Compositions, methods, and kits for detecting Treponema pallidum

Abstract

Oligonucleotide hybridization probes, primer sets, methods, reaction mixtures, and kits for detecting the nucleic acid of Treponema pallidum, the causative agent of syphilis, are presented. The disclosed assays are highly sensitive and specific for detecting T. pallidum nucleic acids. T. pallidum nucleic acid sequences can be detected at 100% positive levels using test samples with only 30 copies / ml of model in vitro transcripts. The presence of potentially cross-reactive non-target microorganisms does not adversely affect the assay results.

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 891,181, filed August 23, 2019. The entire disclosure of the above prior application is incorporated herein by reference.

[0002] The present disclosure relates to the field of biotechnology. More particularly, the present disclosure relates to nucleic acid diagnostics. Even more particularly, the present disclosure relates to assays for detecting nucleic acids of T. pallidum, the infectious pathogen that causes syphilis. [Background technology]

[0003] Syphilis is a sexually transmitted disease caused by the spirochete Treponema pallidum. This motile bacterium can also infect the fetus via transplacental passage during the third trimester, resulting in congenital syphilis. The asymptomatic incubation period can last from 3 to 90 days (average 21 days), leaving a significant window between exposure and detectable infection. (Henao-Martinez et al., Neurol Clin Pract. 4(2):114-122(2014))

[0004] Traditional diagnostic testing has relied on a combination of clinical findings and serological assays. This may involve, for example, detecting antibodies against T. pallidum proteins. Different procedures may involve dark-field microscopy, PCR, and direct fluorescent antibody testing for T. pallidum. Although these tools are available in few clinical centers, it is possible to receive a diagnosis of syphilis before serological conversion (Henao-Martinez et al., (2014)).

[0005] An analysis of the complete genome sequence of T. pallidum was published by Fraser et al. in Science 281:375-388 (1998). Interestingly, the entire genome consists of only about 1.14 Mbp and contains 1041 open reading frames. This small genome size likely reflects the organism's reliance on many functions provided by its mammalian host. Given that the clinical manifestations of syphilis can vary widely and can be confused with other infections, and false-positive nontreponemal tests have been reported for other conditions (including pregnancy), a highly sensitive assay specific for T. pallidum is needed. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Henao-Martinez et al.,Nuerol Clin Pract.4(2):114-122(2014) [Non-patent document 2] Fraser et al., Science 281:375-388 (1998) Summary of the Invention

[0007] In a first aspect, the present disclosure relates to an oligonucleotide hybridization probe for detecting T. pallidum nucleic acids. The hybridization probe comprises a target hybridization sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, allowing for the substitution of RNA and DNA equivalent bases, and a detectable label attached thereto. The oligonucleotide hybridization probe is up to 47 bases in length. In some embodiments, the oligonucleotide hybridization probe further comprises a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety with a 2'-O-methyl substitution. In other embodiments, the oligonucleotide hybridization probe may further comprise a non-nucleotide linker and a pair of interactive labels. The oligonucleotide hybridization probe may be a molecular torch hybridization probe. For example, the pair of interactive labels may comprise a fluorophore moiety and a quencher moiety. In some embodiments, the non-nucleotide linker of the oligonucleotide hybridization probe is a C9 linker. In some embodiments, the target hybridizing sequence of the oligonucleotide hybridization probe is any of SEQ ID NOs: 22, 23, 24, 25, 26, and 27, each of which allows for the substitution of RNA and DNA equivalent bases. In some embodiments, the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO: 19 is the target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO: 21, or its complement, which allows for the substitution of RNA and DNA equivalent bases. For example, the target hybridizing sequence of the oligonucleotide hybridization probe can be any of SEQ ID NOs: 26 and 27, each of which allows for the substitution of RNA and DNA equivalent bases. In some embodiments, the oligonucleotide hybridization probe further comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

[0008] In a second aspect, the present disclosure relates to a primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence. The primer set includes a first primer having a target hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, the first primer being up to 50 bases in length. The primer set further includes a second primer having a target hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, the second primer being up to 50 bases in length, and at least one of the first and second primers including a phage promoter sequence linked upstream of the respective target hybridizing sequence. In some embodiments, the first primer includes a phage promoter sequence linked upstream of the first target hybridizing sequence. For example, the phage promoter sequence may include a T7 promoter sequence. In some embodiments, the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7. In some embodiments, the target hybridizing sequence of the first primer is either SEQ ID NO:7 or SEQ ID NO:8. In some embodiments, the target hybridizing sequence of the first primer is either SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8. In some embodiments, the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO:13. In some embodiments, the target hybridizing sequence of the second primer is SEQ ID NO:16. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO:14. In some embodiments, the target hybridizing sequence of the second primer is SEQ ID NO:17 or SEQ ID NO:16. In some embodiments, the target hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO:15.For example, the target-hybridizing sequence of the second primer can be SEQ ID NO: 18 or SEQ ID NO: 17. In some embodiments, the first primer is SEQ ID NO: 11 and the second primer is SEQ ID NO: 18. In some embodiments, the first primer is SEQ ID NO: 12 and the second primer is SEQ ID NO: 18.

[0009] In a third aspect, the present disclosure relates to a method for determining whether a sample contains T. pallidum nucleic acid, the method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, thereby producing an amplification product if the sample contains T. pallidum nucleic acid; (c) detecting any amplification product produced in step (b) using a detectably labeled oligonucleotide hybridization probe; and (d) determining from the result of step (c) whether an amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. In some embodiments, the detectably labeled hybridization probe comprises a target hybridization sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, allowing for substitution of RNA and DNA equivalent bases, and the oligonucleotide hybridization probe further comprises a detectable label up to 47 bases in length. In some embodiments, the detectably labeled hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interactive labels. In some embodiments, the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher. In some embodiments, the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker located at one end of the target hybridization sequence. In some embodiments, the detectably labeled hybridization probe further comprises at least one nucleotide analog comprising a fluorophore moiety, a quencher moiety, and a ribofuranosyl moiety with a 2'-O-methyl substitution.In some embodiments, the set of primers in step (a) includes a first primer and a second primer, wherein the first primer is up to 50 bases long and includes a target hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, and the second primer is up to 50 bases long and includes a target hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, and at least one of the first and second primers further includes a phage promoter sequence linked upstream of its respective target hybridizing sequence. In some embodiments, steps (a) and (b) occur simultaneously, and the amplification reaction is a real-time amplification reaction. In some embodiments, the amplification product detected in step (c) is an RNA amplicon of the opposite sense to T. pallidum 23S rRNA.

[0010] In a fourth aspect, the present disclosure relates to a reaction mixture for detecting T. pallidum nucleic acids that may be present in a test sample. The reaction mixture may include the test sample, an oligonucleotide primer set including a first primer and a second primer, where the first primer includes a base sequence complementary to at least 18 consecutive bases of SEQ ID NO:3, and the second primer includes a base sequence complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction, and a detectably labeled hybridization probe, where the probe includes a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction performed using the oligonucleotide primer set and a template including the base sequence of SEQ ID NO:1. In some embodiments, the detectably labeled hybridization probe is a molecular torch hybridization probe, each including a fluorophore, a quencher, and a non-nucleotide linker. In some embodiments, the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution. In some embodiments, the base sequence complementary to the amplicon allows for RNA and DNA equivalent base substitutions and is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. In some embodiments, the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:6. In some embodiments, the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO:3. In some embodiments, the promoter sequence is a T7 promoter sequence. In some embodiments, the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO:13.In some embodiments, the second primer comprises a 3' end selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 17, and SEQ ID NO: 16. In some embodiments, the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum. In some embodiments, the reaction mixture comprises an RNA amplicon hybridized to a molecular torch hybridization probe. In some embodiments, the nucleic acid amplification reaction is a transcription-associated amplification reaction. In some embodiments, the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

[0011] In a fifth aspect, the present disclosure relates to a kit of reagents for detecting T. pallidum nucleic acids. The kit may include a set of oligonucleotide primers, wherein a first primer of the set includes a target hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3, and a second primer of the set includes a target hybridizing sequence complementary to an extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction. The kit may further include a molecular torch hybridization probe up to 50 bases in length, including a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO:19 or its complement, and further including a fluorophore moiety, a quencher moiety, a non-nucleotide linker, and at least one nucleotide analogue containing a ribofuranosyl moiety with a 2'-O-methyl substitution. There may also be one or more reagents for performing an in vitro nucleic acid amplification reaction using the set of primers. In some embodiments, the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO:19, or its complement, is the target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO:21, or its complement. In some embodiments, the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27. In some embodiments, the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. In some embodiments, each of the first and second primers is up to 50 bases in length. In some embodiments, there is a phage promoter sequence linked upstream of the target hybridizing sequence of the first primer. In some embodiments, the phage promoter sequence is a T7 promoter sequence. In some embodiments, the target hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7. In some embodiments, the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.In some embodiments, the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. In some embodiments, the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. In some embodiments, the target-hybridizing sequence of the second primer is 17-20 contiguous bases of SEQ ID NO:13. In some embodiments, the one or more reagents comprise each of a reverse transcriptase and a T7 RNA polymerase. [Brief explanation of the drawings]

[0012] [Figure 1A] Figures 1A-1F are graphical real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1B] Figures 1A-1F are graphical real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1C] Figures 1A-1F are graphical real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1A shows results for System S2. Figure 1B shows results for System S3. Figure 1C shows results for System S4. [Figure 1D]Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acids, and "Tdent" refers to results obtained using T. denticola target nucleic acids. [Figure 1E] Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acids, and "Tdent" refers to results obtained using T. denticola target nucleic acids. [Figure 1F] Figures 1A-1F are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 1D shows results from System S5. Figure 1E shows results from System S6. Figure 1F shows results from System S7. In all cases, "Tpal" refers to results obtained using T. pallidum target nucleic acids, and "Tdent" refers to results obtained using T. denticola target nucleic acids. [Figure 2A] Figures 2A-2B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 2A shows the results of biphasic amplification using oligonucleotides from System S5. Figure 2B shows the results of biphasic amplification using oligonucleotides from System S7. [Figure 2B]Figures 2A-2B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 2A shows the results of biphasic amplification using oligonucleotides from System S5. Figure 2B shows the results of biphasic amplification using oligonucleotides from System S7. [Figure 3A] Figures 3A-3B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 3A demonstrates the sensitivity of the T. pallidum detection assay. Figure 3B demonstrates that detection of T. pallidum nucleic acids is highly specific. In all cases, "Tpal" refers to results obtained using the T. pallidum target nucleic acid. [Figure 3B] Figures 3A-3B are schematic real-time run curves showing background-subtracted fluorescence (y-axis) as a function of reaction time (x-axis). Figure 3A demonstrates the sensitivity of the T. pallidum detection assay. Figure 3B demonstrates that detection of T. pallidum nucleic acids is highly specific. In all cases, "Tpal" refers to results obtained using the T. pallidum target nucleic acid. DETAILED DESCRIPTION OF THE INVENTION

[0013] Preface and Overview The present disclosure provides a solution to the clinical need for a highly sensitive assay specific for T. pallidum. For example, the disclosure features a method useful for determining the presence of T. pallidum in a test sample obtained from a swab taken from an individual being tested for this bacterium. Specimens for determining the presence of T. pallidum can be obtained from the genital tract, cultures, bacterial lysates, and other sample media.

[0014] The present disclosure also provides a solution to the clinical need for T. pallidum-specific assays by featuring oligonucleotides useful for determining the presence of T. pallidum in test samples obtained, for example, from the human urethra, anal canal, respiratory tract, or lower genital tract. The featured oligonucleotides can be hybridization assay probes, capture probes, and / or amplification primers for detecting, immobilizing, and / or amplifying target nucleic acid sequences derived from T. pallidum in a test sample. Specifically disclosed are target regions for detecting T. pallidum in sequences derived from 23S rRNA or its complement.

[0015] In one embodiment of the present disclosure, a hybridization assay probe is provided that hybridizes to a 23S rRNA target region present in a nucleic acid derived from T. pallidum, or its complement, to form a detectable probe:target hybrid that indicates the presence of T. pallidum in a test sample. The primer and probe of this embodiment include an oligonucleotide having a target binding region, wherein the base sequence of the target binding region is contained within the base sequence of (SEQ ID NO: 1) or its complement, and which allows for RNA and DNA equivalent base substitutions and backbone modifications or analogs.

[0016] Oligonucleotide hybridization probes (or simply "probes") can be used, for example, under stringent hybridization assay conditions, to preferentially detect target nucleic acids over nucleic acids derived from non-T. pallidum organisms, particularly over nucleic acids derived from T. denticola.

[0017] The target binding region of preferred probes may comprise DNA, RNA, a combination of DNA and RNA, or may comprise a nucleic acid analog (e.g., peptide nucleic acid) or one or more modified nucleosides (e.g., a ribonucleoside having a ribofuranosyl moiety with a 2'-O-methyl substitution). Probes of the present disclosure are preferably oligonucleotides of at least 13 bases and up to 22, 25, 50, or even 100 bases in length. Most preferably, hybridization probes of the present disclosure are nucleic acids or nucleic acid analogs consisting of the recited sequences, optionally containing a detectable label or reporter group.

[0018] Although not required, the probe can contain a detectable label or a group of interactive labels. The label can be any suitable labeling substance, including, but not limited to, radioisotopes, enzymes, enzyme cofactors, enzyme substrates, dyes, haptens, chemiluminescent molecules, fluorescent molecules, phosphorescent molecules, electrochemiluminescent molecules, chromophores, base sequence regions that cannot stably bind to target nucleic acids under the conditions described, and mixtures thereof. Interactive label groups that can be used include, but are not limited to, enzyme / substrate, enzyme / cofactor, fluorophore / quencher, luminescent / adduct, dye dimers, and Forrester energy transfer pairs.

[0019] In some embodiments, the probe comprises a homogeneous detectable label, such as a chemiluminescent label, that can be detected in a homogeneous assay format. Examples of preferred chemiluminescent labels include acridinium ester labels.

[0020] In addition to the base sequence of the target binding region, the hybridization assay probe of the present disclosure may contain one or more base sequences that do not stably bind to nucleic acids derived from the target organism (i.e., T. pallidum) under stringent conditions. For example, the additional base sequence may constitute the immobilized probe binding region of a capture probe, which may be, for example, a 3' poly(dA) region that hybridizes to a 5' poly(dT) region of a polynucleotide directly or indirectly bound to a solid support under stringent conditions. The additional base sequence may also be a 5' sequence that is recognized by RNA polymerase or enhances initiation or elongation by RNA polymerase (e.g., a T7 promoter). When the first sequence is incorporated into, for example, a "molecular beacon" probe, multiple additional base sequences may be included. Molecular beacons are disclosed by Tyagi et al., "Detectably Labeled Dual Conformation Oligonucleotide Probes, Assays and Kits," U.S. Pat. No. 5,925,517, and comprise a target binding region bound by two base sequences having at least a partially complementary region. A "molecular torch" is yet another example of a dual-labeled structured hybridization probe that can be used to detect T. pallidum nucleic acid sequences or amplification products indicative of the presence of T. pallidum. As discussed elsewhere herein, molecular torch hybridization probes are disclosed by Becker et al. in U.S. Pat. No. 6,361,945. Molecular torches can comprise, for example, an additional base sequence directly linked to the target binding region by a non-nucleotide (e.g., C9) linker.

[0021] Also contemplated is a composition comprising a stable nucleic acid duplex formed between one or more oligonucleotides and nucleic acid amplification products under conditions that allow nucleic acid hybridization or nucleic acid amplification.For example, there can be naturally occurring rRNA template or RNA amplification products with opposite polarity to target, and the amplification products can be hybridized with synthetic oligonucleotides (such as primers or detectably labeled hybridization probes).In some embodiments, the hybridization probe can be a double-labeled hybridization probe that includes a fluorophore and a quencher.Such probes include molecular beacons, molecular torches, and hydrolysis probes.

[0022] In another embodiment, the present disclosure contemplates a probe mixture useful for determining whether T. pallidum organisms are present in a test sample. For example, to determine the presence of these organisms, the probe mixture can include one or more of the T. pallidum probes described herein.

[0023] In a further embodiment, the present disclosure provides a capture probe comprising at least one oligonucleotide comprising an immobilized probe-binding region and a target-binding region. The immobilized probe-binding region of the capture probe may comprise any base sequence capable of stably hybridizing to an oligonucleotide bound to a solid support present in a test sample under stringent conditions. Preferably, the immobilized probe-binding region is a poly(dA) homopolymer tail located at the 3' end of the capture probe. In this embodiment, the oligonucleotide bound to the solid support will comprise a 5' poly(dT) tail of sufficient length to stably bind to the poly(dA) tail of the capture probe under assay conditions. In a preferred embodiment, the immobilized probe-binding region comprises a poly(dA) tail approximately 30 adenines in length, and the capture probe comprises a spacer region approximately 3 thymines in length to connect the target-binding region and the immobilized probe-binding region to each other.

[0024] The present disclosure also features amplification primers useful for detecting the presence of T. pallidum nucleic acids in amplification assays. In one preferred embodiment, each amplification primer comprises an oligonucleotide, and the base sequence of the primer's target-binding region has or substantially corresponds to the base sequence contained in SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5. Specific examples of target-complementary oligonucleotide sequences used to prime nucleic acid synthesis are provided by SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. The amplification primers of the present disclosure optionally include a 5' promoter sequence that is recognized by RNA polymerase or enhances initiation or elongation by RNA polymerase. If included, a T7 promoter such as AATTTAATACGACTCACTATAGGGAGA (SEQ ID NO:9) is preferred. Specific examples of T7 promoter-primers disclosed herein include SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0025] The amplification primers of the present disclosure are preferably used in a set of at least two amplification primers. A preferred set includes a first amplification primer comprising an oligonucleotide having a target binding region, the base sequence of which comprises at least about 80% complementary (more preferably at least about 90% complementary, most preferably 100% complementary) to a region of at least 18 contiguous bases present in a target sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. Optionally, the first amplification primer includes a promoter sequence linked upstream of (e.g., at its 5' end) the target hybridizing sequence. The second amplification primer of these preferred sets includes an oligonucleotide having a target binding region, the base sequence of which comprises at least about 80% complementary (more preferably at least about 90% complementary, most preferably 100% complementary) to a region of at least 17 contiguous bases present in a target sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0026] The nucleic acid amplification product (i.e., "amplicon") synthesized by the combined use of the first and second amplification primers can be detected by the use of a labeled hybridization probe. In certain embodiments, the hybridization probe comprises a sequence of at least 13, 14, 16, or 22 contiguous bases of any of the sequences set forth in SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21, each of which allows for the substitution of its complement and RNA and DNA equivalent bases.

[0027] The present disclosure further features a method for determining whether T. pallidum is present in a test sample. In one embodiment, the method includes: (a) contacting the test sample with one of the hybridization assay probes for detecting T. pallidum (e.g., containing a nucleic acid amplification product) under conditions that allow the probe to preferentially hybridize to a target nucleic acid derived from T. pallidum, thereby forming a stable probe:target hybrid for detection; and (b) determining whether a hybrid is present in the test sample as an indication of the presence or absence of T. pallidum in the test sample. The method may further include quantifying the amount of hybrid present in the test sample as a means for estimating the amount of T. pallidum present in the test sample. Preferably, the probe includes a detectable label that produces a detectable signal indicating that the probe hybridizes to a nucleic acid derived from T. pallidum and not another species. For example, the signal may be at least 2-fold, at least 5-fold, at least 10-fold, or at least 500-fold stronger when the probe is hybridized to nucleic acid derived from T. pallidum compared to when the probe is hybridized to nucleic acid derived from T. pallidum.

