Modulators of PNPLA3 expression

Abstract

The present embodiments provide methods, compounds, and compositions useful for inhibiting PNPLA3 expression, which may be useful for treating, preventing, or ameliorating diseases associated with PNPLA3. In some embodiments, the methods, compounds, and compositions are useful for treating, preventing, or ameliorating diseases associated with PNPLA3 having the I148M mutation.

Description

[Technical Field]

[0001] Sequence Listing This application is filed with an electronic Sequence Listing, which is provided as a 480 kb file named BIOL0317USLSEQ_ST25.txt, created on September 13, 2018. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] The present embodiments provide methods, compounds, and compositions that are useful for inhibiting PNPLA3 (patatin-like phospholipase domain-containing 3; hypothetical protein dJ796I17.1; adiponutrin; DJ796I17.1) expression and, in certain cases, for reducing the amount of PNPLA3 protein in cells or animals, which may be useful for treating, preventing, or ameliorating diseases associated with PNPLA3. In some embodiments, the methods, compounds, and compositions are useful for treating, preventing, or ameliorating diseases associated with PNPLA3 having the I148M mutation. [Background technology]

[0003] Nonalcoholic fatty liver disease (NAFLD) encompasses a variety of liver diseases ranging from steatosis to nonalcoholic steatohepatitis (NASH) and cirrhosis. NAFLD is defined as the accumulation of more than 5% fat by weight in the liver in the absence of significant alcohol intake, steatogenic medication, or genetic disease (Non-Patent Document 1).

[0004] Nonalcoholic steatohepatitis (NASH) is an aggressive subtype of NAFLD characterized by signs of inflammation and liver damage. NASH is histologically defined by macrovesicular steatosis, ballooning of hepatocytes, and lobular inflammatory infiltrates (Non-Patent Document 2). NASH is estimated to affect 2-3% of the general population. In the presence of other conditions such as obesity or diabetes, the estimated prevalence increases to 7% and 62%, respectively (Non-Patent Document 3).

[0005] PNPLA3 is a 481-amino acid member of the patatin-like phospholipase domain-containing family expressed in the ER and lipid droplets. PNPLA3 is highly expressed in the liver in humans, but its expression in adipose tissue is five-fold lower (Non-Patent Document 4). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Kotronen et al,Arterioscler Thromb.Vasc.Biol.2008,28;27-38 [Non-patent document 2] Sanyal,Hepatol.Res.2011.41;670-4 [Non-patent document 3] Hashimoto et al,J.Gastroenterol.2011.46(1);63-69 [Non-patent document 4] Huang et al,Proc.Natl.Acad.Sci.USA 2010.107;7892-7 Summary of the Invention [Means for solving the problem]

[0007] Certain embodiments provided herein are compounds and methods for reducing the amount or activity of PNPLA3 mRNA in a cell or animal, and in certain embodiments, for reducing the amount of PNPLA3 protein. In certain embodiments, the animal is suffering from liver disease. In certain embodiments, the disease is NASH. In certain embodiments, the disease is NAFLD. In certain embodiments, the disease is fatty liver. In certain embodiments, the disease is cirrhosis. In certain embodiments, the disease is hepatocellular carcinoma. In certain embodiments, the disease is alcoholic liver disease. In certain embodiments, the disease is alcoholic steatohepatitis (ASH). In certain embodiments, the disease is HCV hepatitis. In certain embodiments, the disease is chronic hepatitis. In certain embodiments, the disease is hereditary hemochromatosis. In certain embodiments, the disease is primary sclerosing cholangitis. Certain compounds provided herein relate to compounds and compositions that reduce liver injury, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in animals.

[0008] Certain embodiments provided herein relate to potent and tolerable compounds and compositions useful for inhibiting PNPLA3 expression, which may be useful for treating, preventing, ameliorating, or slowing the progression of liver disease. Certain embodiments provided herein relate to compounds and compositions that are more potent or have greater therapeutic value than publicly available compounds.

[0009] In some embodiments, the present disclosure provides a method of treating an individual suffering from or at risk of suffering from liver disease, the method comprising administering to the individual having an I148M mutation in patatin-like phospholipase domain-containing protein 3 (PNPLA3) a compound that targets PNPLA3.

