Antisense guide RNA with a functional region added to edit target RNA

Abstract

Problem: Providing antisense guide RNA for editing target RNA by ADAR. Solution: Antisense guide RNA, for editing target RNA by ADAR, wherein: at least one functional region and an antisense region that is complementary to part of the target RNA and forms a double strand with the target RNA are included; and the at least one functional region is joined to the antisense region and substantially does not include an ADAR-recruiting base sequence. Representative drawing: None

Description

[Technical Field]

[0001] The present invention relates to guide RNAs for inducing ADAR to edit target RNAs, in particular antisense guide RNAs to which functional regions have been added. [Background technology]

[0002] RNA editing mechanisms based on single-nucleotide mutations exist in living organisms. In particular, A-to-I RNA editing, which converts adenosine to inosine by deamination, is the most common and targets as many as 4 million RNAs. Adenosine deaminases acting on RNA (ADARs) are enzymes that convert adenosine to inosine using double-stranded RNA as a substrate. There are three genetically distinct subtypes of ADARs (ADAR1, ADAR2, and ADAR3). ADARs possess a double-stranded RNA-binding domain at their N-terminus and a deaminase domain at their C-terminus. ADAR2 highly efficiently edits GluR2, a subunit of the 3-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptor, particularly in the central nervous system (Nature, 1996, Vol. 379, pp. 460-464). Since inosine, which is converted from adenosine, has a similar structure to guanosine, it is recognized as guanosine during translation, which can result in the introduction of amino acid mutations in coding regions. Retrotransposons (FEBS Letters, 2006, Vol. 580, pp. 2301-2305) and microRNA (miRNA) precursors have also been reported as substrates of ADAR in non-coding regions, suggesting that ADAR may play a variety of roles in vivo (Annu. Rev. Biochem., 2010, Vol. 79, pp. 321-349).

[0003] Modified ADARs with artificial mutations have also been reported. For example, a mutant ADAR was reported that, by introducing a mutation into ADAR, it was possible to recognize not only adenosine but also cytidine, and to perform RNA editing from C to U, which converts cytidine to uridine by deamination (Science, 2019, Vol. 365, pp. 382-386).

[0004] In recent years, several reports have been published on RNA editing using wild-type ADAR and artificial guide RNAs, including guide RNAs for editing target RNAs containing GluR2-derived ADAR recruitment sequences (WO 2016 / 097212, WO 2017 / 050306, WO 2017 / 010556, WO 2019 / 111957; Nucleic Acids Research, 2017, Vol. 45, pp. 2797-2808; Nature Methods, 2019, Vol. 16, pp. 239-242).

[0005] In addition, as an RNA editing technology using an artificial synthetic nucleic acid, an antisense oligonucleotide, as a guide RNA, a technology has been reported in which an antisense oligonucleotide of 35 bases or more complementary to the target mRNA containing adenosine is used to form an imperfect helix double strand with the mRNA, thereby recruiting ADAR to edit the target RNA (Patent Documents 1 to 3). It has also been reported that target RNA editing by ADAR can be induced using artificial RNA of 100 bases or more (Non-Patent Document 1). In addition, target RNA editing using a conjugate system of an ADAR1 deaminase domain-MS2 coat protein (MCP) fusion protein and an antisense-MS2 RNA has also been reported (Non-Patent Document 2).

[0006] As such, there have been several reports on RNA editing using antisense oligonucleotides. However, in order to use targeted RNA-editing guide RNAs as pharmaceuticals, they must demonstrate a certain level of editing efficiency in cells, but RNA editing technologies with high editing efficiency have not been fully explored.

[0007] Meanwhile, various RNA sequences with various functions are known, such as small nuclear RNA (snRNA), ribosomal RNA (rRNA), and RNA with higher-order structures such as G-quadruplex structures and stem-loop structures. Some of these RNA sequences have also been reported to be added to RNAs such as guide RNAs or antisense oligonucleotides.

[0008] In eukaryotes, snRNAs mediate the splicing and processing of precursor messenger RNA (pre-mRNA) via ribonucleoproteins (RNPs). Five types of snRNPs (U1, U2, U4, U5, and U6) constitute the spliceosome, which is involved in splicing. snRNAs are abundantly and stably expressed in almost all eukaryotic cells (Biological Chemistry, 2018, Vol. 399, pp. 1265-1276).

[0009] U6 snRNA is stably and abundantly expressed in all human cells and forms the ribonucleoprotein U6 snRNP in the nucleus. U6 snRNP constitutes the spliceosome and controls splicing of RNA precursors. The transcription initiation element upstream of the U6 snRNA gene is known as a strong polymerase III (pol III) promoter that drives the expression of any RNA (e.g., ribozymes, antisense ribonucleic acids, RNA aptamers) (Non-Patent Document 3). Non-Patent Documents 3 to 5 report that small RNA (small RNA) expression cassettes constructed with U6-encoding sequences (hereinafter, expression cassettes containing the U6-encoding sequences described in Non-Patent Documents 3 to 5 are referred to as "U6 cassettes") localize the inserted RNA in the nucleus due to the higher-order structure of the U6 sequence. The U6 cassette contains an artificial stem-loop sequence immediately before the poly(U) terminator sequence to ensure stable and potent expression of small RNAs. An artificial stem-loop sequence containing a tetraloop formed by the RNA sequence UNCG has the thermodynamically most stable stem-loop structure (Nucleic Acids Research, 1991, Vol. 19, pp. 5901-5905). It has been suggested that a stable stem-loop structure exhibits resistance to 3'-5' exonuclease activity and stabilizes the transcription product of the U6 cassette (Non-Patent Documents 3-5).

[0010] U1 snRNA consists of a sequence complementary to the splicing donor sequence (the junction between the 3' end of an exon and the 5' end of an intron) and a sequence that forms a cloverleaf structure. Chimeric U1 snRNA, in which the splicing donor sequence of U1 snRNA is replaced with an antisense sequence of the target gene, is known to be able to induce exon skipping (Mol. Ther., 2010, Vol. 18, pp. 1675-1682; Proc. Nat. Acad. Sci., 2002, Vol. 99, pp. 9456-9461). The 400 bases upstream of the U1 snRNA gene contain a Pol II-type promoter, which is also used for transcription of the chimeric U1 snRNA (Mol. Ther., 2004, Vol. 10, pp. 191-199).

[0011] U7 snRNA is responsible for processing histone pre-mRNA. It consists of a sequence complementary to histone 3 pre-mRNA, an Sm protein-binding site, and a stem-loop sequence. Mutation of the Sm protein-binding site allows it to bind to D1 and D2 proteins that form the spliceosome instead of the original Lsm protein (Cell. Mol. Life Sci., 2004, Vol. 61, pp. 2560-2570). It has been reported that a mutant chimeric U7 snRNA consisting of an antisense sequence of a target gene, a mutated Sm protein-binding site, and a stem-loop sequence can induce exon skipping (Nat. Med., 2014, Vol. 20, pp. 992-1000). The sequence 270 bases upstream of the U7 snRNA gene contains a polymerase II (pol II) promoter, which is also used for transcription of the mutant chimeric U7 snRNA (Science, 2004, Vol. 306, pp. 1796-1799).

[0012] Ribosomes are organelles that synthesize proteins within cells and are composed of two subunits. The large subunit in eukaryotes consists of 28S, 5.8S, and 5S rRNAs and various proteins. It assembles in the nucleolus and is then transported to the cytoplasm. 5S rRNA has a secondary structure consisting of five helices and five loops. Non-Patent Document 5 reports that using an expression cassette containing an antisense sequence containing the 5S rRNA sequence and transcribing the antisense sequence linked to the 5S rRNA from a Pol III promoter upstream of the 5S gene results in localization in the cytoplasm (hereinafter, the expression cassette containing the 5S rRNA described in Non-Patent Document 5 is referred to as the "5S cassette"). Similar to the U6 cassette, the 5S cassette contains an artificial stem-loop sequence immediately before the terminator sequence.

[0013] The G-quadruplex (Gq) structure is a repeating sequence containing guanine, known as a thermodynamically stable DNA or RNA higher-order structure in vivo. Its formation requires monovalent cations. Gq was originally reported as a sequence found in telomeres (Cell, 1989, Vol. 59, pp. 871-880). Functions of Gq include transcription / translation and epigenetic regulation (EMBO Reports, 2015, Vol. 16, pp. 910-922). It has been reported that adding Gq to the 3' end of Cas9 guide RNA improves genome editing efficiency (Non-Patent Document 6). It has also been reported that adding Gq to antisense oligonucleotides increases the efficiency of gene silencing by RNases (Patent Document 4).

[0014] Stem-loop structures, which are higher-order nucleic acid structures found in small RNAs, are known to contribute to translational regulatory functions (Cell. Mol. Life Sci., 2006, Vol. 63, pp. 901-908). The BoxB sequence derived from λ phage has a stem-loop structure and exhibits strong affinity with λN protein (Biol. Cell., 2008, Vol. 100, pp. 125-138; J. Am. Chem. Soc., 2002, Vol. 124, pp. 10966-10967). Taking advantage of this property, it has been reported that a BoxB sequence is added to a guide RNA and λN protein is fused to the ADAR in order to recruit the guide RNA to the ADAR (Non-Patent Document 7). Furthermore, Patent Document 5 describes that a BoxB sequence can be added to the 3' end of a guide RNA designed based on the GluR2 sequence in order to stabilize the guide RNA, but Non-Patent Document 8 describes that the stabilizing effect of adding a BoxB sequence to a guide RNA was minimal.

[0015] As such, although RNA sequences with various functions have been reported, there have been no reports of adding a functional RNA sequence to contribute to the editing activity of a guide RNA that edits a target RNA.

Prior Technology Literature

[0016]

Patent Document 1

Patent document 2

Patent Document 3

Patent document 4

Patent document 5

Non-licensed literature

[0017]

Non-licensed literature 1

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

[0018] Provided are antisense guide RNAs for editing target RNAs by ADARs and nucleic acids encoding the same. [Means for solving the problem]

[0019] The present inventors have conducted extensive research into guide RNAs for inducing ADAR to edit target RNAs, and have discovered that guide RNAs that contain an antisense region linked to at least one functional region and that are substantially free of ADAR-recruiting base sequences exhibit high editing efficiency in cells, leading to the completion of the present invention. That is, the present invention relates to the following [1] to

[23] . [1] A guide RNA for editing a target RNA by ADAR, comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of an ADAR-recruiting base sequence. [2] The guide RNA according to [1], wherein at least one functional region is directly linked to the antisense region or linked via a linker. [3] The guide RNA according to [1] or [2], wherein the antisense region has a base that forms a mismatch base pair with the target RNA. [4] The guide RNA according to any one of [1] to [3], wherein the functional region is a region consisting of a base sequence having one or more functions consisting of stabilization of the guide RNA, localization of the guide RNA in the nucleus, localization of the guide RNA in the cytoplasm, promotion of duplex formation between the target RNA and the antisense region, nonspecific inhibition of duplex formation by the antisense region, and stabilization of a complex formed between the target RNA and the antisense region. [5] A guide RNA according to any one of [1] to [4], wherein the functional region is a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a base sequence that forms a G-quadruplex structure, or a region consisting of a base sequence that forms a stem-loop structure, or any combination thereof. [6] The guide RNA according to [5], wherein the functional region is a region consisting of an snRNA sequence and an optionally included region consisting of a base sequence that forms a stem-loop structure. [7] The guide RNA according to [6], wherein the region consisting of an snRNA sequence is a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, or a region consisting of a U7 snRNA sequence. [8] The guide RNA according to [5], wherein the functional region is a region consisting of an rRNA sequence and an optionally included region consisting of a base sequence that forms a stem-loop structure. [9] The guide RNA according to [8], wherein the region consisting of an rRNA sequence is a region consisting of a 5S rRNA sequence.

[10] The guide RNA according to [5], wherein the functional region is a region consisting of a base sequence that forms a G-quadruplex structure, a region consisting of a base sequence that forms a stem-loop structure, or a combination thereof.

[11] A guide RNA according to any one of [1] to [5], which comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, an optionally included additional functional region, and an optionally included linker, wherein the antisense region, the functional region consisting of a base sequence that forms a G-quadruplex structure, and the optionally included additional functional region are linked in this order from the 5' end to the 3' end.

[12] A guide RNA according to any one of [1] to [5], which comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, an optionally contained further functional region, and an optionally contained linker, wherein the functional region consisting of a base sequence that forms a stem-loop structure and the antisense region are linked in this order from the 5' side to the 3' side.

[13] A system for editing a target RNA, comprising the guide RNA according to any one of [1] to

[12] and an ADAR.

[14] A nucleic acid encoding the guide RNA according to any one of [1] to

[12] .

[15] An expression vector comprising a nucleic acid encoding the guide RNA according to any one of [1] to

[12] .

[16] The expression vector according to

[15] , further comprising a nucleic acid encoding an ADAR.

[17] The expression vector according to

[16] , wherein the ADAR is ADAR1 or ADAR2.

[18] A host cell into which the expression vector according to any one of

[15] to

[17] has been introduced.

[19] A method for producing an expression vector, comprising the step of culturing the host cell according to

[18] .

[20] A pharmaceutical composition comprising the expression vector according to any one of

[15] to

[17] and a pharmaceutically acceptable excipient.

[21] A pharmaceutical composition comprising the expression vector according to

[15] , an expression vector containing a nucleic acid encoding ADAR, and a pharmaceutically acceptable excipient.

[22] A method for editing a target RNA, comprising the step of introducing a nucleic acid encoding the guide RNA according to any one of [1] to

[12] into a cell, a virus, or the like.

[23] A polynucleotide for editing a target RNA by ADAR, comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the polynucleotide is substantially free of an ADAR recruitment base sequence. [Effects of the Invention]

[0020] Antisense guide RNAs with added functional regions can be used as guide RNAs for editing target RNAs. DETAILED DESCRIPTION OF THE INVENTION

[0021] The present invention will be described in detail below, but the present invention is not limited thereto. Unless a term used in this specification is specifically defined, the term is used in the sense generally accepted by those skilled in the art.

