RNA therapeutics and methods of use thereof

ADAR-activating RNAs upregulate ADAR expression, addressing inefficiencies in RNA editing therapeutics by enhancing specificity and delivery, thus improving treatment efficacy for diseases related to ADAR dysregulation.

JP7756166B2Active Publication Date: 2025-10-17ELI LILLY & CO
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023537492
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-12-02
Filing Date
2021-12-20
Publication Date
2025-10-17
Estimated Expiration
2041-12-20

AI Technical Summary

Technical Problem

Existing RNA editing therapeutics face challenges such as low ADAR activity, off-target editing, immunogenicity, and delivery issues, limiting their effectiveness in treating human diseases.

Method used

Development of ADAR-activating RNAs (aRNAs) that upregulate ADAR expression by targeting specific ADAR isoforms, utilizing complementary sequences and chemical modifications, and delivery via ligand targeting moieties and vehicles to enhance therapeutic efficacy.

Benefits of technology

ADAR aRNAs effectively increase ADAR expression, improving RNA editing specificity and reducing off-target effects, thereby enhancing therapeutic outcomes for diseases associated with ADAR-catalyzed dysregulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007756166000001
    Figure 0007756166000001
  • Figure 0007756166000002
    Figure 0007756166000002
  • Figure 0007756166000003
    Figure 0007756166000003
Patent Text Reader

Abstract

ADAR-activating RNA, RNA therapeutics containing ADAR-activating RNA, and methods of using the same.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention is in the field of medicine. More specifically, the present invention relates to RNA editing therapeutic agents.

[0002] Essentially, RNA editing is a biological process in which RNA is modified post-transcriptionally. Similar to DNA editing, RNA editing is an enzyme-catalyzed process that makes individual changes to nucleotides. However, unlike DNA editing, RNA editing modifies nucleotides at the RNA level (e.g., messenger RNA (mRNA), double-stranded RNA (dsRNA), microRNA (miRNA), etc.), but does not modify the genome.

[0003] Adenosine deaminases acting on RNA enzymes (ADARs) are a family of proteins involved in RNA editing. ADARs modify double-stranded RNA (dsRNA) during transcription, converting adenosine to inosine in the resulting mRNA. Four ADAR isoforms (ADAR1p110, ADAR1p150, ADAR2, and ADAR3) are known in humans. ADAR1p110, ADAR1p150, and ADAR2 are known to be involved in adenosine-to-inosine editing of RNA and play a role in RNA editing in innate immune and nervous system tissues, among other functions. ADAR3 is thought to negatively regulate RNA editing by competing with other ADAR proteins (e.g., ADAR1 and 2) for binding to target transcripts. Overall, ADAR-catalyzed adenosine-to-inosine RNA editing is understood to be protective and contribute to the expansion of transcript function and diversity. However, dysregulation of ADAR-catalyzed RNA editing has been associated with several diseases, including autoimmune and neurodegenerative disorders.

[0004] The concept of using RNA as a therapeutic agent to increase or decrease mRNA translation is still in its infancy and continues to expand. Examples of such RNA therapeutics include RNA interference, RNA activation, and targeted RNA editing by guide RNA using systems such as the CRISPR-Cas system. While promising, the use of RNA editing therapeutics to treat human diseases is still in its infancy and faces many obstacles. For example, RNA editing therapeutics that utilize ADAR-catalyzed adenosine-to-inosine base editing have proven to be ineffective due to low ADAR activity. ADAR expression in adult human tissues is known to be lower than in other organisms and varies depending on the tissue system. As a result, ADAR-catalyzed RNA editing systems are considered to be inefficient. To overcome these known issues, synthetically produced ADARs, including modified ADARs, have been developed. However, the use of synthetic ADARs in RNA editing therapies has proven challenging, with significant off-target editing, immunogenicity, toxicity, and delivery-related issues present. Therefore, there remains a need for RNA editing therapies that utilize ADAR-catalyzed editing and overcome one or more of these challenges for use in the treatment of human diseases.

[0005] Accordingly, the present disclosure provides compositions and methods that address one or more of the problems outlined above. More specifically, embodiments of the present disclosure provide adenosine deaminase ("ADAR")-activating RNAs (aRNAs) that act on RNA enzymes, upregulating ADAR expression. According to embodiments of the present disclosure, the ADAR is ADAR1p110, ADAR1p150, ADAR2, or ADAR3. In some embodiments, the ADAR aRNA is about 15 to about 50 nucleotides, and in still other embodiments, the ADAR aRNA is about 19 to about 30 nucleotides. In some more specific embodiments, the ADAR aRNA is 21 or 22 nucleotides.

[0006] According to embodiments, the ADAR aRNA comprises a sense sequence and an antisense sequence. The ADAR aRNA antisense sequence is complementary to the ADAR target genomic sequence, and the sense strand sequence is complementary to the complementary strand sequence of the ADAR target sequence. In some such embodiments, the sense and antisense ADAR aRNAs are at least 80% complementary to their respective target sequences. According to embodiments of the present disclosure, the ADAR aRNA target sequence is within -3000 to +150 nucleotides of the ADAR target sequence transcription start site. According to some embodiments, the ADAR aRNA target sequence is within SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and / or 13. According to certain embodiments of the ADAR aRNA provided herein, the ADAR aRNA is an ADAR1p110 aRNA as provided by one or more of SEQ ID NOs: 14-36 and 100-107. According to certain embodiments of the ADAR aRNA provided herein, the ADAR aRNA is an ADAR1p150 aRNA, as provided by one or more of SEQ ID NOs: 37-99, 108-113, and 134. According to certain embodiments of the ADAR aRNA provided herein, the ADAR aRNA is an ADAR2 aRNA, as provided by one or more of SEQ ID NOs: 114-133. According to certain embodiments of the ADAR aRNA provided herein, the ADAR aRNA is an ADAR3 aRNA. According to some such embodiments, the target sequence is within SEQ ID NOs: 12 and / or 13.

[0007] In some embodiments of the present disclosure, the ADAR aRNA comprises a 3' tail on one or both of the sense and antisense strands. In some embodiments, the ADAR aRNA comprises at least one modified nucleotide. In some such embodiments, the at least one modified nucleotide comprises a nucleotide modification selected from at least one of a thio-modified, an amino-modified, a phosphate-modified, a cholesterol-triethylene glycol (TEG)-modified, a methyl-modified, and a fluoro-modified nucleotide.

[0008] According to some embodiments of the present disclosure, the ADAR aRNA comprises a single strand. According to other embodiments of the present disclosure, the ADAR aRNA comprises a double strand having an antisense strand and a sense strand. In some such embodiments, the antisense strand and the sense strand are each independently about 15 to about 50 nucleotides long, and in still other embodiments, the antisense strand and the sense strand are each independently about 19 to about 30 nucleotides long. In still other embodiments, the antisense strand and the sense strand are each independently about 21 nucleotides long. In some embodiments, at least one of the antisense strand and the sense strand independently comprises a 3' overhang.

[0009] In some embodiments of the present disclosure, the ADAR aRNAs provided herein are encoded on a nucleic acid vector.

[0010] Additionally, according to some embodiments of the ADAR aRNAs provided herein, the aRNA is linked to a ligand targeting moiety. In some such embodiments, the ligand targeting moiety is GalNAc.

[0011] According to some further embodiments, the ADAR aRNA provided herein is linked to a second RNA. According to some such embodiments, the second RNA is a therapeutic RNA. In some embodiments, the therapeutic RNA comprises one of interfering RNA (iRNA) and microRNA (miRNA); messenger RNA (mRNA); guide RNA (gRNA), including single guide RNA (sgRNA); or antisense oligonucleotide (ASO), including activating RNA (aRNA).

[0012] According to the embodiments of the ADAR aRNA provided herein, the ADAR aRNA binds to the Argonaute 2 protein (AGO2) protein.