[0028] The disclosure also features a method for amplifying a target nucleic acid sequence present in nucleic acid derived from T. pallidum present in a test sample, the method including: (a) contacting the test sample with at least one of the amplification primers described above under amplification conditions; and (b) amplifying the target nucleic acid sequence. Preferred amplification methods will include at least two sets of the amplification primers described above.

[0029] In one embodiment, a method for amplifying a target nucleic acid sequence present in nucleic acid derived from T. pallidum further includes (a) contacting a test sample with a hybridization assay probe that preferentially hybridizes to the target nucleic acid sequence, or its complement, under stringent hybridization conditions, thereby forming a stable probe:target hybrid for detection, and (b) determining whether a hybrid is present in the test sample as an indication of the presence or absence of T. pallidum in the test sample. This may include determining whether a nucleic acid amplification product is synthesized using primers according to the present disclosure. The above-described hybridization assay probes are particularly preferred for this method.

[0030] The present disclosure also features reaction mixtures that can be used to detect T. pallidum nucleic acids. These reaction mixtures can include a sample under test, a set of primers, and a detectably labeled hybridization probe. The primers and probes have sequences according to the disclosure and claims herein.

[0031] The present disclosure also features kits for amplifying a target nucleic acid sequence present in nucleic acid derived from T. pallidum, the kits including at least one of the amplification primers described above and one or more hybridization probes for detecting T. pallidum nucleic acid. In further embodiments, these kits may include at least one of the capture probes described above in addition to the amplification primers and hybridization probe. Such kits may further include a solid support material for immobilizing the capture probe in a test sample.

[0032] Detailed Description Oligonucleotides targeting nucleic acids derived from T. pallidum are disclosed herein, and the oligonucleotides are useful for determining the presence or absence of T. pallidum in a test sample. The oligonucleotides can aid in the detection of T. pallidum in different ways, such as by functioning as hybridization assay probes, capture probes, and / or amplification primers. The hybridization assay probes of the present disclosure can preferentially hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under stringent hybridization assay conditions to form detectable duplexes indicating the presence of T. pallidum in a test sample. Preferred probes can distinguish between a target organism and its closest known phylogenetic neighbor. The capture probes of the present disclosure can hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under stringent hybridization assay conditions and can be used to isolate target nucleic acids from clinical specimens. The amplification primers of the present disclosure can hybridize to target nucleic acid sequences present in nucleic acids derived from T. pallidum under amplification conditions and can be used as primers in amplification reactions to produce nucleic acids derived from T. pallidum. The probes and amplification primers can be used in assays to detect and / or quantitate T. pallidum in a test sample.

[0033] Those skilled in the art will understand that the hybridization assay probes of the present disclosure can be used as amplification primers or capture probes, that the target binding regions of the amplification primers of the present disclosure can be used as hybridization assay probes or capture probes, depending on the degree of specificity required by the particular assay, and that the target binding regions of the capture probes of the present disclosure can be used as hybridization assay probes or amplification primers, depending on the degree of specificity required by the particular assay. Thus, the present disclosure contemplates oligonucleotides for use in determining the presence or absence of T. pallidum in a test sample, comprising, consisting essentially of, or consisting of any of the nucleotide base sequences disclosed herein, optionally including one or more nucleotide analogs.

[0034] definition The following terms have the meanings specified herein unless expressly indicated to have a different meaning.

[0035] The terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, as used herein, "nucleic acid" is understood to refer to one or more nucleic acids. Thus, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0036] "Sample" or "test sample" refers to any material suspected of containing a target organism or nucleic acids derived from a target organism. This material can be, for example, an unprocessed clinical specimen such as sputum or a urethral specimen, a buffered medium containing the specimen, a medium containing a lysis agent for releasing the specimen and nucleic acids belonging to the target organism, or a medium containing nucleic acids derived from the target organism that have been isolated and / or purified in a reaction vessel or on a reaction material or device. As used herein, the terms "sample" and "test sample" can refer to the specimen in its raw form or any processing step to release, isolate, and purify nucleic acids derived from the target organism in the specimen.

[0037] As used herein, a "nucleotide" is a nucleic acid subunit consisting of a phosphate group, a five-carbon sugar, and a nitrogenous base (also referred to herein as a "nucleobase"). The five-carbon sugar found in RNA is ribose. In DNA, the five-carbon sugar is 2'-deoxyribose. The term also includes analogs of such subunits, such as a methoxy group at the 2' position of ribose (also referred to herein alternatively as "2'-O-methyl" or "2'-O-Me" or "2'-methoxy" or "2'-OMe").

[0038] "Analog" refers to two or more compounds that exhibit similar or related chemical structures. Despite sharing common structural similarities, analogs may have significantly different biochemical properties.

[0039] "Nucleic acid" and "polynucleotide" refer to polymeric compounds containing nucleotides or nucleotide analogs with nitrogenous heterocyclic bases or base analogs linked together to form polynucleotides, including polymers that are conventional RNA, DNA, mixed RNA-DNA, and their analogs. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar portion of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2' methoxy or 2' halide substitutions). The nitrogenous bases can be conventional bases (A, G, C, T, U), their analogs (e.g., inosine or others, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 th ed., 1992), purine or pyrimidine derivatives (e.g., N 4 -methyldeoxyguanosine, deaza or azapurines, deaza or azapyrimidines, pyrimidine bases with substituents at the 5th or 6th positions, purine bases with substituents at the 2nd, 6th, or 8th positions, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4-alkyl-pyrimidines (U.S. Pat. No. 5,378,825 and PCT Publication No. 93 / 13121). Nucleic acids can contain one or more "abasic" residues in which the backbone does not contain a nitrogenous base at any position in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or can contain both conventional components and substitutions (e.g., conventional bases with a 2' methoxy backbone, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide monomers with bicyclic furanose units locked into RNA that mimic the sugar configuration, which enhances hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Examples of oligomers that can affect the stability of hybridization complexes include PNA oligomers, oligomers containing 2'-methoxy or 2'-fluoro substituted RNA, or oligomers that affect the overall charge, charge density, or steric association of the hybridization complex, including oligomers containing charged linkages (e.g., phosphorothioates) or neutral groups (e.g., methylphosphonates). Unless otherwise indicated, 5-methylcytosine can be used with any of the aforementioned backbones / sugars / linkages, including RNA or DNA backbones (or mixtures thereof). When referring to a range of lengths for an oligonucleotide, amplicon, or other nucleic acid, it is understood that the range includes all integers (e.g., a length of 19 to 25 contiguous nucleotides includes 19, 20, 21, 22, 23, 24, and 25).

[0040] "Oligomer," "oligonucleotide," or "oligo" generally refers to a nucleic acid of less than 1,000 nucleotides (nt), including those in a size range having a lower limit of about 2-5 nucleotides and an upper limit of about 500-900 nucleotides. Some specific embodiments are oligomers in a size range having a lower limit of about 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides and an upper limit of about 50-60 nucleotides, while other specific embodiments are in a size range having a lower limit of about 10-20 nucleotides and an upper limit of about 22-100 nucleotides. Oligomers may be purified from naturally occurring sources or synthesized using any well-known enzymatic or chemical method. The term "oligonucleotide" does not imply any specific function of the reagent, but rather is used generically to encompass all such reagents described herein. Oligonucleotides can serve a variety of different functions. For example, if an oligonucleotide is specific to a complementary strand, can hybridize to it, and can be further extended in the presence of nucleic acid polymerase, it can function as a primer; if an oligonucleotide comprises the sequence that is recognized by RNA polymerase and allows transcription, it can function as a primer and provide a promoter (for example, T7 primer); if an oligonucleotide can hybridize to target nucleic acid or its amplicon and further provide a detectable moiety (for example, acridinium-ester compound), it can function to detect target nucleic acid.Oligomers can be referred to by their functional names (for example, capture probe, primer, or promoter-primer), but those skilled in the art will understand that these terms refer to oligomers.

[0041] Oligonucleotides of defined sequences can be produced by techniques known to those skilled in the art, for example, by chemical synthesis or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules (e.g., bacterial or retroviral vectors).As intended by the present disclosure, oligonucleotides may not consist of wild-type chromosomal DNA or its in vivo transcription products.For example, oligonucleotide hybridization probes can include non-nucleotide linkers and / or detectable labels not found in naturally occurring nucleic acids.

[0042] "Detection probe oligomer," "detection probe," or "probe" refers to an oligomer that specifically hybridizes to a target sequence, including an amplification sequence, under conditions that promote nucleic acid hybridization for the detection of a target nucleic acid. Detection can be either direct (i.e., a probe hybridized directly to the target or its amplification product) or indirect (i.e., a probe hybridized to an intermediate structure that connects the probe to the target or its amplification product). Detection probes can be DNA, RNA, analogs thereof, or combinations thereof (e.g., DNA / RNA chimeras), and they can be labeled or unlabeled. Detection probes can further include alternative backbone linkages (e.g., 2'-O-methyl linkages). The target sequence of a probe generally refers to the specific sequence within a larger sequence to which the probe specifically hybridizes. Detection probes can include target-specific and non-target-specific sequences. Such non-target specific sequences may include sequences that will impart desired secondary or tertiary structure, such as a hairpin structure, that can be used to facilitate detection and / or amplification (see, e.g., U.S. Patent Nos. 5,118,801, 5,312,728, 6,835,542, and 6,849,412). Probes of defined sequences may be produced by techniques known to those of skill in the art, such as by chemical synthesis and by in vitro or in vivo expression from recombinant nucleic acid molecules.

[0043] "Label" or "detectable label" refers to a moiety or compound directly or indirectly attached to a probe that is detected or provides a detectable signal. Direct attachment can use covalent or non-covalent interactions (e.g., hydrogen bonding, hydrophobic or ionic interactions, and chelate or coordinate complex formation), while indirect attachment can use a bridging moiety or linker (e.g., via an antibody or additional oligonucleotide). Any detectable moiety can be used, including radionuclides, ligands such as biotin or avidin, or even polynucleotide sequences, enzymes, enzyme substrates, reactive groups, chromophores such as dyes or particles (e.g., latex or metal beads) that impart a detectable color, luminescent compounds (e.g., bioluminescent, phosphorescent, or chemiluminescent compounds), and fluorescent compounds or moieties (i.e., fluorophores). Embodiments of fluorophores include those that absorb light in the range of about 495-650 nm and emit light in the range of about 520-670 nm, including those known as FAM™, TET™, CAL FLUOR™ (Orange or Red), and QUASAR™ compounds. Fluorophores can be used in combination with a quencher molecule that absorbs light when in close proximity to the fluorophore, thereby reducing background fluorescence. Such quenchers are well known in the art and include, for example, BLACK HOLE QUENCHER™ (or BHQ™) compounds or TAMRA™ compounds. Certain embodiments include "homogeneous detectable labels" that are detectable in a homogeneous system, in which bound labeled probes in a mixture exhibit a detectable change compared to unbound labeled probes, allowing the label to be detected without physically removing hybridized from unhybridized labeled probes (e.g., U.S. Pat. Nos. 5,283,174, 5,656,207, and 5,658,737). Certain homogeneous detectable labels include chemiluminescent compounds, including acridinium ester ("AE") compounds, such as well-known standard AEs or AE derivatives (U.S. Pat. Nos. 5,656,207, 5,658,737, and 5,639,604).The methods of synthesizing labels, binding labels to nucleic acids, and detecting signals from labels are well known (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) Chapter 10, and U.S. Patent Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174, and 4,581,333, and European Patent Application No. 0 747 706). Certain methods of binding AE compounds to nucleic acids are known (e.g., see U.S. Patent No. 5,585,481 and U.S. Patent No. 5,639,604, column 10, line 6 to column 11, line 3, and Example 8). Specific AE labeling locations are the central region of the probe and near the region of A / T base pairs, the 3' or 5' end of the probe, or at or near mismatch sites with known sequences that the probe should not detect compared to the desired target sequence. Other detectably labeled probes include TaqMan™ probes, molecular torches, and molecular beacons. TaqMan™ probes contain donor and acceptor labels, where fluorescence is detected when the probe is enzymatically degraded during amplification to release the fluorophore from the presence of the quencher. Molecular torches and beacons exist in open and closed configurations, with the closed configuration quenching the fluorophore and the open position separating the fluorophore from the quencher, allowing fluorescence. Hybridization to the target nucleic acid opens the otherwise closed probe.

[0044] "Stable," "stable," or "stable for detection" means that the temperature of the reaction mixture is at least 2°C below the melting temperature of the nucleic acid duplex. More preferably, the temperature of the reaction mixture is at least 5°C below the melting temperature of the double-stranded nucleic acid, and even more preferably, at least 10°C below the melting temperature of the reaction mixture.

[0045] "Substantially homologous," "substantially corresponding," or "substantially corresponding" means that the subject oligonucleotide has a base sequence containing at least about 80% homology, preferably at least about 90% homology, and most preferably 100% homology, with a 10-base region present in a reference base sequence (excluding RNA and DNA equivalents). (Those skilled in the art will readily understand the appropriate modifications that can be made to hybridization assay conditions at various percentages of homology to allow hybridization of the oligonucleotide to the target sequence while preventing a level of nonspecific hybridization sufficient to interfere with the detection of the target nucleic acid.) The degree of similarity is determined by comparing the order of the nucleic acid bases constituting the two sequences, and does not take into account other structural differences that may exist between the two sequences, as long as the structural differences do not prevent hydrogen bonding with complementary bases. The degree of homology between two sequences can also be expressed in terms of the number of base differences between each set of at least 10 contiguous bases compared, which can be 0, 1, or 2 base differences.

[0046] "Substantially complementary" means that the subject oligonucleotide has a base sequence containing a region of at least 10 contiguous bases that is at least 80% complementary, preferably at least 90% complementary, and most preferably 100% complementary to a region of at least 10 contiguous bases present in a target nucleic acid sequence (excluding RNA and DNA equivalents). Those skilled in the art will readily understand the appropriate modifications that can be made to hybridization assay conditions at various percentages of complementarity to allow hybridization of an oligonucleotide to a target sequence while preventing a level of nonspecific hybridization sufficient to interfere with detection of the target nucleic acid. The degree of complementarity is determined by comparing the order of the nucleic acid bases that make up the two sequences, without taking into account other structural differences that may exist between the two sequences, provided that the structural differences do not prevent hydrogen bonding with complementary bases. The degree of complementarity between two sequences can also be expressed in terms of the number of base mismatches present in each set of at least 10 contiguous bases compared, which can be 0, 1, or 2 base mismatches.

[0047] The temperatures, concentrations, and times discussed in this disclosure are preceded by the implicit "about" and it will be understood that small, non-substantial deviations are within the scope of the present teachings. In general, the term "about" indicates non-substantial variations in the amounts of components of a composition that do not have any significant effect on the activity or stability of the composition. All ranges should be interpreted as including the endpoints unless expressly excluded, such as "excluding the endpoints." Thus, for example, "within 10 to 15" includes the values ​​10 and 15.

[0048] "RNA and DNA equivalents" refer to RNA and DNA molecules that have essentially the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar moieties (i.e., ribose versus deoxyribose) and may further differ by the presence of uracil in RNA and thymine in DNA. Because RNA and DNA equivalents have the same degree of complementarity for a specific sequence, differences between RNA and DNA equivalents do not contribute to differences in homology.

[0049] "RNA and DNA equivalent base" refers to a nucleotide base that has the same complementary base pair hybridization properties in RNA and DNA. Here, the base uracil can be used instead of the base thymine, or vice versa, and therefore uracil and thymine are RNA and DNA equivalent bases. The polynucleotide base sequence 5'-AGCT-3', which allows for the substitution of RNA and DNA equivalent bases, would also describe the sequence 5'-AGCU-3'. Because RNA and DNA equivalents have the same degree of complementarity for a particular sequence, differences between RNA equivalent bases and DNA equivalent bases do not contribute to differences in homology.

[0050] The term "complement" refers to a nucleic acid molecule that contains a contiguous nucleic acid sequence (in standard nucleotide sequences, A:T, A:U, C:G) that is complementary to a contiguous nucleic acid sequence of another nucleic acid molecule. For example, 5'-AACTGUC-3' is the complement of 5'-GACAGTT-3'.

[0051] As used herein, a "target nucleic acid" (or sometimes simply "target") is a nucleic acid containing a sequence to be amplified and / or detected. A target nucleic acid may be DNA or RNA, and may be either single-stranded or double-stranded. A target nucleic acid may contain other sequences besides the target sequence that may not be amplified. Examples of target nucleic acids include 16S rRNA and 23S rRNA. Claims may limit the target sequence to the specific meaning of the recited sequence, provided that complementary sequences are excluded.

[0052] The term "target sequence" as used herein refers to a specific nucleotide sequence of a target nucleic acid to be amplified and / or detected. "Target sequence" includes a complexing sequence to which an oligonucleotide (e.g., a priming oligonucleotide and / or a promoter oligonucleotide) is complexed during an amplification process (e.g., PCR, TMA). If the target nucleic acid is originally single-stranded, the term "target sequence" will also refer to a sequence complementary to the "target sequence" present in the target nucleic acid. If the target nucleic acid is originally double-stranded, the term "target sequence" refers to both the sense (+) strand and the antisense (-) strand.

[0053] "Target hybridizing sequence of bases" or "target hybridizing sequence" or "target-specific sequence" are used herein to refer to a portion of an oligomer configured to hybridize with a target nucleic acid sequence. Preferably, the target hybridizing sequence is configured to specifically hybridize with the target nucleic acid sequence. The target hybridizing sequence may be, but is not necessarily, 100% complementary to the portion of the target sequence to which it is configured to hybridize. The target hybridizing sequence may also contain inserted, deleted, and / or substituted nucleotide residues compared to the target sequence. Less than 100% complementarity of the target hybridizing sequence to the target sequence may occur, for example, when the target nucleic acid is multiple strains within a species, as in the case of an oligomer configured to hybridize to a sequence variant. It is understood that there are other reasons for configuring a target hybridizing sequence to have less than 100% complementarity to the target nucleic acid.

[0054] "Hybridization" or "hybridizing" refers to the ability of two fully or partially complementary nucleic acid strands to come together under specified hybridization assay conditions in a parallel or antiparallel orientation to form a stable structure having a double-stranded region. The two constituent strands of this double-stranded structure, sometimes called a hybrid, are held together by hydrogen bonds. These hydrogen bonds are most commonly formed between nucleotides containing the bases adenine and thymine or uracil (A and T or U) or cytosine and guanine (C and G) on a single nucleic acid strand, although base pairing can also occur between bases that are not members of these "canonical" pairs. Non-canonical base pairing is known in the art. See, e.g., R.L.P. Adams et al., The Biochemistry of the Nucleic Acids (11th ed. 1992).