[0022] <Guide RNA of the present invention> The present invention provides a guide RNA for editing a target RNA by ADAR, which comprises at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of an ADAR recruitment sequence (hereinafter also referred to as "guide RNA of the present invention"). In the present invention, "guide RNA for editing a target RNA by ADAR" refers to an RNA molecule that has a region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, and that guides ADAR to the target RNA.

[0023] 1.Target RNA In the present invention, "target RNA" refers to RNA that is targeted for editing by the guide RNA of the present invention. A portion of the target RNA contains adenosine, which is converted to inosine, or cytidine, which is converted to uridine. In one embodiment, the target RNA is any RNA sequence that contains adenosine and can regulate cellular function and / or gene expression by converting the adenosine to inosine. In another embodiment, the target RNA is any RNA sequence that contains cytidine and can regulate cellular function and / or gene expression by converting the cytidine to uridine. Here, "cell function can be regulated" means that the function of the cell can be regulated by changing the RNA function, translation, or protein function in a cell that has the target RNA. "Gene expression can be regulated" means that the expression of a gene that has the target RNA can be regulated. The target RNA may be present within RNA, including exons, introns, coding regions within exons, or various untranslated regions (e.g., retrotransposons, microRNAs (miRNAs), transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), etc.). The target RNA may be present within RNA contained in eukaryotic cells, mammalian cells, viruses, prokaryotic cells, bacteria, phages, etc.

[0024] 2. Antisense region The guide RNA of the present invention includes an antisense region. In the present invention, the term "antisense region" refers to a region having a nucleotide sequence complementary to a portion of a target RNA and consisting of a sequence that forms a double strand with the target RNA. The length of the nucleotide sequence constituting the antisense region is, in some embodiments, 10 to 100 nucleotides, 10 to 80 nucleotides, 10 to 60 nucleotides, or 10 to 40 nucleotides, in some embodiments, 15 to 40 nucleotides, in some embodiments, 10 to 38 nucleotides, in some embodiments, 15 to 38 nucleotides, or in some embodiments, 18 to 38 nucleotides. In some embodiments, the antisense region may contain bases that form mismatch base pairs or wobble base pairs with the target RNA. In some embodiments, the antisense region may contain bases that form mismatch base pairs with the target RNA.

[0025] As used herein, "mismatch base pairs" refer to GA, CA, UC, AA, GG, CC, and UU base pairs. As used herein, "wobble base pairs" refer to GU, IU, IA, and IC base pairs. In one embodiment, the antisense region is a region consisting of a base sequence that has a base that forms a mismatch base pair with adenosine or cytidine contained in a portion of the target RNA and forms a double strand with the target RNA. In one embodiment, the antisense region is a region consisting of a base sequence that has a base that forms a mismatch base pair with adenosine contained in a portion of the target RNA and forms a double strand with the target RNA. In one embodiment, the antisense region is a region consisting of a base sequence that has cytidine, a base that forms a mismatch base pair with adenosine contained in a portion of the target RNA, and forms a double strand with the target RNA.

[0026] The base sequence constituting the antisense region can be appropriately designed by those skilled in the art, taking into consideration the sequence and base length of the target RNA, the position of the mismatch base formed with the target RNA, off-target effects, etc. The base sequence constituting the antisense region can also be designed to form a mismatch base pair or a wobble base pair with adenosine or cytidine in order to improve the efficiency of editing of the target RNA by ADAR into adenosine or cytidine (RNA, 2001, Vol. 7, pp. 846-858; Nat. Biotechnol., 2019, Vol. 37, pp. 1059-1069).

[0027] As used herein, "ASR" means antisense region.

[0028] 3.Functional area The guide RNA of the present invention comprises at least one functional region. In the present invention, the term "functional region" refers to a region consisting of a nucleotide sequence having one or more functions, such as stabilizing the guide RNA, localizing the guide RNA to the nucleus, localizing the guide RNA to the cytoplasm, promoting duplex formation between the target RNA and the antisense region, inhibiting nonspecific duplex formation by the antisense region, and stabilizing the complex formed between the target RNA and the antisense region. In one embodiment, the functional region is a region consisting of a nucleotide sequence having one or more functions, such as stabilizing the guide RNA, localizing the guide RNA to the nucleus, localizing the guide RNA to the cytoplasm, promoting duplex formation between the target RNA and the antisense region, inhibiting nonspecific duplex formation by the antisense region, and stabilizing the complex formed between the target RNA and the antisense region.

[0029] In one embodiment, the guide RNA of the present invention includes, as functional regions, (a) a region consisting of a nucleotide sequence that promotes stabilization of the guide RNA, (b) a region consisting of a nucleotide sequence that promotes localization of the guide RNA in the nucleus, (c) a region consisting of a nucleotide sequence that promotes localization of the guide RNA in the cytoplasm, (d) a region consisting of a nucleotide sequence that promotes duplex formation between the target RNA and the antisense region, (e) a region consisting of a nucleotide sequence that inhibits nonspecific duplex formation by the antisense region, or (f) a region consisting of a nucleotide sequence that promotes stabilization of a complex formed between the target RNA and the antisense region, or a region consisting of a nucleotide sequence having two or more of the functions described in (a) to (f). A functional region having one or more of these functions may be collectively referred to as "having a function." Furthermore, having the functions described in (a), (b), and (d) may be collectively referred to as "having the function of an snRNA sequence." Having the functions described in (a) and (c) may be collectively referred to as "having the function of an rRNA sequence."

[0030] As used herein, "promoting guide RNA stabilization" refers to conferring resistance to RNases. This function can be evaluated by known methods, such as measuring the amount of guide RNA remaining in the presence of RNases, or the amount of guide RNA remaining in cells under transcription inhibition after introducing a nucleic acid encoding the guide RNA into a cell. For example, this can be evaluated by the method described in Example 10. "Promoting guide RNA localization to the nucleus" refers to promoting the nuclear migration and localization of guide RNA introduced into a cell. This function can be evaluated by known methods, such as detecting the distribution and amount of guide RNA within the cell. For example, this can be confirmed by in situ hybridization (Mol. Ther., 2003, Vol. 7, pp. 237-247). "Promoting guide RNA localization to the cytoplasm" refers to promoting the retention of guide RNA introduced into a cell in the cytoplasm. This function can be evaluated by known methods, such as detecting the distribution and amount of guide RNA within the cell. For example, this can be confirmed by in situ hybridization (Mol. Ther., 2003, Vol. 7, pp. 237-247). "Promoting duplex formation between a target RNA and an antisense region" refers to improving the affinity between the target RNA and the antisense region. This function can be evaluated by affinity assays using known methods (BMC Biotech., 2008, Vol. 8, article number 48). "Inhibiting nonspecific duplex formation by the antisense region" refers to reducing nonspecific duplex formation (also referred to as "off-target effects"). This function can be evaluated by known methods such as RNA sequencing (Nat. Biotechnol., 2019, Vol. 37, pp. 657-666). "Promoting stabilization of a complex formed between a target RNA and an antisense region" refers to maintaining the state of a complex containing a duplex formed between the target RNA and the antisense region.This function can be evaluated by measuring the remaining amount of the duplex formed between the target RNA and the antisense region in the presence of an RNase that degrades the RNA in the DNA / RNA hybrid strand, using a known method. For example, it can be evaluated by measuring the remaining amount of the duplex formed between the target RNA and a guide RNA consisting of a DNA sequence in the presence of RNase H (Antiviral Chemistry & Chemotherapy, 1996, Vol. 7, pp. 86-93).

[0031] In one embodiment, the region consisting of a nucleotide sequence that promotes guide RNA stabilization is a region consisting of a nucleotide sequence that forms a thermodynamically stabilized higher-order structure. The thermodynamically stabilized higher-order structure is not particularly limited as long as it is a structure that is resistant to nuclease activity. In one embodiment, the region consisting of a nucleotide sequence that promotes guide RNA stabilization is a region consisting of a small nuclear RNA (snRNA) sequence, a region consisting of a ribosomal RNA (rRNA) sequence, a region consisting of a nucleotide sequence that forms a double-stranded structure, a region consisting of a nucleotide sequence that forms a triple-stranded structure, a region consisting of a nucleotide sequence that forms a quadruplex structure, a region consisting of a nucleotide sequence that forms a stem-loop structure, or the like. In one embodiment, the region consisting of a nucleotide sequence that promotes guide RNA stabilization is a region consisting of an snRNA sequence, a region consisting of a nucleotide sequence that forms a G-quadruplex (Gq) structure, or a region consisting of a nucleotide sequence that forms a stem-loop structure.

[0032] In one embodiment, the region consisting of a nucleotide sequence that promotes localization of the guide RNA to the nucleus is a region consisting of a nucleotide sequence derived from a small RNA, or an snRNA sequence.

[0033] In one embodiment, the region consisting of a nucleotide sequence that promotes localization of the guide RNA in the cytoplasm is a region consisting of a nucleotide sequence derived from a small RNA. In one embodiment, the region consisting of a nucleotide sequence that promotes localization of the guide RNA in the cytoplasm is a region consisting of a nucleotide sequence that promotes localization of the guide RNA to ribosomes, and in one embodiment, a region consisting of an rRNA sequence. In one embodiment, the region consisting of a nucleotide sequence that promotes localization of the guide RNA in the cytoplasm is a region consisting of a transfer RNA (tRNA) sequence. In one embodiment, the region consisting of a nucleotide sequence that promotes localization of the guide RNA in the cytoplasm is a region consisting of a 7SL RNA sequence, which is an RNA sequence derived from a signal recognition particle (SRP).

[0034] In one embodiment, the region consisting of a nucleotide sequence that promotes duplex formation between the target RNA and the antisense region is a region consisting of a nucleotide sequence that thermodynamically and conformationally promotes the formation of a duplex and a complex containing a duplex (Nat. Biotechnol., 2019, Vol. 37, pp. 657-666). In one embodiment, the region consisting of a nucleotide sequence that promotes duplex formation between the target RNA and the antisense region is a region consisting of an snRNA sequence, a region consisting of a nucleotide sequence that forms a stem-loop structure, or any combination thereof. In one embodiment, the region consisting of a nucleotide sequence that promotes duplex formation between the target RNA and the antisense region is a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, a region consisting of a U7 snRNA sequence, a region consisting of a nucleotide sequence that forms a stem-loop structure, or any combination thereof.

[0035] In one embodiment, the region consisting of a nucleotide sequence that inhibits nonspecific duplex formation by the antisense region is a region consisting of a nucleotide sequence that thermodynamically and conformationally reduces off-target effects. In one embodiment, the region consisting of a nucleotide sequence that inhibits nonspecific duplex formation by the antisense region is a region consisting of a nucleotide sequence that forms a stem-loop structure (Chem. Commun., 2018, Vol. 54, pp. 2377-2380).

[0036] In one embodiment, the region consisting of a nucleotide sequence that promotes stabilization of the complex formed between the target RNA and the antisense region is a region consisting of a nucleotide sequence that thermodynamically and conformationally stabilizes double-stranded chains and complexes containing double-stranded chains, and exhibits resistance to nuclease activity (Antiviral Chemistry & Chemotherapy, 1996, Vol. 7, pp. 86-93). In another embodiment, the region consisting of a nucleotide sequence that promotes stabilization of the complex formed between the target RNA and the antisense region is a region consisting of a nucleotide sequence that forms a stem-loop structure.

[0037] In one embodiment, the guide RNA of the present invention comprises, as a functional region, a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a nucleotide sequence that forms a G-quadruplex (Gq) structure, a region consisting of a nucleotide sequence that forms a stem-loop structure, a region consisting of an SRP-derived RNA sequence, a region consisting of a long non-coding RNA (lncRNA) sequence, a region consisting of a tRNA sequence, a region consisting of a small nucleolar RNA (snoRNA) sequence, a region consisting of an miRNA sequence, or any combination thereof. In one embodiment, the guide RNA of the present invention comprises, as a functional region, a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a nucleotide sequence that forms a Gq structure, a region consisting of a nucleotide sequence that forms a stem-loop structure, or any combination thereof.

[0038] In one embodiment, the guide RNA of the present invention comprises a region consisting of an snRNA sequence as a functional region. In one embodiment, the guide RNA of the present invention comprises a region consisting of an snRNA sequence and a region consisting of a nucleotide sequence forming a stem-loop structure as functional regions. In one embodiment, the region consisting of a nucleotide sequence forming a stem-loop structure that can be used in combination with the region consisting of an snRNA sequence is a region consisting of an artificial stem-loop sequence. An artificial stem-loop sequence is a sequence that forms an artificially created stem-loop structure, and examples thereof include artificial stem-loop sequences (referred to herein as "STL sequences") contained in a U6 cassette or a 5S cassette (Gene Ther., 1997, Vol. 4, pp. 45-54; Nat. Biotechnol., 2002, Vol. 20, pp. 505-508; Mol. Ther., 2003, Vol. 7, pp. 237-247). In one embodiment, the region consisting of a nucleotide sequence forming a stem-loop structure that can be used in combination with the region consisting of an snRNA sequence is a region consisting of an STL sequence. In one aspect, the guide RNA of the present invention comprises, as functional regions, a region consisting of an snRNA sequence and a region consisting of an artificial stem-loop sequence. In one aspect, the guide RNA of the present invention comprises, as functional regions, a region consisting of an snRNA sequence and a region consisting of an STL sequence.

[0039] The region consisting of the snRNA sequence used in the present invention is a region consisting of a snRNA base sequence known to those skilled in the art, and may include partial modifications in the base sequence of a natural snRNA, and / or may be a partial sequence of a natural snRNA base sequence, so long as it retains the function of the snRNA sequence. For example, the guide RNA of the present invention comprises, as a functional region, a region consisting of the U1 snRNA sequence, U2 snRNA sequence, U4 snRNA sequence, U5 snRNA sequence, U6 snRNA sequence, U7 snRNA sequence, U11 snRNA sequence, U12 snRNA sequence, U4atac snRNA sequence, or U6atac snRNA sequence, or any combination thereof. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of the U1 snRNA sequence, U2 snRNA sequence, U4 snRNA sequence, U5 snRNA sequence, U6 snRNA sequence, or U7 snRNA sequence, or any combination thereof. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, or a region consisting of a U7 snRNA sequence.