[0013] According to some embodiments, the ADAR aRNA is linked to a delivery vehicle, hi some embodiments, the delivery vehicle comprises at least one of an antibody or fragment thereof, an scFv, a peptide, GalNAc, an apatamer, or a nanoparticle.

[0014] According to some further embodiments, the ADAR aRNA provided herein is fully or partially encapsulated within a delivery vehicle, and according to some such embodiments, the delivery vehicle comprises at least one of a lipid, a liposome, a lipoplex, a polymer, or a nanoparticle.

[0015] Additionally, methods for regulating ADAR expression are provided herein, by administering the ADAR aRNA of the present disclosure to a patient.Some such methods increase ADAR expression.In some such methods, ADAR expression increases by at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, or at least 350%.

[0016] According to some embodiments of the present disclosure, a method of treating a human disease is provided, comprising administering a therapeutically effective amount of an ADAR aRNA of the present disclosure. In certain embodiments, the ADAR aRNA is an ADAR3 aRNA, and the ADAR3 target sequence is within SEQ ID NO: 12 and / or 13. In some such embodiments, the ADAR3 aRNA is delivered to tissues exhibiting ADAR1 and / or ADAR2 overexpression. According to some embodiments, the disease is characterized by excessive ADAR1- or ADAR2-catalyzed transcriptional editing. According to some embodiments, the disease is one of cancer, tumorigenesis, metastasis, brain cancer, chronic neurological disorders, immune disorders, or autoimmune diseases. According to some embodiments, the ADAR3 aRNA is delivered to the CNS. In some embodiments, a therapeutically effective amount of a therapeutic RNA for a human is also administered to the human.

[0017] The present disclosure also provides RNA editing therapeutics, including the therapeutic RNAs and ADAR aRNAs provided herein. According to some such embodiments, the therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO.

[0018] Further provided by the present disclosure are methods for treating human diseases. According to embodiments, such methods include administering a therapeutically effective amount of an RNA editing therapeutic to a human, wherein the RNA therapeutic includes a therapeutic RNA and an ADAR aRNA of the present disclosure. According to some embodiments, the therapeutic RNA and the ADAR aRNA are co-administered. In some embodiments, the therapeutic RNA and the ADAR aRNA are co-formulated. In yet other embodiments, the therapeutic RNA and the ADAR aRNA are linked. In such method embodiments, at least one of the therapeutic RNA and the ADAR aRNA is fully or partially encapsulated within a delivery vehicle. According to some such embodiments, the delivery vehicle includes at least one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. In some embodiments, at least one of the therapeutic RNA and the ADAR aRNA is linked to the delivery vehicle. According to some such embodiments, the delivery vehicle includes one of an antibody or fragment thereof, an scFv, a peptide, GalNAc, an apatamer, or a nanoparticle.

[0019] Additionally, according to some embodiments, the present disclosure provides a pharmaceutical composition comprising a therapeutic RNA, an ADAR aRNA provided herein, and at least one pharmaceutically acceptable excipient. According to some embodiments, the therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO.

[0020] Additionally, the present disclosure provides a method for treating a human disease, comprising administering a therapeutically effective amount of a pharmaceutical composition of the present disclosure to a human. According to such embodiments, the pharmaceutical composition comprises a therapeutic RNA, an ADAR aRNA provided by the present disclosure, and a pharmaceutically acceptable excipient. According to some such embodiments, the therapeutic RNA and the ADAR aRNA are co-administered. In some embodiments, the therapeutic RNA and the ADAR aRNA are co-formulated. In some embodiments, the therapeutic RNA and the ADAR aRNA are linked. Furthermore, in some embodiments, at least one of the therapeutic RNA and the ADAR aRNA is fully or partially encapsulated within a delivery vehicle. According to some such embodiments, the delivery vehicle comprises at least one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. In some embodiments, at least one of the therapeutic RNA and the ADAR aRNA is linked to the delivery vehicle. According to some such embodiments, the delivery vehicle comprises one of an antibody or fragment thereof, an scFv, a peptide, GalNAc, an apatamer, or a nanoparticle.

[0021] As used herein, RNA editing therapy refers to a system or method that uses therapeutic RNA to regulate, i.e., up-regulate or down-regulate, protein translation from RNA. Examples of RNA editing therapeutics include, but are not limited to, RNA interference, RNA activation, and targeted RNA editing by guide RNA using systems such as the CRISPR-Cas system. Such RNA editing therapeutics use therapeutic RNAs such as interfering RNA (iRNA, also known as siRNA) and antisense oligonucleotides such as microRNA (miRNA), mRNA, RNA aptamers, activating RNA (aRNA, also known as saRNA), and guide RNA (gRNA), including single guide RNA (sgRNA). The term therapeutic RNA refers to RNA oligonucleotides (e.g., ASO, iRNA, miRNA, mRNA, RNA aptamer, aRNA, gRNA, sgRNA, etc.) used in RNA editing therapeutics.

[0022] As used herein, ADAR-activating RNA (ADAR aRNA) refers to RNA that regulates the expression of endogenous ADAR. The ADAR aRNA comprises an antisense sequence that is complementary, at least 80% complementary, to the ADAR aRNA target sequence. According to embodiments, the ADAR aRNA target sequence is located between nucleotides -3000 (e.g., 3000 nucleotides upstream) and +150 (150 nucleotides downstream) of the ADAR target sequence transcription start site. According to more specific embodiments, the ADAR aRNA target sequence is located within SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and / or 13. In certain embodiments, for example, an ADAR1 p110 aRNA target sequence may be located within SEQ ID NOs: 1, 2, and / or 3, while an ADAR1 p150 aRNA target sequence may be located within SEQ ID NOs: 4, 5, 6, and / or 7, while an ADAR2 aRNA target sequence may be located within SEQ ID NOs: 8, 9, 10, and / or 11, while an ADAR3 aRNA target sequence may be located within SEQ ID NOs: 12 and / or 13.

[0023] Additionally, according to the present disclosure, therapeutic RNA and ADAR aRNA embodiments can be chemically synthesized or recombinantly produced using methods known in the art. Furthermore, therapeutic RNA and / or ADAR aRNA embodiments can include one or more modified nucleotides known in the art, such as thio-modified, amino-modified, phosphate-modified, cholesterol-TEG-modified, methyl-modified, or fluoro-modified nucleotides.

[0024] As used herein, "RNA" refers interchangeably to ribonucleic acid and ribonucleotides. RNA refers to both natural and non-natural (artificial, synthetic), modified or unmodified nucleotides or polynucleotides.

[0025] As used herein, "linked" refers to two or more moieties that are physically joined or connected to each other to form a structure, either directly or through one or more additional moieties that act as linking agents.

[0026] The Argonaute 2 protein (AGO2) referred to herein is a protein naturally occurring in humans that is known to bind to RNA, is involved in RNA interference, and has endonuclease activity.

[0027] As used herein, a delivery vehicle refers to a molecule used in conjunction with an ADAR aRNA or therapeutic RNA to deliver the RNA to a patient. Examples include antibodies or fragments thereof, scFvs, peptides, GalNAc, apatamers, or nanoparticles bound to RNA. Other examples include lipidoids, liposomes, lipoplexes, polymers, or nanoparticles in which RNA is fully or partially encapsulated.

[0028] As used herein, a pharmaceutical composition refers to a composition comprising an ADAR aRNA of the present disclosure formulated into a dosage form such as topical, intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, subcutaneous), including liquid dosage forms, injectable formulations, pulmonary dosage forms, and solid dosage forms. A pharmaceutical composition may also include at least one pharmaceutically acceptable excipient, and may also include an ADAR aRNA formulated into a dosage form together with a therapeutic RNA.

[0029] As used interchangeably herein, "treatment" and / or "treating" and / or "treat" are intended to refer to any process that may result in the complete elimination, slowing or delay of, reduction in the severity or frequency (e.g., of episodes), interruption or halt of progression of a disease and / or disease symptoms, but does not require the complete elimination of all disease symptoms. Treatment includes the administration of an RNA editing therapeutic according to the present disclosure, including administration of an ADAR aRNA, to a person who would benefit from at least one of the above processes, and includes (a) inhibiting or slowing further progression of disease symptoms and effects, i.e., preventing onset or progression; (b) relieving disease, i.e., causing elimination or regression of the disease, disease symptoms, or disease complications; and (c) preventing or reducing the frequency of disease episodes.