[0055] "Preferentially hybridize" means that under stringent hybridization assay conditions, hybridization assay probes are capable of hybridizing to their target nucleic acids to form stable probe:target hybrids ("detectable hybrids") indicative of the presence of at least one organism of interest, without forming a sufficient number of detectable stable probe:non-target hybrids to indicate the presence of non-target organisms ("non-detectable hybrids"), particularly closely phylogenetically related organisms. Thus, the probes hybridize to the target nucleic acids to a sufficiently greater extent than non-target nucleic acids to enable one skilled in the art to accurately detect the presence (or absence) of T. pallidum-derived nucleic acids and distinguish their presence from the presence of closely phylogenetically related organisms in a test sample. Generally, decreasing the degree of complementarity between an oligonucleotide sequence and its target sequence will decrease the degree or rate of hybridization of the oligonucleotide to its target region. However, the inclusion of one or more non-complementary bases can enhance the ability of the oligonucleotide to distinguish non-target organisms.

[0056] Preferential hybridization can be measured using any of a variety of techniques known in the art, including, but not limited to, those based on luminescence, mass change, and changes in conductivity or turbidity.Several detection means are described herein, and one in particular is used in the examples provided below.Preferably, there is at least a 10-fold difference between the target hybridization signal and the non-target hybridization signal in the test sample, more preferably at least a 100-fold difference, and most preferably at least a 500-fold difference.Preferably, the non-target hybridization signal in the test sample is below the background signal level.

[0057] "Stringent hybridization assay conditions," "hybridization assay conditions," "stringent hybridization conditions," or "stringent conditions" refer to conditions that allow a hybridization assay probe to hybridize preferentially to target nucleic acids (preferably rRNA or rDNA) derived from T. pallidum over nucleic acids derived from closely related non-target microorganisms. Stringent hybridization assay conditions can vary depending on factors including the GC content and length of the probe, the degree of similarity between the probe sequence and the sequences of non-target sequences that may be present in the test sample, and the degree of similarity between the probe sequence and the target sequence. Hybridization conditions include temperature and the composition of the hybridization reagents or solutions. The Examples section below provides preferred hybridization assay conditions for detecting target nucleic acids derived from T. pallidum using the probes of the present disclosure, although other stringent conditions can be readily ascertained by one of skill in the art.

[0058] "Assay conditions" means conditions that allow stable hybridization of an oligonucleotide to a target nucleic acid. Assay conditions do not require preferential hybridization of an oligonucleotide to a target nucleic acid.

[0059] "Homogeneous detectable label" refers to a label that can be detected in a homogeneous manner by determining whether the label is on a probe hybridized to a target sequence. That is, a homogeneous detectable label can be detected without physically removing the unhybridized form of the label or the hybridized form from the labeled probe. When using a labeled probe to detect amplified nucleic acid, a homogeneous detectable label is preferred. Examples of homogeneous labels are described in detail in U.S. Patent No. 5,283,174 to Arnold et al., U.S. Patent No. 5,656,207 to Woodhead et al., and U.S. Patent No. 5,658,737 to Nelson et al. Preferred labels for use in homogeneous assays include chemiluminescent compounds (see, for example, U.S. Patent No. 5,656,207 to Woodhead et al., U.S. Patent No. 5,658,737 to Nelson et al., and U.S. Patent No. 5,639,604 to Arnold, Jr. et al.). Preferred chemiluminescent labels are acridinium ester ("AE") compounds, such as standard AE or its derivatives (e.g., naphthyl-AE, ortho-AE, 1- or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl-AE, ortho-dibromo-AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, ortho-methoxy(cinnamyl)-AE, ortho-methyl-AE, ortho-fluoro-AE, 1- or 3-methyl-ortho-fluoro-AE, 1- or 3-methyl-meta-difluoro-AE, and 2-methyl-AE).

[0060] "Homogeneous assay" refers to a detection procedure that does not require physical separation of hybridized from unhybridized probes before determining the degree of specific probe hybridization. Exemplary homogeneous assays, such as those described herein, can use molecular torches, molecular beacons, or other self-reporting probes that emit a fluorescent signal when hybridized to an appropriate target, chemiluminescent acridinium ester labels that can be selectively destroyed by chemical means when not present in the hybrid duplex, and other homogeneously detectable labels that will be familiar to those skilled in the art.

[0061] By "nucleic acid duplex," "duplex," "nucleic acid hybrid," or "hybrid" is meant a stable nucleic acid structure containing double-stranded hydrogen-bonded regions. Such hybrids include RNA:RNA, RNA:DNA, and DNA:DNA double-stranded molecules, and analogs thereof. The structure is sufficiently stable to be detectable by any known means.

[0062] An "amplification oligonucleotide" or "amplification oligomer" is an oligonucleotide that hybridizes to a target nucleic acid or its complement and participates in a nucleic acid amplification reaction (e.g., functions as a primer or promoter-primer). Particular amplification oligomers contain at least about 10 contiguous bases, and optionally at least 17, 18, 19, 20, 21, or 22 contiguous bases, that are complementary to a region of the target nucleic acid sequence or its complementary strand. The contiguous bases may be at least about 80%, at least about 90%, or fully complementary to the target sequence to which the amplification oligomer binds. Those skilled in the art will understand that recited ranges include all integers and rational numbers within the range (e.g., 92% or 98.377%). Particular amplification oligomers are about 17 to about 50 bases in length, or more preferably about 17 to about 22 bases in length, and may optionally contain modified nucleotides or extra base sequences not found in T. pallidum attached at the 5' end.

[0063] A "primer" is an amplification oligomer that hybridizes to a template nucleic acid and has a 3' end that is extended by a polymerase enzyme. Primers can optionally be modified (e.g., by including a 5' region that is non-complementary to the target sequence). Such modifications can include functional additions such as tags, promoters, or other non-target-specific sequences used or useful for manipulating or amplifying the primer or target oligonucleotide.

[0064] Within the context of transcription-mediated amplification, a primer modified with a 5' promoter sequence is referred to herein as a "promoter-primer." Those skilled in the art of molecular biology or biochemistry will understand that an oligomer capable of functioning as a primer can be modified to include a 5' promoter sequence and then function as a promoter-primer; similarly, any promoter-primer can serve as a primer regardless of its 5' promoter sequence. A promoter-primer modified to incorporate a 3' blocked end is referred to herein as a "promoter provider," which can hybridize to a target nucleic acid and provide an upstream promoter sequence that serves to initiate transcription, but does not provide a primer for oligo extension.

[0065] "Nucleic acid amplification" or "target amplification" or simply "amplification" refers to any in vitro procedure that produces multiple copies of a target nucleic acid sequence, or its complement, or fragments thereof (i.e., amplified sequences that contain less than the entire target nucleic acid). Examples of nucleic acid amplification procedures include transcription-related methods, such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), and others (e.g., U.S. Pat. Nos. 5,399,491, 5,554,516, 5,437,990, 5,130,238, 4,868,105, and 5,124,246), replicase-mediated amplification (e.g., U.S. Pat. Nos. 4,786,606, 4,786,606, and 5,124,246). 0), polymerase chain reaction (PCR) (e.g., U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), ligase chain reaction (LCR) (e.g., European Patent No. 0320308), helicase-dependent amplification (e.g., U.S. Pat. No. 7,282,328), and strand displacement amplification (SDA) (e.g., U.S. Pat. No. 5,422,252). Amplification can be linear or exponential. PCR amplification uses DNA polymerase, primers, and thermal cycling steps to synthesize multiple copies of two complementary strands of DNA or cDNA. LCR amplification uses at least four separate oligonucleotides to amplify a target and its complementary strand by using multiple cycles of hybridization, ligation, and denaturation. Helicase-dependent amplification uses a helicase to separate the two strands of a DNA duplex to produce a single-stranded template, followed by hybridization of a sequence-specific primer that hybridizes to the template and extension by DNA polymerase to amplify the target sequence. SDA uses a primer containing a restriction endonuclease recognition site that nicks one strand of a semi-modified DNA duplex containing the target sequence, followed by a series of primer extension and strand displacement steps to achieve amplification. Replicase-mediated amplification uses self-replicating RNA molecules and a replicase such as Qβ-replicase. While certain embodiments use PCR or TMA, it will be apparent to those skilled in the art that the oligomers disclosed herein can easily be used as primers in other amplification methods.

[0066] Transcription-associated amplification uses oligonucleotides containing DNA polymerase, RNA polymerase, deoxyribonucleoside triphosphates, ribonucleoside triphosphates, a promoter, and optionally other oligonucleotides to ultimately produce multiple RNA transcripts from a nucleic acid template (see, e.g., U.S. Pat. Nos. 5,399,491 and 5,554,516 to Kacian et al., U.S. Pat. No. 5,437,990 to Burg et al., PCT Publication Nos. 88 / 01302 and 88 / 10315 to Gingeras et al., U.S. Pat. No. 5,130,238 to Malek et al., U.S. Pat. Nos. 4,868,105 and 5,124,246 to Urdea et al., PCT Publication No. 94 / 03472 to McDonough et al., and PCT Publication No. 95 / 03430 to Ryder et al.). al.) Methods using TMA have been described in detail previously (e.g., U.S. Patent Nos. 5,399,491 and 5,554,516).

[0067] "Amplification conditions" means conditions that allow nucleic acid amplification. The Examples section below provides preferred amplification conditions for amplifying target nucleic acid sequences from T. pallidum using primers of the present disclosure in a transcription-mediated amplification method, although other acceptable amplification conditions can be readily determined by one of skill in the art depending on the particular amplification method desired.

[0068] "Reverse sense" or "reverse strand" means a nucleic acid molecule that is completely complementary to a reference or sense nucleic acid strand.

[0069] By "sense," "homogeneous sense," or "positive sense" is meant a nucleic acid molecule that is completely homologous to a reference nucleic acid molecule.

[0070] "Amplicon" refers to a nucleic acid molecule produced in a nucleic acid amplification reaction that is derived from a target nucleic acid. The amplicon contains a target nucleic acid sequence that can be of the same sense or opposite sense as the target nucleic acid. "Derived from" means that the referenced nucleic acid is obtained directly from the target organism or indirectly as a product of nucleic acid amplification, which can be, for example, an antisense RNA molecule that is not present in the target organism.

[0071] "Capture probe" refers to an oligonucleotide or a set of at least two oligonucleotides linked together that can hybridize to a target nucleic acid and an immobilized probe, thereby providing a means for immobilizing and isolating the target nucleic acid in a test sample. The portion of the capture probe that hybridizes to the target nucleic acid is called the "target binding region," and the portion of the capture probe that hybridizes to the immobilized probe is called the "immobilized probe binding region." While preferred capture probes hybridize to both the target nucleic acid and the immobilized probe under assay conditions, the target binding region and the immobilized probe binding region can be designed to hybridize to their respective target sequences under different hybridization conditions. In this way, the capture probe can be designed to first hybridize to the target nucleic acid under more favorable solution-phase kinetics before adjusting conditions to allow hybridization of the immobilized probe binding region to the immobilized probe. When the target binding and immobilized probe binding regions are provided on the same capture probe, they can be directly adjacent to each other on the same oligonucleotide, they can be separated from each other by one or more optionally modified nucleotides, or they can be linked to each other by a non-nucleotide linker.

[0072] "Target hybridizing sequence" or "target binding region" refers to the portion of an oligonucleotide that stably binds to a target sequence present in a target nucleic acid, the DNA or RNA equivalent of the target sequence, or the complement of the target sequence under assay conditions. Assay conditions can be stringent hybridization conditions or amplification conditions.

[0073] By "immobilized probe binding region" is meant the portion of an oligonucleotide that hybridizes to an immobilized probe under assay conditions.

[0074] In the claims, "homopolymer tail" means a consecutive base sequence of at least 10 identical bases (e.g., 10 consecutive adenines or thymines).

[0075] "Immobilized probe" refers to an oligonucleotide for binding a capture probe to an immobilized support. The immobilized probe is bound to a solid support either directly or indirectly by a bond or interaction, and remains stable under the conditions used to hybridize the capture probe to the target nucleic acid and the immobilized probe, whether the conditions are the same or different. The immobilized probe facilitates the separation of the bound target nucleic acid from unbound materials in the sample.

[0076] By "isolate" or "isolating" is meant that at least a portion of the target nucleic acid present in a test sample is concentrated in a reaction vessel, or on a reaction device or solid support (e.g., a test tube, cuvette, microtiter plate well, nitrocellulose filter, slide, or pipette tip) in a fixed or releasable manner such that the target nucleic acid can be purified without significant loss of target nucleic acid from the vessel, device, or support.

[0077] "Separate," "separating," "separating," or "purify," "purified," or "purifying" means that one or more components of a sample contained in or on a container, device, or carrier are physically removed from one or more other sample components present in or on the container, device, or carrier. Sample components that may be removed during a separation or purification step include proteins, carbohydrates, lipids, inhibitors, non-target nucleic acids, and unbound probes. Preferably, target nucleic acids bound to immobilized capture probes are retained in the sample during the separation or purification step.

[0078] "Species-specific" means that the referenced hybridization assay probe is capable of preferentially (e.g., under stringent hybridization assay conditions) detecting target nucleic acid sequences present in nucleic acids derived from organisms belonging to the species T. pallidum.

[0079] "Consisting essentially of" means that additional components, compositions, or method steps that do not materially alter the basic and novel characteristics of the invention may be included in the compositions, kits, or methods of the invention. Any component, composition, or method step that materially affects the basic and novel characteristics of the invention would not fall within the term. For example, additions or deletions to an oligonucleotide may be non-material changes that do not prevent the oligonucleotide from having its claimed properties (i.e., hybridizing preferentially to target nucleic acids over non-target nucleic acids under stringent hybridization assay conditions). An oligonucleotide may contain other nucleic acid molecules that are not involved in and do not affect hybridization of the probe to the target nucleic acid.

[0080] Hybridization conditions and probe design Hybridization reaction conditions, most importantly the hybridization temperature and salt concentration in the hybridization solution, can be selected to allow the hybridization assay probes of the present disclosure to hybridize preferentially to nucleic acids having target nucleic acid sequences derived from T. pallidum. At reduced salt concentrations and / or elevated temperatures (conditions of increased stringency), the degree of nucleic acid hybridization decreases as hydrogen bonds between paired nucleotide bases in double-stranded hybrid molecules are disrupted. This process is known as "melting."

[0081] Generally speaking, the most stable hybrids are those with the greatest number of contiguous perfectly matched (i.e., hydrogen-bonded) nucleotide base pairs. Such hybrids are usually expected to melt last as the stringency of hybridization conditions increases. However, double-stranded nucleic acid regions containing one or more mismatched, "non-canonical," or imperfect base pairs (resulting in weaker or nonexistent base pairing at that position in the nucleotide sequence of the nucleic acid) may remain sufficiently stable under relatively high stringency conditions, allowing nucleic acid hybrids to form and be detected in hybridization assays without cross-reacting with other unselected nucleic acids that may be present in the test sample.

[0082] Thus, depending on, on the one hand, the degree of similarity between the nucleotide sequence of the target nucleic acid and the nucleotide sequences of non-target nucleic acids belonging to phylogenetically distinct but closely related organisms, and, on the other hand, the degree of complementarity between the nucleotide sequence of a particular probe and the nucleotide sequences of the target and non-target nucleic acids, one or more mismatches will not necessarily overcome the ability of the oligonucleotides contained in the probe or primer to hybridize to the target nucleic acid but not to the non-target nucleic acid.

[0083] Hybridization assay probes of the present disclosure are characterized by the melting temperature (T m )(T m is defined as the temperature at which half of the potentially double-stranded molecules in a given reaction mixture are in a single-stranded denatured state) and the T of mismatched hybrids formed between the probe and the rRNA or rDNA of the phylogenetically most closely related organism not sought to be detected but expected to be present in the test sample. mThe sequences used in this comparison were chosen, selected, and / or designed to maximize the difference between the sequence of the target nucleic acid and the sequence of the target nucleic acid. Unlabeled amplification primers and capture probes need not have the extremely high degree of specificity of hybridization assay probes to be useful in this disclosure, but they are similarly designed to hybridize preferentially to one or more target nucleic acids over other nucleic acids under designated amplification or hybridization assay conditions. The sequences used in this comparison were determined in the laboratory or obtained from published sources.

[0084] Within rRNA molecules, there is a close relationship between secondary structure (caused in part by intramolecular hydrogen bonding) and function. This fact places constraints on evolutionary changes in the primary nucleotide sequence, ensuring that secondary structure is maintained. For example, if a base is changed in one "strand" of a double helix (both "strands" are part of the same rRNA molecule due to intramolecular hydrogen bonding), a compensatory substitution usually occurs in the primary sequence of the other "strand" to preserve complementarity (called covariance) and thus the necessary secondary structure. This allows two very different rRNA sequences to align based on both conserved primary sequence and also conserved secondary structural elements. Potential target sequences for the hybridization assay probes described herein were identified by noting changes in homology between aligned sequences.

[0085] The mere identification of a putatively unique potential target nucleotide sequence does not guarantee that a functional, species-specific hybridization assay probe can be made to hybridize to T. pallidum rRNA or rDNA containing that sequence. A variety of other factors will determine the suitability of a nucleic acid locus as a target site for a species-specific probe. Because the extent and specificity of a hybridization reaction, such as those described herein, are influenced by several factors, manipulation of one or more of these factors will determine the exact sensitivity and specificity of a particular oligonucleotide, whether or not it is perfectly complementary to its target. The importance and impact of various assay conditions are known to those of skill in the art and are disclosed in Kohne, "Method for Detection, Identification and Quantitation of Non-Viral Organisms" (U.S. Pat. No. 4,851,330), Hogan et al., "Nucleic Acid Probes to Mycobacterium gordonae" (U.S. Pat. No. 5,216,143), and Hogan, "Nucleic Acid Probes for Detection and / or Quantitation of Non-Viral Organisms" (U.S. Pat. No. 5,840,488).

[0086] The desired hybridization temperature and hybridization solution composition (such as salt concentration, detergents, and other solutes) can also affect the stability of double-stranded hybrids. Conditions such as ionic strength and the temperature at which the probe will hybridize to the target must be considered when constructing species-specific probes. The thermal stability of hybrid nucleic acids generally increases with the ionic strength of the reaction mixture. On the other hand, chemical reagents that disrupt hydrogen bonds, such as formamide, urea, dimethyl sulfoxide, and alcohols, can significantly reduce the thermal stability of hybrids.

[0087] To maximize the specificity of the probe for its target, the probes of the present disclosure are designed to hybridize to their targets under high stringency conditions. Under such conditions, only single nucleic acid strands (or regions) with a high degree of complementarity will hybridize with each other. Single nucleic acid strands that do not have such a high degree of complementarity will not form a hybrid. Therefore, the stringency of the assay conditions determines the amount of complementarity that must exist between two nucleic acid strands to form a hybrid. The stringency is selected to maximize the difference in stability between the hybrid formed between the probe and the target nucleic acid and the potential hybrid between the probe and any non-target nucleic acid present in the test sample.

[0088] Appropriate specificity can be achieved by minimizing the length of hybridization assay probes that have perfect complementarity to sequences of non-target organisms, by avoiding G- and C-rich regions of complementarity to non-target nucleic acids, and by constructing the probe to contain as many destabilizing mismatches as possible to the non-target sequence. Whether a probe is suitable for detecting only a particular type of organism depends largely on the difference in thermal stability between the probe:target hybrid and the probe:non-target hybrid. These T m The difference between the values ​​should be as large as possible (preferably 2°C to 5°C or more). m Manipulation of the sequence can be achieved by varying probe length and probe composition, such as GC content versus AT content, or the inclusion of nucleotide analogs (e.g., ribonucleotides with 2'-O-methyl substitutions for ribofuranosyl moieties).