[0010] In some embodiments, the present disclosure provides a method for reducing one or more of liver injury, hepatic steatosis, hepatitis, liver fibrosis, and hepatic fat synthesis in an individual, the method comprising administering a compound that targets patatin-like phospholipase domain-containing protein 3 (PNPLA3) to an individual having an I148M mutation in PNPLA3.

[0011] In some embodiments, the present disclosure provides a method for reducing protein levels of one or more of haptoglobin, MCP1, and TIMP2 in an individual, the method comprising administering to the individual having an I148M mutation in patatin-like phospholipase domain-containing protein 3 (PNPLA3) a compound that targets PNPLA3.

[0012] In some embodiments, the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the disease is fatty liver.

[0013] In some embodiments, the method reduces or prevents hepatitis or liver fibrosis. In some embodiments, reducing or preventing hepatitis includes reducing liver macrophage levels. In some embodiments, the liver macrophage levels are reduced by at least 20% compared to an individual who is not administered a compound targeting PNPLA3, as measured by immunohistochemical staining of liver sections from the individual.

[0014] In some embodiments, the protein level of haptoglobin is reduced by at least 20% when measured by colorimetric assay of the individual's serum or plasma compared to an individual who has not been administered a compound targeting PNPLA3. In some embodiments, the protein level of MCP1 is reduced by at least 20% when measured by immunoblotting of the individual's liver sample compared to an individual who has not been administered a compound targeting PNPLA3. In some embodiments, the protein level of TIMP2 is reduced by at least 20% when measured by immunoblotting of the individual's liver sample compared to an individual who has not been administered a compound targeting PNPLA3.

[0015] In some embodiments, the individual has a homozygous I148M mutation in PNPLA3. In some embodiments, the individual is a human individual.

[0016] In some embodiments, in individuals with I148M mutation, the compound that targets PNPLA3 is an antisense compound that targets PNPLA3.In some embodiments, the antisense compound that targets PNPLA3 is small interfering RNA (siRNA).In some embodiments, the antisense compound that targets PNPLA3 is antisense oligonucleotide (ASO).

[0017] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide 8 to 80 linked nucleosides in length, having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17 to 2169. In some embodiments, a compound targeting PNPLA3 comprises a modified oligonucleotide 8 to 80 nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In some embodiments, a compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 17 to 2169.

[0018] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobases that are 100% complementary to an equal length portion of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO:2, and wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a complementary nucleobase sequence within nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO:2, and the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2.

[0019] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide comprises at least 8 consecutive nucleobase portions complementary to equal length portions of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of a PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2, and wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide comprises a 16 nucleobase portion complementary to an equal length portion of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO:2.

[0020] In some embodiments, a compound targeting PNPLA3 in an individual having an I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, a compound targeting PNPLA3 in an individual having an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.

[0021] In some embodiments, modified oligonucleotides have a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2 over the entire length of the nucleobase sequence.

[0022] In some embodiments, the modified nucleotide comprises at least one modification selected from at least one modified internucleoside linkage, at least one modified sugar, and at least one modified nucleobase. In some embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0023] In some embodiments, the modified sugar is a bicyclic sugar. In some embodiments, the bicyclic sugar is selected from the group consisting of 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)-O-2' (cEt). In some embodiments, the modified sugar is 2'-O-methoxyethyl. In some embodiments, the modified nucleobase is 5-methylcytosine.

[0024] In some embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides, a 5' wing segment consisting of linked nucleosides, and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment comprises a modified sugar.

[0025] In some embodiments, the compound targeting PNPLA3 in an individual with an I148M mutation is single-stranded. In some embodiments, the compound targeting PNPLA3 is double-stranded. In some embodiments, the compound targeting PNPLA3 in an individual with an I148M mutation comprises ribonucleotides. In some embodiments, the compound targeting PNPLA3 in an individual with an I148M mutation comprises deoxyribonucleotides.

[0026] In some embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 15 to 30 linked nucleosides.