[0030] As used herein, the terms "about" or "approximately," when used in reference to a specifically recited numerical value or range of values, mean that the value may vary from the recited value by no more than 10% (e.g., + / - 10%). For example, as used herein, the phrase "about 100" includes 90 and 110, and all values ​​therebetween (e.g., 91, 92, 93, 94, etc.). [Example]

[0031] Example 1: Exemplary ADAR aRNAs Exemplary ADAR aRNAs can be prepared substantially as described below. For each human ADAR isoform, an ADAR aRNA library can be generated and screened. Nucleotide sequences from about -3000 (3000 nucleotides upstream) to about +150 (150 nucleotides downstream) of the ADAR transcription start sequence (e.g., position 0) can be selected. More specifically, for ADAR1p110, target sequence regions within SEQ ID NOs: 1, 2, and / or 3 (e.g., ADAR1p110 targeting regions A, B, and C) can be selected. For ADAR1p150, target sequence regions within SEQ ID NOs: 4, 5, 6, and / or 7 (e.g., ADAR1p150 targeting regions A, B, C, and D) can be selected. Similarly, for ADAR2, target sequence regions within SEQ ID NOs: 8, 9, 10, and / or 11 (e.g., ADAR2 targeting regions A, B, C, and D) can be selected, and for ADAR3, target sequence regions within SEQ ID NOs: 12 and / or 13 (e.g., ADAR3 targeting regions A and B) can be selected. Regions containing repetitive elements and CpG island sequences can then be screened out.

[0032] An initial library of nucleotide sequences of 15 to 50 nucleotides can then be selected. In exemplary embodiments, sequences of 21 and 22 nucleotides can be selected. Exemplary libraries of ADAR1_p110 aRNA antisense sequences (Table 4), ADAR1_p150 aRNA antisense sequences (Tables 1, 2, 6, and 9), and ADAR2 aRNA antisense sequences (Table 8) are provided herein.

[0033] Further screening may be performed. Library candidates may be cross-compared to ADAR transcription regions and miRNA libraries, thereby screening for overlapping ADAR aRNA candidates. Any candidate ADAR aRNAs that show a complementary match may also be screened for their complement (e.g., only one candidate of a complementary pair is selected). Additionally, ADAR aRNA candidates identified as cross-reactive with other genes (e.g., identical to or within one base mismatch with another gene transcriptome) may also be screened. Further screening may be performed to screen for ADAR aRNA candidates targeting low-expression exon regions. AGO2 binding prediction scores from the ADAR aRNA candidate library may also be used to rank candidates for in vitro and in vivo evaluation.

[0034] ADAR aRNAs (both sense and antisense strands) may contain chemical modifications. Exemplary chemical modifications according to embodiments of the present disclosure include 2'-O-methyl (mG, mA, mC, or mU) and / or 2'-fluoro (fG, fA, fC, or fU) at the 2'-ribose position. Additionally, the phosphodiester backbone may be substituted with phosphonothioate at one or more nucleotides, and a 5'-phosphorylation modification may be introduced, for example, at the 5' end of the antisense strand. Furthermore, as described herein, ADAR aRNAs of the present disclosure may be linked to a delivery vehicle or ligand targeting moiety, such as cholesterol or GalNAc, which may be linked to the ADAR aRNA via, for example, triethylene glycol. Exemplary embodiments are shown in Table 1. [Table 1]

[0035] Additionally, the sense and antisense strands of the ADAR aRNA of the present disclosure may comprise nucleotide overhangs of 1, 2, or up to 5 nucleotides. According to some embodiments, one or both of the sense and antisense strands may comprise 1, 2, or up to 5 nucleotides at the 5'-end. In some embodiments, one or both of the sense and antisense strands comprise 1, 2, or up to 5 nucleotides at the 3'-end. In some embodiments, both the sense and antisense strands comprise two uracil 3' overhangs.

[0036] Additionally, as described herein, one or both of the sense and antisense strands of the ADAR aRNAs provided herein may contain one or more nucleotide mismatches between the nucleotide sequences of the target sequence for both the sense and antisense strands. Exemplary embodiments containing mismatched nucleotide sequences for both the sense and antisense strands are provided in Table 2 (the sense and antisense sequences of Reference A and Reference B in Table 2 do not contain mismatches to their respective ADAR target sequences). Modulation of ADAR1 p150 expression by exemplary ADAR aRNAs with mismatches is performed according to the process provided in Example 2B herein. The percentage of ADAR1 expression levels compared to Reference A or Reference B, respectively, is shown in Table 2. [Table 2]

[0037] Example 2: In vitro ADAR expression regulation The modulation of ADAR expression by the ADAR aRNA candidate prepared according to the process provided herein can be evaluated substantially as described herein. The ADAR aRNA can be transfected into a target cell line at a serial concentration for 24 hours. The expression of each ADAR isoform can then be assayed individually at the mRNA and / or protein level. The ADAR mRNA level can be assayed using quantitative reverse transcription polymerase chain reaction (qRT-PCR), while the ADAR protein expression level can be assayed by Western blot or enzyme-linked immunosorbent assay (ELISA). The ADAR mRNA and protein expression levels can then be compared with untreated controls to identify the ADAR aRNA candidate that provides the greatest upregulation.

[0038] Example 2A. ADAR1 p110 The expression level of ADAR1 mRNA in HEK293T cells transfected with ADAR1 p110 aRNA is evaluated and compared with the control ADAR1 mRNA level in HEK293T cells not transfected with ADAR1 p110 aRNA, essentially as described herein. Briefly, HEK293T cells are seeded at 10,000 cells / well on a 96-well plate in serum-free medium (Opti-MEM, Cat. No. 11058021). Then, the cells are treated with 100 nM ADAR p110 aRNA (antisense sequence listed in Table 4) containing vehicle (Lipofectamine RNAiMax, Cat. No. 13778100), or with vehicle alone (not transfected with ADAR p110 aRNA) as a control for 12 hours or more. The medium of treated and untreated cells is replaced with complete medium (DMEM + 10% FBS) 8-12 hours after transfection and cell cultures are maintained until the end point. ADAR1 mRNA levels are measured using quantitative RT-PCR (PowerTrack SYBR Green Master Mix, catalog number A46012) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). As shown in Table 4a, three specific ADAR1p110 targeting regions (designated regions A, B, and C in Table 3) were identified, and an ADAR1p110 aRNA antisense sequence targeting one of these three regions shows an increase in ADAR1 transcription of up to 150%. [Table 3] [Table 4]

[0039] ADAR1 p110 mRNA expression levels in HELA cells transfected with ADAR1 p110 aRNA were assessed and compared to control ADAR1 p100 levels in HELA cells not transfected with ADAR1 p110 aRNA, essentially as described herein. Briefly, HELA cells were seeded at 10,000 cells / well in a 96-well plate set up in serum-free medium (Opti-MEM, catalog no. 11058021). Cells were then treated with 100 nM ADAR p110 aRNA (antisense sequence listed in Table 4b) containing vehicle (Lipofectamine RNAiMax, catalog no. 13778100) or vehicle alone (not transfected with ADAR p110 aRNA) as a control for 12 hours or more. The medium of treated and untreated cells was replaced with complete medium (DMEM + 10% FBS) 8-12 hours after transfection, and cell cultures were maintained until the end point. ADAR1P110 mRNA levels are measured using quantitative RT-PCR (TaqMan™ Fast Advanced Master Mix, catalog number 4444965) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). As shown in Table 4b, three specific ADAR1P110 targeting regions (designated regions A, B, and C in Table 3) were identified, and ADAR1P110 aRNA antisense sequences targeting one of these three regions show an increase in ADAR1P110 transcription of up to 350%. [Table 5]