[0089] Generally, the optimal hybridization temperature for an oligonucleotide probe is about 5°C lower than the melting temperature of a given duplex. Incubation at a temperature lower than the optimal temperature may allow mismatched base sequences to hybridize, thus reducing specificity. The longer the probe and the more hydrogen bonds between base pairs, the higher the Tm Increasing the percentage of G and C also increases the thermal stability of T, because GC base pairs exhibit additional hydrogen bonding and therefore higher thermal stability than AT base pairs. m Such considerations are known in the art. See, for example, J. SAMBROOK ET AL., MOLECULAR CLONING: A LABORATORY MANUAL CH. 11 (2d ed. 1989).

[0090] T m A preferred method for determining T is to measure hybridization using the well-known hybridization protection assay (HPA) disclosed in Arnold et al., "Homogenous Protection Assay" (U.S. Patent No. 5,283,174). m can be measured using HPA in the following manner: A probe molecule is labeled with an acridinium ester, and an excess of target is used to form a probe:target hybrid in lithium succinate buffer (0.1 M lithium succinate buffer, pH 4.7, 20 mM EDTA, 15 mM aldrithiol-2, 1.2 M LiCl, 3% (vol / vol) ethanol absolute, 2% (wt / vol) lithium lauryl sulfate). An aliquot of the solution containing the probe:target hybrid is then diluted with lithium succinate buffer solution to obtain the expected T. m Incubate for 5 min at various temperatures, starting at a lower temperature (typically 55 °C) and increasing in 2-5 °C increments. Then, dilute this solution with a weakly alkaline borate buffer (600 mM boric acid, 240 mM NaOH, 1% (vol / vol) TRITON® X-100, pH 8.5) and incubate for 10 min at an equivalent or lower temperature (e.g., 50 °C).

[0091] Under these conditions, the acridinium ester attached to the single-stranded probe hydrolyzes, while the acridinium ester attached to the hybridized probe is relatively protected from hydrolysis. Thus, the amount of acridinium ester remaining after the hydrolysis process is proportional to the number of hybrid molecules. The remaining acridinium ester can be measured by monitoring the chemiluminescence produced from the remaining acridinium ester by adding hydrogen peroxide and alkali to the solution. The chemiluminescence can be measured with a luminometer such as the LEADER® 450i Luminometer (Gen-Probe Incorporated, San Diego, CA). The resulting data can be plotted as a percentage of the maximum signal (usually from the lowest temperature) versus temperature. T m is defined as the temperature at which 50% of the maximum signal remains. m can be determined by isotopic methods known to those skilled in the art (see, for example, US Pat. No. 5,840,488).

[0092] T of a given hybrid m Note that this will vary depending on the nature of the hybridization solution used. Factors such as salt concentration, detergents, and other solutes can affect hybrid stability during thermal denaturation (see, e.g., Chapter 11 of SAMBROOK ET AL. (supra)). Conditions such as ionic strength and the temperature at which the probe will hybridize to the target should be considered when constructing the probe. Generally speaking, the thermal stability of hybrid nucleic acids increases with the ionic strength of the reaction mixture. On the other hand, chemical reagents that disrupt hydrogen bonds, such as formamide, urea, dimethyl sulfoxide, and alcohols, can significantly reduce the thermal stability of hybrids.

[0093] To ensure the specificity of a hybridization assay probe for its target, it is preferable to design a probe that hybridizes only to the target nucleic acid under high stringency conditions. Only highly complementary sequences will form hybrids under high stringency conditions. Therefore, the stringency of the assay conditions determines the amount of complementarity required between two sequences to form a stable hybrid. The stringency should be selected to maximize the difference in stability between the probe:target hybrid and potential probe:non-target hybrids.

[0094] Examples of specific stringent hybridization conditions are provided herein. Of course, alternative stringent hybridization conditions can be determined by those skilled in the art based on the present disclosure. (See, e.g., Chapter 11 of SAMBROOK ET AL. (supra).)

[0095] The length of target nucleic acid sequence region, and therefore the length of probe sequence, can also be important.In some cases, there may be several sequences from a specific region, which differ in position and length, and can be used to design a probe with desired hybridization properties.In other cases, one probe may be significantly better in terms of specificity than another probe that differs only by a single base.Although nucleic acids that are not completely complementary can hybridize, the longest stretch of completely complementary bases and base composition will generally determine hybrid stability.

[0096] Regions of rRNA known to form strong internal structures inhibitory to hybridization are less preferred target regions. Similarly, probes with extensive self-complementarity are generally avoided. However, some degree of self-complementarity in probes may be desirable, such as hairpin probes such as molecular torches and molecular beacons discussed herein. If a strand is fully or partially contained in an intramolecular or intermolecular hybrid, it will be less likely to participate in the formation of new intermolecular probe:target hybrids without changes in reaction conditions. Ribosomal RNA molecules are known to form highly stable intramolecular helices and secondary structures through hydrogen bonding. Designing a probe to a region of the target nucleic acid that remains substantially single-stranded under hybridization conditions can increase the rate and extent of hybridization between the probe and target.

[0097] Genomic ribosomal nucleic acid (rDNA) targets naturally occur in double-stranded form, similar to the products of polymerase chain reaction (PCR). These double-stranded targets are naturally inhibitory to hybridization with probes and require denaturation before hybridization. Appropriate denaturation and hybridization conditions are known in the art (see, for example, Southern, EM, J. Mol. Biol., 98:503 (1975)).

[0098] Several formulas are available that will provide an estimate of the melting temperature of oligonucleotides perfectly matched to their target nucleic acid. One such formula is: T m =81.5+16.6(log 10 [Na + ])+0.41(Fraction G+C)-(600 / N) where N is the length of the oligonucleotide in number of nucleotides, and T of oligonucleotides between 14 nucleotides and 60-70 nucleotides in length. m From such calculations, T mSubsequent empirical validation or "fine-tuning" of the hybridization sequence can be performed using screening techniques well known in the art. For further information regarding hybridization and oligonucleotide probes, see SAMBROOK ET AL. (supra) Chapter 11. This reference provides, among other things well known in the art, the T m Thus, from the known nucleotide sequences of a given region of the ribosomal RNA (or rDNA) of two or more organisms, oligonucleotides can be designed that will distinguish these organisms from one another.

[0099] Preparation of oligonucleotides The hybridization assay probes, amplification primers, and capture probes of the present disclosure can be easily prepared by methods known in the art. Preferably, oligonucleotides are synthesized using solid-phase methods. Standard phosphoramidite solid-phase chemistry for linking nucleotides by phosphodiester bonds is disclosed in Caruthers et al., "Chemical Synthesis of Deoxynucleotides by the Phosphoramidite Method," Methods Enzymol., 154:287 (1987). Automated solid-phase chemical synthesis using cyanoethyl phosphoramidite precursors is described by Barone. See Barone et al., "In Situ Activation of bis-dialkylaminephosphines -- a New Method for Synthesizing Deoxyoligonucleotides on Polymer Supports," Nucleic Acids Res., 12(10):4051 (1984). Batt, in U.S. Patent No. 5,449,769, entitled "Method and Reagent for Sulfurization of Organophosphorous Compounds," discloses a procedure for synthesizing oligonucleotides having phosphorothioate linkages. Additionally, Riley et al., in U.S. Patent No. 5,811,538, entitled "Process for the Purification of Oligomers," disclose the synthesis of oligonucleotides having different linkages, including methylphosphonate linkages. Furthermore, methods for the organic synthesis of oligonucleotides are known to those skilled in the art and are described, for example, in Chapter 10 of SAMBROOK ET AL. (supra).

[0100] Following synthesis and purification of a particular oligonucleotide, several different procedures can be utilized to purify the oligonucleotide and control its quality. Suitable procedures include polyacrylamide gel electrophoresis or high pressure liquid chromatography. Both of these procedures are well known to those skilled in the art.

[0101] All of the oligonucleotides of the present disclosure, whether hybridization assay probes, amplification primers, or capture probes, can be modified with chemical groups to enhance their performance or facilitate the characterization of amplification products. For example, backbone-modified oligonucleotides that make the oligonucleotide resistant to the nucleolytic activity of certain polymerases or nuclease enzymes, such as oligonucleotides with phosphorothioate, methylphosphonate, 2'-O-alkyl, or peptide groups, can enable the use of such enzymes in amplification or other reactions. Another example of modification includes the use of non-nucleotide linkers that are incorporated between nucleotides in the nucleic acid chain of the probe or primer and do not prevent probe hybridization or primer hybridization and extension. See Arnold et al., "Non-Nucleotide Linking Reagents for Nucleotide Probes" (U.S. Patent No. 6,031,091). The oligonucleotides of the present disclosure can also contain a mixture of desired modifications and natural nucleotides.

[0102] The 3' terminus of an amplification oligonucleotide can be modified or blocked to prevent or inhibit the initiation of DNA synthesis as disclosed by Kacian et al. in U.S. Patent No. 5,554,516. The 3' terminus of an amplification oligonucleotide can be modified in a variety of ways well known in the art. By way of example, suitable modifications can include the addition of ribonucleotides, 3'-deoxynucleotide residues (e.g., cordycepin), 2',3'-dideoxynucleotide residues, modified nucleotides such as phosphorothioates, and non-nucleotide linkages, such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091 or alkane-diol modifications (see Wilk et al., "Backbone-Modified Oligonucleotides Containing a Butanediol-1,3 Moiety as a 'Vicarious Segment' for the Deoxyribosyl Moiety—Synthesis and Enzyme Studies," Nucleic Acids Res., 18(8):2065 (1990)), or the modification can simply consist of a region 3' of the priming sequence that is non-complementary to the target nucleic acid sequence. In addition, different 3'-blocked primers or mixtures of 3'-blocked or non-blocked primers can increase the efficiency of nucleic acid amplification, as disclosed therein.

[0103] The 5' end of the primer can be modified to be resistant to the 5'-exonuclease activity present in some nucleic acid polymerases. Such modification can be achieved by adding a non-nucleotide group to the terminal 5' nucleotide of the primer using techniques such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. To facilitate strand displacement, the 5' end can also be modified to include a non-complementary nucleotide, as disclosed by Dattagupta et al., "Isothermal Strand Displacement Nucleic Acid Amplification" (U.S. Pat. No. 6,087,133).

[0104] Once synthesized, selected oligonucleotides can be labeled by any of several well-known methods (see, e.g., SAMBROOK, supra, Chapter 10). Useful labels include radioisotopes and non-radioactive reporting groups. Isotopic labels include: 3 H, 35 S, 32 P, 125 I, 57 Co, and 14 C. Isotopic labels can be introduced into oligonucleotides by techniques known in the art, such as nick translation, end-labeling, second-strand synthesis, reverse transcription, and by chemical methods. When using radioactively labeled probes, hybridization can be detected by autoradiography, scintillation counting, or gamma counting. The detection method selected will depend on the specific radioisotope used for labeling.

[0105] Nonisotopic materials can also be used for labeling and can be introduced internally or at the end of a nucleic acid sequence. Modified nucleotides can be incorporated enzymatically or chemically. Chemical modification of probes can be performed during or after probe synthesis using non-nucleotide linker groups, for example, as disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. Non-isotopic labels include fluorescent molecules (individual labels or combinations of interacting labels, such as the fluorescence resonance energy transfer (FRET) pairs disclosed by Tyagi et al. in U.S. Pat. No. 5,925,517), chemiluminescent molecules, enzymes, cofactors, enzyme substrates, haptens, or other ligands. In some embodiments, the hybridization assay probes of the present disclosure are labeled with a non-nucleotide linker bearing an AE, such as a standard acridinium ester (AE). Acridinium ester labeling can be performed as disclosed by Arnold et al., "Acridinium Ester Labeling and Purification of Nucleotide Probes" (U.S. Pat. No. 5,185,439).

[0106] Nucleic Acid Amplification Preferably, the amplification primer of the present disclosure is an oligomer and is long enough to be used as a substrate for extension by nucleic acid polymerase.The optimal primer length should consider several factors, including reaction temperature, primer structure and base composition, and how the primer should be used.For example, for optimal specificity, oligonucleotide primers should generally be at least 12 bases long, depending on the complexity of the target nucleic acid sequence.When such specificity is not essential, shorter primers can be used.In such cases, it may be desirable to perform the reaction at a lower temperature to form a stable hybrid complex with the template nucleic acid.

[0107] Useful guidelines for designing amplification primers with desired characteristics are provided above in the section entitled "Preparation of Oligonucleotides." Optimal sites for amplification and probing include at least two, and preferably three, conserved regions of T. pallidum nucleic acid. These regions are approximately 15-350 bases in length, preferably approximately 15-150 bases in length.

[0108] The degree of amplification observed with a set of amplification primers (primer and / or promoter-primer) depends on several factors, including the ability of the primers to hybridize to their particular target sequence and their ability to be enzymatically extended or copied. While amplification primers of different lengths and base compositions can be used, preferred amplification primers in this disclosure have a target binding region of 17-22 bases and a predicted T m is preferably targeted to be above 42°C, preferably at least about 50°C.

[0109] Parameters that affect probe hybridization, such as the melting temperature, complementarity, and secondary structure of the target sequence, also affect amplification primer hybridization, which in turn affects the performance of the amplification primer. The degree of nonspecific extension (primer-dimer or non-target copy) can also affect amplification efficiency. Therefore, amplification primers are generally selected to have low self-complementarity or cross-complementarity, especially at the 3' end of their sequence. Amplification primers containing self-complementary regions, such as the self-reporting "signal primer" disclosed in Nadeau et al., "Detection of Nucleic Acids by Fluorescence Quenching" (U.S. Pat. No. 5,958,700) and the "hairpin primer" disclosed in Nazarenko et al., "Nucleic Acid Amplification Oligonucleotides with Molecular Energy Transfer Labels and Methods Based on Fluorescence Quenching" (U.S. Pat. No. 5,866,336), can be useful. To reduce false primer extension, long homopolymer runs and high GC content are avoided. Computer programs are available to aid in this aspect of the design, including Oligo Tech® analysis software available from Oligo Therapeutics, Inc.

[0110] The nucleic acid polymerase used with the amplification primers of the present disclosure refers to a chemical, physical, or biological agent that incorporates either ribonucleotides or deoxyribonucleotides, or both, into a nucleic acid polymer or strand in a template-dependent manner. Examples of nucleic acid polymerases include DNA-directed DNA polymerases, RNA-directed DNA polymerases, and RNA-directed RNA polymerases. DNA polymerases result in template-dependent nucleic acid synthesis in a 5' to 3' direction. Due to the typical antiparallel orientation of the two strands in double-stranded nucleic acids, this direction is from the 3' region on the template to the 5' region on the template. Examples of DNA-directed DNA polymerases include E. coli DNA polymerase I, thermostable DNA polymerase from Thermus aquaticus (Taq), and a large fragment of DNA polymerase I from Bacillus stearothermophilus (Bst). See, e.g., Riggs et al., "Purified DNA Polymerase from Bacillus stearothermophilus" (U.S. Patent No. 6,066,483). Examples of RNA-directed DNA polymerases include various retroviral reverse transcriptases, such as Moloney murine leukemia virus (MMLV) reverse transcriptase or avian myeloblastosis virus (AMV) reverse transcriptase.

[0111] During most nucleic acid amplification reactions, a nucleic acid polymerase uses the target nucleic acid as a template to add nucleotide residues to the 3' end of a primer, thus synthesizing a second nucleic acid strand with a nucleotide sequence that is partially or completely complementary to a region of the target nucleic acid. In many nucleic acid amplification reactions, the two strands comprising the resulting double-stranded structure must be separated by chemical or physical means in order for the amplification reaction to proceed. Alternatively, the newly synthesized template strand can be made available for hybridization with a second primer or promoter-primer by other means, such as strand displacement or the use of nucleases that digest part or all of the original target strand. In this way, this process can be repeated for several cycles, resulting in a significant increase in the number of nucleic acid molecules containing the target nucleotide sequence.

[0112] Either the first amplification primer or the second amplification primer, or both, can be promoter-primers. In some applications, the amplification primer can consist solely of a promoter-primer complementary to the sense strand, as disclosed in Kacian et al., "Nucleic Acid Sequence Amplification Method, Composition and Kit" (U.S. Patent No. 5,554,516). Promoter-primers typically contain an oligonucleotide segment that is not complementary to the nucleotide sequence present in the target nucleic acid molecule or primer extension product (see, for example, Kacian et al., "Nucleic Acid Sequence Amplification Methods" (U.S. Patent No. 5,399,491)). These non-complementary sequences can be located 5' to the complementary sequence on the amplification primer and, when double-stranded by the action of nucleic acid polymerase, can provide a locus for the initiation of RNA synthesis. Such a provided promoter can enable in vitro transcription of multiple RNA copies of the target nucleic acid sequence. Unless the context clearly dictates otherwise, all references to primers herein will be understood to include primers and promoter-primers.

[0113] A preferred amplification method is the transcription-mediated amplification method disclosed by Kacian et al., "Nucleic Acid Sequence Amplification Methods," U.S. Patent No. 5,480,784. According to this method, a promoter-primer having a 3' and 5' promoter region complementary to a portion of the target and a primer having the same nucleotide sequence as a portion of the target are contacted with a target RNA molecule. The primer and promoter-primer define the boundaries of the target region to be amplified, including both the sense present on the target molecule and its complement, and thereby the length and sequence of the amplicon. In this preferred embodiment, the amplification oligonucleotides and immobilized target RNA are contacted at 42°C in the presence of effective amounts of Moloney murine leukemia virus reverse transcriptase and T7 RNA polymerase, both ribonucleotide and deoxyribonucleotide triphosphates, and necessary salts and cofactors. Under these conditions, nucleic acid amplification occurs, resulting primarily in the production of RNA amplicons of the opposite sense to the target nucleic acid. These amplicons can then be detected in solution, for example, by using one or more detectably labeled hybridization probes. In some embodiments, the hybridization probe is an acridinium ester labeled hybridization probe of the same sense as the target nucleic acid and can be detected using HPA technology as disclosed by Arnold et al. in U.S. Pat. No. 5,283,174.

[0114] The 3' ends of the immobilized and capture probes are preferably "capped" or blocked to prevent or inhibit their use as substrates for nucleic acid polymerase activity. Capping can include 3' deoxyribonucleotides (such as cordycepin), 3',2'-dideoxynucleotide residues, non-nucleotide linkers such as those disclosed by Arnold et al. in U.S. Pat. No. 6,031,091, alkane-diol modifications, or non-3' terminal non-complementary nucleotide residues.

[0115] Those skilled in the art will recognize that the above methodology is suitable, either as described or with obvious modifications, for a variety of other amplification schemes, including, for example, polymerase chain reaction (PCR), Qβ replicase-mediated amplification, self-sustained sequence replication (3SR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), and ligase chain reaction (LCR).