[0040] In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U6 snRNA sequence, a region consisting of the U1 snRNA sequence, or a region consisting of the U7 snRNA sequence, and a region consisting of a nucleotide sequence forming a stem-loop structure. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U6 snRNA sequence and a region consisting of a nucleotide sequence forming a stem-loop structure. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U6 snRNA sequence and a region consisting of an artificial stem-loop sequence. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U6 snRNA sequence and a region consisting of an STL sequence. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U1 snRNA sequence and a region consisting of a nucleotide sequence forming a stem-loop structure. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U1 snRNA sequence and a region consisting of an artificial stem-loop sequence. In one embodiment, the guide RNA of the present invention comprises, as functional regions, a region consisting of the U1 snRNA sequence and a region consisting of an STL sequence. In one aspect, the guide RNA of the present invention comprises, as functional regions, a region consisting of a U7 snRNA sequence and a region consisting of a nucleotide sequence forming a stem-loop structure. In one aspect, the guide RNA of the present invention comprises, as functional regions, a region consisting of a U7 snRNA sequence and a region consisting of an artificial stem-loop sequence. In one aspect, the guide RNA of the present invention comprises, as functional regions, a region consisting of a U7 snRNA sequence and a region consisting of an STL sequence.

[0041] The region consisting of the U6 snRNA sequence used in the present invention is a region composed of the nucleotide sequence of U6 snRNA, and may contain partial modifications in the nucleotide sequence of natural U6 snRNA, and / or may be a partial sequence of natural U6 snRNA, so long as it retains the function of the snRNA sequence. In one embodiment, the region consisting of the U6 snRNA sequence used in the present invention is a region consisting of a partial sequence of the nucleotide sequence of U6 snRNA, and in one embodiment, is a region consisting of the nucleotide sequence from the transcription start site to the 27th base of the nucleotide sequence of U6 snRNA. In the guide RNA of the present invention, the region consisting of the U6 snRNA sequence may be used in combination with a region consisting of an artificial stem-loop sequence, so long as it retains the function of the snRNA sequence. When a region consisting of the U6 snRNA sequence and a region consisting of an artificial stem-loop sequence are used, an antisense region is inserted between the region consisting of the U6 snRNA sequence and the region consisting of the artificial stem-loop sequence. In one aspect, the region consisting of the U6 snRNA sequence used in the present invention is a region consisting of a nucleotide sequence having the function of an snRNA sequence, which is the nucleotide sequence shown in SEQ ID NO: 1, or the nucleotide sequence shown in SEQ ID NO: 1 in which 1 to 3 bases have been deleted, substituted, inserted and / or added. In one aspect, the region consisting of the artificial stem-loop sequence used in the present invention is a region consisting of an STL sequence, and in another aspect, is a region consisting of the nucleotide sequence shown in SEQ ID NO: 2, or the nucleotide sequence shown in SEQ ID NO: 2 in which 1 to 3 bases have been deleted, substituted, inserted and / or added, and which forms a stem-loop structure.

[0042] The region consisting of the U1 snRNA sequence used in the present invention is a region composed of the nucleotide sequence of U1 snRNA. As long as it retains the function of the snRNA sequence, it may contain partial modifications in the nucleotide sequence of natural U1 snRNA and / or may be a partial sequence of natural U1 snRNA, as long as it retains the function of the snRNA sequence. In the guide RNA of the present invention, the region consisting of the U1 snRNA sequence may be used by linking an antisense region to the U1 snRNA sequence, or by inserting an antisense region into the U1 snRNA sequence, as long as it retains the function of the snRNA sequence. When inserting an antisense region into the U1 snRNA sequence, the U1 snRNA sequence is divided into any two regions and the antisense region is inserted between them. Inserting an antisense region into the U1 snRNA sequence may be performed by replacing a portion of the U1 snRNA sequence with the antisense region. In one embodiment, the nucleotide sequence from the third to tenth bases from the transcription start point of the U1 snRNA sequence can be replaced with the antisense region. In one embodiment, an antisense region can be inserted into the U1 snRNA sequence at the third base from the transcription start point of the U1 snRNA sequence, which consists of a nucleotide sequence in which eight bases, from the third base to the tenth base from the transcription start point of the U1 snRNA sequence, have been deleted. In one embodiment, the region consisting of the U1 snRNA sequence used in the present invention is the nucleotide sequence shown in SEQ ID NO: 3, or the nucleotide sequence in which 1 to 20 bases have been deleted, substituted, inserted, and / or added from the nucleotide sequence shown in SEQ ID NO: 3, and is a region consisting of a nucleotide sequence that functions as an snRNA sequence. In another embodiment, the region is the nucleotide sequence in which eight bases, from the third base to the tenth base from the transcription start point of the nucleotide sequence shown in SEQ ID NO: 3, have been deleted, substituted, inserted, and / or added from the nucleotide sequence shown in SEQ ID NO: 3, and is a region consisting of a nucleotide sequence that functions as an snRNA sequence.

[0043] The region consisting of the U7 snRNA sequence used in the present invention is a region composed of the nucleotide sequence of U7 snRNA. It may contain partial modifications in the nucleotide sequence of natural snRNA, and / or may be a partial sequence of natural U7 snRNA, so long as it retains the function of the snRNA sequence. In one embodiment, the region consisting of the U7 snRNA sequence used in the present invention is a region consisting of a partial sequence of the nucleotide sequence of U7 snRNA. In another embodiment, the region consisting of the U7 snRNA sequence used in the present invention is a region consisting of a partial sequence of the nucleotide sequence of U7 snRNA, and in another embodiment, is a region consisting of a U7 snRNA sequence containing the Sm protein binding site (Sm OPT sequence) and the stem-loop sequence of U7 snRNA. In the guide RNA of the present invention, the region consisting of the U7 snRNA sequence may be used by linking an antisense region to the U7 snRNA sequence, or by inserting an antisense region into the U7 snRNA sequence, so long as it retains the function of the snRNA sequence. The region consisting of the U7 snRNA sequence used in the present invention is the base sequence shown in SEQ ID NO: 4, or a base sequence in which 1 to 10 bases have been deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 4, and is a region consisting of a base sequence that has the function of an snRNA sequence.

[0044] In one embodiment, the guide RNA of the present invention comprises, as a functional region, a region consisting of an rRNA sequence. In one embodiment, the guide RNA of the present invention comprises, as a functional region, a region consisting of an rRNA sequence and a region consisting of a nucleotide sequence that forms a stem-loop structure.

[0045] The region consisting of an rRNA sequence used in the present invention is a region consisting of an rRNA base sequence well known to those skilled in the art, and may contain partial modifications in the base sequence of natural rRNA as long as it has the function of an rRNA sequence. In one aspect, the guide RNA of the present invention comprises a region consisting of a eukaryotic rRNA sequence as a functional region. In one aspect, the guide RNA of the present invention comprises a region consisting of a 28S rRNA sequence, an 18S rRNA sequence, a 5.8S rRNA sequence, a 5S rRNA sequence, a mitochondrial 12S rRNA sequence, or a mitochondrial 16S rRNA sequence, or any combination thereof as a functional region. In one aspect, the guide RNA of the present invention comprises a region consisting of a 5S rRNA sequence as a functional region.

[0046] The region consisting of a 5S rRNA sequence used in the present invention is a region consisting of the nucleotide sequence of 5S rRNA, and may include partial modifications in the natural 5S rRNA nucleotide sequence, so long as it retains the function of an rRNA sequence. In the guide RNA of the present invention, the region consisting of a 5S rRNA sequence may be used in combination with a region consisting of an artificial stem-loop sequence, so long as it retains the function of an rRNA sequence. When a region consisting of a 5S rRNA sequence and a region consisting of an artificial stem-loop sequence are used, an antisense region is inserted between the region consisting of the 5S rRNA sequence and the region consisting of the artificial stem-loop sequence. In one embodiment, the region consisting of a 5S rRNA sequence used in the present invention is a region consisting of a nucleotide sequence represented by SEQ ID NO: 5, or a nucleotide sequence represented by SEQ ID NO: 5 in which 1 to 10 bases have been deleted, substituted, inserted, and / or added, and which retains the function of an rRNA sequence. In one aspect, the region consisting of the artificial stem-loop sequence used in the present invention is a region consisting of a base sequence that forms a stem-loop structure, which is the base sequence shown in SEQ ID NO: 2 or a base sequence in which 1 to 3 bases have been deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 2.

[0047] In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a nucleotide sequence that forms a G-quadruplex structure, or a region consisting of a nucleotide sequence that forms a stem-loop structure, or a combination thereof. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a nucleotide sequence that forms a G-quadruplex structure. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a nucleotide sequence that forms a stem-loop structure.

[0048] The region consisting of a base sequence forming a G-quadruplex structure (Gq structure) used in the present invention includes a Gq sequence. A Gq sequence is a sequence containing four repeating units of consecutive guanines, and the four guanines form a planar quadruplex (Gq) structure. Bases other than guanine may be contained between the repeating units of guanine as long as the Gq structure is maintained. In one embodiment, the Gq sequence contains repeating units of 1, 2, 3, or 4 consecutive guanines, forming 1, 2, 3, or 4 layers of Gq, respectively. In another embodiment, the Gq sequence contains repeating units of 3 consecutive guanines, forming 3 layers of Gq. This is referred to as a "three-layer G-quadruplex structure" (hereinafter also referred to as "3Gq"). In one aspect, the guide RNA of the present invention comprises a region consisting of a base sequence that forms 3Gq as a functional region, and in one aspect, the region consisting of a base sequence that forms 3Gq is the base sequence shown in SEQ ID NO: 6, or a base sequence in which 1 to 3 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 6, and is a region consisting of a base sequence that forms a Gq structure.

[0049] Stem-loop structures, also called hairpin structures, are well known in the art. Examples of base sequences that form stem-loop structures include aptamer sequences (Int. J. Biochem. Mol. Biol., 2013, Vol. 4, pp. 27-40, International Publication No. 2016 / 143700), sequences derived from BoxB sequences, sequences derived from MS2 sequences, and sequences derived from PP7 sequences (Integr. Biol., 2009, Vol. 1, pp. 499-505, Nucleic Acids Research, 2016, Vol. 44, pp. 9555-9564), and artificial stem-loop sequences (e.g., artificial stem-loop sequences (STL sequences) contained in a U6 cassette or a 5S cassette (Gene Ther., 1997, Vol. 4, pp. 45-54; Nat. Biotechnol., 2002, Vol. 20, pp. 505-508; Mol. Ther., 2003, Vol. 7, pp. 237-247).

[0050] In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a nucleotide sequence that forms a stem-loop structure, and the region consisting of a nucleotide sequence that forms the stem-loop structure is a region consisting of a sequence derived from a BoxB sequence, an aptamer sequence, a sequence derived from an MS2 sequence, a sequence derived from a PP7 sequence, or an artificial stem-loop sequence (e.g., an STL sequence), or any combination thereof. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of a sequence derived from a BoxB sequence. In one aspect, the guide RNA of the present invention comprises, as a functional region, a region consisting of an STL sequence.

[0051] In one aspect, the region consisting of a sequence derived from the BoxB sequence used in the present invention is the base sequence shown in SEQ ID NO: 7, or a base sequence in which 1 to 3 bases have been deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 7, and which consists of a base sequence that forms a stem-loop structure.

[0052] In one aspect, the region consisting of an artificial stem-loop sequence used in the present invention is a region consisting of an artificial stem-loop sequence (STL sequence) contained in a U6 cassette or a 5S cassette, and in another aspect, is a region consisting of a base sequence that forms a stem-loop structure, which is the base sequence shown in SEQ ID NO: 2 or a base sequence in which 1 to 3 bases have been deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 2.

[0053] In one embodiment, the guide RNA of the present invention comprises, as a functional region, a region consisting of an SRP-derived RNA sequence, and in another embodiment, the region consisting of the SRP-derived RNA sequence is a region consisting of a 7SL RNA sequence, a 6S RNA sequence, or a 4.5S RNA sequence.

[0054] In one embodiment, the guide RNA of the present invention may contain at least two identical functional regions, and in another embodiment, it may contain at least one each of two or more different functional regions.

[0055] 4. Linking functional regions In the guide RNA of the present invention, the functional region is linked to the antisense region. As used herein, "linking" includes direct linking and linking via a linker. In one embodiment, in the guide RNA of the present invention, at least one functional region is directly linked to the antisense region. In another embodiment, in the guide RNA of the present invention, at least one functional region is linked to the antisense region via a linker. When multiple functional regions are linked together in the guide RNA of the present invention, the link between the functional regions may be either direct or via a linker.

[0056] When a linker is used, in one embodiment, the length of the linker is 1 to 10 bases, in another embodiment, 1 to 6 bases, in another embodiment, 1 to 3 bases, in another embodiment, 3 to 6 bases, in another embodiment, 3 bases, and in another embodiment, 6 bases. The base sequence of the linker can be appropriately designed by those skilled in the art based on the sequence constituting the guide RNA. For example, the base sequence of the linker used in the present invention may be designed so that it does not form a complementary strand with the target RNA. In one embodiment, the linker consists of the base sequence "UCU," the restriction enzyme SalI site sequence "GUCGAC," or the restriction enzyme XbaI site sequence "UCUAGA."

[0057] In one embodiment, when the guide RNA of the present invention comprises a region consisting of a sequence derived from a BoxB sequence as a functional region, a linker can be used between the region consisting of a sequence derived from a BoxB sequence and the antisense region, and between the region consisting of a sequence derived from a BoxB sequence and another functional region; in one embodiment, the linker has the nucleotide sequence "UCU." In one embodiment, when the guide RNA of the present invention comprises a region consisting of a U6 snRNA sequence and an optionally included region consisting of a nucleotide sequence that forms a stem-loop structure as a functional region, or when the guide RNA of the present invention comprises a region consisting of a 5S rRNA sequence and an optionally included region consisting of a nucleotide sequence that forms a stem-loop structure as a functional region, the antisense region can be linked to the functional region via a linker; in one embodiment, the linker has the nucleotide sequence "GUCGAC" or "UCUAGA."