[0040] Example 2B. ADAR1 p150 The expression level of ADAR1p150 mRNA in HEK293T cells transfected with ADAR1p150 aRNA is evaluated, and compared with the control ADAR1 mRNA level in HEK293T cells not transfected with ADAR1p150 aRNA. Briefly, HEK293T cells are seeded at 10,000 cells / well on a 96-well plate in serum-free medium (Opti-MEM, Cat. No. 11058021). Then, cells are treated with 100 nM ADAR p150 aRNA (antisense sequence described in Table 6a) containing vehicle (Lipofectamine RNAiMax, Cat. No. 13778100), or with vehicle alone (not transfected with ADAR p150 aRNA) as a control for 12 hours or more. The medium of treated and untreated cells is replaced with complete medium (DMEM + 10% FBS) 8-12 hours after transfection and cell cultures are maintained until the end point. ADAR1 p150 mRNA transcription is measured using quantitative RT-PCR (PowerTrack SYBR Green Master Mix, catalog number A46012) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). As shown in Table 6a, four specific ADAR1 p150 targeting regions (designated regions A, B, C, and D in Table 5) were identified, and an ADAR1 p150 aRNA antisense sequence targeting one of these four regions shows an increase in ADAR1 transcription of up to 370%. [Table 6] [Table 7]

[0041] The expression levels of ADAR1 p150 mRNA and protein in HELA cells transfected with ADAR1 p150 aRNA are evaluated and compared with the control ADAR1 p150 levels in HELA cells not transfected with ADAR1 p150 aRNA, essentially as described herein. Briefly, HELA cells are seeded at 10,000 cells / well in a 96-well plate set up in serum-free medium (Opti-MEM, Cat. No. 11058021). Cells are then treated with 100 nM ADAR p150 aRNA (antisense sequence listed in Table 6b) containing vehicle (Lipofectamine RNAiMax, Cat. No. 13778100), or with vehicle alone (not transfected with ADAR p150 aRNA) as a control for 12 hours or more. The medium of treated and untreated cells is replaced with complete medium (DMEM + 10% FBS) 8-12 hours after transfection, and cell cultures are maintained until the end point. ADAR1 p150 mRNA levels are measured using quantitative RT-PCR (TaqMan™ Fast Advanced Master Mix, catalog number 4444965) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). As shown in Table 6b, three specific ADAR1 p150 targeting regions (designated regions A, B, and C in Table 5) were identified, and ADAR1 p150 aRNA antisense sequences targeting one of these three regions show an increase in ADAR1 p150 transcription of up to 350%. [Table 8]

[0042] ADAR1P110 protein levels are measured using semi-quantitative Western blotting. Table 6c shows the percentage of ADAR1 protein in HELA cells transfected with 100 nM and 10 nM of an exemplary ADAR aRNA containing the sense strand of SEQ ID NO: 65 and the antisense strand of SEQ ID NO: 66. Also shown are the ADAR1 protein levels in HELA cells transfected with 100 nM and 10 nM of non-targeting aRNA; the non-targeting aRNA contains the sense strand (UCCUAUGACUGUAGAUUUUAU SEQ ID NO: 135) and the antisense strand (AUAAAAUCUACAGUCAUAGGAAU SEQ ID NO: 136). The ADAR1 protein levels in HELA cells treated with recombinant IFN-beta for 24 hours are also provided as a positive control. Results are shown as the percentage of ADAR1 protein compared to untreated HELA cells. [Table 9]

[0043] Example 2C. ADAR2 ADAR2 mRNA and protein expression levels in Hela cells transfected with ADAR2 aRNA were assessed and compared to control ADAR2 levels in Hela cells not transfected with ADAR2 aRNA, essentially as described herein. Briefly, Hela cells were seeded at 10,000 cells / well in a 96-well plate set up in serum-free medium (Opti-MEM, Cat. No. 11058021). Cells were then treated with 100 nM ADAR2 aRNA (antisense sequence listed in Table 8) containing vehicle (Lipofectamine RNAiMax, Cat. No. 13778100) or vehicle alone (not transfected with ADAR2 aRNA) as a control for 12 hours or more. The medium of treated and untreated cells was replaced with complete medium (DMEM + 10% FBS) 8-12 hours after transfection, and cell cultures were maintained until the end point. ADAR2 mRNA levels are measured using quantitative RT-PCR (TaqMan™ Fast Advanced Master Mix, catalog number 4444965) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). As shown in Table 8, three specific ADAR2 targeting regions (designated regions A, B, C, and D in Table 7) were identified, and ADAR2 aRNA antisense sequences targeting one of these three regions show an increase in ADAR2 transcription of up to 200%. [Table 10] [Table 11]

[0044] Example 3: ADAR-catalyzed RNA editing The evaluation of ADAR aRNA candidates in RNA editing therapy can be performed substantially as described herein. The ADAR aRNA candidates can be delivered together with therapeutic RNA (e.g., guide RNA) designed to edit target RNA. This can be performed in vitro and / or in vivo. In in vitro assays, serial concentrations of ADAR aRNA and therapeutic RNA can be transfected into target cell lines for 24, 48, and 72 hours. Additionally, the ADAR aRNA and therapeutic RNA can be bound or encapsulated in a delivery vehicle (e.g., GalNAc conjugation, liposome, etc.).

[0045] Following transfection, cell lysates can be processed for target transcript analysis by RNA sequencing technology. The proportion of edited target RNA transcripts can be used to assess the effectiveness of RNA editing (compared to control groups, including control groups of cells transfected with ADAR aRNA or therapeutic RNA alone).

[0046] The editing efficacy of therapeutic RNAs is evaluated in vitro substantially as described herein. Briefly, HeLa cells are seeded at 10,000 cells / well in a 96-well plate in serum-free medium (Opti-MEM, catalog no. 11058021). Cells are transfected with 100 nM of therapeutic RNA (ASO targeting either the beta-actin gene or the GAPDH gene). Therapeutic RNA-transfected cells are co-treated within 12 hours with either: (i) 100 nM of ADAR p150 aRNA (antisense sequence listed in Table 9) and vehicle (Lipofectamine RNAiMax, catalog no. 13778100), or (ii) vehicle alone. Eight to 12 hours after transfection, the medium is replaced with complete medium (DMEM + 10% FBS). ADAR1 mRNA levels are measured using quantitative RT-PCR (TaqMan™ Fast Advanced Master Mix, catalog number 4444965) according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, catalog number A35379). Editing efficiency is assessed by Sanger sequencing (i.e., quantifying A-to-G editing efficiency). As shown in Table 9a, co-transfection of therapeutic RNA of the beta-actin gene with ADAR1 p150 aRNA demonstrates up to a 600% increase in ADAR1 transcription and up to a 350% enhancement in editing efficiency. As shown in Table 9b, co-transfection of therapeutic RNA of the GAPDH gene with ADAR1 p150 aRNA demonstrates up to a 1000% increase in ADAR1 transcription and up to a 150% enhancement in editing efficiency. [Table 12] [Table 13]

[0047] Example 4: Regulation of ADAR3 expression Embodiments of the present disclosure provide ADAR3 aRNA for upregulating endogenous ADAR3. In certain embodiments, the ADAR3 aRNA is delivered to tissues for the treatment of diseases associated with excessive transcriptional editing catalyzed by ADAR1 or ADAR2. Thus, upregulation of endogenous ADAR3 expression may be regulated, for example, through competitive inhibition, reduced binding efficiency, reduced activity, and / or reduced expression, ADAR1 and / or ADAR2 activity, thereby controlling excessive transcript editing catalyzed by ADAR1 or ADAR2. In some specific embodiments, the ADAR3 aRNA is co-delivered with a therapeutic RNA designed to edit a target RNA to provide a therapeutic effect in diseases associated with excessive transcript editing catalyzed by ADAR1 or ADAR2.