[0027] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide 16 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides, a 5' wing segment consisting of linked nucleosides, and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0028] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide 16 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises a gap segment of 10 linked deoxynucleosides, a 5' wing segment of 3 linked nucleosides, and a 3' wing segment of 3 linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein the 5' wing segment and the 3' wing segment comprise a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0029] In some embodiments, compounds targeting PNPLA3 in individuals with the I148M mutation comprise a conjugate moiety and a conjugate linker. In some embodiments, the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0030] In some embodiments, the conjugate linker consists of a single bond. In some embodiments, the conjugate linker is cleavable. In some embodiments, the conjugate linker comprises 1 to 3 linker nucleosides. In some embodiments, the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. In some embodiments, the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0031] In some embodiments, in individuals with an I148M mutation, the compound targeting PNPLA3 has the following formula or a salt thereof: [ka] Includes.

[0032] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is 16 linked nucleosides in length and consists of the sequence of SEQ ID NO: 1089, wherein the modified oligonucleotide comprises a gap segment of 10 linked deoxynucleosides, a 5' wing segment of 3 linked nucleosides, and a 3' wing segment of 3 linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside in each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine, and the conjugate group is located at the 5' end of the modified oligonucleotide; [ka] is.

[0033] In some embodiments, in individuals with an I148M mutation, the compound targeting PNPLA3 has the following formula or a salt thereof: [ka] It has.

[0034] In some embodiments, the compound that targets PNPLA3 in an individual with I148M mutation is a modified oligonucleotide in the form of a pharmaceutically acceptable salt.In some embodiments, the pharmaceutically acceptable salt is a sodium salt.In some embodiments, the pharmaceutically acceptable salt is a potassium salt.

[0035] In some embodiments, the compound that targets PNPLA3 in an individual with I148M mutation is administered to the individual as a composition comprising a compound that targets PNPLA3 and a pharmaceutically acceptable carrier. In some embodiments, the compound that targets PNPLA3 in an individual with I148M mutation is administered to the individual parenterally.

[0036] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. 2173 ~ 2175 and modified oligonucleotides having a nucleobase sequence at least 90% identical to any one of:

[0037] In some embodiments, a compound targeting PNPLA3 in an individual having an I148M mutation consists of the sequence of SEQ ID NO: 115, wherein the modified oligonucleotide comprises a gap segment of 10 linked deoxynucleosides, a 5' wing segment of 3 linked nucleosides, and a 3' wing segment of 3 linked nucleosides, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside in each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In some embodiments, a compound targeting PNPLA3 in an individual having an I148M mutation further comprises a conjugate group, wherein the conjugate group is located at the 5' end of the modified oligonucleotide, [ka] is. [Brief explanation of the drawings]

