embodiments, the kit or system may further comprise at least one additional component necessary for amplification and detection of the amplification product, such as a DNA polymerase and a nucleotide mixture.

[0128] In some embodiments, the kit or system may further include appropriate reaction buffers and a written protocol for performing the assay. The written protocol may include instructions for performing any of the steps disclosed herein, including, but not limited to, PCR cycling parameters, Cq determination and analysis, and delta Cq thresholds.

[0129] It will be understood that the computer-related methods, steps, and processes described herein are implemented using software stored in non-volatile or non-transitory computer-readable instructions that, when executed, are configured to perform or instruct a computer processor or computer to perform instructions.

[0130] The following examples are presented to more fully illustrate certain embodiments of the present invention, but they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art can readily devise numerous variations and modifications of the principles disclosed herein without departing from the scope of the invention. [Example]

[0131] Example 1 - Testing of Plasma Samples The following pairs of short and long amplicons were designed to test DNA from plasma samples, leukocyte-contaminated plasma samples, and whole blood samples. "Short" (126 base pairs) (SEQ ID NO: 1): GTCTTTGTGACATTGAGTTACAGGGCTTTGACTCCTGGGTCTAAAAATTACACCAAATATTGTTAAATCTTAAACACTAACAGCAATTCAAGCCTCATCTTC AGGTCCTGGAGAAGATGCCAATAT

[0132] The short amplicon corresponds to positions 155565467 to 155565601 on chromosome 1 (according to hg18). The short amplicon was designed for amplification using the following primers: Forward (SEQ ID NO: 3): GTCTTTGTGACATTGAGTTACAG Reverse (SEQ ID NO: 4): ATATTGGCATCTTCTCCAGGAC "Long" (450 base pairs) (SEQ ID NO: 2): GTCAGCCTTTATTATCACTTTGCAATACAAAGAAAGCAAGGTGAAGACTAACTTTTCTCTTGTACAGAATCATCAGGCTAAATTTTTGGCATTATTTCAGTCCTTGGAGACATCTGAGAGATTCCGGGATGCCAGTGGTGCCTCTCTGGCCACACTGACAACAAATAATTCACCTAAGGAATAGTTCACTTCAGCTATTTTTTGCTACTCATTGGTTGTCAGTGC CATTGAGGAGAGCTCAGTGTAGATCAAAGAAAACGGTGTAGATCAAAGAAAACGGTGATTCGGTGATTGTTCCCCTTCTTCCAGCCACCCACCATCTGAACCTAATGCATCATTGTACAATGGCCGTAAAGGATGACAAGGGACTCAGCAATCAGTTCCTGGAGGAAATGATGCTGTGGCTTTTGGCTGGTGGCACCATCATCCTCAGTCATCAGTCAGAGTCA

[0133] The long amplicon corresponds to positions 121380810 to 121381259 on chromosome 7 (according to hg18). The long amplicon was designed for amplification using the following primers: Forward (SEQ ID NO: 5): GTCAGCTTTATTATCACTTTGC Reverse (SEQ ID NO: 6): TGACTCTGACTGATGACTGAGG

[0134] Blood samples were collected from human subjects and either processed to obtain plasma or plasma plus buffy coat (white blood cells and platelets) or kept unprocessed (whole blood).

[0135] To obtain plasma and buffy coat, the blood tubes (containing anticoagulant) were centrifuged at 1500 g for 10 minutes to separate the blood components. After centrifugation, the plasma layer was collected along with the buffy coat layer (white blood cells and platelets) and transferred to a new tube.

[0136] To obtain plasma samples, blood tubes (containing anticoagulant) were centrifuged at 1500 g for 10 minutes to separate blood components. After centrifugation, the plasma layer was collected (without accessing the buffy coat) and transferred to a new tube. The plasma was centrifuged again (1500 g for 10 minutes) and the pure plasma was transferred to a new tube.

[0137] DNA was extracted from the samples using a QIAamp® Circulating Nucleic Acid Kit, and the extracted DNA was subjected to real-time (RT)-PCR to amplify the short and long amplicons from each sample (co-amplification).

[0138] The amplification reaction (total volume 25 microliters) contained 2 microliters of extracted DNA (DNA concentration was not measured before amplification), 0.05–0.5 μM primers, dNTPs, and reaction buffer. To enable detection of amplification products during amplification, fluorescently labeled polynucleotide probes for each amplicon (FAM and JOE labels for long and short amplicons, respectively) were added to the reaction. Primer and probe concentrations for each amplicon were adjusted to achieve comparable efficiency. RT-PCR reactions were performed on an ABI 7500 FastDx instrument using the following PCR program: 95°C, 10 min -> 45X (95°C, 15 s) -> 60°C, 1 min.