[0048] Briefly, ADAR3 aRNA can be prepared according to the methods provided herein for the ADAR3 aRNA target sequence provided by SEQ ID NO: 12 and / or 13, and prepared substantially as described in Example 1. In vitro ADAR3 expression, both at baseline and after ADAR3 aRNA transfection, can be assessed using methods substantially as described herein and in Example 2. Additionally, co-delivery of ADAR3 aRNA with a therapeutic RNA designed to edit the target RNA to provide a therapeutic benefit in diseases associated with ADAR1-catalyzed or ADAR2-catalyzed hyperactive transcript editing can be assessed substantially as described herein and in Example 3.

[0049] According to certain embodiments, ADAR3 aRNA upregulation of endogenous ADAR3 is delivered to central nervous system tissue (with or without a therapeutic RNA designed to edit a target RNA) for ADAR1-catalyzed or ADAR2-catalyzed excessive transcript editing. In more specific embodiments, ADAR3 aRNA upregulation of endogenous ADAR3 is delivered to central nervous system tissue for control of ADAR1-catalyzed or ADAR2-catalyzed excessive transcript editing associated with brain tumors (including glioblastoma), tumorigenesis, and / or chronic neurological disorders. According to some embodiments, ADAR3 aRNA upregulation of endogenous ADAR3 is delivered to non-CNS tissue (e.g., peripheral tissue) (with or without a therapeutic RNA designed to edit a target RNA) for control of ADAR1-catalyzed or ADAR2-catalyzed excessive transcript editing diseases, including tumorigenesis, metastasis, immune and autoimmune diseases (e.g., systemic lupus erythematosus).