[0038] [Figure 1A]Figures 1A-1F relate to Example 11. The results in Figures 1A-1C relate to human HepG2 cells subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. PNPLA3 mRNA levels are shown. [Figure 1B] Figures 1A-1F relate to Example 11. The results in Figures 1A-1C relate to human HepG2 cells subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Oil Red O (ORO) staining area is shown. [Figure 1C] Figures 1A-1F relate to Example 11. The results in Figures 1A-1C relate to human HepG2 cells subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Images of ORO staining are shown. [Figure 1D] Figures 1A-1F relate to Example 11. The results in Figures 1D-1F relate to human HepG2 cells subjected to either control siRNA or PNPLA3 siRNA described in the embodiments herein. PNPLA3 mRNA levels are shown. [Figure 1E] Figures 1A-1F relate to Example 11. The results in Figures 1D-1F relate to human HepG2 cells subjected to either control siRNA or PNPLA3 siRNA described in the embodiments herein. Oil Red O (ORO) staining areas are shown. [Figure 1F] Figures 1A-1F relate to Example 11. The results in Figures 1D-1F relate to human HepG2 cells subjected to either control siRNA or PNPLA3 siRNA described in the embodiments herein. Images of ORO staining are shown. [Figure 2A] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type mice and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Weight gain before and after treatment with the ASO is shown. [Figure 2B]Figures 2A-2J relate to Example 13. The results in Figures 2A-2J are for wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Caloric intake before and after treatment with the ASO is shown. [Figure 2C] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J are for wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Hepatic Pnpla3 mRNA levels measured by qPCR and normalized to ribosomal protein large PO (RplpO) are shown. [Figure 2D] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Pnpla3 protein levels in liver lipid droplets, as measured by Western blot, are shown. [Figure 2E] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J are for wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Representative images of ORO-stained liver sections 8 weeks after treatment with ASO are shown (black scale bar represents 100 μm). [Figure 2F] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Six weeks after treatment with the ASO, liver lipid levels were assessed by MRI in PNPLA3 I148M mutant and wild-type mice, respectively. [Figure 2G]Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Liver and plasma triglyceride levels of PNPLA3 I148M mutant and wild-type mice, respectively, measured by biochemical assay are shown. [Figure 2H] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J are for wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Representative images of ORO-stained liver sections 8 weeks after treatment with ASO are shown (black scale bar represents 100 μm). [Figure 2I] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Six weeks after treatment with the ASO, liver lipid levels were assessed by MRI in PNPLA3 I148M mutant and wild-type mice, respectively. [Figure 2J] Figures 2A-2J relate to Example 13. The results in Figures 2A-2J relate to wild-type and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Liver and plasma triglyceride levels of PNPLA3 I148M mutant and wild-type mice, respectively, measured by biochemical assay are shown. [Figure 3A] Figures 3A-3F relate to Example 14. The results in Figures 3A-3F are for wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Body weights measured throughout the experiment are shown. [Figure 3B]Figures 3A-3F relate to Example 14. The results in Figures 3A-3F relate to wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Caloric intake measured before and after treatment with the ASO is shown. [Figure 3C] Figures 3A-3F relate to Example 14. The results in Figures 3A-3F are for wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Hepatic Pnpla3 mRNA levels measured by qPCR and normalized to ribosomal protein large PO (RplpO) are shown. [Figure 3D] Figures 3A-3F relate to Example 14. The results in Figures 3A-3F relate to wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Pnpla3 protein levels in liver lipid droplets, as measured by Western blot, are shown. [Figures 3E-3F] Figures 3A-3F relate to Example 14. The results in Figures 3A-3F relate to wild-type mice and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Plasma ALT, AST, and triglyceride levels, as well as triglyceride content, are shown for PNPLA3 I148M mutant mice and wild-type mice, respectively. [Figure 4A-4B] Figures 4A-4B relate to Example 14. The results in Figures 4A-4B relate to wild-type mice and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. The fatty liver score, lobular inflammation score, NAFLD activity score (NAS), and fibrosis stage of the PNPLA3 I148M mutant mice and wild-type mice are shown, respectively. [Figure 5A]Figures 5A-5E relate to Example 15. The results in Figures 5A-5E relate to wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Representative images of liver sections stained with Oil Red O are shown (black scale bar represents 100 μm). [Figure 5B-5C] Figures 5A-5E relate to Example 15. The results in Figures 5A-5E relate to wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Hepatic Acc1 and Scd1 mRNA expression levels are shown in PNPLA3 I148M mutant and wild-type mice, respectively. [Figure 5D-5E] Figures 5A-5E relate to Example 15. The results in Figures 5A-5E relate to wild-type and PNPLA3 I148M mutant knock-in mice treated with either a control ASO or a PNPLA3 ASO described in the embodiments herein. The fatty acid composition of liver lipid droplets from PNPLA3 I148M mutant and wild-type mice is shown, respectively. [Figure 6] Figure 6 relates to Example 15. The results in Figure 6 are for wild-type mice and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. The fatty acid composition of additional liver lipid droplets from PNPLA3 I148M mutant mice and wild-type mice is shown, including monounsaturated fatty acids (MUFA), polyunsaturated fatty acids (PUFA), and saturated fatty acids (SFA). [Figures 7A-7B] Figures 7A-7H relate to Example 16. The results in Figures 7A-7H relate to wild-type and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Plasma haptoglobin levels and liver macrophage content (measured by Mac2 staining) are shown for PNPLA3 I148M mutant and wild-type mice, respectively. [Figure 7C]Figures 7A-7H relate to Example 16. The results in Figures 7A-7H are for wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Representative images of liver sections stained with Mac2 are shown (black scale bar represents 100 μm). [Figures 7D-7H] Figures 7A-7H relate to Example 16. The results in Figures 7A-7H relate to wild-type and PNPLA3 I148M mutant knock-in mice treated with either a control ASO or a PNPLA3 ASO described in the embodiments herein. Liver protein levels of McP1 (Figure 7D), Il1β (Figure 7E), Il6 (Figure 7F), Tnfα (Figure 7G), and αSma (Figure 7H) are shown for PNPLA3 I148M mutant and wild-type mice. [Figure 8A-8B] Figures 8A-8E relate to Example 16. The results in Figures 8A-8E are for wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Liver Col1a1 mRNA and protein (immunohistochemistry) levels are shown in PNPLA3 I148M mutant and wild-type mice, respectively. [Figure 8C] Figures 8A-8E relate to Example 16. The results in Figures 8A-8E relate to wild-type mice and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Representative images of immunohistochemistry of collagen in liver sections are shown (black scale bar represents 100 μm). [Figure 8D-8E] Figures 8A-8E relate to Example 16. The results in Figures 8A-8E relate to wild-type mice and PNPLA3 I148M mutant knock-in mice that were subjected to either a control ASO or a PNPLA3 ASO described in embodiments herein. Hydroxyproline levels in the livers of PNPLA3 I148M mutant mice and wild-type mice, respectively, are shown. [Figures 9A-9D]Figures 9A-9D relate to Example 16. The results in Figures 9A-9D relate to wild-type and PNPLA3 I148M mutant knock-in mice subjected to either a control ASO or a PNPLA3 ASO described in the embodiments herein. Liver proteins of Timp2 (Figure 9A), Mmp2 (Figure 9B), Timp1 (Figure 9C), and Tgfβr2 (Figure 9D) measured by Western blot analysis in PNPLA3 I148M mutant and wild-type mice are shown. DETAILED DESCRIPTION OF THE INVENTION