[0116] Sample processing Sample processing prior to amplification or detection of a target sequence may be necessary or useful to distinguish the target sequence from non-target nucleic acids present in the sample. Sample processing procedures may include, for example, direct or indirect immobilization of nucleic acids and / or oligonucleotides from the solution phase in a heterogeneous assay. In some procedures, such immobilization may require multiple hybridization events. Ranki et al., in "Detection of Microbial Nucleic Acids by a One-Step Sandwich Hybridization Test," U.S. Pat. Nos. 4,486,539 and 4,563,419, for example, disclose a one-step nucleic acid "sandwich" hybridization method that includes the use of solid-phase-bound nucleic acids bearing a target-complementary sequence and labeled nucleic acid probes complementary to distinct regions of the target nucleic acid. Stabinsky, "Methods and Kits for Performing Nucleic Acid Hybridization Assays," U.S. Patent No. 4,751,177, discloses a method involving a "mediator" polynucleotide that reportedly overcomes the sensitivity problems associated with the Ranki method due to leakage of the immobilized probe from the solid support. Instead of directly immobilizing the target nucleic acid, Stabinsky's mediator polynucleotide is used to bind and indirectly immobilize target polynucleotide:probe polynucleotide complexes formed free in solution.

[0117] Any known solid support, such as a matrix or particle free in solution, can be used for sample processing. The solid support can be, for example, nitrocellulose, nylon, glass, polyacrylate, mixed polymers, polystyrene, silane polypropylene, and preferably magnetically attractable particles, which facilitate sample recovery and / or removal of unbound nucleic acids or other sample components. Particularly preferred supports are monodisperse (i.e., uniform in size within ±5%) magnetic spheres, which provide consistent results and are particularly advantageous for use in automated procedures. One such automated procedure is disclosed by Ammann et al., "Automated Process for Isolating and Amplifying a Target Nucleic Acid Sequence," U.S. Patent No. 6,335,166.

[0118] Oligonucleotides for immobilizing target nucleic acids on solid supports can be directly or indirectly bound to the solid support by any bond or interaction that is stable under assay conditions (e.g., conditions for amplification and / or detection). These oligonucleotides, referred to herein as "immobilization probes," can bind directly to the target nucleic acid or contain a base sequence region, such as a homopolymer tract (e.g., poly(dT)) or a simple short repetitive sequence (e.g., AT repeats), that hybridizes to a complementary base sequence region present on the capture probe. Direct binding occurs when the immobilization probe is bound to the solid support without an intermediate oligonucleotide. For example, direct binding can be via covalent bonding, chelation, or ionic interactions. Indirect binding occurs when the immobilization probe is bound to the solid support by one or more linkers. A "linker" is a means for linking at least two different molecules into a stable complex, containing one or more components of a binding partner set.

[0119] Members of a binding partner set can recognize and bind to each other. Binding partner sets can be, for example, receptors and ligands, enzymes and substrates, enzymes and cofactors, enzymes and coenzymes, antibodies and antigens, sugars and lectins, biotin and streptavidin, ligands and chelators, nickel and histidine, substantially complementary oligonucleotides, and complementary homopolymeric nucleic acids or homopolymeric portions of polymeric nucleic acids. Components of a binding partner set are regions of the members that participate in binding.

[0120] A preferred sample processing system, which has practical advantages in terms of its ease of use and speed, includes an immobilized probe containing a base sequence complementary to that of the capture probe, referred to herein as the "immobilized probe binding region." The capture probe further includes a base sequence, referred to herein as the "target binding region," that can specifically hybridize to a target sequence contained in the target nucleic acid under assay conditions. While specificity of the target binding region of the capture probe for the region of the target nucleic acid is desirable to minimize the number of non-target nucleic acids remaining from the sample after the separation step, it is not a requirement of the capture probe of the present disclosure when the capture probe is used solely to isolate the target nucleic acid. When the capture probe is not used to isolate the target nucleic acid for subsequent amplification of the target sequence, the capture probe may further include a detectable label attached within or near the target binding region, such as a substituted or unsubstituted acridinium ester. Labeled capture probes can be used in homogeneous or semi-homogeneous assays to specifically detect hybrid nucleic acids without detecting single-stranded nucleic acids such as the capture probe.

[0121] An advantage of this system is that only a single target-specific hybridization event (capture probe:target) is required for target detection, rather than multiple such events (e.g., capture probe:target and probe:target or probe:amplicon) as required in other sample processing procedures described herein. Also, because the overall rate at which a target nucleic acid is captured and detected is limited by the slowest hybridizing oligonucleotide, fewer oligonucleotides in the assay tend to make the assay faster and easier to optimize. While the target-binding region of the capture probe may be less specific in alternative assay systems, it must still be sufficiently rare to avoid significant saturation of the capture probe with non-target nucleic acids. Thus, the requirement that two separate, specific target sequences be identified in these alternative systems may impose constraints on the identification of the appropriate target. In contrast, when the capture probe simultaneously functions as a detection probe, only one such target sequence is required.

[0122] Regardless of which approach is adopted, the assay may include a means for detecting the presence of a target nucleic acid in a test sample. Various means for detecting a target nucleic acid, including means that do not require the presence of a detectable label, are well known to those skilled in the art of nucleic acid detection. Nevertheless, probes containing a detectable label are preferred. A labeled probe for detecting the presence of a target nucleic acid will need to contain a base sequence that is substantially complementary to and specifically hybridizes to a target sequence contained in the target nucleic acid. Once the probe is stably bound to the target nucleic acid and the resulting target:probe hybrid is directly or indirectly immobilized, unbound probe can be washed away or inactivated, and the remaining bound probe can be detected and / or measured.

[0123] Preferred sample processing systems combine elements of detection and nucleic acid amplification. These systems first immobilize the target nucleic acid directly or indirectly (e.g., using a capture probe), and the captured target nucleic acid is purified by removing cellular debris, non-target nucleic acids, and amplification inhibitors from the sample-containing vessel, followed by amplification of the target sequence contained in the target nucleic acid. The amplification product is then detected with a labeled probe, preferably in solution. The target nucleic acid can remain immobilized during amplification, or the T of the capture probe:target complex can be detected. m and / or the T of the capture probe:immobilized probe complex mThe capture probe can be eluted or separated from the solid support before amplification using appropriate conditions, such as first incubating at a temperature above 100°C. A preferred embodiment of this system is disclosed by Weisburg et al., "Two-Step Hybridization and Capture of a Polynucleotide," U.S. Patent No. 6,110,678. In this system, a capture probe hybridizes to a target nucleic acid, and an immobilized probe hybridizes to a capture probe:target complex under different hybridization conditions. Under a first set of hybridization conditions, hybridization of the capture probe to the target nucleic acid is preferred over hybridization of the capture probe to the immobilized probe. Thus, under this first set of conditions, the capture probe is in solution rather than bound to a solid support, thereby maximizing the concentration of free capture probe and utilizing solution-phase kinetics that favor hybridization to the target nucleic acid. After the capture probe has had sufficient time to hybridize to the target nucleic acid, a second set of hybridization conditions is imposed, allowing it to hybridize to the immobilized probe in the capture probe:target complex, thereby isolating the target nucleic acid in the sample solution. The immobilized target nucleic acid can then be purified, and the target sequence present in the target nucleic acid can be amplified and detected. When treating crude samples (e.g., clinical, environmental, industrial, food, water, etc.) to prevent enzyme inhibition and / or nucleic acid degradation by substances present in the sample, a purification procedure that includes one or more wash steps is generally desirable.

[0124] Capture probes for isolating ribosomal nucleic acids The capture probe of the present disclosure is designed to bind to and isolate nucleic acids derived from the 23S ribosomal nucleic acid of T. pallidum in the presence of non-target nucleic acids. As such, the capture probe comprises both a target binding region and an immobilized probe binding region. The target binding region of the capture probe comprises a base sequence that hybridizes to a target sequence derived from the 23S ribosomal nucleic acid of T. pallidum under assay conditions. Although not required, the target binding region preferably exhibits specificity for the target sequence in the presence of non-target nucleic acids under assay conditions. The immobilized probe binding region has a base sequence that hybridizes to an immobilized probe comprising a polynucleotide or a chimera comprising a polynucleotide sequence that is bound, either directly or indirectly, to a solid support present in the test sample. The target binding region and the immobilized probe binding region can be linked to each other directly or by, for example, a nucleotide base sequence, an abasic sequence, or a non-nucleotide linker.

[0125] In a preferred embodiment, a capture probe according to the present disclosure comprises a target-binding region comprising a base sequence region that is at least about 85% homologous (preferably at least about 90% homologous, more preferably at least about 95% homologous, and most preferably 100% homologous) to one of the capture probes disclosed herein. The immobilized probe-binding region of these preferred capture probes comprises a base sequence that hybridizes to an immobilized probe directly or indirectly bound to a solid support provided to a test sample under assay conditions. The immobilized probe-binding region preferably comprises a homopolymer region (e.g., poly(dA)) located at the 3' end of the capture probe that is complementary to a homopolymer region (e.g., poly(dT)) located at the 5' end of the immobilized probe. Other base sequences can be incorporated into the immobilized probe-binding region, including, for example, short repeat sequences.

[0126] To prevent undesired cross-hybridization reactions, the capture probes of the present disclosure preferably exclude nucleotide base sequences other than the nucleotide base sequence of the target binding region, which can stably bind to nucleic acids from any organism that may be present in the test sample under assay conditions. Consistent with this approach, to maximize immobilization of the capture probe:target complex formed, the nucleotide base sequence of the immobilized probe binding region is preferably designed to be capable of stably binding to the nucleotide base sequence present in the immobilized probe under assay conditions, rather than to nucleic acids from any organism that may be present in the test sample.

[0127] The target binding region of the capture probe and the immobilized probe binding region are such that the capture probe:target complex is the T of the capture probe:immobilized probe complex. m Higher than T m In this way, a first set of conditions can be imposed that favors hybridization of the capture probe to the target sequence over the immobilized probe, thereby providing optimal solution-phase hybridization kinetics for hybridization of the capture probe to the target sequence. Once sufficient time has passed for the capture probe to bind to the target sequence, a second set of less stringent conditions can be imposed that allows hybridization of the capture probe to the immobilized probe. Sets of conditions useful for these applications can be established by one of ordinary skill in the art using only routine experimentation.

[0128] Capture probes of the present disclosure can also include a label or an interactive label pair for direct detection of a target sequence in a test sample. Non-limiting examples of labels, combinations of labels, and means for labeling probes are described above.

[0129] Regardless of their application in direct detection assays, the most common use of capture probes is in isolating and purifying target nucleic acids prior to amplifying the target sequence contained therein. By isolating and purifying the target nucleic acid prior to amplification, the number of unintended amplification reactions (i.e., amplification of non-target nucleic acids) can be advantageously reduced. The 3' end of the capture probe can be capped or blocked to prevent or inhibit the capture probe itself from functioning as a substrate for nucleic acid polymerase activity in the presence of amplification reagents and under amplification conditions. Examples of capping agents include 3' deoxyribonucleotides, 3',2'-dideoxynucleotide residues, non-nucleotide linkers, alkane-diol modifications, and non-complementary nucleotide residues at the 3' end.

[0130] The following specific examples incorporated a target capture step to isolate and purify target nucleic acids prior to amplification of the target nucleic acid sequence. The capture probes in these examples had 5' target binding regions of SEQ ID NO:34, SEQ ID NO:35, and SEQ ID NO:36, and further contained 3' immobilized probe binding regions with 30-nucleotide-long poly dA tails, as given by SEQ ID NO:37, SEQ ID NO:38, and SEQ ID NO:39. The target binding regions of the capture probes were designed to bind to a region of the target nucleic acid that was distinct from the regions bound by the primers, promoter-primers, and hybridization assay probes. The solid support for this target capture assay was Sera-Mag™ MG-CM Carboxylate Modified (Seradyn, Inc., Indianapolis, Indiana, Cat. No. 24152105-050450), 1 micron, containing a covalently linked oligo(dT) that was capable of binding to the poly dA tail of the capture probe under hybridization conditions. 14The magnetic particles may be superparamagnetic particles having a pH of 10. Similar magnetic particles are disclosed by Sutor, "Process for Preparing Magnetically Responsive Microparticles," U.S. Pat. No. 5,648,124. To remove the particles from suspension and immobilize them along the inner wall of the sample tube, the tube was transferred to a magnetic separation rack as disclosed by Acosta et al. in U.S. Pat. No. 6,254,826. While the particles were immobilized, fluid was aspirated from the tube, and the tube was washed with a wash buffer as described below. The wash step can be repeated before adding the amplification and enzyme reagents described below for amplifying the target sequence. Between wash steps, the particles can be resuspended in a wash buffer.

[0131] Amplification of T. pallidum ribosomal nucleic acid The amplification primers of the present disclosure are directed to a region of the 23S ribosomal nucleic acid derived from T. pallidum. The amplification primers can be adjacent to, overlap with, or contained within at least one of the target nucleic acid sequences (or their complements) of the hybridization assay probes used to detect the presence of T. pallidum using nucleic acid amplification assays. As indicated above, the amplification primers can also contain non-complementary bases at their 5' ends, and can optionally contain a promoter sequence (e.g., a T7 promoter sequence) that can bind to RNA polymerase and induce RNA transcription using the target nucleic acid as a template.

[0132] The amplification primers of the present disclosure are capable of amplifying target nucleic acid sequences present in nucleic acids derived from T. pallidum. First strand amplification primers include oligonucleotides having a target hybridizing sequence of 18-22 contiguous bases of either SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and optionally including a 5' promoter sequence (e.g., SEQ ID NO:9). Exemplary first strand primers include a target hybridizing sequence of SEQ ID NO:8, SEQ ID NO:7, or SEQ ID NO:6. Second strand amplification primers include oligonucleotides having a target hybridizing sequence of 17-20 contiguous bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15. Exemplary second strand primers include a target hybridizing sequence of SEQ ID NO:18, SEQ ID NO:17, or SEQ ID NO:16.

[0133] Amplification primers of the present disclosure may have modifications such as blocked 3' and / or 5' ends (discussed above), or sequence additions including, but not limited to, specific nucleotide sequences recognized by RNA polymerases (e.g., promoter sequences for T7, T3, or SP6 RNA polymerases), sequences that enhance the initiation or elongation of RNA transcription by RNA polymerases, or sequences that provide intramolecular base pairing and can promote the formation of secondary or tertiary nucleic acid structures.

[0134] Amplification primers are used in nucleic acid amplification procedures such as polymerase chain reaction (PCR), Q replicase-mediated amplification, self-sustained sequence replication (3SR), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), ligase chain reaction (LCR), strand displacement amplification (SDA), and loop-mediated isothermal amplification (LAMP), each of which is well known in the art. See, for example, Mullis, "Process for Amplifying Nucleic Acid Sequences," U.S. Pat. No. 4,683,202; Erlich et al., "Kits for Amplifying and Detecting Nucleic Acid Sequences," U.S. Pat. No. 6,197,563; Walker et al., "Strand Displacement Amplification—an Isothermal, In Vitro DNA Amplification Technique," Nucleic Acids Res., 20(7):1691-1696 (1992); Fahy et al., "Self-sustained Sequence Replication (3SR): An Isothermal Transcription-Based Amplification System Alternative to PCR," PCR Methods and Applications, 1:25-33 (1991); Kacian et al., U.S. Pat. No. 5,399,491; Davey et al., "Nucleic Acid Amplification Process”, U.S. Patent No. 5,554,517, Birkenmeyer et al., “Amplification of Target Nucleic Acids Using Gap Filling Ligase Chain Reaction”, U.S. Patent No. 5,427,930, Marshall et al.See, for example, W., "Amplification of RNA Sequences Using the Ligase Chain Reaction," U.S. Pat. No. 5,686,272; Walker, "Strand Displacement Amplification," U.S. Pat. No. 5,712,124; Notomi et al., "Process for Synthesizing Nucleic Acid," U.S. Pat. No. 6,410,278; Dattagupta et al., "Isothermal Strand Displacement Amplification," U.S. Pat. No. 6,214,587; and Helen H. Lee et al., Nucleic Acid Amplification Technologies: Application to Disease Diagnosis (1997). Although not specifically indicated, other amplification procedures that meet the definition of "nucleic acid amplification" are also contemplated by the inventors.

[0135] The amplification primers of the present disclosure are preferably unlabeled, but may contain one or more reporter groups to facilitate detection of target nucleic acids in combination with or without hybridization assay probes. A wide variety of methods are available for directly detecting amplified target sequences. For example, nucleotide substrates or primers can contain detectable labels that are incorporated into newly synthesized DNA. The resulting labeled amplification products are then generally separated from unused labeled nucleotides or primers, and the labels are detected in the separated product fractions. See, for example, Wu, "Detection of Amplified Nucleic Acid Using Secondary Capture Oligonucleotides and Test Kit," U.S. Patent No. 5,387,510.

[0136] If the primer is modified, for example, by attaching two dyes that form a donor / acceptor dye pair (i.e., a pair of interactive labels), no separation step is required. The modified primer can be designed so that the fluorescence of one dye pair member remains quenched by the other dye pair member unless the primer hybridizes to the target nucleic acid, thereby physically separating the two dyes. Furthermore, the primer can be further modified to include a restriction endonuclease recognition site positioned between the two dyes, so that when a hybrid is formed between the modified primer and the target nucleic acid, the restriction endonuclease recognition site becomes double-stranded and available for cleavage or nicking by the appropriate restriction endonuclease. Cleavage or nicking of the hybrid then separates the two dyes, resulting in a change in fluorescence due to reduced quenching, which can be detected as an indication of the presence of the target organism in the test sample. Such modified primers are disclosed by Nadeau et al., "Detection of Nucleic Acids by Fluorescence Quenching," U.S. Patent Nos. 5,958,700 and 6,054,279.

[0137] Substances that can function as useful detectable labels are well known in the art and include radioisotopes, fluorescent molecules, chemiluminescent molecules, chromophores, and ligands such as biotin and haptens, which are not directly detectable but can be readily detected by reaction with labeled forms of their specific binding partners (e.g., avidin and antibodies, respectively).

[0138] Another approach is to detect amplification products by hybridizing with a detectably labeled probe and measuring the resulting hybrid by any conventional method.For example, the product can be assayed by hybridizing a chemiluminescent acridinium ester-labeled probe to target sequence, selectively hydrolyzing the acridinium ester present on unhybridized probe, and measuring the chemiluminescence produced from the remaining acridinium ester with a luminometer.See, for example, Arnold et al., U.S. Patent No. 5,283,174, and Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch.17 (Larry J. Kricka ed., 2nd ed.1995).

[0139] Hybridization assay probes to T. pallidum ribosomal nucleic acid Disclosed herein are novel hybridization assay probes useful for detecting nucleic acids (e.g., nucleic acid amplification products) derived from T. pallidum. Hybridization is the association of two single strands of complementary nucleic acid to form a hydrogen-bonded duplex. A nucleic acid sequence capable of hybridizing to a nucleic acid sequence desired to be detected (the "target sequence") can serve as a probe for the target sequence. Hybridization can occur between complementary nucleic acid strands, including DNA / DNA, DNA / RNA, and RNA / RNA. Two single strands of deoxyribo-(DNA) or ribo-(RNA) nucleic acid, formed from nucleotides containing the bases adenine (A), cytosine (C), thymidine (T), guanine (G), uracil (U), inosine (I), and their analogs, can hybridize to form a double-stranded structure in which the two strands are held together by hydrogen bonds between pairs of complementary bases. Generally, A is hydrogen bonded to T or U, and G is hydrogen bonded to C. Thus, at any point along the hybridized strand, the classical base pairs AT or AU, TA or UA, GC or CG may be found. Thus, if a first single strand of nucleic acid contains enough contiguous bases complementary to a second, and the two strands are brought together under conditions that will promote their hybridization, a double-stranded nucleic acid will result. Under appropriate conditions, DNA / DNA, RNA / DNA, or RNA / RNA hybrids may be formed.