[0139] After amplification, quantitative PCR plots showing the change in fluorescent signal from the probe as a function of cycle number were analyzed to calculate the quantification cycle (Cq) for each amplicon. ΔCq was calculated between the Cq of the long amplicon and the Cq of the short amplicon (Cq(long) - Cq(short)).

[0140] Figure 1A-C show exemplary quantitative PCR plots of short and long amplicon amplification products in DNA samples from plasma (Figure 1A, ΔCq = 3), plasma contaminated with leukocytes (Figure 1B, ΔCq = (-0.4)), and DNA from whole blood (Figure 1C, ΔCq = (-0.2)).

[0141] In plasma samples with very low amounts of DNA from leukocytes, long amplicons were amplified with low efficiency, rising approximately 3–4 cycles later than short amplicons.

[0142] In plasma samples contaminated with leukocytes and in whole blood samples with high levels of leukocyte DNA, long and short amplicons were amplified with similar efficiency, with the long amplicons rising in approximately the same cycles as the short amplicons.

[0143] The foregoing descriptions of specific embodiments fully reveal the general nature of the present invention, so that others, by applying their current knowledge, can easily modify and / or adapt such specific embodiments to various uses without undue experimentation and without departing from the general concept; therefore, such adaptations and modifications are intended to be understood within the meaning and range of equivalents of the disclosed embodiments. It should be understood that the phraseology or terminology used herein is for purposes of description and not limitation. The means, materials, and steps for carrying out the various disclosed chemical structures and functions may take a variety of alternative forms without departing from the invention.

Claims

1. A system for determining the efficiency of plasma separation from whole blood, comprising: (i) by PCR co-amplification; a first amplification product of 70 to 150 base pairs from a first genomic locus; and a second amplification product of at least 350 base pairs from a second genomic locus; a first primer pair and a second primer pair for generating: (ii) probes for detecting the first and second amplification products to determine the signal intensity for each amplification product; and (iii) computer software stored on a computer-readable medium, the computer software instructing a computer processor to determine plasma separation based on a difference in signal intensities of the first and second amplification products. Including, The system wherein the first and second amplification products generate distinct signal intensity differences for plasma DNA and whole blood DNA.

2. The computer software causes a computer processor to perform the following steps: (a) determining the signal intensity for each of the first and second amplification products; and / or (b) calculating the difference between the signal strengths The system of claim 1 , wherein the system instructs the user to execute:

3. The system described in claim 1, wherein the computer software receives input parameters or raw data for a real-time PCR run.

4. The system of claim 3, wherein the computer software instructs the computer processor to analyze real-time PCR runs to determine signal strength (Cqs) and signal strength difference (ΔCq).

5. The computer software is (c) comparing the calculated difference with a predetermined threshold; and / or (d) outputting whether the plasma sample is separated based on the comparison; The system according to any one of claims 2 to 4, further instructing the user to:

6. The system of claim 1, wherein the processor is configured to determine plasma separation based on a comparison of the calculated signal intensity difference between the first and second amplification products with a threshold signal intensity difference.

7. The system described in claim 1, comprising a machine for performing the generation of amplification products.

8. The system described in claim 7, comprising a real-time PCR machine.

9. The system described in claim 1, wherein the probe is a fluorescently labeled oligonucleotide probe.

10. The system described in claim 1, wherein the first amplification product comprises an array selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:

10.

11. The system described in claim 1, wherein the second amplification product comprises an array selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO:

9.

12. The system described in claim 1, wherein the first amplification product is 100 to 150 base pairs.

13. The system described in claim 1, wherein the second amplification product is 350 to 700 base pairs.

14. The system described in claim 1, wherein the second amplification product is 350 to 550 base pairs.

15. The system of claim 1, wherein the first and second primer pairs are of equal efficiency.

16. The system described in claim 1, wherein the first primer pair is sequence number 3 (forward) and sequence number 4 (reverse).

17. The system described in claim 1, wherein the second primer pair is sequence number 5 (forward) and sequence number 6 (reverse).

18. The system described in claim 1, wherein the first primer pair is sequence number 3 (forward) and sequence number 4 (reverse), and the second primer pair is sequence number 5 (forward) and sequence number 6 (reverse).

Citation Information

Patent Citations

  • Multiplexed assay for quantitating and assessing integrity of cell-free DNA in biological fluids for cancer diagnosis, prognosis and surveillance

    US20160186239A1