[0058] 5. Guide RNA for editing target RNA The guide RNA of the present invention is a guide RNA that does not substantially contain an ADAR recruitment base sequence. An "ADAR recruitment base sequence" is a base sequence that forms a stem-loop structure within the same molecule, to which ADAR binds, allowing the ADAR to be recruited to a target RNA. Examples of ADAR recruitment base sequences include base sequences designed based on the stem-loop structure derived from an ADAR substrate, such as GluR2 mRNA precursor (WO 2016 / 097212, WO 2017 / 050306, German Patent No. 102015012522, WO 2017 / 010556, WO 2019 / 111957, Nucleic Acids Research, 2017, Vol. 45, pp. 2797-2808, Nature Methods, 2019, Vol. 16, pp. 239-242). In the present invention, "substantially free of" an ADAR recruiting base sequence means that the same molecule of the guide RNA does not contain an ADAR recruiting base sequence.

[0059] In one embodiment, the guide RNA of the present invention is any of the following guide RNAs: A guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one functional region is directly linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment sequences; or A guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is linked to the antisense region via a linker, and the guide RNA is substantially free of an ADAR recruitment base sequence.

[0060] In one embodiment, the guide RNA of the present invention is a guide RNA as follows: A guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of an ADAR recruitment base sequence, and the antisense region has bases that form mismatch base pairs with the target RNA.

[0061] In one embodiment, the guide RNA of the present invention comprises at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment sequences, and has the following characteristics: (1) The functional region is a region consisting of a base sequence having one or more functions including stabilization of the guide RNA, localization of the guide RNA in the nucleus, localization of the guide RNA in the cytoplasm, promotion of duplex formation between the target RNA and the antisense region, inhibition of nonspecific duplex formation by the antisense region, and stabilization of the complex formed between the target RNA and the antisense region. (2) The functional region is a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a base sequence that forms a G-quadruplex structure, or a region consisting of a base sequence that forms a stem-loop structure, or any combination thereof. (3) The functional region is a region consisting of an snRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (4) The functional region is a region consisting of a snRNA sequence selected from a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, and a region consisting of a U7 snRNA sequence, and a region consisting of an optionally contained base sequence forming a stem-loop structure. (5) The functional region is a region consisting of a U6 snRNA sequence and a region consisting of an artificial stem-loop sequence. (6) The functional region is a region consisting of a partial base sequence of the U6 snRNA sequence and having the function of the snRNA sequence, and a region consisting of an artificial stem-loop sequence. (7) The functional region is a region consisting of a partial sequence from the transcription start site to the 27th base of the nucleotide sequence of the U6 snRNA sequence, which has the function of an snRNA sequence, and a region consisting of an artificial stem-loop sequence. (8) The functional region is a region consisting of a base sequence having the function of an snRNA sequence, which is the base sequence shown in SEQ ID NO: 1 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 1, and a region consisting of a base sequence forming a stem-loop structure, which is the base sequence shown in SEQ ID NO: 2 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 2. (9) The functional region is a region consisting of a U1 snRNA sequence. (10) The functional region is a region consisting of a base sequence having the function of an snRNA sequence, which is the base sequence shown in SEQ ID NO: 3 or a base sequence in which 1 to 20 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 3. (11) The functional region is a base sequence in which 8 bases from the 3rd base to the 10th base from the transcription start site in the base sequence shown in SEQ ID NO: 3 are deleted, and the functional region is a region consisting of a base sequence having the function of an snRNA sequence. (12) The functional region is a region consisting of a U7 snRNA sequence. (13) The functional region is a partial sequence of the U7 snRNA nucleotide sequence including the Sm protein binding site (Sm OPT sequence) and the stem-loop sequence of U7 snRNA, and is a region consisting of a nucleotide sequence having the function of the snRNA sequence. (14) The functional region is a region consisting of a base sequence having the function of an snRNA sequence, which is the base sequence shown in SEQ ID NO: 4 or a base sequence in which 1 to 10 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 4. (15) The functional region is a region consisting of an rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (16) The functional region is a region consisting of a 5S rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (17) The functional region is a region consisting of a base sequence having the function of an rRNA sequence, which is the base sequence shown in SEQ ID NO: 5 or a base sequence in which 1 to 10 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 5, and a region consisting of a base sequence that forms an optionally contained stem-loop structure. (18) The functional region is a region consisting of a 5S rRNA sequence and a region consisting of an artificial stem-loop sequence. (19) The functional region is a region consisting of a base sequence having the function of an rRNA sequence, which is the base sequence shown in SEQ ID NO: 5 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 5, and a region consisting of a base sequence having the function of an rRNA sequence, which is the base sequence shown in SEQ ID NO: 2 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted and / or added in the base sequence shown in SEQ ID NO: 2, and which includes a base sequence that forms a stem-loop structure. (20) The functional region is a region consisting of a base sequence that forms a G-quadruplex structure, a region consisting of a base sequence that forms a stem-loop structure, or a combination thereof. (21) The functional region is a region consisting of a base sequence that forms a G-quadruplex structure. (22) The functional region is a region consisting of a base sequence that forms a three-layer G-quadruplex structure. (23) The functional region is a region consisting of a base sequence that forms a G-quadruplex structure, which is the base sequence shown in SEQ ID NO: 6 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 6. (24) The functional region is a region consisting of a base sequence that forms a stem-loop structure. (25) The functional region is a region consisting of a sequence derived from a BoxB sequence. (26) The functional region is a region consisting of a base sequence that forms a stem-loop structure and is the base sequence shown in SEQ ID NO: 7 or a base sequence in which 1 to 3 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 7. (27) The functional region is a combination of a region consisting of a base sequence that forms a G-quadruplex structure and a region consisting of a base sequence that forms a stem-loop structure. (28) The functional region is a combination of a region consisting of a base sequence that forms a three-layer G-quadruplex structure and a region consisting of a sequence derived from a BoxB sequence.

[0062] In the guide RNA of the present invention having any of the above characteristics (1) to (28), at least one of the functional regions may be directly linked to the antisense region or may be linked via a linker.

[0063] In one embodiment, the guide RNA of the present invention comprises at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment sequences, and has the following characteristics: (a-1) The guide RNA comprises a functional region comprising a U6 snRNA sequence, an antisense region, an optionally contained linker, and a region comprising an artificial stem-loop sequence, and the functional region comprising the U6 snRNA sequence, the antisense region, and the region comprising the artificial stem-loop sequence are linked in this order from the 5' end to the 3' end. (a-2) The guide RNA comprises a functional region consisting of a partial sequence from the transcription start point to the 27th base of the nucleotide sequence of the U6 snRNA sequence, which is a nucleotide sequence having the function of an snRNA sequence, an antisense region, an optionally contained linker, and a region consisting of an artificial stem-loop sequence, and the functional region consisting of a partial sequence from the transcription start point to the 27th base of the nucleotide sequence of the U6 snRNA sequence, which is a nucleotide sequence having the function of an snRNA sequence, the antisense region, and the region consisting of the artificial stem-loop sequence are linked in this order from the 5' side to the 3' side. (a-3) The guide RNA comprises a functional region consisting of a U1 snRNA sequence and an antisense region, and the antisense region is inserted into the base sequence of the U1 snRNA sequence. (a-4) The guide RNA comprises a functional region consisting of a base sequence in which 8 bases from the 3rd base to the 10th base from the transcription start point of the base sequence of the U1 snRNA sequence are deleted and which has the function of an snRNA sequence, and an antisense region, and the antisense region is inserted at the 3rd base from the transcription start point of the base sequence of the U1 snRNA sequence. (a-5) The guide RNA comprises a functional region consisting of a U7 snRNA sequence and an antisense region, and the antisense region and the functional region consisting of the U7 snRNA sequence are linked in this order from the 5' end to the 3' end. (a-6) The guide RNA comprises a functional region consisting of a partial sequence of the base sequence of the U7 snRNA sequence, including the Sm protein binding site (Sm OPT sequence) and the stem-loop sequence of the U7 snRNA, and having the function of an snRNA sequence, and an antisense region, and the antisense region and the functional region consisting of the partial sequence of the base sequence of the U7 snRNA sequence are linked in this order from the 5' end to the 3' end. (a-7) The guide RNA comprises a functional region consisting of a 5S rRNA sequence, an antisense region, an optionally contained linker, and a region consisting of an artificial stem-loop sequence, and the functional region consisting of the 5S rRNA sequence, the antisense region, and the region consisting of the artificial stem-loop sequence are linked in this order from the 5' side to the 3' side. (a-8) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, and an optionally contained linker, and the antisense region and the functional region consisting of a base sequence that forms a G-quadruplex structure are linked in this order from the 5' end to the 3' end. (a-9) The guide RNA comprises a functional region consisting of a base sequence that forms a G-quadruplex structure, an antisense region, and an optionally contained linker, and the functional region consisting of a base sequence that forms a G-quadruplex structure and the antisense region are linked in this order from the 5' end to the 3' end. (a-10) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, an additional functional region, and an optionally contained linker, and the antisense region, the functional region consisting of a base sequence that forms a G-quadruplex structure, and the additional functional region are linked in this order from the 5' end to the 3' end. (a-11) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, an additional functional region, and an optionally contained linker, and the additional functional region, the antisense region, and the functional region consisting of a base sequence that forms a G-quadruplex structure are linked in this order from the 5' end to the 3' end. (a-12) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a stem-loop structure, and an optionally contained linker, and the antisense region and the functional region consisting of a base sequence that forms a stem-loop structure are linked in this order from the 5' side to the 3' side. (a-13) The guide RNA comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, and an optionally contained linker, and the functional region consisting of a base sequence that forms a stem-loop structure and the antisense region are linked in this order from the 5' side to the 3' side. (a-14) The guide RNA comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, a further functional region, and an optionally contained linker, and the functional region consisting of a base sequence that forms a stem-loop structure, the antisense region, and the further functional region are linked in this order from the 5' side to the 3' side. (a-15) The guide RNA comprises a functional region consisting of a base sequence that forms a G-quadruplex structure, an antisense region, a functional region consisting of a base sequence that forms a stem-loop structure, and an optionally contained linker, and the functional region consisting of a base sequence that forms a G-quadruplex structure, the antisense region, and the functional region consisting of a base sequence that forms a stem-loop structure are linked in this order from the 5' end to the 3' end. (a-16) The guide RNA comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, and an optionally contained linker, and the functional region consisting of a base sequence that forms a stem-loop structure, the antisense region, and the functional region consisting of a base sequence that forms a G-quadruplex structure are linked in this order from the 5' end to the 3' end. (a-17) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, a functional region consisting of a base sequence that forms a stem-loop structure, and an optionally contained linker, and the antisense region, the functional region consisting of a base sequence that forms a G-quadruplex structure, and the functional region consisting of a base sequence that forms a stem-loop structure are linked in this order from the 5' end to the 3' end; or (a-18) The guide RNA comprises a functional region consisting of a base sequence that forms a G-quadruplex structure, a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, and an optionally included linker, and the functional region consisting of a base sequence that forms a G-quadruplex structure, the functional region consisting of a base sequence that forms a stem-loop structure, and the antisense region are linked in this order from the 5' end to the 3' end.

[0064] <ADAR used in the present invention> The ADAR used in the present invention includes naturally occurring ADARs and their variants as long as they have deaminase activity. Deaminase activity can be measured by detecting the deamination of a substrate using methods known to those skilled in the art. For example, deaminase activity can be measured by detecting the conversion of adenosine to inosine or cytidine to uridine. Specifically, deaminase activity can be measured by the methods described in Examples 7 or 8. In some embodiments, the ADAR used in the present invention is a eukaryotic ADAR, in some embodiments, a mammalian ADAR, or in some embodiments, a human ADAR. In some embodiments, the ADAR used in the present invention is ADAR1 or ADAR2, and in some embodiments, it is ADAR2. ADAR1 includes two splicing variants, ADAR1 p110 and ADAR1 p150, and in some embodiments, the ADAR used in the present invention is ADAR1 p110 or ADAR1 p150. In one embodiment, the ADAR used in the present invention is human ADAR1 or human ADAR2, and in another embodiment, human ADAR2. In one embodiment, the ADAR used in the present invention is a polypeptide comprising a double-stranded-RNA binding domain (dsRBD) and having deaminase enzyme activity (Trends in Biochemical Sciences, 2001, Vol. 26, pp. 376-384; RNA, 2001, Vol. 7, pp. 846-858). In one embodiment, the ADAR used in the present invention is a polypeptide comprising a deaminase domain and capable of converting adenosine in target RNA to inosine. In another embodiment, the ADAR used in the present invention is a polypeptide comprising a deaminase domain and capable of converting cytidine in target RNA to uridine. In yet another embodiment, the ADAR used in the present invention is a polypeptide comprising a deaminase domain and capable of converting adenosine to inosine and cytidine to uridine in target RNA. The ADAR used in the present invention may be a fusion protein with another factor.The ADAR variants used in the present invention include variants having adenosine deaminase activity, variants having cytidine deaminase activity, and variants having deaminase activity that recognizes both adenosine and cytidine and converts them to inosine and uridine, respectively (Science, 2019, Vol. 365, pp. 382-386). The ADAR and ADAR variants used in the present invention may be fusion proteins with other factors.

[0065] In one embodiment, the ADAR used in the present invention is a polypeptide consisting of the amino acid sequence set forth in accession number [NP_001103.1], accession number [NP_056648.1], or accession number [NP_001102.3], or an amino acid sequence that is 90% or more identical to these amino acid sequences, or an amino acid sequence in which 1 to 10 amino acids have been deleted, substituted, inserted, and / or added in these amino acid sequences, and has adenosine deaminase activity. In one embodiment, the ADAR used in the present invention is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 9 (human ADAR2), or an amino acid sequence that is 90% or more identical to said sequence, or an amino acid sequence in which 1 to 10 amino acids have been deleted, substituted, inserted, and / or added in said sequence, and has adenosine deaminase activity. In one embodiment, the ADAR used in the present invention is an ADAR that is endogenously present in eukaryotic cells, or in another embodiment, it may be an ADAR that has been exogenously introduced into eukaryotic cells. ADAR can be introduced into eukaryotic cells by directly introducing an ADAR polypeptide or by introducing an expression vector containing a nucleic acid encoding ADAR.