[0140] The rate and extent of hybridization are affected by many factors. For example, if one of the two strands is fully or partially contained in the hybrid, it implies that it is less able to participate in the formation of new hybrids. By designing the probe so that a significant portion of the sequence of interest is single-stranded, the rate and extent of hybridization can be significantly increased. Also, if the target is an integrated genomic sequence, it will naturally occur in double-stranded form, as in the case of PCR products. These double-stranded targets are naturally inhibitory to hybridization with the probe and require denaturation before the hybridization step. In addition, if there is sufficient self-complementarity, intramolecular hybrids may form within the probe. Regions of nucleic acids known to form strong internal structures that are inhibitory to hybridization are typically less preferred. Examples of such structures include hairpin loops. Undesirable secondary structures in hybridization assay probes can be avoided through careful probe design, and commercial computer programs, such as Oligo Tech® analysis software available from Oligo Therapeutics, Inc., are available to search for these types of interactions.

[0141] In some applications, such as homogeneous assays, probes that exhibit at least some degree of self-complementarity may be desirable to facilitate the detection of probe:target duplexes in test samples. As discussed hereinabove, such probes comprise "molecular torches" that are designed to contain distinct regions of self-complementarity, called "target binding domains" and "target closing domains." These two domains are connected by a binding region in the molecular torch and hybridize to each other under hybridization assay conditions. The binding region can be a non-nucleotide linker, such as polyethylene glycol. Molecular torches are disclosed by Becker et al., "Molecular Torches," U.S. Patent No. 6,361,945.

[0142] Upon exposure to denaturing conditions, the two complementary regions (which may be fully or partially complementary) of the molecular torch melt, making the target binding domain available for hybridization to the target sequence when the original hybridization assay conditions are restored. The molecular torch is designed so that the target binding domain preferentially hybridizes to the target sequence over the target closing domain. The target binding domain and target closing domain of the molecular torch contain interactive labels (e.g., fluorophores / quenchers) positioned so that when the molecular torch is self-hybridized, it produces a different signal than when the molecular torch is hybridized to the target nucleic acid, thereby enabling detection of the probe:target duplex in a test sample in the presence of an unhybridized probe having a viable label associated therewith.

[0143] In accordance with the teachings of Becker et al. in U.S. Pat. No. 6,361,945, hybridization assay probes of the present disclosure can be designed and constructed to include a "target closing domain," a "binding region," and an interactive label characteristic of a molecular torch, in addition to a "target binding domain" capable of distinguishing between nucleic acids derived from T. pallidum.

[0144] Another example of a self-complementary hybridization assay probe is a "molecular beacon." A molecular beacon contains a nucleic acid molecule having a target-complementary sequence, an affinity pair (or nucleic acid arms) that holds the probe in a closed conformation in the absence of the target nucleic acid sequence, and a label pair that interacts when the probe is in the closed conformation. Hybridization of the target nucleic acid with the target-complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable by reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Examples of various molecular beacon configurations and applications are disclosed by Tyagi et al. in U.S. Pat. No. 5,925,517. Following the teachings of Tyagi et al., probes according to the present disclosure can be designed and constructed to contain, in addition to a "target-complementary sequence" that can distinguish between nucleic acids derived from T. pallidum, an "affinity pair" and dual labels characteristic of molecular beacons.

[0145] In the case of hybridization assays, the length of the target nucleic acid sequence, and therefore the length of the probe sequence, can be important. In some cases, several sequences from a particular region may be present, varying in location and length, resulting in a probe with the desired hybridization properties. In other cases, one sequence may have better hybridization properties than another that differs by only a single base. While it is possible for nucleic acids that are not perfectly complementary to hybridize, the longest stretch of perfectly homologous base sequence will usually primarily determine hybrid stability. While probes of different lengths and base compositions can be used, preferred probes have oligonucleotides up to 100 bases in length, more preferably 13-50 bases in length, and even more preferably 13-22 bases in length.

[0146] The hybridization assay probe comprises a base sequence substantially complementary to a 23S rRNA or rDNA target sequence present in or derived from T. pallidum nucleic acid (e.g., comprising a nucleic acid amplification product). Thus, the probe can stably bind to the T. pallidum target sequence under stringent hybridization assay conditions or under conditions used during nucleic acid amplification. As discussed above, the hybridization assay probe may have additional base sequences that do not stably bind to the target nucleic acid.

[0147] In addition to self-complementary probes, probes of the present disclosure can be designed and constructed to include an immobilized probe-binding region of a capture probe, which is composed of a nucleotide base sequence capable of hybridizing to a substantially complementary nucleotide base sequence contained in an immobilized probe directly or indirectly bound to a solid support under predetermined hybridization conditions. The immobilized probe-binding region is preferably selected so that it does not stably bind to nucleic acids from any organism that may be present in the test sample, including T. pallidum, under predetermined hybridization conditions. Thus, a preferred nucleotide base sequence for the immobilized probe-binding region of a capture probe according to the present disclosure is a homopolymer tail, such as a 3' poly-dA tail that matches the 5' poly-dT tail on the immobilized probe. These tails can be of any length sufficient to promote stable hybridization under predetermined hybridization conditions, preferably about 30 bases in length.

[0148] The immobilized probe is preferably attached to magnetically attractable particles that can be isolated in a reaction vessel during a purification step once the probe has had sufficient time to hybridize to the target nucleic acid present in the sample. Acosta et al., in U.S. Pat. No. 6,254,826 ("Assay Work Station"), disclose an instrument that can be used to perform such a purification step. The capture probe is preferably designed so that the melting temperature of the capture probe:target hybrid is higher than the melting temperature of the capture probe:immobilized probe hybrid. In this way, a different set of hybridization assay conditions can be used to promote hybridization of the capture probe to the target nucleic acid before hybridization of the capture probe to the immobilized oligonucleotide, thereby maximizing the concentration of free probe and providing favorable solution-phase hybridization kinetics. This "two-step" target capture method is discussed above and is disclosed by Weisburg et al., U.S. Pat. No. 6,110,678. Other target capture schemes that can be readily adapted to the present disclosure are well known in the art and include, without limitation, those disclosed by Dunn et al., Methods in Enzymology, "Mapping viral mRNAs by sandwich hybridization," 65(1):468-478 (1980); Ranki et al., U.S. Pat. No. 4,486,539; Stabinsky, U.S. Pat. No. 4,751,177; and Becker et al., U.S. Pat. No. 6,130,038.

[0149] With respect to T. pallidum probes, the terms "target nucleic acid sequence," "target nucleotide sequence," "target sequence," and "target region" all refer to a nucleic acid sequence present in T. pallidum rRNA or rDNA, or a sequence complementary thereto, that is not present in the nucleic acids of closely related non-T. pallidum species.

[0150] The T. pallidum probes of the present disclosure include oligonucleotides having a target hybridizing sequence at least 13 nucleotides in length that allows for the substitution of RNA and DNA equivalent bases and nucleotide analogs, and that are entirely contained within a base sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, or its complement. The probes hybridize preferentially to target nucleic acids derived from T. pallidum over nucleic acids derived from non-T. pallidum organisms under stringent hybridization conditions. In some embodiments, the probes do not contain any other target-complementary base sequence regions overlapping or in addition to the target hybridizing sequence of bases that can form stable hybrids with nucleic acids derived from T. pallidum under the same conditions. In some embodiments, the probes are labeled with a fluorophore and a quencher and optionally include an internally positioned non-nucleotide linker (e.g., a C9 linker).

[0151] The probe can be labeled with a detectable label or reporter group by any known method. For example, the probe can be labeled with a detectable moiety, such as a radioisotope, an antigen, or a chemiluminescent moiety, to facilitate the detection of the target sequence. Useful labels include radioisotopes and non-radioactive reporting groups. Isotopic labels include: 3 H, 35 S, 32 P, 125 I, 57 Co, and 14 C. Isotopic labels can be introduced into oligonucleotides by techniques known in the art, such as nick translation, end-labeling, second-strand synthesis, reverse transcription, and chemical methods. When using radioactively labeled probes, hybridization can be detected by techniques such as autoradiography, scintillation counting, or gamma counting. The detection method selected depends on the specific radioisotope used for labeling.

[0152] As discussed above, nonisotopic materials can also be used for labeling and can be introduced internally between nucleotides or at the end of the oligonucleotide. Modified nucleotides can be incorporated enzymatically or chemically. Chemical modification of oligonucleotides can be performed during or after oligonucleotide synthesis using techniques known in the art. For example, by using non-nucleotide linker groups as disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. Non-isotopic labels include fluorescent molecules, chemiluminescent molecules, fluorescent chemiluminescent molecules, phosphorescent molecules, electrochemiluminescent molecules, chromophores, enzymes, enzyme cofactors, enzyme substrates, dyes, and haptens or other ligands. Another useful labeling technique is a base sequence that cannot stably bind to target nucleic acids under stringent conditions. The probes of the present disclosure can be labeled with acridinium esters attached to the probes by non-nucleotide linkers. The acridinium ester labeling technique is disclosed by Arnold et al. in U.S. Pat. No. 5,185,439. Binding reagents are disclosed by Arnold et al. in US Pat. No. 6,031,091.

[0153] The selected hybridization assay probe can be contacted with a test sample suspected of containing T. pallidum nucleic acid. Generally, the test sample is derived from a source that also contains unknown organisms. After contacting the probe with the test sample that may contain amplified nucleic acid derived from T. pallidum, the test sample can be incubated under conditions that allow preferential hybridization of the probe to target nucleic acid derived from T. pallidum over nucleic acid derived from non-target organisms in the test sample.

[0154] Nucleic acid composition In another related aspect, the disclosure features a composition including a nucleic acid hybrid formed between a hybridization assay probe and a target nucleic acid ("probe:target"). One use of the hybrid formed between the probe and the target nucleic acid is to provide an indication of the presence or amount of a target organism or group of organisms in a test sample.

[0155] The present disclosure also contemplates compositions comprising nucleic acid hybrids formed between a capture probe and a target nucleic acid ("capture probe:target"), for example, under stringent hybridization assay conditions. One use of the hybrid formed between a capture probe and a target nucleic acid is to isolate and purify the target nucleic acid in a test sample prior to amplifying a target sequence contained in the target nucleic acid or detecting the target nucleic acid, for example, in a heterogeneous assay. Isolating and purifying the target nucleic acid prior to amplification or detection advantageously reduces the chance of non-specific binding or amplification.

[0156] The present disclosure further features compositions containing nucleic acid hybrids formed between amplification primers and target nucleic acids ("primer:target") under amplification conditions. One use of the hybrid formed between the primer and target nucleic acid is to provide an initiation site for nucleic acid polymerase at the 3' end of the amplification primer. For example, the hybrid can form an initiation site for reverse transcriptase, DNA polymerase such as Taq polymerase or T4 DNA polymerase, and RNA polymerase such as T7 polymerase, SP6 polymerase, T3 polymerase, etc.

[0157] The disclosed compositions include compositions for determining the presence or amount of T. pallidum in a test sample, comprising a nucleic acid hybrid formed between a target nucleic acid derived from T. pallidum and a probe comprising an oligonucleotide having a target binding region, wherein the base sequence of the target binding region consists of the base sequence of any of the probes disclosed herein. The oligonucleotides of these compositions may contain at least one additional nucleotide base sequence region that does not stably bind to a nucleic acid derived from T. pallidum under stringent hybridization conditions.

[0158] Also contemplated by the present disclosure are compositions for immobilizing target nucleic acids derived from T. pallidum present in a test sample, comprising a nucleic acid hybrid formed between the target nucleic acid and a capture probe having a target binding region, wherein the base sequence of the target binding region is at least about 85% homologous (preferably at least about 90% homologous, more preferably at least about 95% homologous, and most preferably 100% homologous) to the base sequence of any target capture oligonucleotide disclosed herein. In further embodiments, these compositions further comprise a nucleic acid hybrid formed between the immobilized probe binding region of the capture probe and the immobilized probe.

[0159] Assay Method The present disclosure contemplates various methods for determining the presence or amount of nucleic acids derived from T. pallidum in a test sample. Those skilled in the art will understand that the exact assay conditions, probes, and / or primers used will vary depending on the particular assay format and sample source used.

[0160] One aspect of the present disclosure relates to a method for determining the presence or amount of T. pallidum in a test sample by contacting the test sample under stringent hybridization assay conditions with a hybridization assay probe capable of preferentially hybridizing under stringent hybridization conditions to nucleic acid derived from T. pallidum over nucleic acid derived from non-T. pallidum organisms present in the test sample. The probe of this method may include at least one additional base sequence region that does not stably bind to nucleic acid derived from T. pallidum under stringent hybridization conditions.

[0161] A further aspect of the present disclosure relates to a method for amplifying nucleic acid derived from T. pallidum present in a test sample by contacting the test sample with one or more amplification primers under amplification conditions, each amplification primer comprising an oligonucleotide having a target binding region, the base sequence of which has or substantially corresponds to the base sequence of an oligonucleotide primer set forth herein. The amplification primers of this embodiment optionally contain a 5' sequence that is recognized by an RNA polymerase or enhances initiation or elongation by an RNA polymerase. If included, a T7 promoter is preferred.

[0162] In a preferred embodiment, the method for amplifying T. pallidum-derived nucleic acid in a test sample further comprises contacting the test sample under stringent hybridization conditions with a hybridization assay probe capable of preferentially hybridizing to the amplified T. pallidum target nucleic acid over nucleic acids from non-T. pallidum organisms present in the test sample under stringent hybridization conditions. The test sample may optionally be contacted with the hybridization assay probe after a period sufficient for amplification has elapsed, although alternatively, the amplification primers and hybridization assay probe may be added to the sample in any order, particularly if the hybridization assay probe is a self-hybridizing probe such as a molecular torch or molecular beacon.

[0163] Certain preferred embodiments of the disclosed technology can be performed using a real-time format, in which the synthesis of T. pallidum-specific nucleic acid amplification products is monitored as the amplification reaction occurs. Molecular torches or molecular beacons can be included in the amplification reaction mixture to enable sequence-specific detection. Molecular torches can be particularly useful for real-time detection of target nucleic acids.

[0164] Yet another aspect of the present disclosure relates to a method for immobilizing a target nucleic acid derived from T. pallidum in a test sample, comprising providing a capture probe having a target-binding region and an immobilized probe-binding region to the test sample under a first set of hybridization conditions that allow the capture probe to stably bind to the target nucleic acid, thereby forming a capture probe:target complex, and a second set of hybridization conditions that allow the capture probe to stably bind to the immobilized probe in the test sample, thereby forming an immobilized probe:capture probe:target complex. The first and second sets of hybridization conditions can be the same or different, and the capture probe:target complex remains stable under the second set of hybridization conditions. The target-hybridizing sequence of bases in the capture probe can have the base sequence of SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36. The target capture oligonucleotide can further include a 3' immobilized probe-binding region with a 30-base-long poly(dA) tail, as given by SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39.

[0165] Oligonucleotide segments incorporating these target binding region sequences can be synthesized to contain 2'-O-methyl substitutions (sometimes "2' methoxy" or "2'OMe") on the sugar residues of the oligonucleotide backbone.

[0166] A purification step may follow the immobilization step to remove one or more components of the test sample that may interfere with or prevent the amplification or specific detection of the target sequence contained in the immobilized target nucleic acid. This method for immobilizing and optionally purifying nucleic acid from T. pallidum may precede any of the above-described methods for amplifying and / or detecting the presence of a target nucleic acid from T. pallidum. When a purification step is included, the target nucleic acid may be indirectly eluted or separated from the immobilized probe by changing the sample conditions before amplifying or detecting the target sequence, or may be directly eluted or separated from the capture probe of the immobilized probe:capture probe:target complex.

[0167] kit The present disclosure also features kits useful for detecting and / or quantifying T. pallidum. The kits may contain any of the disclosed hybridization assay probes, capture probes, and / or amplification primers in suitable packaging, as will be familiar to those of skill in the art, in an amount sufficient for at least one assay. Typically, the kits will also include tangible (e.g., paper or electronic) instructions for using the packaged probes and / or primers in an amplification and / or detection assay to determine the presence or amount of T. pallidum in a test sample. Various kit components may be provided in various formats. For example, the necessary enzymes, nucleotide triphosphates, probes, and / or primers may be provided as lyophilized reagents. The components of the lyophilized reagents may be premixed prior to lyophilization so that, upon reconstitution, they form a complete mixture of each component in the appropriate ratio, ready for use in an assay. Additionally, the kits of the present disclosure may include a reconstitution reagent for reconstituting the lyophilized reagents. In certain preferred kits for amplifying target nucleic acids from T. pallidum, the enzyme, nucleotide triphosphates, and cofactors required for the enzyme are provided as a single lyophilized reagent that, upon reconstitution, forms a reagent suitable for use in the present amplification methods. These kits may also provide lyophilized primer reagents. In other preferred kits, lyophilized probe reagents are provided. Typical packaging materials will include solid matrices, such as glass, plastic, paper, foil, microparticles, and the like, capable of retaining the disclosed hybridization assay probes, capture probes, and / or amplification primers within fixed limits. Thus, for example, packaging materials may include vials (e.g., glass or plastic) used to contain submilligram (e.g., picogram or nanogram) quantities of the intended probes or primers, or they may be microtiter plate wells to which the disclosed probes or primers are operably attached, i.e., bound, so as to be able to participate in the disclosed amplification and / or detection methods.

[0168] The instructions will typically indicate the reagents and / or concentrations of the reagents, as well as at least one assay method parameter (which may be, for example, the relative amount of reagent to use per volume of sample). In addition, details such as maintenance, duration, temperature, and buffer conditions may also be included.

[0169] As indicated above, the kits of the present disclosure may include any of the hybridization assay probes, capture probes, and / or amplification primers described herein for use in amplifying and / or determining the presence or amount of T. pallidum in a test sample, whether provided individually or in one of the combinations disclosed above.

[0170] Examples are provided below to illustrate different aspects and embodiments of the present disclosure. Those skilled in the art will understand that these examples are not intended to limit the disclosure to the specific embodiments described therein. [Example]

[0171] The disclosed technology was exemplified using a real-time transcription-mediated amplification (TMA) reaction format, in which a dual-labeled molecular torch hybridization probe was used to detect T. pallidum nucleic acid amplification products. All of the hybridization assay probes described below, as well as capture probes, primers, and promoter-primers, were synthesized using standard phosphoramidite chemistry and standard procedures well known in the art. See, for example, Caruthers et al., Methods in Enzymol., 154:287 (1987). Synthesis was performed using an Expedite™ 8909 Nucleic Acid Synthesizer (Applied Biosystems; Foster City, CA).

[0172] The system developed for amplifying and detecting ribosomal nucleic acids in T. pallidum included probes, primers, capture oligonucleotides, and combinations thereof. Notably, a single bacterial cell contains at least approximately 1,000 copies of 23S rRNA. Therefore, results demonstrating the detectability of 1,000 or fewer copies of the 23S target nucleic acid would be consistent with the procedure being able to detect a single bacterial cell. Details are provided in the following examples.