[0050] Illustrative Embodiments 1. Adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on RNA enzymes and upregulates the expression of ADAR; Adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on RNA enzymes, where the ADAR aRNA contains an antisense oligonucleotide sequence. 2. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR1p110. 3. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR1p150. 4. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR2. 5. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR3. 6. The ADAR aRNA of any one of embodiments 1 to 5, wherein the antisense oligonucleotide sequence is about 15 to about 50 nucleotides. 7. The ADAR aRNA of any one of embodiments 1 to 5, wherein the antisense oligonucleotide sequence is about 19 to about 30 nucleotides. 8. The ADAR aRNA of any one of embodiments 1 to 7, wherein the ADAR aRNA further comprises a sense oligonucleotide sequence. 9. The ADAR aRNA of embodiment 8, wherein the antisense sequence is at least 80% complementary to the target sequence. 10. The ADAR aRNA of embodiment 9, wherein the target sequence is within −3000 to +150 nucleotides of the ADAR target sequence transcription start site. 11. The ADAR aRNA of embodiment 9, wherein the target sequence is within SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 and / or 13. 12. The ADAR aRNA of any one of embodiments 1 to 11, wherein at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises a 3' tail. 13. The ADAR aRNA of any one of embodiments 1 to 12, wherein at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises at least one modified nucleotide. 14. The ADAR aRNA of embodiment 13, wherein at least one modified nucleotide comprises a nucleotide modification selected from at least one of a thio-modified, an amino-modified, a phosphate-modified, a cholesterol-triethylene glycol (TEG)-modified, a methyl-modified, and a fluoro-modified nucleotide. 15. The ADAR aRNA of any one of embodiments 1 to 14, wherein the antisense oligonucleotide sequence and the sense oligonucleotide sequence are each independently about 15 to about 50 nucleotides. 16. The ADAR aRNA of any one of embodiments 1 to 14, wherein the antisense oligonucleotide sequence and the sense oligonucleotide sequence are each independently about 19 to about 30 nucleotides. 17. The ADAR aRNA of any one of embodiments 1 to 14, wherein the antisense and sense oligonucleotide sequences are each 22 nucleotides. 18. The ADAR aRNA of any one of embodiments 1 to 14, wherein the antisense and sense oligonucleotide sequences are each 21 nucleotides. 19. The ADAR aRNA of any one of embodiments 1 to 18, wherein at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises a 3-overhang. 20. The ADAR aRNA of any one of embodiments 1 to 19, wherein at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence is contained on a nucleic acid vector. 21. The ADAR aRNA of any one of embodiments 1 to 20, wherein the aRNA is linked to a ligand-targeting moiety. 22. The ADAR aRNA of embodiment 21, wherein the ligand targeting moiety is GalNAc. 23. The ADAR aRNA of any one of embodiments 1 to 22, wherein the aRNA is linked to a second RNA. 24. The ADAR aRNA of embodiment 23, wherein the second RNA is a therapeutic RNA. 25. The ADAR aRNA of embodiment 24, wherein the therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO. 26. The ADAR aRNA of any one of embodiments 1 to 25, wherein the aRNA binds to AGO2 protein. 27. The ADAR aRNA of any one of embodiments 1 to 26, wherein the aRNA is linked to a delivery vehicle. 28. The ADAR aRNA of embodiment 27, wherein the delivery vehicle comprises one of an antibody, or a fragment thereof, an scFv, a peptide, GalNAc, an apatamer, or a nanoparticle. 29. The ADAR aRNA of any one of embodiments 1 to 27, wherein the aRNA is fully or partially encapsulated within a delivery vehicle. 30. The ADAR aRNA of embodiment 29, wherein the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. 31. The ADAR aRNA of any one of embodiments 1 to 4 and 6 to 30, wherein the antisense oligonucleotide sequence comprises at least one of SEQ ID NOs: 14 to 134. 32. ADAR1p110 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 14-36 and 100-107. 33. An ADAR1p150 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 37-99, 108-113, and 134. 34. An ADAR2 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 114-133. 35. A method for modulating ADAR expression, comprising administering to a patient an ADAR aRNA according to any one of embodiments 1 to 34, 60, and 74 to 76. 36. The method of embodiment 35, wherein ADAR expression is increased. 37. The method of embodiment 36, wherein ADAR expression is increased by at least 20%. 38. The method of embodiment 36, wherein ADAR expression is increased by at least 30%. 39. The method of embodiment 36, wherein ADAR expression is increased by at least 40%. 40. The method of embodiment 36, wherein ADAR expression is increased by at least 50%. 41. RNA editing therapeutic agents, A therapeutic RNA; An RNA editing therapeutic agent comprising an ADAR aRNA of any of embodiments 1 to 34, 60, and 74 to 76. 42. The RNA editing therapeutic of embodiment 41, wherein the therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO. 43. A method for treating a disease in a human, comprising administering to the human a therapeutically effective amount of an RNA editing therapeutic, wherein the RNA therapeutic comprises a therapeutic RNA and an ADAR aRNA described in any one of embodiments 1-34, 60, and 74-76. 44. The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are administered simultaneously. 45. The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are co-formulated. 46. ​​The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are linked. 47. The method of any one of embodiments 43 to 46, wherein at least one of the therapeutic RNA and the ADAR aRNA is fully or partially encapsulated within the delivery vehicle. 48. The method of embodiment 47, wherein the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. 49. The method of any one of embodiments 43 to 46, wherein at least one of the therapeutic RNA and the ADAR aRNA is linked within a delivery vehicle. 50. The method of embodiment 49, wherein the delivery vehicle comprises one of an antibody, or fragment thereof, scFv, peptide, GalNAc, apatamer, or nanoparticle. 51. Therapeutic RNA and An ADAR aRNA according to any one of embodiments 1 to 34, 60, and 74 to 76; and at least one pharmaceutically acceptable excipient. 52. The pharmaceutical composition of embodiment 51, wherein the therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO. 53. A method for treating a disease in a human, comprising administering to the human a therapeutically effective amount of a pharmaceutical composition, the pharmaceutical composition comprising a therapeutic RNA, an ADAR aRNA described in any one of embodiments 1-34, 60, and 74-76, and a pharmaceutically acceptable excipient. 54. The method of embodiment 53, wherein the therapeutic RNA and the ADAR aRNA are administered simultaneously. 55. The method of embodiment 53, wherein the therapeutic RNA and the ADAR aRNA are co-formulated. 56. The method of embodiment 53, wherein the therapeutic RNA and the ADAR aRNA are linked. 57. The method of any one of embodiments 53-56, wherein at least one of the therapeutic RNA and the ADAR aRNA is fully or partially encapsulated within the delivery vehicle. 58. The method of embodiment 57, wherein the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. 59. The method of any one of embodiments 53 to 58, wherein at least one of the therapeutic RNA and the ADAR aRNA is linked within a delivery vehicle. 60. The method of embodiment 59, wherein the delivery vehicle comprises one of an antibody, or fragment thereof, scFv, peptide, GalNAc, an apatamer, or a nanoparticle. 61. The ADAR aRNA of any one of embodiments 5 to 25 and 27 to 30, wherein the ADAR is ADAR3 and the target sequence is within SEQ ID NO: 12 and / or 13. 62. A method for treating a disease in a human, comprising administering to the human a therapeutically effective amount of the ADAR3 aRNA of embodiment 61. 63. The method of embodiment 62, wherein ADAR3 aRNA is delivered to tissues that exhibit overexpression of ADAR1 and / or ADAR2. 64. The method of embodiment 62 or 63, wherein the ADAR3 aRNA is delivered to the CNS. 65. The method of any one of embodiments 62-64, wherein the ADAR3 aRNA is fully or partially encapsulated within the delivery vehicle. 66. The method of embodiment 65, wherein the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. 67. The method of any one of embodiments 62-66, wherein the ADAR3 aRNA is linked to a delivery vehicle. 68. The method of any one of embodiments 65-67, wherein the delivery vehicle comprises one of an antibody, or fragment thereof, scFv, peptide, GalNAc, apatamer, or nanoparticle. 69. The method of any one of embodiments 62-68, further comprising administering a therapeutically effective amount of a therapeutic RNA to the human. 70. The method of embodiment 69, wherein the therapeutic RNA and the ADAR3 aRNA are administered simultaneously. 71. The method of embodiment 70, wherein the therapeutic RNA and the ADAR3 aRNA are co-formulated. 72. The method of embodiment 70 or 71, wherein the therapeutic RNA and the ADAR3 aRNA are linked. 73. The method of any one of embodiments 62-72, wherein the disease is characterized by excessive ADAR1-catalyzed or ADAR2-catalyzed transcriptional editing. 74. The method of any one of embodiments 62-72, wherein the disease is one of cancer, tumorigenesis, metastasis, brain tumors including glioblastoma, chronic neurological disorders, immune diseases, or autoimmune diseases including systemic lupus erythematosus. 75. The ADAR aRNA of any one of embodiments 2, 6-30, and 32, wherein the ADAR is ADAR1p110 and the target sequence is within SEQ ID NO: 1, 2 and / or 3. 76. The ADAR aRNA of any one of embodiments 3, 6-30, and 33, wherein the ADAR is ADAR1p150 and the target sequence is within SEQ ID NO: 4, 5, 6 and / or 7. 77. The ADAR aRNA of any one of embodiments 4 and 6 to 30, wherein the ADAR is ADAR2 and the target sequence is within SEQ ID NO: 8, 9, 10 and / or 11. The present invention includes the following aspects. <1> an adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on RNA enzymes, and upregulates the expression of ADAR; An adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on an RNA enzyme, wherein the ADAR aRNA comprises an antisense oligonucleotide sequence. <2> ADAR is ADAR1p110, ADAR1p150, ADAR2 or ADAR3; <1> The ADAR aRNA described in <3> the antisense oligonucleotide sequence is about 15 to about 50 nucleotides; <1> or <2> The ADAR aRNA described in <4> the antisense oligonucleotide sequence is about 19 to about 30 nucleotides; <1> ~ <3> The ADAR aRNA according to any one of the preceding items. <5> The ADAR aRNA further comprises a sense oligonucleotide sequence. <1> ~ <4> The ADAR aRNA according to any one of the preceding items. <6> the antisense sequence is at least 80% complementary to the target sequence; <5> The ADAR aRNA described in <7> the target sequence is within -3000 to +150 nucleotides of the ADAR target sequence transcription start site; <6> The ADAR aRNA described in <8> the target sequence is within SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; <7> The ADAR aRNA described in <9> at least one of the antisense and sense oligonucleotide sequences comprises at least one modified nucleotide; the at least one modified nucleotide comprises a nucleotide modification from at least one of a thio-modified nucleotide, an amino-modified nucleotide, a phosphate-modified nucleotide, a cholesterol-triethylene glycol (TEG)-modified nucleotide, a methyl-modified nucleotide, and a fluoro-modified nucleotide; <1> ~ <8> The ADAR aRNA according to any one of the preceding items. <10> the antisense oligonucleotide sequence and the sense oligonucleotide sequence are each independently about 19 to about 30 nucleotides; <1> ~ <9> The ADAR aRNA according to any one of the preceding items. <11> the antisense and sense oligonucleotide sequences are each 21 nucleotides, or the antisense and sense oligonucleotide sequences are each 21 nucleotides; <10> The ADAR aRNA described in <12> at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises a 3' overhang; <1> ~ <11> The ADAR aRNA according to any one of the preceding items. <13> the aRNA is linked to a therapeutic RNA; <1> ~ <11> The ADAR aRNA according to any one of the preceding items. <14> The therapeutic RNA comprises one of mRNA, miRNA, sgRNA, aRNA, iRNA, or ASO; <13> The ADAR aRNA described in <15> the aRNA is linked to a delivery vehicle; <1> ~ <14> The ADAR aRNA according to any one of the preceding items. <16> the delivery vehicle comprises one of an antibody or fragment thereof, an scFv, a peptide, GalNAc, an apatamer, or a nanoparticle; <15> The ADAR aRNA described in <17> the aRNA is fully or partially encapsulated within a delivery vehicle; the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle; <15> The ADAR aRNA described in <18> The antisense oligonucleotide sequence comprises at least one of SEQ ID NOs: 14 to 134. <1> ~ <17> The ADAR aRNA according to any one of the preceding items. <19> An ADAR1p110 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 14-36 and 100-107. <20> An ADAR1p150 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 37-99, 108-113, and 134. <21> An ADAR2 aRNA comprising an antisense oligonucleotide sequence given by one of SEQ ID NOs: 114-133. <22> <1> ~ <21> A method for regulating ADAR expression, comprising administering to a patient an ADAR aRNA described in any one of the above. <23> ADAR expression increases, ADAR expression is at least 20%, at least 30%, at least 40%, or increase by at least 50%, <22> The method described below. <24> 1. A method of treating a disease in a human, comprising: administering a therapeutically effective amount of a therapeutic RNA to a human; <1> ~ <21> and administering to the human an ADAR aRNA described in any one of the above.

[0051] Sequence Listing SEQ ID NO: 1: ADAR1 p110 target sequence, region A, -715 to -322 (inverted 5'-3')

Chem.

[0052] SEQ ID NO: 2: ADAR1 p110 target sequence, region B, -1469 to -1137 (5'-3' reversed) (reversal)

Chem.

[0053] SEQ ID NO: 3: ADAR1 p110 target sequence, region C, -1619 to -1500 (inverted 5'-3')

Chem.

[0054] SEQ ID NO: 4: ADAR1 p150 target sequence, region A, -828 to -456 (inverted 5'-3')

Chem.

[0055] SEQ ID NO: 5: ADAR1 p150 target sequence, region B, -1136 to -934 (inverted 5'-3')

Chem.