[0066] As used herein, the term "identity" refers to the value "Identity" obtained by searching using the EMBOSS NEEDLE program (J. Mol. Biol., 1970, Vol. 48, pp. 443-453) using the default parameters. The parameters are as follows: Gap Open penalty=10 Gap Extend penalty=0.5 Matrix=EBLOSUM62

[0067] <Target RNA editing system of the present invention> The present invention also provides a system for editing a target RNA comprising the guide RNA and ADAR of the present invention. The system for editing a target RNA sequence comprising the guide RNA and ADAR of the present invention includes a kit for editing a target RNA sequence comprising the guide RNA and ADAR of the present invention, or a method for editing a target RNA sequence using the guide RNA and ADAR of the present invention. In one embodiment, the system for editing a target RNA of the present invention is a system comprising a guide RNA comprising at least one functional region and an antisense region complementary to a portion of the target RNA and forming a duplex with the target RNA, wherein at least one functional region is linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment base sequences, and an ADAR. In another embodiment, the system is a system comprising a guide RNA comprising at least one functional region and an antisense region complementary to a portion of the target RNA and forming a duplex with the target RNA, wherein at least one functional region is linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment base sequences, and ADAR1 or ADAR2. The target RNA editing system of the present invention can be used intracellularly or extracellularly. In some embodiments, the system can be used in eukaryotic cells. In some embodiments, the system can be used in prokaryotic cells, bacteria, phages, viruses, etc.

[0068] <Nucleic acid encoding the guide RNA of the present invention> The present invention also provides nucleic acids encoding the guide RNAs of the present invention (also referred to in this section as "nucleic acids of the present invention"). The nucleic acids of the present invention are nucleic acids encoding guide RNAs that include at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, with at least one of the functional regions linked to the antisense region, and are substantially free of ADAR recruitment base sequences. In one embodiment, the nucleic acids of the present invention are nucleic acids encoding guide RNAs that include at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, with at least one of the functional regions linked to the antisense region, and are substantially free of ADAR recruitment base sequences, and the nucleic acids encoding the functional regions include the nucleic acids shown below; (1) A nucleic acid consisting of a base sequence shown in one of the SEQ ID NOs shown in the "Nucleic acid encoding a functional region" below, (2) A nucleic acid comprising a base sequence in which 1 to 20 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 12 in the "nucleic acid encoding a functional region" below, and which has a function as the functional region; (3) A nucleic acid comprising a base sequence in which 1 to 10 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14 shown in the "nucleic acid encoding a functional region" below, and which has a function as the functional region; (4) A nucleic acid comprising a base sequence in which 1 to 3 bases are deleted, substituted, inserted, and / or added in the base sequence shown in SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 15, or SEQ ID NO: 16 shown in the "nucleic acid encoding a functional region" below, and which encodes a region having a function as the functional region, or (5) Some combinations of nucleic acids included in (1) to (3): Nucleic acids encoding functional regions Nucleic acid encoding U6 snRNA: SEQ ID NO: 10 Nucleic acid encoding STL: SEQ ID NO: 11 Nucleic acid encoding U1 snRNA: SEQ ID NO: 12 Nucleic acid encoding U7 snRNA: SEQ ID NO: 13 Nucleic acid encoding 5S rRNA: SEQ ID NO: 14 Nucleic acid encoding 3Gq: SEQ ID NO: 15 Nucleic acid encoding BoxB: SEQ ID NO: 16

[0069] The nucleic acid of the present invention has a structure in which deoxyribonucleic acids are linked, for example, DNA, and in some embodiments, it is DNA. In some embodiments, the nucleic acid of the present invention is a nucleic acid incorporated into an expression vector. In some embodiments, the nucleic acid of the present invention is a nucleic acid incorporated into a plasmid vector. In some embodiments, the nucleic acid of the present invention is a nucleic acid incorporated into a viral vector.

[0070] Specific embodiments of the guide RNA encoded by the nucleic acid of the present invention are the same as those of the guide RNA of the present invention described above in the section <Guide RNA of the present invention>. Specific examples are shown below. In one embodiment, the nucleic acid of the present invention is a nucleic acid encoding any of the following guide RNAs: a guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is directly linked to the antisense region and the guide RNA is substantially free of an ADAR recruitment sequence; a guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is linked to the antisense region via a linker, and the guide RNA is substantially free of an ADAR recruitment sequence; or A guide RNA comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the guide RNA is substantially free of an ADAR recruitment base sequence, and the antisense region has bases that form mismatch base pairs with the target RNA.

[0071] In one embodiment, the nucleic acid of the present invention is a nucleic acid encoding a guide RNA, which comprises at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is linked to the antisense region, and the guide RNA is substantially free of ADAR recruitment sequences, and the guide RNA has the following characteristics: (1) The functional region is a region consisting of a base sequence having one or more functions including stabilization of the guide RNA, localization of the guide RNA in the nucleus, localization of the guide RNA in the cytoplasm, promotion of duplex formation between the target RNA and the antisense region, inhibition of nonspecific duplex formation by the antisense region, and stabilization of the complex formed between the target RNA and the antisense region. (2) The functional region is a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a base sequence that forms a G-quadruplex structure, or a region consisting of a base sequence that forms a stem-loop structure, or any combination thereof. (3) The functional region is a region consisting of an snRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (4) The functional region is a region consisting of a snRNA sequence selected from a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, and a region consisting of a U7 snRNA sequence, and a region consisting of an optionally contained base sequence forming a stem-loop structure. (5) The functional region is a region consisting of an rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (6) The functional region is a region consisting of a 5S rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (7) The functional region is a region consisting of a base sequence that forms a G-quadruplex structure, a region consisting of a base sequence that forms a stem-loop structure, or a combination thereof. (8) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, an optionally included additional functional region, and an optionally included linker, and the antisense region, the functional region consisting of a base sequence that forms a G-quadruplex structure, and the optionally included additional functional region are linked in this order from the 5' end to the 3' end. (9) The guide RNA comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, an optionally contained further functional region, and an optionally contained linker, and the functional region consisting of a base sequence that forms a stem-loop structure and the antisense region are linked in this order from the 5' end to the 3' end.

[0072] <Nucleic acids encoding ADARs used in the present invention> The ADAR-encoding nucleic acid used in the present invention is a nucleic acid encoding an ADAR described in the above section "ADAR Used in the Present Invention." In one embodiment, the ADAR-encoding nucleic acid used in the present invention is a nucleic acid consisting of a nucleotide sequence encoding the amino acid sequence set forth in Accession No. [NP_001103.1], Accession No. [NP_056648.1], or Accession No. [NP_001102.3], or a nucleic acid consisting of a nucleotide sequence having 90% or more identity to at least one of these sequences, or a nucleotide sequence in which 1 to 10 bases have been deleted, substituted, inserted, and / or added in at least one of these sequences, and encoding a polypeptide having adenosine deaminase activity. In one embodiment, the ADAR-encoding nucleic acid used in the present invention is a nucleic acid consisting of the nucleotide sequence set forth in SEQ ID NO: 8, or a nucleotide sequence having 90% or more identity to said sequence, or a nucleotide sequence in which 1 to 10 bases have been deleted, substituted, inserted, and / or added in said sequence, and encoding a polypeptide having adenosine deaminase activity.

[0073] <Expression vector containing a nucleic acid encoding the guide RNA of the present invention> The present invention also provides an expression vector (also referred to as "expression vector of the present invention") comprising a nucleic acid encoding a guide RNA of the present invention. The present invention also provides an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and a nucleic acid encoding an ADAR. The nucleic acid encoding a guide RNA of the present invention and the nucleic acid encoding an ADAR may be carried in the same expression vector or in separate expression vectors. In one aspect, the expression vector of the present invention is a combination of an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and an expression vector comprising a nucleic acid encoding an ADAR. In one aspect, the expression vector of the present invention is an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and a nucleic acid encoding an ADAR.

[0074] 1. Expression vectors used in the present invention The expression vector used in the present invention is not particularly limited as long as it is an expression vector that can express the guide RNA of the present invention from a nucleic acid encoding the guide RNA of the present invention and / or an expression vector that can express ADAR. In one aspect, the expression vector used in the present invention is an expression vector that can be used to express the guide RNA of the present invention and / or express ADAR in human cells. In one aspect, examples of the expression vector used in the present invention include plasmid vectors, viral vectors (e.g., adenovirus vectors, retrovirus vectors, adeno-associated virus vectors), etc.

[0075] 2. Promoter The expression vector of the present invention may contain a promoter operably linked to a nucleic acid encoding a guide RNA of the present invention and / or a nucleic acid encoding an ADAR. As used herein, "operably linked" means that at least one promoter is linked to a nucleic acid so that the polypeptide or RNA encoded by the nucleic acid can be expressed in a host cell. The promoter contained in the expression vector of the present invention is not particularly limited, and a promoter corresponding to an RNA polymerase (e.g., RNA polymerase II (pol II) or RNA polymerase III (pol III)) suitable for expressing a nucleic acid encoding a guide RNA or an ADAR of the present invention can be used. In one embodiment, a promoter corresponding to pol II or pol III can be used to express the guide RNA of the present invention, and in another embodiment, a promoter corresponding to pol III can be used. In one embodiment, a promoter corresponding to pol II can be used to express ADAR.

[0076] Examples of promoters compatible with Pol II include a promoter derived from cytomegalovirus (CMV), a simian virus 40 (SV40) promoter, a respiratory syncytial virus (RSV) promoter, an elongation factor 1α (EF1α) promoter, a CAG promoter, a U1 snRNA promoter, and a U7 snRNA promoter. Examples of promoters compatible with Pol III include, but are not limited to, the human U6 snRNA promoter (U6) (Nat. Biotechnol., 2002, vol. 20, pp. 497-500), the highly sensitive U6 promoter (Nucleic Acids Research, 2003, vol. 31, p. e100), the human H1 promoter, the 5S rRNA promoter, and other viral and eukaryotic promoters known to those skilled in the art.

[0077] Depending on the promoter and host cell used, the expression vector of the present invention may further contain a translation initiation codon, a translation termination codon, a purine base (G or A) preferred at the transcription initiation site of pol III, a polyA signal, a terminator sequence of consecutive Ts for pol III, an enhancer, an untranslated region, a splicing junction, etc.

[0078] <Host cells of the present invention> The present invention also provides host cells (also referred to as "host cells of the present invention") transformed by introducing a nucleic acid encoding a guide RNA of the present invention. In one embodiment, the host cell of the present invention is a host cell into which an expression vector of the present invention has been introduced. In one embodiment, the host cell of the present invention is a host cell into which an expression vector of the present invention that is a plasmid vector has been introduced. In one embodiment, the host cell of the present invention is a host cell into which a plasmid vector for producing the expression vector of the present invention that is a viral vector has been introduced. In one embodiment, the host cell of the present invention is a host cell into which an expression vector of the present invention that is a viral vector has been introduced.

[0079] The host cell into which the expression vector of the present invention is introduced is not particularly limited, and any cell known in the art can be selected as long as it can be used to produce a nucleic acid encoding the guide RNA of the present invention or an expression vector of the present invention. Host cells that can be used to replicate the vector include various cells, such as natural cells or artificially established cells, commonly used in the technical field of the present invention. Host cells that can be used to replicate the vector include animal cells (e.g., CHO cells, HEK293 cells, etc.), insect cells (e.g., Sf9 cells, etc.), bacteria (e.g., Escherichia coli), yeast (e.g., Saccharomyces, Pichia, etc.), etc. In one embodiment, Escherichia coli can be used as a host cell. Transformation can be performed using methods known to those skilled in the art (Green, M.R. and Sambrook, J., Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, 2012).

[0080] <Method for producing the nucleic acid encoding the guide RNA of the present invention and the expression vector of the present invention> Nucleic acids encoding the guide RNAs of the present invention (also referred to in this section as "nucleic acids of the present invention") can be synthesized using standard polynucleotide synthesis methods known in the art based on the sequences described herein or publicly available sequence information. Furthermore, once a nucleic acid of the present invention is obtained, it is also possible to prepare another nucleic acid of the present invention by introducing a mutation at a predetermined site using a method known to those skilled in the art, such as site-directed mutagenesis (Current Protocols in Molecular Biology edition, 1987, John Wiley & Sons Section).

[0081] Methods for producing the nucleic acids and expression vectors of the present invention include methods for producing nucleic acids comprising the step of culturing host cells into which the nucleic acid of the present invention or an expression vector comprising the nucleic acid of the present invention has been introduced. In one aspect, methods for producing the nucleic acids of the present invention comprise the step of culturing host cells into which the nucleic acid of the present invention has been introduced and replicating the nucleic acid of the present invention. In one aspect, methods for producing the nucleic acids of the present invention comprise the step of culturing host cells into which an expression vector comprising the nucleic acid of the present invention has been introduced and replicating the expression vector of the present invention. When the expression vector of the present invention is a viral vector, methods for producing the expression vector of the present invention comprise the step of culturing host cells into which a viral vector plasmid comprising the nucleic acid of the present invention has been introduced and purifying the viral vector produced in the host cells. Viral vectors can be produced by methods known to those skilled in the art.

[0082] Methods for producing the nucleic acids and expression vectors of the present invention may include a step of recovering the culture medium of the host cells to obtain a lysate (bacterial lysate). The lysate can be obtained, for example, by treating the recovered culture medium with alkaline lysis or boiling. Methods for producing the nucleic acids of the present invention may further include a step of purifying the nucleic acids or expression vectors from the lysate. Ion exchange chromatography and / or hydrophobic interaction chromatography can be used to purify the nucleic acids or expression vectors from the lysate. When the expression vector of the present invention is a viral vector, methods such as cesium chloride density gradient centrifugation, sucrose gradient centrifugation, iodixanol density gradient centrifugation, ultrafiltration, diafiltration, affinity chromatography, ion exchange chromatography, polyethylene glycol precipitation, and ammonium sulfate precipitation can also be used to purify the viral vector from the lysate.