[0173] Example 1 describes screening of oligonucleotides in a real-time TMA reaction that amplified and detected the 23s ribosomal nucleic acid of T. pallidum. Advantageously, the T. pallidum nucleic acid sequence was detected without also detecting the nucleic acid sequence of the closely related bacterium T. denticola.

[0174] Example 1 Screening of oligonucleotide combinations specific for 23s ribosomal nucleic acid detection The in vitro transcripts served as target nucleic acids containing ribosomal RNA sequences in the screening procedure. A DNA insert encoding a portion of the T. pallidum 23S ribosomal nucleic acid sequence was ligated into a plasmid cloning vector downstream of a T7 promoter and propagated in a bacterial host using standard laboratory procedures. The purified plasmid was linearized by restriction enzyme digestion and then used as a template for T7 RNA polymerase to produce T. pallidum in vitro transcripts (IVTs), which were quantified by spectrophotometry. The T. pallidum IVTs contained the sequence of SEQ ID NO:1. A parallel procedure was used to prepare a plasmid cloning vector containing a DNA insert encoding a portion of the T. denticola 23S ribosomal nucleic acid sequence downstream of a T7 promoter. Again, the plasmid was propagated in a bacterial host, purified, linearized by restriction enzyme digestion, and used to produce T. denticola IVTs, which were also quantified by spectrophotometry. The T. denticola IVTs contained the sequence of SEQ ID NO:2.

[0175] Oligonucleotide primer and probe combinations were screened for their ability to amplify and specifically detect T. pallidum nucleic acid sequences. Table 1 shows the oligonucleotide combinations used in this procedure. [Table 1]

[0176] Real-time monitoring of isothermal nucleic acid amplification reactions was performed using a temperature-controlled MX3005p instrument (Stratagene, La Jolla, CA). As is well known to those skilled in the art, reactions were performed in individual wells of a multiwell plate, with each well containing 65 μl of amplification reagents, including a pH-buffered mixture of ribonucleotide triphosphates, deoxyribonucleotide triphosphates, salts, and cofactors for carrying out the TMA reaction. The reactions further contained primers and molecular torch hybridization probes, as shown in Table 1. Individual wells were then filled with 1 x 10 of either T. pallidum IVT or T. denticola IVT, which served as either template or target for the amplification reaction. 6Each well received a 10 μl aliquot containing a copy of each well. All reactions were prepared in duplicate. The multiwell plate was first incubated at 60°C for 5 minutes to allow hybridization of the primers to the IVT, then equilibrated to approximately 43°C. The multiwell plate was then transferred to an EPPENDORF THERMOMIXER® (Eppendorf North America, Westbury, NY) set at 44°C. Next, as also well known to those skilled in the art, each reaction well received a 25 μl aliquot of enzyme reagent containing a pH-buffered mixture of Moloney murine leukemia virus ("MMLV") reverse transcriptase and T7 RNA polymerase. The plate was sealed with an adhesive cover, gently shaken for 1 minute, and then transferred to a real-time instrument set to incubate at 42°C. The fluorescent signal from the molecular torch (measured in relative fluorescence units (RFU)) was detected at regular time intervals. A threshold-based TTime value, which serves as an indicator of the amount of amplicon synthesized, was determined from the monitored fluorescent signal substantially according to the method disclosed by Light et al. in US Pat. No. 8,615,368.

[0177] The results of the procedure shown in Figures 1A–1F identified several viable oligosystems that detected target nucleic acids in T. pallidum but not in T. denticola .

[0178] Example 2 describes another approach for detecting T. pallidum nucleic acids. Here, the target nucleic acid is amplified using a "biphasic" reaction mechanism, with linear and exponential amplification steps separated in time. The essential features of this technique are described in U.S. Patent No. 10,196,674, the entire disclosure of which is incorporated herein by reference. In particular, the use of biphasic amplification technology improved the sensitivity of T. pallidum nucleic acid detection.

[0179] Example 2 Amplification and detection using a biphasic amplification procedure The biphasic amplification procedure employed a phase 1 linear amplification reaction and a phase 2 exponential amplification reaction. This procedure utilized the primer and probe combinations of systems S5 and S7. The phase 1 amplification reaction began with a target capture step in which preamplification hybrid complexes, each containing a T7 promoter-primer hybridized to its complementary T. pallidum target nucleic acid, were captured on solid-support magnetic beads. The target capture reaction included a 400 μl volume of pH-buffered lithium lauryl sulfate (LLS) detergent solution, a known copy level of T. pallidum IVT, one of the T7 promoter-primers (SEQ ID NO: 11 for S5 and SEQ ID NO: 12 for S7), magnetic beads that allow capture or immobilization of the IVT and any hybridized T7 promoter-primer (i.e., preamplification hybrids), and a target capture oligo (SEQ ID NO: 37 for both S5 and S7) that facilitates immobilization or capture of the preamplification hybrids to the magnetic beads. In this example, the target capture oligonucleotide (TCO) serves to bridge the bead-immobilized oligonucleotide (i.e., oligo(dT)) and the IVT; however, other options are also available for sequence-specific capture of the IVT directly onto beads displaying a capture oligonucleotide complementary to the IVT. The target capture step allowed for the formation and capture of preamplification hybrids formed in the reaction mixture. The use of an automated magnetic particle processor facilitated isolation and washing of the magnetic beads. This procedure yielded isolated preamplification hybrids depleted or substantially free of unhybridized T7 promoter-primer. The isolated preamplification hybrids were then purified with a pH buffer, ribonucleotide triphosphates, deoxyribonucleotide triphosphates, salts, cofactors, MMLV reverse transcriptase, and T7 RNA polymerase enzymes, along with a non-T7 primer (SEQ ID NO:18), but without the addition of any T7 promoter-primer other than that contained in the preamplification hybrid. A cDNA strand was generated by T7 primer extension of the preamplification hybrid during the phase 1 reaction. The RNase H activity of MMLV reverse transcriptase digested the RNA strand that served as a template for cDNA synthesis.The non-T7 primers present in the reaction mixture hybridized to the complementary cDNA and were extended to produce double-stranded DNA containing the T7 promoter sequence. The T7 RNA polymerase in the reaction mixture then synthesized transcripts from the double-stranded template. These transcripts hybridized to the non-T7 primers included in the reaction mixture and were then extended by reverse transcriptase. Again, the RNA template strand was degraded by the RNase H activity of MMLV reverse transcriptase. The result of these steps was the accumulation in the phase 1 reaction mixture of a promoterless cDNA strand with the same sequence orientation or polarity as the IVT target strand.

[0180] The exponential phase amplification reaction was initiated by adding the T7 promoter-primer (SEQ ID NO: 11 for S5 and SEQ ID NO: 12 for S7) and molecular torch hybridization probe (SEQ ID NO: 32 for S5 and SEQ ID NO: 33 for S7) to the first phase reaction mixture. In this exemplary procedure, the added T7 promoter-primer was the same as that used during the target capture step (i.e., a component of the preamplification hybrid). Alternatively, other T7 promoter-primers could be used. RNA transcripts produced as amplification products during the exponential phase amplification reaction hybridized to the molecular torch hybridization probe as the reaction progressed, and the resulting complexes were detected by fluorescence emission as a function of reaction time. The general aspects of the biphasic amplification technique are disclosed by Nelson et al. in U.S. Patent No. 10,196,674.

[0181] The results of this procedure, shown in Figures 2A-2B, confirmed that both System 5 and System 7 performed well using a biphasic amplification and detection format. System 5 showed a very well-shaped run curve, even with as little as 10 copies / ml of IVT.

[0182] Example 3 describes a set of procedures used to demonstrate the sensitivity and specificity of an exemplary assay for detecting T. pallidum nucleic acids. This procedure combined variable amounts of T. pallidum IVT with fixed amounts of closely related but non-target T. denticola IVT. The mixture was subjected to target capture and biphasic amplification and detection. System S5 oligonucleotides were used in this demonstration.

[0183] Example 3 Testing the sensitivity and specificity of the assay using IVT The biphasic amplification and detection procedure of Example 2, using System S5 primer and probe oligonucleotides, was essentially followed to demonstrate the sensitivity and specificity of the assay. The amount and identity of the target nucleic acid served as variables. Individual target capture reactions were performed with either (1) 10 copies / ml, 30 copies / ml, 100 copies / ml, or 300 copies / ml of T. pallidum IVT to establish a baseline for comparison, or (2) 0 copies / ml of T. pallidum IVT and 1 x 10 copies / ml of T. pallidum IVT. 6 copies / ml of T. denticola, 30 copies / ml of T. pallidum IVT, and 1 × 10 6 copies / ml of T. denticola or 100 copies / ml of T. pallidum IVT and 1 × 10 6 aliquots of either T. denticola or T. denticola were spiked at 100 copies / ml. Phase 1 linear and phase 2 exponential amplification reactions were performed as described in the previous example.

[0184] The procedural results shown in Figures 3A-3B confirmed that the T. pallidum assay was highly specific for the T. pallidum target nucleic acid and was not substantially impaired by the presence of large amounts of closely related non-target nucleic acids. Figure 3A shows a well-formed run curve demonstrating detection of T. pallidum amplification products even at levels of 10 copies / ml. Thus, the assay was highly sensitive. Figure 3B demonstrated that T. pallidum amplification products were readily detectable at 300 copies / ml or 30 copies / ml in the presence of high levels of T. denticola non-target nucleic acids. Furthermore, amplification products of the T. denticola target nucleic acid were undetectable. Thus, the assay was highly sensitive and specific.

[0185] Example 4 presents the procedure used to investigate the specificity and sensitivity of the T. pallidum assay using cells instead of IVT. Assay sensitivity was determined using curve-fitting analysis of positive results obtained using known numbers of whole T. pallidum organisms.

[0186] Example 4 Testing assay sensitivity using T. pallidum cells The real-time TMA assay described in Example 3 was used to capture, amplify, and detect T. pallidum 23S rRNA for sensitivity testing using T. pallidum cells as the source of target nucleic acid. Samples were processed and amplification and detection reactions were performed using a commercially available Panther® automated nucleic acid testing instrument (Hologic, Inc., San Diego, CA). Serial dilutions of dark-field quantified T. pallidum organisms at the levels shown in Table 2 were processed in 10 replicates, and positive detection was determined by the combination of a minimum fluorescent signal reading and the maximum time required to reach a predetermined level of amplification. More specifically, positive detection was determined as a background-subtracted RFU (relative fluorescence unit) of at least 1.0 and a Ttime measurement of 53 minutes or less. The results of the procedure are presented in Table 2. [Table 2]

[0187] Statistical analysis of the results presented in Table 2 showed that using the disclosed assay there was a 50% chance of detecting at least 0.27 organisms and a 95% chance of detecting at least 1.36 organisms.

[0188] Example 5 describes a procedure that demonstrates how the assay of the previous example can be used to detect T. pallidum nucleic acids without also detecting nucleic acids from a variety of other organisms.

[0189] Example 5 Testing assay specificity using bacterial cells The specificity of the T. pallidum assay was investigated using a collection of non-target organisms as a source of amplifiable nucleic acid, following a biphasic amplification and detection procedure essentially as described in Example 4. A pooled set of panels containing known amounts of non-target organisms is shown in Table 3. As described above, the lysis and target capture reagent combination included a pH buffer, lithium lauryl sulfate surfactant, and magnetic beads displaying surface-immobilized oligonucleotides to assist in nucleic acid capture. In this case, the surface-immobilized oligonucleotide comprised oligo(dT), and the target capture reagent further included a T7 promoter-primer comprising the target capture oligonucleotide of SEQ ID NO:37 and the target hybridization sequence of SEQ ID NO:7 (e.g., SEQ ID NO:11). The beads with the captured complexes containing the target nucleic acid and hybridized primer were washed and then combined with an amplification reagent containing deoxyribonucleotide triphosphates, ribonucleotide triphosphates, MMLV reverse transcriptase, T7 RNA polymerase, salts and cofactors, and a non-T7 primer having the sequence of SEQ ID NO:18 to initiate linear-phase amplification. After an initial incubation period, the reaction mixture was combined with an aliquot of reagent containing a molecular torch having the sequence of SEQ ID NO: 32 and a T7 promoter-primer to initiate an exponential phase amplification reaction. In this case, the added T7 promoter was the same as that contained in the target capture reagent (SEQ ID NO: 11), a matter of convenient choice. It is possible that a different T7 promoter-primer could have been used for the same purpose.

[0190] The results, shown in Table 3, advantageously demonstrated that the T. pallidum assay is highly specific for detecting T. pallidum nucleic acids. As shown in the table, nucleic acid sequences characteristic of T. pallidum were detected at a 100% positive level using test samples with an IVT of only 30 copies / ml. In the presence of potentially cross-reactive non-target organisms and the absence of the T. pallidum target, the positive rate was 0%. Interference testing with low-titer T. pallidum RNA (30 copies / ml) showed 100% positivity. Assay performance was not affected by non-target organisms. [Table 3]

[0191] It is to be understood that both the foregoing summary and detailed description are exemplary and explanatory only and are not restrictive of the present teachings. To the extent that any material incorporated by reference contradicts the explicit content of this disclosure, the explicit content shall control.

[0192] While the present disclosure has been described and illustrated in considerable detail with reference to certain illustrative embodiments comprising various combinations and subcombinations of features, those skilled in the art will readily recognize other embodiments, and variations and modifications thereof, that are encompassed within the scope of the present disclosure. Moreover, the description of such embodiments, combinations, and subcombinations is not intended to convey that the present disclosure requires any features or combinations of features other than those expressly recited in the claims. Accordingly, the present disclosure is deemed to include all modifications and variations encompassed within the spirit and scope of the following numbered embodiments.

[0193] Numbered Embodiments Example 1 is an oligonucleotide hybridization probe for detecting T. pallidum nucleic acid, a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, It is an oligonucleotide hybridization probe that is up to 47 bases in length.

[0194] Embodiment 2 is an oligonucleotide hybridization probe according to embodiment 1, further comprising a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0195] Embodiment 3 further comprises a non-nucleotide linker and a pair of interacting labels, The oligonucleotide hybridization probe of embodiment 1, which is a molecular torch hybridization probe.

[0196] Embodiment 4 is the oligonucleotide hybridization probe of embodiment 3, wherein the pair of interactive labels comprises a fluorophore moiety and a quencher moiety.

[0197] Embodiment 5 is the oligonucleotide hybridization probe of embodiment 3 or 4, wherein the non-nucleotide linker is a C9 linker.

[0198] Embodiment 6 is an oligonucleotide hybridization probe according to any one of embodiments 1 to 5, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27, each of which sequences allows for the substitution of RNA and DNA equivalent bases.

[0199] Embodiment 7 is an oligonucleotide hybridization probe according to any one of embodiments 1 to 5, wherein the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO: 19 is a target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO: 21, or its complement, allowing for substitution of RNA and DNA equivalent bases.

[0200] Embodiment 8 is the oligonucleotide hybridization probe of embodiment 7, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27, each of which allows for the substitution of RNA and DNA equivalent bases.

[0201] Embodiment 9 is an oligonucleotide hybridization probe according to any one of embodiments 1 or 3-8, further comprising at least one nucleotide analogue comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0202] Embodiment 10 is a primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence, comprising: a first primer comprising a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; a first primer, the first primer being at most 50 bases in length; a second primer comprising a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15; the second primer is up to 50 bases in length; At least one of the first and second primers is a primer set further comprising a phage promoter sequence linked upstream of each of the target hybridizing sequences.

[0203] Embodiment 11 is the primer set of embodiment 10, wherein the first primer comprises the phage promoter sequence linked upstream of the first target hybridizing sequence.

[0204] Embodiment 12 is the primer set according to embodiment 11, wherein the phage promoter sequence comprises a T7 promoter sequence.

[0205] Embodiment 13 is the primer set according to any one of Embodiments 10 to 12, wherein the target-hybridizing sequence of the first primer ends with SEQ ID NO:7 at its 3' end.

[0206] Embodiment 14 is the primer set according to any one of Embodiments 10 to 13, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.

[0207] Embodiment 15 is the primer set according to any one of embodiments 10 to 12, wherein the target hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0208] Embodiment 16 is the primer set according to any one of Embodiments 10 to 12, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0209] Embodiment 17 is the primer set according to any one of embodiments 10 to 16, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13.

[0210] Embodiment 18 is the primer set according to any one of Embodiments 10 to 17, wherein the target-hybridizing sequence of the second primer is SEQ ID NO:16.

[0211] Embodiment 19 is the primer set according to any one of embodiments 10 to 17, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:14.

[0212] Embodiment 20 is the primer set of embodiment 19, wherein the target-hybridizing sequence of the second primer is SEQ ID NO: 17 or SEQ ID NO: 16.

[0213] Embodiment 21 is the primer set according to any one of embodiments 10 to 17, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:15.

[0214] Embodiment 22 is the primer set of embodiment 21, wherein the target-hybridizing sequence of the second primer is SEQ ID NO: 18 or SEQ ID NO: 17.

[0215] Embodiment 23 is the primer set according to any one of Embodiments 10 to 12, wherein the first primer is SEQ ID NO:11 and the second primer is SEQ ID NO:18.

[0216] Embodiment 24 is the primer set according to any one of Embodiments 10 to 12, wherein the first primer is SEQ ID NO:12 and the second primer is SEQ ID NO:18.

[0217] Embodiment 25 is a method for determining whether a sample contains nucleic acid of T. pallidum, said method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, whereby, if the sample contains T. pallidum nucleic acid, an amplification product is produced; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether the amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. Embodiment 26 is the method for detecting a target gene, wherein the detectably labeled hybridization probe comprises: a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, 26. The method of embodiment 25, wherein said oligonucleotide hybridization probe is up to 47 bases in length.

[0218] Embodiment 27 is the method of embodiment 26, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interacting labels.

[0219] Embodiment 28 is the method of embodiment 27, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher.

[0220] Embodiment 29 is the method of embodiment 27, wherein the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the target hybridizing sequence.

[0221] Embodiment 30 is the method of embodiment 26, wherein the detectably labeled hybridization probe further comprises each of a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

[0222] Embodiment 31 is a method for detecting genomic DNA fragments, wherein the set of primers in step (a) comprises a first primer and a second primer; the first primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO: 3; the second primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO: 13; 27. The method of embodiment 26, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence.

[0223] Embodiment 32 is the method according to any one of embodiments 25 to 31, wherein steps (a) and (b) are performed simultaneously, and the amplification reaction is a real-time amplification reaction.

[0224] Embodiment 33 is the method according to any one of embodiments 25 to 32, wherein the amplification product detected in step (c) is an RNA amplicon of the opposite sense to the 23S rRNA of T. pallidum.

[0225] Embodiment 34 is a reaction mixture for detecting T. pallidum nucleic acids that may be present in a test sample, comprising: The test sample; An oligonucleotide primer set comprising a first primer and a second primer, the first primer comprises a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3; an oligonucleotide primer set, wherein the second primer comprises a base sequence complementary to an extension product of the first primer when SEQ ID NO: 1 is used as a template in a polymerase-mediated primer extension reaction; and a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction carried out using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO:1.