[0056] SEQ ID NO: 6: ADAR1 p150 target sequence, region C, -1274 to -1211 (inverted 5'-3')

change

[0057] SEQ ID NO: 7: ADAR1 p150 target sequence, region D, -1539 to -1370 (inverted 5'-3')

change

[0058] SEQ ID NO: 8: ADAR2 target sequence, region A, -801 to -500

change

[0059] SEQ ID NO: 9: ADAR2 target sequence, region B, -1324 to -835

change

[0060] SEQ ID NO: 10: ADAR2 target sequence, region C, -1773 to -1566

change

[0061] SEQ ID NO: 11: ADAR2 target sequence, region D, -3000 to -1924

change

[0062] SEQ ID NO: 12: ADAR3 target sequence, region A, -1165 to -300 (inverted 5'-3')

change

[0063] SEQ ID NO: 13: ADAR3 target sequence, region B, -2937 to -1288 (inverted 5'-3')

change

[0064] SEQ ID NO: 14: Exemplary ADAR1p110 aRNA antisense sequence

change

[0065] SEQ ID NO: 15: Exemplary ADAR1p110 aRNA antisense sequence

change

[0066] SEQ ID NO: 16: Exemplary ADAR1p110 aRNA antisense sequence

change

[0067] SEQ ID NO: 17: Exemplary ADAR1p110 aRNA antisense sequence

change

[0068] SEQ ID NO: 18: Exemplary ADAR1p110 aRNA antisense sequence

change

[0069] SEQ ID NO: 19: Exemplary ADAR1p110 aRNA antisense sequence

change

[0070] SEQ ID NO: 20: Exemplary ADAR1p110 aRNA antisense sequence

change

[0071] SEQ ID NO: 21: Exemplary ADAR1p110 aRNA antisense sequence

change

[0072] SEQ ID NO: 22: Exemplary ADAR1p110 aRNA antisense sequence

change

[0073] SEQ ID NO: 23: Exemplary ADAR1p110 aRNA antisense sequence

change

[0074] SEQ ID NO: 24: Exemplary ADAR1p110 aRNA antisense sequence

change

[0075] SEQ ID NO: 25: Exemplary ADAR1p110 aRNA antisense sequence

change

[0076] SEQ ID NO: 26: Exemplary ADAR1p110 aRNA antisense sequence

change

[0077] SEQ ID NO: 27: Exemplary ADAR1p110 aRNA antisense sequence

change

[0078] SEQ ID NO: 28: Exemplary ADAR1p110 aRNA antisense sequence

change

[0079] SEQ ID NO: 29: Exemplary ADAR1p110 aRNA antisense sequence

change

[0080] SEQ ID NO: 30: Exemplary ADAR1p110 aRNA antisense sequence

change

[0081] SEQ ID NO: 31: Exemplary ADAR1p110 aRNA antisense sequence

change

[0082] SEQ ID NO: 32: Exemplary ADAR1p110 aRNA antisense sequence

change

[0083] SEQ ID NO: 33: Exemplary ADAR1p110 aRNA antisense sequence

change

[0084] SEQ ID NO: 34: Exemplary ADAR1p110 aRNA antisense sequence

change

[0085] SEQ ID NO: 35: Exemplary ADAR1p110 aRNA antisense sequence

change

[0086] SEQ ID NO: 36: Exemplary ADAR1p110 aRNA antisense sequence

change

[0087] SEQ ID NO: 37: Exemplary ADAR1p150 aRNA antisense sequence

change

[0088] SEQ ID NO: 38: Exemplary ADAR1p150 aRNA antisense sequence

change

[0089] SEQ ID NO: 39: Exemplary ADAR1p150 aRNA antisense sequence

change

[0090] SEQ ID NO: 40: Exemplary ADAR1p150 aRNA antisense sequence

change

[0091] SEQ ID NO: 41: Exemplary ADAR1p150 aRNA antisense sequence

change

[0092] SEQ ID NO: 42: Exemplary ADAR1p150 aRNA antisense sequence

change

[0093] SEQ ID NO: 43: Exemplary ADAR1p150 aRNA antisense sequence

change

[0094] SEQ ID NO: 44: Exemplary ADAR1p150 aRNA antisense sequence

change

[0095] SEQ ID NO: 45: Exemplary ADAR1p150 aRNA antisense sequence

change

[0096] SEQ ID NO: 46: Exemplary ADAR1p150 aRNA antisense sequence

change

[0097] SEQ ID NO: 47: Exemplary ADAR1p150 aRNA antisense sequence

change

[0098] SEQ ID NO: 48: Exemplary ADAR1p150 aRNA antisense sequence

change

[0099] SEQ ID NO: 49: Exemplary ADAR1p150 aRNA antisense sequence

change

[0100] SEQ ID NO: 50: Exemplary ADAR1p150 aRNA antisense sequence

change

[0101] SEQ ID NO: 51: Exemplary ADAR1p150 aRNA antisense sequence

change

[0102] SEQ ID NO: 52: Exemplary ADAR1p150 aRNA antisense sequence

change

[0103] SEQ ID NO: 53: Exemplary ADAR1p150 aRNA antisense sequence

change

[0104] SEQ ID NO: 54: Exemplary ADAR1p150 aRNA antisense sequence

change

[0105] SEQ ID NO: 55: Exemplary ADAR1p150 aRNA antisense sequence

change

[0106] SEQ ID NO: 56: Exemplary ADAR1p150 aRNA antisense sequence

change

[0107] SEQ ID NO: 57: Exemplary ADAR1p150 aRNA antisense sequence

change

[0108] SEQ ID NO: 58: Exemplary ADAR1p150 aRNA antisense sequence

change

[0109] SEQ ID NO: 59: Exemplary ADAR1p150 aRNA antisense sequence

change

[0110] SEQ ID NO: 60: Exemplary ADAR1p150 aRNA antisense sequence

change

[0111] SEQ ID NO: 61: Exemplary ADAR1p150 aRNA antisense sequence

change

[0112] SEQ ID NO: 62: Exemplary ADAR1p150 aRNA antisense sequence

change

[0113] SEQ ID NO: 63: Exemplary ADAR1p150 aRNA antisense sequence

change

[0114] SEQ ID NO: 64: Exemplary ADAR1p150 aRNA antisense sequence

change

[0115] SEQ ID NO: 65: Exemplary ADAR1p150 aRNA sense sequence

change

[0116] SEQ ID NO: 66: Exemplary ADAR1p150 aRNA antisense sequence

change

[0117] SEQ ID NO: 67: Exemplary ADAR1p150 aRNA sense sequence

change

[0118] SEQ ID NO: 68: Exemplary ADAR1p150 aRNA antisense sequence

change

[0119] SEQ ID NO: 69: Exemplary ADAR1p150 aRNA sense sequence

change

[0120] SEQ ID NO: 70: Exemplary ADAR1p150 aRNA antisense sequence

change

[0121] SEQ ID NO: 71: Exemplary ADAR1p150 aRNA sense sequence

change

[0122] SEQ ID NO: 72: Exemplary ADAR1p150 aRNA antisense sequence

change

[0123] SEQ ID NO: 73: Exemplary ADAR1p150 aRNA sense sequence

change

[0124] SEQ ID NO: 74: Exemplary ADAR1p150 aRNA antisense sequence

change

[0125] SEQ ID NO: 75: Exemplary ADAR1p150 aRNA sense sequence

change

[0126] SEQ ID NO: 76: Exemplary ADAR1p150 aRNA antisense sequence

change

[0127] SEQ ID NO: 77: Exemplary ADAR1p150 aRNA sense sequence

change

[0128] SEQ ID NO: 78: Exemplary ADAR1p150 aRNA antisense sequence

change

[0129] SEQ ID NO: 79: Exemplary ADAR1p150 aRNA sense sequence

change

[0130] SEQ ID NO: 80: Exemplary ADAR1p150 aRNA sense sequence

change

[0131] SEQ ID NO: 81: Exemplary ADAR1p150 aRNA antisense sequence

change

[0132] SEQ ID NO: 82: Exemplary ADAR1p150 aRNA sense sequence

change

[0133] SEQ ID NO: 83: Exemplary ADAR1p150 aRNA antisense sequence

change

[0134] SEQ ID NO: 84: Exemplary ADAR1p150 aRNA sense sequence

change

[0135] SEQ ID NO: 85: Exemplary ADAR1p150 aRNA antisense sequence

change

[0136] SEQ ID NO: 86: Exemplary ADAR1p150 aRNA sense sequence

change

[0137] SEQ ID NO: 87: Exemplary ADAR1p150 aRNA antisense sequence

change

[0138] SEQ ID NO: 88: Exemplary ADAR1p150 aRNA sense sequence

change

[0139] SEQ ID NO: 89: Exemplary ADAR1p150 aRNA antisense sequence