[0083] <Method for producing guide RNA of the present invention> The guide RNA of the present invention can be synthesized based on sequence information using standard polynucleotide synthesis methods known in the art. Furthermore, once a guide RNA of the present invention is obtained, it is possible to create a variant of the guide RNA of the present invention that maintains its target RNA guidance and target RNA editing functions by introducing mutations into a predetermined site using methods known to those skilled in the art, such as site-directed mutagenesis (Current Protocols in Molecular Biology edition, 1987, John Wiley & Sons Section). The guide RNA of the present invention can also be produced using modified nucleic acids. The guide RNA of the present invention can also be produced using nucleic acids encoding the guide RNA of the present invention. For example, the guide RNA of the present invention can be produced by transcribing the guide RNA of the present invention from an expression vector containing a nucleic acid encoding the guide RNA of the present invention.

[0084] <Polynucleotide of the present invention> The present invention also provides a polynucleotide for editing a target RNA with ADAR, the polynucleotide comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, and the polynucleotide is substantially free of an ADAR recruitment base sequence (hereinafter also referred to as the "polynucleotide of the present invention").

[0085] As used herein, the term "polynucleotide" includes unmodified nucleotides (DNA or RNA) and modified nucleotides. Examples of modified nucleotides used in the present invention include nucleotides with a modified 2'-OH group of ribose, nucleotides with a modified internucleoside phosphodiester bond, nucleotides with an altered ribose, nucleotides with a modified purine or pyrimidine residue, and nucleotides containing an intramolecularly bridged ribose. Nucleotides with a modified 2'-OH group of ribose include nucleotides containing 2'-O-methylribose, 2'-fluororibose, etc. Nucleotides with a modified internucleoside phosphodiester bond include nucleotides containing phosphorothioates, methylphosphonates, etc., or peptide-linked nucleic acids (PNAs). Nucleotides with an altered ribose include morpholino nucleic acids (PMOs), etc. Nucleotides in which the purine or pyrimidine residue is modified include 5-methyl-deoxycytidine phosphate (5-Me-dCMP), 2-amino-deoxyadenosine phosphate (2-amino-dAMP), and nucleotides containing C5-modified pyrimidines. Nucleotides containing intramolecularly bridged ribose include locked nucleic acids (LNAs). The polynucleotides of the present invention can be prepared by methods known in the art based on the base sequence and type of modification used.

[0086] Specific embodiments of the polynucleotide of the present invention are the same as those of the guide RNA of the present invention described above in the sections <Guide RNA of the present invention> and <Nucleic acid encoding the guide RNA of the present invention>. Specific examples are shown below.

[0087] In one embodiment, the polynucleotide of the present invention is any of the following polynucleotides: a polynucleotide comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is directly linked to the antisense region, and the polynucleotide is substantially free of an ADAR recruitment sequence; a polynucleotide comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is linked to the antisense region via a linker, and the polynucleotide is substantially free of an ADAR recruitment sequence; or A polynucleotide comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one functional region is linked to the antisense region, and the polynucleotide is substantially free of an ADAR recruitment base sequence, and the antisense region has bases that form mismatch base pairs with the target RNA.

[0088] In one embodiment, the polynucleotide of the present invention comprises at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein the at least one functional region is linked to the antisense region, and the polynucleotide is substantially free of ADAR recruitment sequences, and has the following characteristics: (1) The functional region is a region consisting of a base sequence having one or more functions including stabilization of the guide RNA, localization of the guide RNA in the nucleus, localization of the guide RNA in the cytoplasm, promotion of duplex formation between the target RNA and the antisense region, inhibition of nonspecific duplex formation by the antisense region, and stabilization of the complex formed between the target RNA and the antisense region. (2) The functional region is a region consisting of an snRNA sequence, a region consisting of an rRNA sequence, a region consisting of a base sequence that forms a G-quadruplex structure, or a region consisting of a base sequence that forms a stem-loop structure, or any combination thereof. (3) The functional region is a region consisting of an snRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (4) The functional region is a region consisting of a snRNA sequence selected from a region consisting of a U6 snRNA sequence, a region consisting of a U1 snRNA sequence, and a region consisting of a U7 snRNA sequence, and a region consisting of an optionally contained base sequence forming a stem-loop structure. (5) The functional region is a region consisting of an rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (6) The functional region is a region consisting of a 5S rRNA sequence and an optionally contained region consisting of a base sequence forming a stem-loop structure. (7) The functional region is a region consisting of a base sequence that forms a G-quadruplex structure, a region consisting of a base sequence that forms a stem-loop structure, or a combination thereof. (8) The guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, an optionally included additional functional region, and an optionally included linker, and the antisense region, the functional region consisting of a base sequence that forms a G-quadruplex structure, and the optionally included additional functional region are linked in this order from the 5' end to the 3' end. (9) The guide RNA comprises a functional region consisting of a base sequence that forms a stem-loop structure, an antisense region, an optionally contained further functional region, and an optionally contained linker, and the functional region consisting of a base sequence that forms a stem-loop structure and the antisense region are linked in this order from the 5' end to the 3' end.

[0089] <Pharmaceutical composition of the present invention> The present invention also provides pharmaceutical compositions (also referred to as "pharmaceutical compositions of the present invention") comprising a guide RNA of the present invention, a nucleic acid encoding a guide RNA of the present invention (also referred to in this section as a "nucleic acid of the present invention"), an expression vector of the present invention, or a polynucleotide of the present invention, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a guide RNA of the present invention and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a guide RNA of the present invention, an ADAR, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a nucleic acid of the present invention, an ADAR, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and a nucleic acid encoding an ADAR, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising an expression vector comprising a nucleic acid encoding a guide RNA of the present invention, an expression vector comprising a nucleic acid encoding an ADAR, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a polynucleotide of the present invention and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a polynucleotide of the present invention, an ADAR, and a pharmaceutically acceptable excipient.

[0090] In one aspect, the pharmaceutical composition of the present invention comprises an expression vector comprising a nucleic acid encoding a guide RNA of the present invention and a nucleic acid encoding human ADAR1 or human ADAR2, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention comprises an expression vector comprising a nucleic acid encoding a guide RNA of the present invention, an expression vector comprising a nucleic acid encoding human ADAR1 or human ADAR2, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention comprises a nucleic acid encoding a guide RNA of the present invention and an expression vector comprising a nucleic acid consisting of a nucleotide sequence encoding a polypeptide having adenosine deaminase activity, the nucleotide sequence encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO:9 or an amino acid sequence having 90% or more identity to said amino acid sequence, and a pharmaceutically acceptable excipient. In one aspect, the pharmaceutical composition of the present invention is a pharmaceutical composition comprising: an expression vector comprising a nucleic acid encoding the guide RNA of the present invention; an expression vector comprising a nucleic acid comprising a base sequence encoding a polypeptide having adenosine deaminase activity, the base sequence being a base sequence encoding a polypeptide having the amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence having 90% or more identity to said amino acid sequence; and a pharmaceutically acceptable excipient.

[0091] The pharmaceutical compositions of the present invention can be prepared by commonly used methods using excipients commonly used in the art, i.e., pharmaceutical excipients, pharmaceutical carriers, etc. Examples of dosage forms of these pharmaceutical compositions include parenteral preparations such as injections and infusions, which can be administered intravenously, subcutaneously, intradermally, intramuscularly, etc. When formulating the compositions, excipients, carriers, additives, etc. appropriate for these dosage forms can be used within pharmaceutically acceptable ranges.

[0092] The dosage of the guide RNA of the present invention, the nucleic acid of the present invention, the expression vector of the present invention, the polynucleotide of the present invention, the expression vector containing a nucleic acid encoding ADAR, or ADAR can be adjusted appropriately depending on the cells in which the target RNA is present, the severity and age of the patient's symptoms, the dosage form of the preparation used, etc. For example, the dosage can be in the range of 0.001 mg / kg to 100 mg / kg.

[0093] In one embodiment, the disease that can be prevented or treated with the pharmaceutical composition of the present invention is a genetic disease, in another embodiment, any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change, or in another embodiment, any disease in which converting one or more adenosines to inosines in a target RNA results in a beneficial change. The pharmaceutical composition of the present invention can be used as a prophylactic or therapeutic agent for any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change. In one embodiment, the pharmaceutical composition of the present invention can be used as a prophylactic or therapeutic agent for any disease in which converting one or more adenosines to inosines in a target RNA results in a beneficial change.

[0094] The present invention includes a pharmaceutical composition for preventing or treating any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change, comprising a guide RNA of the present invention, a nucleic acid of the present invention, an expression vector of the present invention, or a polynucleotide of the present invention. The present invention also includes a method for preventing or treating any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change, comprising administering a prophylactically or therapeutically effective amount of a guide RNA of the present invention, a nucleic acid of the present invention, an expression vector of the present invention, or a polynucleotide of the present invention. The present invention also includes a guide RNA of the present invention, a nucleic acid of the present invention, an expression vector of the present invention, or a polynucleotide of the present invention for use in preventing or treating any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change. The present invention also includes the use of a guide RNA of the present invention, a nucleic acid of the present invention, an expression vector of the present invention, or a polynucleotide of the present invention in the manufacture of a pharmaceutical composition for preventing or treating any disease in which editing of one or more adenosines or cytidines in a target RNA results in a beneficial change.

[0095] <Method for editing target RNA of the present invention> The present invention also provides a method for editing a target RNA using a guide RNA of the present invention (also referred to as the "editing method of the present invention"). In one embodiment, the editing method of the present invention includes a method in which the antisense region of a guide RNA of the present invention forms a duplex with a target RNA, ADAR is recruited to the formed double-stranded RNA, and the recruited ADAR converts an adenosine in the target RNA sequence to inosine. Here, the adenosine in the target RNA that is converted to inosine may form a mismatch base pair with the antisense region. In one embodiment, the editing method of the present invention includes a method in which the antisense region of a guide RNA of the present invention forms a duplex with a target RNA, ADAR is recruited to the formed double-stranded RNA, and the recruited ADAR converts a cytidine in the target RNA sequence to uridine. Here, the cytidine in the target RNA that is converted to uridine may form a mismatch base pair with the antisense region.

[0096] The editing method of the present invention comprises the step of (i) introducing a guide RNA of the present invention, a nucleic acid encoding the guide RNA of the present invention, an expression vector of the present invention, or a polynucleotide of the present invention into a cell or virus having a target RNA. In one embodiment, the editing method of the present invention further comprises the step of (ii) introducing an ADAR, a nucleic acid encoding an ADAR, or an expression vector comprising a nucleic acid encoding an ADAR into the cell. Steps (i) and (ii) may be performed simultaneously or separately. In one embodiment, the cell to be introduced is a eukaryotic cell or a prokaryotic organism, etc., and in another embodiment, the cell is a mammalian cell or a bacterium, etc. In one embodiment, the virus to be introduced includes a phage. In one embodiment, adenosine in the target RNA is converted to inosine, and in another embodiment, cytidine in the target RNA is converted to uridine. Furthermore, when the target RNA is in a coding region, the method may comprise the step of reading inosine as guanosine during translation. [Example]

[0097] Unless otherwise specified, the steps described in the following examples can be carried out according to known methods. Furthermore, for parts in which commercially available kits or reagents were used, experiments were carried out according to the attached protocols unless otherwise specified.

[0098] Example 1: Preparation of a guide RNA expression plasmid containing a U6 snRNA sequence as a functional region A vector was constructed by replacing the H1 RNA polymerase III promoter (hereafter referred to as the H1 promoter) of the pSUPER.neo vector (Oligoengine, catalog number VEC-PBS-0004) with the human U6 snRNA polymerase III (hU6) promoter sequence (SEQ ID NO: 17) (hereafter referred to as the pSUPER.neo-U6 vector). A fragment containing the hU6 promoter sequence was amplified using standard PCR techniques with pBAsi-hU6 Neo DNA (Takara Bio, catalog number 3227) containing the hU6 promoter as a template, adding EcoRI restriction sites at the 5' end and BglII restriction sites at the 3' end. The reaction was carried out using DNA polymerase Gflex (Takara Bio, catalog number R060A). The resulting hU6 promoter fragment was inserted into the pSUPER.neo vector using the EcoRI restriction site (5' end) and the BglII restriction site (3' end). E. coli DH5α Competent Cells (Takara Bio, catalog number 9057, hereafter referred to as "DH5α E. coli strain") were transformed with the constructed pSUPER.neo-U6 vector and cultured in liquid medium. The culture medium was centrifuged to collect the bacterial cells, and the plasmid was extracted and purified using NucleoBond® Xtra Midi Plus EF (Takara Bio, catalog number U0422B) to obtain the amplified pSUPER.neo-U6 vector.

[0099] A guide RNA expression plasmid containing the U6 snRNA sequence (hereinafter sometimes referred to as "U6") as a functional region was constructed as follows: The DNA sequence (SEQ ID NO: 18) encoding the guide RNA U6-ASR-STL was inserted downstream of the hU6 promoter of the pSUPER.neo-U6 vector using the BglII site (5' end) and HindIII site (3' end) of the restriction enzymes. The DNA sequence to be inserted was prepared by annealing forward and reverse oligos (described below) that were synthesized to form restriction enzyme cleavage ends. Forward oligo: 5'-GATCT-DNA sequence encoding guide RNA-3' Reverse oligo: 5'-AGCTT-reverse complement of the DNA sequence encoding the guide RNA-3' The inserted DNA sequence contains a purine base (G or A) preferred for the transcription initiation site of polIII on the 5' side and a polIII terminator sequence on the 3' side. The prepared guide RNA expression plasmid is called pSUPERneo_U6_gRNA.

[0100] Here, ASR represents a 24-base antisense base sequence complementary to a portion of the detection reporter mRNA (Rluc-W104X) used in Example 4, and consists of an RNA sequence encoded by the sequence from base 37 to base 60 of the DNA sequence shown in SEQ ID NO: 18. U6 consists of the RNA sequence shown in SEQ ID NO: 1, and the nucleic acid encoding U6 consists of the DNA sequence shown in SEQ ID NO: 10. STL consists of the RNA sequence shown in SEQ ID NO: 2, and the nucleic acid encoding STL consists of the DNA sequence shown in SEQ ID NO: 11. An overview of guide RNAs is shown in Table 1. In Table 1, "5'-" indicates a functional region attached to the 5' side of the ASR, and "-3'" indicates a functional region attached to the 3' side of the ASR. "Linker" indicates the sequence connecting the ASR to each functional region. The constructed pSUPERneo_U6_gRNA plasmid was propagated in the same manner as above using the DH5α Escherichia coli strain (Takara Bio, catalog number 9057).