[0226] Embodiment 35 is the reaction mixture of embodiment 34, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotide linker.

[0227] Embodiment 36 is the reaction mixture of embodiment 34, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

[0228] Embodiment 37 is a reaction mixture according to any one of embodiments 34 to 36, wherein the base sequence complementary to the amplicon allows for substitution of RNA and DNA equivalent bases and is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27.

[0229] Embodiment 38 is the reaction mixture of any one of embodiments 34 to 36, wherein the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:6.

[0230] Embodiment 39 is the reaction mixture of any one of embodiments 34 to 38, wherein the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3.

[0231] Embodiment 40” is the reaction mixture of embodiment 39, wherein the promoter sequence is a T7 promoter sequence.

[0232] Embodiment 41 is the reaction mixture of any one of embodiments 34 to 40, wherein the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO:13.

[0233] Embodiment 42 is the reaction mixture of any one of embodiments 34 to 41, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO:18, SEQ ID NO:17, and SEQ ID NO:16.

[0234] Embodiment 43 is a reaction mixture described in any one of embodiments 34 to 42, wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum.

[0235] Embodiment 44 is the reaction mixture of embodiment 43, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe.

[0236] Embodiment 45 is the reaction mixture of any one of embodiments 34 to 44, wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction.

[0237] Embodiment 46 is the reaction mixture of embodiment 45, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

[0238] Embodiment 47 is a kit of reagents for detecting nucleic acids of T. pallidum, comprising: A set of oligonucleotide primers, a first primer of the set comprising a target-hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3; a set of oligonucleotide primers, wherein a second primer of the set comprises a target-hybridizing sequence that is complementary to the extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; a molecular torch hybridization probe, the molecular torch hybridization probe being up to 50 bases in length and comprising a target-hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, and further comprising each of a fluorophore moiety, a quencher moiety, a non-nucleotide linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for carrying out an in vitro nucleic acid amplification reaction using the primer set.

[0239] Embodiment 48 is the kit of embodiment 47, wherein the target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19, or its complement, is a target hybridizing sequence of 13 to 22 consecutive bases of SEQ ID NO: 21, or its complement.

[0240] Embodiment 49 is the kit of embodiment 47 or 48, wherein the target-hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27.

[0241] Embodiment 50 is a kit described in any one of embodiments 47 to 49, wherein the target hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27.

[0242] Embodiment 51 is the kit according to any one of embodiments 47 to 50, wherein each of the first and second primers is up to 50 bases in length.

[0243] Embodiment 52 is the kit according to any one of embodiments 47 to 51, wherein a phage promoter sequence is linked upstream of the target hybridizing sequence of the first primer.

[0244] Embodiment 53 is the kit of embodiment 52, wherein the phage promoter sequence is a T7 promoter sequence.

[0245] Embodiment 54 is the kit of any one of embodiments 47 to 53, wherein the target-hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:7.

[0246] Embodiment 55 is the kit of any one of embodiments 47 to 54, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:8.

[0247] Embodiment 56 is a kit according to any one of embodiments 47 to 53, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8.

[0248] Embodiment 57 is the kit of any one of embodiments 47 to 56, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12.

[0249] Embodiment 58 is the kit of any one of embodiments 47 to 57, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13.

[0250] Embodiment 59 is the kit of any one of embodiments 47 to 58, wherein the one or more reagents include each of a reverse transcriptase and a T7 RNA polymerase.

[0251] While various embodiments of the present disclosure have been shown and described in detail, it will be readily apparent to those skilled in the art that various modifications can be made therein without departing from the scope of the present disclosure or the appended claims. In certain embodiments, for example, the following are provided: (Item 1) 1. An oligonucleotide hybridization probe for detecting T. pallidum nucleic acid, comprising: a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, An oligonucleotide hybridization probe, wherein said oligonucleotide hybridization probe is up to 47 bases in length. (Item 2) 2. The oligonucleotide hybridization probe of claim 1, further comprising a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 3) further comprising a non-nucleotide linker and a pair of interacting labels; 2. The oligonucleotide hybridization probe according to item 1, which is a molecular torch hybridization probe. (Item 4) 4. The oligonucleotide hybridization probe according to item 3, wherein the pair of interactive labels comprises a fluorophore moiety and a quencher moiety. (Item 5) 5. The oligonucleotide hybridization probe according to item 3 or 4, wherein the non-nucleotide linker is a C9 linker. (Item 6) 6. The oligonucleotide hybridization probe of any one of items 1 to 5, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, each of which sequences allows for substitution of RNA and DNA equivalent bases. (Item 7) 6. The oligonucleotide hybridization probe of any one of items 1 to 5, wherein the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO: 19 is a target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO: 21 or its complement, allowing for substitution of RNA and DNA equivalent bases. (Item 8) 8. The oligonucleotide hybridization probe of item 7, wherein the target hybridizing sequence is selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27, each of which allows for the substitution of RNA and DNA equivalent bases. (Item 9) 9. The oligonucleotide hybridization probe of any one of items 1 or 3 to 8, further comprising at least one nucleotide analogue comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 10) A primer set for amplifying a T. pallidum 23S ribosomal nucleic acid sequence, comprising: a first primer comprising a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; a first primer, wherein the first primer is up to 50 bases in length; a second primer comprising a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15; a second primer, wherein the second primer is up to 50 bases in length; A primer set, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence. (Item 11) 11. The primer set according to Item 10, wherein the first primer comprises the phage promoter sequence linked upstream of a first target hybridizing sequence. (Item 12) Item 12. The primer set according to Item 11, wherein the phage promoter sequence comprises a T7 promoter sequence. (Item 13) 13. The primer set according to any one of Items 10 to 12, wherein the target-hybridizing sequence of the first primer has a 3' end terminated with SEQ ID NO:7. (Item 14) 14. The primer set according to any one of Items 10 to 13, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8. (Item 15) 13. The primer set according to any one of Items 10 to 12, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. (Item 16) 13. The primer set according to any one of items 10 to 12, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. (Item 17) 17. The primer set according to any one of Items 10 to 16, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:13. (Item 18) 18. The primer set according to any one of Items 10 to 17, wherein the target-hybridizing sequence of the second primer is SEQ ID NO:16. (Item 19) 18. The primer set according to any one of Items 10 to 17, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:14. (Item 20) 20. The primer set of item 19, wherein the target-hybridizing sequence of the second primer is SEQ ID NO: 17 or SEQ ID NO: 16. (Item 21) 18. The primer set according to any one of Items 10 to 17, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO:15. (Item 22) 22. The primer set of item 21, wherein the target-hybridizing sequence of the second primer is SEQ ID NO: 18 or SEQ ID NO: 17. (Item 23) 13. The primer set according to any one of items 10 to 12, wherein the first primer is SEQ ID NO: 11 and the second primer is SEQ ID NO: 18. (Item 24) 13. The primer set according to any one of items 10 to 12, wherein the first primer is SEQ ID NO: 12 and the second primer is SEQ ID NO: 18. (Item 25) 1. A method for determining whether a sample contains T. pallidum nucleic acid, said method comprising: (a) contacting the sample with a set of primers; (b) using the set of primers in an in vitro nucleic acid amplification reaction to amplify any T. pallidum nucleic acid that may be present in the sample, whereby an amplification product is produced if the sample contains T. pallidum nucleic acid; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether an amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid. (Item 26) the detectably labeled hybridization probe a target hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label, 26. The method of claim 25, wherein the oligonucleotide hybridization probe is up to 47 bases in length. (Item 27) 27. The method of claim 26, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interactive labels. (Item 28) 28. The method of claim 27, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher. (Item 29) 28. The method of claim 27, wherein the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the target hybridizing sequence. (Item 30) 27. The method of claim 26, wherein the detectably labeled hybridization probe further comprises a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution. (Item 31) the set of primers in step (a) comprises a first primer and a second primer; the first primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO: 3; the second primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO: 13; 27. The method of claim 26, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence. (Item 32) 32. The method according to any one of items 25 to 31, wherein steps (a) and (b) are carried out simultaneously, and the amplification reaction is a real-time amplification reaction. (Item 33) 33. The method of any one of items 25 to 32, wherein the amplification product detected in step (c) is an RNA amplicon of the opposite sense to the 23S rRNA of T. pallidum. (Item 34) 1. A reaction mixture for detecting T. pallidum nucleic acids that may be present in a test sample, comprising: the test sample; An oligonucleotide primer set comprising a first primer and a second primer, the first primer comprises a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3; an oligonucleotide primer set, wherein the second primer comprises a base sequence complementary to an extension product of the first primer when SEQ ID NO: 1 is used as a template in a polymerase-mediated primer extension reaction; A reaction mixture comprising: a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction performed using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO: 1. (Item 35) 35. The reaction mixture of item 34, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotide linker. (Item 36) 35. The reaction mixture of claim 34, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution. (Item 37) 37. The reaction mixture of any one of items 34 to 36, wherein the base sequence complementary to the amplicon allows for substitution of RNA and DNA equivalent bases and is selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27. (Item 38) 37. The reaction mixture according to any one of Items 34 to 36, wherein the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 7, and SEQ ID NO: 6. (Item 39) 39. The reaction mixture according to any one of items 34 to 38, wherein the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3. (Item 40) 40. The reaction mixture of item 39, wherein the promoter sequence is a T7 promoter sequence. (Item 41) 41. The reaction mixture according to any one of items 34 to 40, wherein the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO: 13. (Item 42) 42. The reaction mixture according to any one of items 34 to 41, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 17, and SEQ ID NO: 16. (Item 43) 43. The reaction mixture of any one of items 34 to 42, wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum. (Item 44) 44. The reaction mixture of item 43, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe. (Item 45) 45. The reaction mixture according to any one of items 34 to 44, wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction. (Item 46) 46. ​​The reaction mixture of item 45, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction. (Item 47) A kit of reagents for detecting nucleic acids of T. pallidum, comprising: A set of oligonucleotide primers, a first primer of the set comprises a target-hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3; a set of oligonucleotide primers, wherein a second primer of the set comprises a target-hybridizing sequence that is complementary to the extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; a molecular torch hybridization probe, the molecular torch hybridization probe being up to 50 bases in length and comprising a target-hybridizing sequence of at least 13 consecutive bases of SEQ ID NO: 19 or its complement, and further comprising each of a fluorophore moiety, a quencher moiety, a non-nucleotide linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for performing an in vitro nucleic acid amplification reaction using the set of primers. (Item 48) Item 48. The kit of Item 47, wherein the target hybridizing sequence of at least 13 contiguous bases of SEQ ID NO: 19 or its complement is a target hybridizing sequence of 13 to 22 contiguous bases of SEQ ID NO: 21 or its complement. (Item 49) 49. The kit of claim 47 or 48, wherein the target-hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:26 and SEQ ID NO:27. (Item 50) 50. The kit of any one of Items 47 to 49, wherein the target-hybridizing sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, and SEQ ID NO:27. (Item 51) 51. The kit according to any one of Items 47 to 50, wherein each of the first and second primers is up to 50 bases in length. (Item 52) 52. The kit according to any one of Items 47 to 51, wherein a phage promoter sequence is bound upstream of the target-hybridizing sequence of the first primer. (Item 53) 53. The kit of item 52, wherein the phage promoter sequence is a T7 promoter sequence. (Item 54) 54. The kit according to any one of Items 47 to 53, wherein the target-hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO: 7. (Item 55) 55. The kit according to any one of Items 47 to 54, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8. (Item 56) 54. The kit according to any one of Items 47 to 53, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. (Item 57) 57. The kit according to any one of Items 47 to 56, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. (Item 58) 58. The kit according to any one of Items 47 to 57, wherein the target-hybridizing sequence of the second primer is 17 to 20 consecutive bases of SEQ ID NO: 13. (Item 59) 59. The kit of any one of items 47 to 58, wherein the one or more reagents include each of a reverse transcriptase and a T7 RNA polymerase.

Claims

1. 1. An oligonucleotide hybridization probe for detecting T. pallidum nucleic acid, comprising: a sequence consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33, or its complement, which allows for the substitution of RNA and DNA equivalent bases; and a detectable label.

2. 10. The oligonucleotide hybridization probe of claim 1, further comprising a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

3. further comprising a non-nucleotide linker and a pair of interacting labels; 10. The oligonucleotide hybridization probe of claim 1, which is a molecular torch hybridization probe.

4. The oligonucleotide hybridization probe of claim 3 , wherein the pair of interactive labels comprises a fluorophore moiety and a quencher moiety.

5. 4. The oligonucleotide hybridization probe of claim 3, wherein the non-nucleotide linker is a C9 linker.

6. 4. The oligonucleotide hybridization probe of claim 3, wherein the sequence is selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: 33, each of which allows for the substitution of RNA and DNA equivalent bases.

7. 10. The oligonucleotide hybridization probe of claim 1, further comprising at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

8. 1. A method for determining whether a sample contains T. pallidum nucleic acid, said method comprising: (a) contacting the sample with a set of primers; (b) amplifying any T. pallidum nucleic acid that may be present in the sample using the set of primers in an in vitro nucleic acid amplification reaction, whereby an amplification product is produced if the sample contains T. pallidum nucleic acid; (c) detecting any of the amplification products produced in step (b) using a detectably labeled oligonucleotide hybridization probe; (d) determining from the result of step (c) whether the amplification product was produced in step (b) as an indication of whether the sample contains T. pallidum nucleic acid; the detectably labeled oligonucleotide hybridization probe a sequence consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33, or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label.

9. 9. The method of claim 8, wherein the detectably labeled oligonucleotide hybridization probe is a molecular torch hybridization probe comprising a non-nucleotide linker and a pair of interactive labels.

10. 10. The method of claim 9, wherein the pair of interactive labels of the molecular torch hybridization probe comprises a fluorophore and a quencher.

11. 10. The method of claim 9, wherein the non-nucleotide linker of the molecular torch hybridization probe is a C9 linker positioned at one end of the sequence.

12. 9. The method of claim 8, wherein the detectably labeled oligonucleotide hybridization probe further comprises each of a fluorophore moiety, a quencher moiety, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution.

13. the set of primers in step (a) comprises a first primer and a second primer; the first primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 18 consecutive bases of SEQ ID NO:3; the second primer is up to 50 bases in length and comprises a target-hybridizing sequence of at least 17 consecutive bases of SEQ ID NO: 13; 9. The method of claim 8, wherein at least one of the first and second primers further comprises a phage promoter sequence linked upstream of the respective target hybridizing sequence.

14. 14. The method of claim 13, wherein steps (a) and (b) are performed simultaneously, and the amplification reaction is a real-time amplification reaction.

15. 14. The method of claim 13, wherein the amplification product detected in step (c) is an RNA amplicon of the opposite sense to the 23S rRNA of T. pallidum.

16. 1. A reaction mixture for detecting T. pallidum nucleic acids that may be present in a test sample, comprising: the test sample; An oligonucleotide primer set comprising a first primer and a second primer, the first primer comprises a base sequence complementary to at least 18 consecutive bases of SEQ ID NO: 3; an oligonucleotide primer set, wherein the second primer comprises a base sequence complementary to an extension product of the first primer when SEQ ID NO: 1 is used as a template in a polymerase-mediated primer extension reaction; a detectably labeled hybridization probe, the hybridization probe comprising a base sequence complementary to an amplicon produced in a nucleic acid amplification reaction carried out using the oligonucleotide primer set and a template comprising the base sequence of SEQ ID NO: 1; the detectably labeled hybridization probe a sequence consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33, or its complement, which allows for the substitution of RNA and DNA equivalent bases; a detectable label.

17. 17. The reaction mixture of claim 16, wherein the detectably labeled hybridization probe is a molecular torch hybridization probe comprising each of a fluorophore, a quencher, and a non-nucleotide linker.

18. 17. The reaction mixture of claim 16, wherein the detectably labeled hybridization probe comprises at least one nucleotide analog having a ribofuranosyl moiety with a 2'-O-methyl substitution.

19. 18. The reaction mixture of claim 17, wherein the first primer comprises a 3' terminal sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:7, and SEQ ID NO:

6.

20. 17. The reaction mixture of claim 16, wherein the first primer is up to 50 bases in length and comprises a promoter sequence upstream of a sequence complementary to at least 18 consecutive bases of SEQ ID NO:

3.

21. 21. The reaction mixture of claim 20, wherein the promoter sequence is a T7 promoter sequence.

22. 22. The reaction mixture of claim 21, wherein the second primer is up to 50 bases in length and comprises at least 17 consecutive bases of SEQ ID NO:

13.

23. 18. The reaction mixture of claim 17, wherein the second primer comprises a 3' end selected from the group consisting of SEQ ID NO:18, SEQ ID NO:17, and SEQ ID NO:

16.

24. 22. The reaction mixture of claim 21, wherein the amplicon is an RNA amplicon having the opposite polarity to the 23S rRNA of T. pallidum, such that the RNA amplicon is complementary to the 23S rRNA of T. pallidum.

25. 25. The reaction mixture of claim 24, wherein the reaction mixture comprises the RNA amplicon hybridized to the molecular torch hybridization probe.

26. 22. The reaction mixture of claim 21, wherein the nucleic acid amplification reaction is a transcription-associated amplification reaction.

27. 27. The reaction mixture of claim 26, wherein the transcription-associated amplification reaction is a transcription-mediated amplification (TMA) reaction.

28. 1. A kit of reagents for detecting nucleic acids of T. pallidum, comprising: A set of oligonucleotide primers, a first primer of the set comprises a target-hybridizing sequence complementary to at least 18 consecutive bases of SEQ ID NO:3; a set of oligonucleotide primers, wherein a second primer of the set comprises a target-hybridizing sequence that is complementary to the extension product of the first primer when SEQ ID NO:1 is used as a template in a polymerase-mediated primer extension reaction; a molecular torch hybridization probe comprising a sequence consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, or SEQ ID NO:33, or its complement, and further comprising each of a detectable label, a fluorophore moiety, a quencher moiety, a non-nucleotide linker, and at least one nucleotide analog comprising a ribofuranosyl moiety having a 2'-O-methyl substitution; and one or more reagents for performing an in vitro nucleic acid amplification reaction using the set of primers.

29. 29. The kit of claim 28, wherein the sequence of the molecular torch hybridization probe is selected from the group consisting of SEQ ID NO:32 and SEQ ID NO:

33.

30. 30. The kit of claim 29, wherein each of the first and second primers is up to 50 bases in length.

31. 31. The kit of claim 30, wherein a phage promoter sequence is linked upstream of the target hybridizing sequence of the first primer.

32. 32. The kit of claim 31, wherein the phage promoter sequence is a T7 promoter sequence.

33. 32. The kit of claim 31, wherein the target-hybridizing sequence of the first primer terminates at its 3' end with SEQ ID NO:

7.

34. 32. The kit of claim 31 , wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:7 and SEQ ID NO:

8.

35. 29. The kit of claim 28, wherein the target-hybridizing sequence of the first primer is selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:

8.

36. 29. The kit of claim 28, wherein the first primer is a promoter-primer selected from the group consisting of SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:

12.

37. 37. The kit of claim 36, wherein the target-hybridizing sequence of the second primer is 17 to 20 contiguous bases of SEQ ID NO:

13.

38. 30. The kit of claim 28, wherein the one or more reagents comprise each of a reverse transcriptase and a T7 RNA polymerase.

Images