change

[0140] SEQ ID NO: 90: Exemplary ADAR1p150 aRNA sense sequence

change

[0141] SEQ ID NO: 91: Exemplary ADAR1p150 aRNA antisense sequence

change

[0142] SEQ ID NO: 92: Exemplary ADAR1p150 aRNA sense sequence

change

[0143] SEQ ID NO: 93: Exemplary ADAR1p150 aRNA antisense sequence

change

[0144] SEQ ID NO: 94: Exemplary ADAR1p150 aRNA sense sequence

change

[0145] SEQ ID NO: 95: Exemplary ADAR1p150 aRNA antisense sequence

change

[0146] SEQ ID NO: 96: Exemplary ADAR1p150 aRNA sense sequence

change

[0147] SEQ ID NO: 97: Exemplary ADAR1p150 aRNA antisense sequence

change

[0148] SEQ ID NO: 98: Exemplary ADAR1p150 aRNA sense sequence

change

[0149] SEQ ID NO: 99: Exemplary ADAR1p150 aRNA antisense sequence

change

[0150] SEQ ID NO: 100: Exemplary ADAR1p110 aRNA antisense sequence

change

[0151] SEQ ID NO: 101: Exemplary ADAR1p110 aRNA antisense sequence

change

[0152] SEQ ID NO: 102: Exemplary ADAR1p110 aRNA antisense sequence

change

[0153] SEQ ID NO: 103: Exemplary ADAR1p110 aRNA antisense sequence

change

[0154] SEQ ID NO: 104: Exemplary ADAR1p110 aRNA antisense sequence

change

[0155] SEQ ID NO: 105: Exemplary ADAR1p110 aRNA antisense sequence

change

[0156] SEQ ID NO: 106: Exemplary ADAR1p110 aRNA antisense sequence

change

[0157] SEQ ID NO: 107: Exemplary ADAR1p110 aRNA antisense sequence

change

[0158] SEQ ID NO: 108: Exemplary ADAR1p150 aRNA antisense sequence

change

[0159] SEQ ID NO: 109: Exemplary ADAR1p150 aRNA antisense sequence

change

[0160] SEQ ID NO: 110: Exemplary ADAR1p150 aRNA antisense sequence

change

[0161] SEQ ID NO: 111: Exemplary ADAR1p150 aRNA antisense sequence

change

[0162] SEQ ID NO: 112: Exemplary ADAR1p150 aRNA antisense sequence

change

[0163] SEQ ID NO: 113: Exemplary ADAR1p150 aRNA antisense sequence

change

[0164] SEQ ID NO: 114: Exemplary ADAR2 aRNA antisense sequence

change

[0165] SEQ ID NO: 115: Exemplary ADAR2 aRNA antisense sequence

change

[0166] SEQ ID NO: 116: Exemplary ADAR2 aRNA antisense sequence

change

[0167] SEQ ID NO: 117: Exemplary ADAR2 aRNA antisense sequence

change

[0168] SEQ ID NO: 118: Exemplary ADAR2 aRNA antisense sequence

change

[0169] SEQ ID NO: 119: Exemplary ADAR2 aRNA antisense sequence

change

[0170] SEQ ID NO: 120: Exemplary ADAR2 aRNA antisense sequence

change

[0171] SEQ ID NO: 121: Exemplary ADAR2 aRNA antisense sequence

change

[0172] SEQ ID NO: 122: Exemplary ADAR2 aRNA antisense sequence

change

[0173] SEQ ID NO: 123: Exemplary ADAR2 aRNA antisense sequence

change

[0174] SEQ ID NO: 124: Exemplary ADAR2 aRNA antisense sequence

change

[0175] SEQ ID NO: 125: Exemplary ADAR2 aRNA antisense sequence

change

[0176] SEQ ID NO: 126: Exemplary ADAR2 aRNA antisense sequence

change

[0177] SEQ ID NO: 127: Exemplary ADAR2 aRNA antisense sequence

change

[0178] SEQ ID NO: 128: Exemplary ADAR2 aRNA antisense sequence

change

[0179] SEQ ID NO: 129: Exemplary ADAR2 aRNA antisense sequence

change

[0180] SEQ ID NO: 130: Exemplary ADAR2 aRNA antisense sequence

change

[0181] SEQ ID NO: 131: Exemplary ADAR2 aRNA antisense sequence

change

[0182] SEQ ID NO: 132: Exemplary ADAR2 aRNA antisense sequence

change

[0183] SEQ ID NO: 133: Exemplary ADAR2 aRNA antisense sequence

change

[0184] SEQ ID NO: 134: Exemplary ADAR1p150 aRNA sense sequence

change

[0185] SEQ ID NO: 135: Non-targeting (e.g., scrambled) sense sequence

change

[0186] SEQ ID NO: 136: Non-targeting (e.g., scrambled) antisense sequence

change

Claims

1. an adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on an RNA enzyme and upregulates the expression of ADAR; the ADAR aRNA comprises an antisense oligonucleotide sequence, the antisense oligonucleotide sequence being 21 to 22 nucleotides, and the antisense oligonucleotide sequence being complementary to 21 to 22 nucleotides in a target sequence within SEQ ID NO: 1, 2, or 3 for ADAR1 p110; the antisense oligonucleotide sequence comprises at least one of SEQ ID NOs: 14-36 and 100-107; Adenosine deaminase (ADAR)-activating RNA (aRNA) acts on RNA enzymes.

2. The ADAR aRNA described in claim 1, wherein the ADAR aRNA further comprises a sense oligonucleotide sequence.

3. at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises at least one modified nucleotide; 3. The ADAR aRNA of claim 2, wherein the at least one modified nucleotide comprises a nucleotide modification from at least one of a thio-modified nucleotide, an amino-modified nucleotide, a phosphate-modified nucleotide, a cholesterol-triethylene glycol (TEG)-modified nucleotide, a methyl-modified nucleotide, and a fluoro-modified nucleotide.

4. 4. The ADAR aRNA of claim 2 or 3, wherein the antisense oligonucleotide sequence and the sense oligonucleotide sequence are each 21 nucleotides, or the antisense oligonucleotide sequence and the sense oligonucleotide sequence are each 22 nucleotides.

5. The ADAR aRNA of any one of claims 2 to 4, wherein at least one of the antisense oligonucleotide sequence and the sense oligonucleotide sequence comprises a 3' overhang.

6. The ADAR aRNA of any one of claims 1 to 5, wherein the aRNA is linked to a therapeutic RNA.

7. 7. The ADAR aRNA of claim 6, wherein the therapeutic RNA comprises one of an mRNA, a miRNA, a sgRNA, aRNA, an iRNA, or an ASO.

8. The ADAR aRNA of any one of claims 1 to 7, wherein the aRNA is linked to a delivery vehicle.

9. 9. The ADAR aRNA of claim 8, wherein the delivery vehicle comprises one of an antibody, or fragment thereof, an scFv, a peptide, GalNAc, an aptamer, or a nanoparticle.

10. the aRNA is fully or partially encapsulated within a delivery vehicle; 9. The ADAR aRNA of claim 8, wherein the delivery vehicle comprises one of a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle.

11. A pharmaceutical agent for increasing expression of adenosine deaminase (ADAR) acting on RNA enzymes, comprising the ADAR aRNA of any one of claims 1 to 10.

12. ADAR expression is increased, The pharmaceutical agent of claim 11, wherein ADAR expression is increased by at least 20%, at least 30%, at least 40%, or at least 50%.

13. Use of an adenosine deaminase (ADAR) aRNA according to any one of claims 1 to 10 in the manufacture of a medicament for increasing ADAR.

Citation Information

Patent Citations

  • saRNA composition and method of use

    JP2018512876A