[0101] Example 2: Preparation of guide RNA expression plasmids containing U1 snRNA sequence, U7 snRNA sequence, or 5S rRNA sequence as functional regions Guide RNA expression plasmids containing the U1 snRNA sequence, U7 snRNA sequence, or 5S rRNA sequence (hereinafter referred to as "U1," "U7," and "5S," respectively) as functional regions were constructed as follows. The EcoRI site (5' end) and HindIII site (3' end) upstream of the H1 promoter in the pSUPER.neo vector were used to insert DNA sequences encoding the respective promoter sequences and guide RNAs. The DNA sequences encoding the following guide RNAs were linked directly downstream of the human U1 snRNA promoter sequence (SEQ ID NO: 19), human U7 snRNA promoter sequence (SEQ ID NO: 20), or 5S rRNA promoter sequence (SEQ ID NO: 21). <Name of guide RNA and DNA sequence number encoding it> ASR-U1: SEQ ID NO: 22 ASR-U7: SEQ ID NO: 23 5S-ASR-STL: SEQ ID NO: 24 ASR-U1 and 5S-ASR-STL contain a poly-T sequence on the 3' side.

[0102] U1 consists of the RNA sequence shown in SEQ ID NO: 3, and the nucleic acid encoding U1 consists of the DNA sequence shown in SEQ ID NO: 12. ASR-U1 (SEQ ID NO: 22) consists of the base sequence in which the 3rd to 10th bases of SEQ ID NO: 12 are replaced with ASR. U7 consists of the RNA sequence shown in SEQ ID NO:4, and the nucleic acid encoding U7 consists of the DNA sequence shown in SEQ ID NO:13. 5S consists of the RNA sequence shown in SEQ ID NO:5, and the nucleic acid encoding 5S consists of the DNA sequence shown in SEQ ID NO:14. An overview of the DNA sequences encoding each guide RNA is shown in Table 1.

[0103] The DNA sequences to be inserted were prepared by DNA synthesis (Fasmac Co., Ltd.). The resulting plasmids are referred to as pSUPERneo_U1_gRNA, pSUPERneo_U7_gRNA, and pSUPERneo_5S_gRNA, respectively. The constructed plasmid was propagated in the same manner as in Example 1 using the DH5α Escherichia coli strain (Takara Bio Inc., catalog number 9057).

[0104] Example 3: Preparation of a guide RNA expression plasmid containing a Gq sequence and / or a BoxB sequence as a functional region Expression plasmids for guide RNAs containing a Gq sequence (in the Examples, the sequence forming 3Gq is sometimes referred to as the Gq sequence) and / or a sequence derived from the BoxB sequence as a functional region were prepared as follows: DNA sequences encoding eight types of guide RNAs (see <Names of guide RNAs and DNA sequence numbers encoding them> below) were inserted downstream of the H1 promoter of the pSUPER.neo vector using the BglII restriction enzyme site (5' end) and the HindIII restriction enzyme site (3' end). <Name of guide RNA and DNA sequence number encoding it> ASR-Gq: SEQ ID NO: 25 Gq-ASR: SEQ ID NO: 26 ASR-BoxB: SEQ ID NO: 27 BoxB-ASR: SEQ ID NO: 28 Gq-ASR-BoxB: SEQ ID NO: 29 BoxB-ASR-Gq: SEQ ID NO: 30 ASR-Gq-BoxB: SEQ ID NO: 31 Gq-BoxB-ASR: SEQ ID NO: 32 The inserted DNA sequence contains a purine base (G or A) preferred for the transcription initiation site of polIII on the 5' side and a polIII terminator sequence on the 3' side.

[0105] Gq consists of the RNA sequence shown in SEQ ID NO: 6, and the nucleic acid encoding Gq consists of the DNA sequence shown in SEQ ID NO: 15. BoxB consists of the RNA sequence shown in SEQ ID NO: 7, and the nucleic acid encoding BoxB consists of the DNA sequence shown in SEQ ID NO: 16. An overview of each guide RNA is shown in Table 1.

[0106] The DNA sequence to be inserted was prepared using the same method as in Example 1. The resulting guide RNA expression plasmids are collectively referred to as pSUPERneo_H1_gRNA. The constructed plasmid was propagated in the same manner as in Example 1 using the DH5α Escherichia coli strain (Takara Bio Inc., catalog number 9057).

[0107] A control guide RNA was prepared in the same manner as above using a DNA sequence (SEQ ID NO: 33) encoding only ASR without the functional region. The inserted DNA sequence contained a purine base (G or A) favorable for the transcription start site of Pol III on the 5' side and a Pol III terminator sequence on the 3' side.

[0108] [Table 1]

[0109] Example 4: Preparation of reporter expression plasmid for detecting intracellular target RNA editing activity Renilla luciferase (Rluc) mRNA was used as a reporter mRNA to detect intracellular target RNA editing activity. The reporter Rluc mRNA (Rluc-W104X) for detecting intracellular target RNA editing activity was designed based on the Rluc mRNA sequence encoded by the Rluc gene carried in the psiCHECK-2 vector (Promega, catalog no. C8021). Specifically, Rluc-W104X was designed to encode a translation termination codon (UAG) instead of Trp, replacing the G at position 311 of UGG, which encodes the 104th amino acid of Rluc. The Rluc-W104X expression plasmid was constructed by substituting a DNA sequence (SEQ ID NO: 34) containing the G311A mutation into the psiCHECK-2 vector (Promega, catalog no. C8021) using the DraIII site (5') and the AatII site (3'). The resulting plasmid is referred to as psiCHECK-2_Rluc-W104X. The constructed psiCHECK-2_Rluc-W104X vector was propagated in the same manner as in Example 1 using the DH5α Escherichia coli strain (Takara Bio Inc., catalog number 9057).

[0110] Example 5: Construction of ADAR2 expression plasmid The ADAR2 expression plasmid was constructed by inserting a DNA sequence (SEQ ID NO: 8) encoding ADAR2 (SEQ ID NO: 9) into the EcoRI site (5' end) and BamHI site (3' end) downstream of the CMV-derived promoter of the pAAV-CMV vector (Takara Bio, catalog no. 6230) using the EcoRI site (5' end) and BglII site (3' end). The resulting plasmid is designated pAAV-CMV-ADAR2. The inserted DNA sequence contained a Kozak sequence ("ACC" from bases 13 to 15 of SEQ ID NO: 8) upstream of the translation initiation codon and a stop codon downstream of the ADAR2 gene. The constructed pAAV-CMV-ADAR2 plasmid was propagated in a DH5α Escherichia coli strain (Takara Bio, catalog no. 9057) using the same method as in Example 1.

[0111] Example 6 Transfection Experiment 1 (Transfection for examining RNA editing efficiency by luciferase assay and Sanger sequencing, the results of which are shown in Table 2) Human embryonic kidney-derived cell line HEK293 cells were suspended in Dulbecco's Modified Eagle Medium (DMEM; ThermoFisher Scientific, catalog number 10569-010) supplemented with 5% fetal bovine serum (FBS) and plated at 2.0 × 10 4 The cells were seeded at 100 μL and cultured overnight at 37°C in the presence of 5% CO 2 .

[0112] The reporter expression plasmid for detecting intracellular target RNA editing activity (psiCHECK-2_Rluc-W104X) prepared in Example 4, the ADAR2 expression plasmid (pAAV-CMV-ADAR2) prepared in Example 5, the guide RNA expression plasmids (pSUPERneo_U6_gRNA, pSUPERneo_U1_gRNA, pSUPERneo_U7_gRNA, pSUPERneo_5S_gRNA, and pSUPERneo_H1_gRNA) prepared in Examples 1, 2, or 3, and the carrier plasmid were mixed at a weight ratio of 1:40:30:9, respectively, to a total amount of 100 ng / well. pHelper Vector (Takara Bio, catalog number 6230) was used as the carrier plasmid.

[0113] HEK293 cells were seeded and cultured overnight. TM Transfection was performed using 3000 Transfection Reagent (ThermoFisher Scientific, catalog number L3000015). A control guide RNA expression plasmid was also transfected in the same manner. After transfection, the cells were cultured under the same conditions, and after 3 days of culture, the RNA editing activity was examined by the luciferase assay described in Example 7, and the RNA editing efficiency was examined by Sanger sequencing described in Example 8.

[0114] Experiment 2 (Transfection for examination of RNA editing efficiency by luciferase assay and Sanger sequencing, the results of which are shown in Table 3) A reporter expression plasmid for detecting intracellular target RNA editing activity (psiCHECK-2_Rluc-W104X), an ADAR2 expression plasmid (pAAV-CMV-ADAR2), guide RNA expression plasmids (pSUPERneo_U6_gRNA and pSUPERneo_H1_gRNA) prepared in Examples 1 and 3, and a carrier plasmid were mixed at a weight ratio of 1:20:15:4, respectively, to a total amount of 100 ng / well, and transfection into HEK293 cells was performed using the same method as in Experiment 1. pHelper Vector (Takara Bio, catalog number 6230) was used as the carrier plasmid.

[0115] Example 7 Detection of RNA editing activity by luciferase assay In each well of cells transfected in Example 6, the firefly luciferase luminescence intensity (Fluc) to correct for transfection efficiency and the Renilla luciferase luminescence intensity (Rluc) to evaluate editing activity were measured using the Dual-Glo (registered trademark) Luciferase Assay System (Promega, catalog number E2940) and EnVision (PerkinElmer) according to the attached protocol.

[0116] In Table 2, the results obtained in the transfection experiment of Experiment 1 of Example 6 are shown. In Table 2, the Rluc / Fluc value was calculated to correct for transfection efficiency between samples, and the Rluc / Fluc value of each guide RNA sample is expressed as a relative value when the Rluc / Fluc value of the control ASR was set to 1. The arithmetic mean of four independent trials is shown.

[0117] [Table 2] "ND" indicates below detection limit.

[0118] In Table 3, the results obtained in the transfection experiment of Experiment 2 of Example 6 are shown. Table 3 shows the Rluc / Fluc values ​​calculated to correct for transfection efficiency between samples, and shows the arithmetic mean and standard deviation values ​​of three wells, as well as the Rluc / Fluc value of each guide RNA sample as a relative value when the Rluc / Fluc value of the control ASR was set to 1.

[0119] [Table 3]

[0120] When the ADAR protein and guide RNA induce A-to-I editing of the target RNA in cells, the mutated translation termination codon (UIG) becomes Trp when translated from mRNA, and Renilla luciferase luminescence is restored. In other words, a higher Rluc value indicates higher RNA editing activity.

[0121] As shown in Table 2, guide RNAs with snRNA or 5S rRNA linked to the antisense region, guide RNAs with only Gq linked to the 3' side of the antisense region, guide RNAs with only BoxB linked to the 5' side of the antisense region, and guide RNAs with Gq and BoxB linked to the 3' side of the antisense region showed a relative Rluc / Fluc value of 2.0 or higher compared to guide RNAs (ASR) consisting of an antisense region used as a comparison control.

[0122] As shown in Table 3, all guide RNAs except for guide RNAs with Gq linked to the 5' side of the antisense region and BoxB linked to the 3' side showed higher Rluc / Fluc values ​​than the control ASR. In particular, guide RNAs with U6 linked to the antisense region, guide RNAs with only Gq linked to the 3' side of the antisense region, guide RNAs with only BoxB linked to the 5' side of the antisense region, and guide RNAs with Gq and BoxB linked to the 3' side of the antisense region showed Rluc / Fluc values ​​of 5.0 or higher relative to the control ASR.

[0123] Example 8: Examination of RNA editing efficiency by Sanger sequencing The cells transfected in Example 6 were harvested, and total RNA was extracted and purified from the harvested cells using QIAshredder (QIAGEN, catalog number 79656), RNeasy Mini Kit (QIAGEN, catalog number 74106), and RNase-free DNase Set (QIAGEN, catalog number 79254) according to the attached protocol. The purified RNA was subjected to DNA digestion again using Recombinant DNase I (RNase-free) (Takara Bio, catalog number 2270A) according to the attached protocol. The obtained RNA was purified using SuperScript (registered trademark) VILO. TM cDNA was obtained by reverse transcription using a cDNA Synthesis kit (ThermoFisher Scientific, catalog number 11754-250) according to the attached protocol. Using the cDNA as a template, PCR was performed using the following primers to amplify a fragment containing the edit point and PrimeSTAR® GXL DNA Polymerase (Takara Bio, catalog number R050A) according to the attached protocol.

[0124] <Primers used in the experiments in Table 2> Forward primer: ATGGCTTCCAAGGTGTACGACC (SEQ ID NO: 35) Reverse primer: TTACTGCTCGTTCTTCAGCACG (SEQ ID NO: 36) <Primers used in the experiments in Table 3> Forward primer: CTCGCTGCAAGCAAATGAAC (SEQ ID NO: 37) Reverse primer: TCGTCCCAGGACTCGATCAC (SEQ ID NO: 38)

[0125] PCR amplified fragments were analyzed using ExoSAP-IT TMThe fragments were purified using Express PCR Product Cleanup Reagents (Thermofisher Scientific, catalog number 75001.200.UL) according to the attached protocol, and subjected to Sanger sequencing reaction using a 3730xl DNA Analyzer (Applied Biosystems) together with the forward primer used for PCR amplification. In Table 2, the results obtained in the transfection experiment of Experiment 1 of Example 6 are shown. The waveform data file (extension: .ab1) obtained from the Sanger sequencing reaction was analyzed using QSVanalyzer (Bioinformatics, 2009, Vol. 25, pp. 3244-3250), and the ratio of guanine (G) signal intensities (G / (G+A) x 100) was used to determine the RNA editing efficiency (%). "ND" indicates below the detection limit. Representative results are shown. In Table 3, the results obtained in the transfection experiment of Experiment 2 of Example 6 are shown. In Table 3, the obtained waveform data file (extension: .ab1) was analyzed using QSVanalyzer. The G signal intensity of unedited Rluc-W104X was corrected to 0 and the A signal intensity to 1, and the G signal intensity of wild-type Rluc was corrected to 1 and the A signal intensity to 0. The ratio of the corrected G signal intensities (G / (G+A) × 100) was defined as the RNA editing efficiency (%). Representative results are shown.

[0126] As shown in Table 2, the RNA editing efficiency induced by ASR, which serves as a control, was below the detection limit. Under the same conditions, guide RNAs with snRNA or 5S rRNA linked to the antisense region, guide RNAs with only Gq linked to the 3' side of the antisense region, guide RNAs with only BoxB linked to the 5' side of the antisense region, and guide RNAs with both Gq and BoxB linked to the 3' side of the antisense region showed RNA editing efficiencies of 23% or higher. The guide RNAs of the present invention, which include an antisense region linked to a functional region listed in Table 3, exhibited higher RNA editing efficiency than the comparative ASR. In particular, the guide RNAs in which U6 was linked to the antisense region, the guide RNAs in which only Gq was linked to the 3' side of the antisense region, the guide RNAs in which only BoxB was linked to the 5' side of the antisense region, and the guide RNAs in which Gq and BoxB were linked to the 3' side of the antisense region exhibited RNA editing efficiencies of 47% or more.

[0127] Example 9: Examination of RNA editing efficiency targeting firefly luciferase (Fluc) mRNA We confirmed whether the guide RNA of the present invention also exhibits high RNA editing efficiency for different target RNAs. A guide RNA expression plasmid in which A at position 167 in the coding region of firefly luciferase (Fluc) contained in the psiCHECK-2 vector (Promega, catalog number C8021) was targeted for editing was prepared in the same manner as in Examples 1 and 3. The DNA sequence encoding the guide RNA used for preparation is as follows: <Name of guide RNA and DNA sequence number encoding it> U6-ASRf-STL: SEQ ID NO: 39 ASRf-Gq: SEQ ID NO: 40 Gq-ASRf: SEQ ID NO: 41 ASRf-BoxB: SEQ ID NO: 42 BoxB-ASRf: SEQ ID NO: 43 Gq-ASRf-BoxB: SEQ ID NO: 44 BoxB-ASRf-Gq: SEQ ID NO: 45 ASRf-Gq-BoxB: SEQ ID NO: 46 Gq-BoxB-ASRf: SEQ ID NO: 47 The DNA sequence contains a purine base (G or A) preferred for the transcription initiation site of polIII on the 5' side and a polIII terminator sequence on the 3' side. The resulting plasmids are collectively referred to as pSUPERneo_gRNAf. ASRf represents an antisense base sequence consisting of 24 bases complementary to the Fluc reporter mRNA containing the editing target A, and consists of an RNA base sequence encoded by the sequence from base 3 to base 26 of the DNA sequence shown in SEQ ID NO: 40. In addition, a control guide RNA expression plasmid was also prepared using a DNA sequence (sequence number 48) that does not contain any functional region and encodes only ASRf.

[0128] In the same manner as in Experiment 1 of Example 6, the Fluc reporter expression plasmid (psiCHECK-2 (Promega, C8021)), the ADAR2 expression plasmid (pAAV-CMV-ADAR2) prepared in Example 5, the guide RNA expression plasmid (pSUPERneo_gRNAf), and the carrier plasmid were mixed at a weight ratio of 1:80:100:19, respectively, to a total amount of 100 ng / well, and then transfected into HEK293 cells using Lipofectamine. TM Transfection was performed using 3000 Transfection Reagent (ThermoFisher Scientific, Catalog No. L3000015). A control guide RNA expression plasmid was also transfected in the same manner. pHelper Vector (Takara Bio, Catalog No. 6230) was used as the carrier plasmid. PCR reactions were performed in the same manner as in Example 8 (Table 2), and Sanger sequencing reactions were performed using sequencing primers. The RNA editing efficiency targeting the Fluc reporter mRNA was calculated from the waveform data file of the Sanger sequencing reaction in the same manner as in Table 2. The primers used in the PCR reactions and Sanger sequencing reactions in this test are shown below. Forward primer Fluc:ACCCGCTTAAAAGCTTGGC (SEQ ID NO: 49) Reverse primer Fluc: CCACGGTAGGCTGAGAAATG (SEQ ID NO: 50) Sequencing primer: CATGCTGTTCAGCAGCTCGC (SEQ ID NO: 51) The arithmetic means of three independent trials are shown in Table 4.

[0129] [Table 4]

[0130] The following guide RNAs showed higher RNA editing efficiency than the control ASRf: U6-linked antisense RNA, Gq-linked only at the 5' or 3' end of the antisense region, BoxB-linked only at the 3' end of the antisense region, BoxB-linked only at the 5' end of the antisense region and Gq-linked only at the 3' end of the antisense region, and BoxB-linked only at the 3' end of the antisense region. In particular, U6-linked antisense RNA, Gq-linked only at the 3' end of the antisense region, and BoxB-linked only at the 5' end of the antisense region and Gq-linked only at the 3' end of the antisense region showed RNA editing efficiency of 17% or higher.

[0131] Example 10: Examination of intracellular stability of guide RNA The stability of guide RNA in cells can be evaluated by comparing the amount of guide RNA remaining after transcription inhibition. The greater the amount of guide RNA remaining after introduction into cells, the higher the stability.

[0132] HEK293 cells were cultured in DMEM supplemented with 5% FBS and plated at 1 × 10 5The cells were seeded at 0.5 mL per well and cultured overnight at 37°C in the presence of 5% CO2. The next day, the reporter expression plasmid for detecting intracellular target RNA editing activity (psiCHECK-2_Rluc-W104X) prepared in Example 4, the ADAR2 expression plasmid (pAAV-CMV-ADAR2) prepared in Example 5, and the guide RNA expression plasmids (pSUPERneo_H1_gRNA and pSUPERneo_U6_gRNA) prepared in Examples 1 and 3, and the carrier plasmid were mixed at a weight ratio of 1:40:30:9, respectively, to a total volume of 400 ng / well. pHelper Vector (Takara Bio, Catalog No. 6230) was used as the carrier plasmid. Lipofectamine TM HEK293 cells were transfected using 3000 Transfection Reagent (Thermo Fisher Scientific, catalog number L3000015).

[0133] Twenty-four hours after transfection, cells from some wells were harvested, and the state before actinomycin D addition was designated time 0. At the same time, the remaining wells were replaced with DMEM supplemented with 5 μg / mL actinomycin D (Wako Pure Chemical Industries, Ltd., catalog no. 010-21263). Actinomycin D is known to bind to double-stranded DNA and inhibit transcription by RNA polymerase. Cells were harvested 4 and 6 hours after actinomycin D addition, and total RNA, including guide RNA, was extracted and purified from the harvested cells using the miRNeasy Mini Kit (QIAGEN, catalog no. 217004) and RNase-free DNase Set (QIAGEN, catalog no. 79254) according to the accompanying protocol. The resulting RNA was subjected to polyadenylation of small RNA using the Mir-X miRNA First-Strand Synthesis Kit (Takara Bio, Inc., catalog no. 638315) according to the accompanying protocol, followed by reverse transcription to obtain cDNA. Two types of touchdown PCR reactions were performed using PrimeSTAR® GXL DNA Polymerase (Takara Bio, catalog number R050A) with cDNA as a template. The U6 forward and reverse primers included with the Mir-X miRNA qRT-PCR TB Green® Kit (Takara Bio, catalog number 638314) were used for PCR of endogenously expressed U6 snRNA. The amount of endogenous U6 snRNA was used to normalize the amount of guide RNA between samples. The guide RNA PCR reaction used a primer with a sequence homologous to ASR (SEQ ID NO: 52) and the mRQ 3' primer included with the kit. The touchdown PCR reaction conditions consisted of a 1-minute pre-cycling heat denaturation stage at 94°C, a 10-second heat denaturation stage at 98°C, a 15-second annealing stage at 65°C, and a 30-second extension stage at 68°C. Finally, a 3-minute extension stage at 72°C was used. Of these, the first to fifth cycles of the amplification stage are touchdown cycles in which the annealing temperature is lowered by 1°C with each cycle, and the annealing temperature from the sixth cycle onwards is maintained at 60°C.The amplification stage of the PCR for endogenous U6 snRNA was performed for a total of 23 cycles, and the amplification stage of the PCR for guide RNA was performed for a total of 20 cycles.

[0134] Each PCR product was electrophoresed on a 2% agarose gel, and the electrophoresis results were analyzed by ChemiDoc. TM Images were taken using a Touch Imaging System (BIO RAD). PCR bands were quantified using Image Lab 6.1 Software for Windows (BIO RAD). In Table 5, the signal intensity of the PCR band using guide RNA as a template was corrected by the signal intensity of the PCR band using intracellular U6 snRNA as a template (guide RNA / U6 value). The remaining amount of guide RNA was calculated as 1 before the addition of actinomycin D, and the guide RNA / U6 value 4 hours and 6 hours after the addition of actinomycin D was shown as a relative value. The arithmetic mean of three independent trials is shown.

[0135] [Table 5]

[0136] The greater the amount of guide RNA remaining after the addition of actinomycin D, the higher the stability of the guide RNA within the cell. The guide RNAs of the present invention shown in Table 5 showed higher amounts of remaining guide RNA 4 and 6 hours after the addition of actinomycin D than the control ASR, demonstrating their high stability. [Industrial Applicability]

[0137] The guide RNA of the present invention is useful for editing target RNA, and pharmaceutical compositions comprising the guide RNA of the present invention, the nucleic acid encoding the guide RNA of the present invention, the expression vector of the present invention, or the polypeptide of the present invention are useful in that they can be used for various diseases that can be prevented or treated by editing target RNA, including genetic diseases. [Sequence List Free Text]

[0138] SEQ ID NOs: 1 to 7: synthetic RNA SEQ ID NOs: 10 to 52: Synthetic DNA

Claims

1. A guide RNA for editing a target RNA by ADAR, comprising at least one functional region and an antisense region that is complementary to a portion of the target RNA and forms a duplex with the target RNA, wherein at least one of the functional regions is linked to the antisense region, the guide RNA does not comprise an ADAR recruitment base sequence, and the guide RNA has one of the following (a) to (i): (a) the guide RNA comprises a functional region consisting of a U6 snRNA sequence, an antisense region, an optionally contained linker, and a region consisting of an artificial stem-loop sequence, and the functional region consisting of the U6 snRNA sequence, the antisense region, and the region consisting of the artificial stem-loop sequence are linked in this order from the 5' side to the 3' side; (b) the guide RNA comprises a functional region consisting of a partial sequence from the transcription start point to the 27th base of the base sequence of the U6 snRNA sequence, which is a base sequence having the function of the snRNA sequence, an antisense region, an optionally contained linker, and a region consisting of an artificial stem-loop sequence, and the functional region consisting of a partial sequence from the transcription start point to the 27th base of the base sequence of the U6 snRNA sequence, which is a base sequence having the function of the snRNA sequence, the antisense region, and the region consisting of the artificial stem-loop sequence are linked in this order from the 5' side to the 3' side; (c) the guide RNA comprises a functional region consisting of a base sequence in which 8 bases from the 3rd base to the 10th base from the transcription start point of the base sequence of the U1 snRNA sequence are deleted and which has the function of an snRNA sequence, and an antisense region, wherein the antisense region is inserted at the 3rd base from the transcription start point of the base sequence of the U1 snRNA sequence; (d) the guide RNA comprises a functional region consisting of a U7 snRNA sequence and an antisense region, and the antisense region and the functional region consisting of the U7 snRNA sequence are linked in this order from the 5' side to the 3' side; (e) the guide RNA comprises a functional region consisting of a partial base sequence of the U7 snRNA sequence, including an Sm protein binding site (Sm OPT sequence) and the stem-loop sequence of the U7 snRNA, and a base sequence having the function of the snRNA sequence, and an antisense region, and the antisense region and the functional region consisting of a partial base sequence of the U7 snRNA sequence are linked in this order from the 5' side to the 3' side; (f) the guide RNA comprises a functional region consisting of a 5S rRNA sequence, an antisense region, an optionally contained linker, and a region consisting of an artificial stem-loop sequence, and the functional region consisting of the 5S rRNA sequence, the antisense region, and the region consisting of the artificial stem-loop sequence are linked in this order from the 5' side to the 3' side; (g) the guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, and an optionally contained linker, and the antisense region and the functional region consisting of a base sequence that forms a G-quadruplex structure are linked in this order from the 5' side to the 3' side; (h) the guide RNA comprises a functional region consisting of a BoxB sequence, an antisense region, and an optionally contained linker, and the functional region consisting of the BoxB sequence and the antisense region are linked in this order from the 5' side to the 3' side; or (i) the guide RNA comprises an antisense region, a functional region consisting of a base sequence that forms a G-quadruplex structure, a functional region consisting of a BoxB sequence, and an optionally contained linker, and the antisense region, the functional region consisting of the base sequence that forms a G-quadruplex structure, and the functional region consisting of the BoxB sequence are linked in this order from the 5' side to the 3' side; A guide RNA having a characteristic selected from the group consisting of:

2. A system for editing a target RNA, comprising the guide RNA of claim 1 and an ADAR.

3. A nucleic acid encoding the guide RNA of claim 1.

4. An expression vector comprising a nucleic acid encoding the guide RNA of claim 1.

5. The expression vector of claim 4, further comprising a nucleic acid encoding an ADAR.

6. The expression vector of claim 5 , wherein the ADAR is ADAR1 or ADAR2.

7. A host cell into which the expression vector according to any one of claims 4 to 6 has been introduced.

8. A method for producing an expression vector, comprising culturing the host cell of claim 7.

9. A pharmaceutical composition comprising the expression vector according to any one of claims 4 to 6 and a pharmaceutically acceptable excipient.

10. A pharmaceutical composition comprising the expression vector of claim 4, an expression vector comprising a nucleic acid encoding an ADAR, and a pharmaceutically acceptable excipient.

Images