[0039] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments as claimed. As used herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "comprising" is non-limiting, as are other forms such as "includes" and "included."

[0040] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records, as well as portions of the documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0041] It is understood that the sequence set forth in each SEQ ID NO in the examples provided herein is independent of any modifications to the sugar moiety, internucleoside linkage, or nucleobase. Thus, a compound defined by a SEQ ID NO can independently contain one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase. A compound described by an ION number represents a combination of nucleobase sequence, chemical modification, and motif.

[0042] definition Unless otherwise indicated, the following terms have the following meanings:

[0043] "2'-deoxynucleoside" means a nucleoside containing a 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxynucleosides may contain modified nucleobases or may contain RNA nucleobases (uracil).

[0044] "2'-O-Methoxyethyl" (also referred to as 2'-MOE) refers to 2'-O(CH2)2-OCH3 in place of the 2'-OH group of the ribosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0045] "2'-MOE nucleoside" (also referred to as 2'-O-methoxyethyl nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0046] "2'-substituted nucleoside" or "2-modified nucleoside" means a nucleoside that includes a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to a sugar moiety means a sugar moiety that includes at least one 2'-substituent other than H or OH.

[0047] "3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3'-most nucleotide of a particular compound.

[0048] "5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5'-most nucleotide of a particular compound.

[0049] "5-methylcytosine" means a cytosine with a methyl group attached to the 5 position.

[0050] "About" means within ±10% of a value. For example, if it is stated that "a compound had about a 70% effect on inhibiting PNPLA3," it means that PNPLA3 levels were inhibited within a range of 60% to 80%.

[0051] "Administration" or "administering" refers to the route of introducing a compound or composition provided herein into an individual to perform its intended function. One example of an administration route that can be used includes, but is not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0052] "Concurrent administration" or "co-administration" means administering two or more compounds in any manner that produces the pharmacological effects of both in a patient. Concurrent administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not be simultaneous. The effects need only overlap for a period of time, not necessarily over the same period of time. Concurrent administration or co-administration includes parallel or sequential administration.

[0053] "Amelioration" refers to an improvement or alleviation of at least one indicator, symptom, or symptom of the associated disease, disorder, or condition. In certain embodiments, amelioration includes delaying or slowing the progression or severity of one or more indicators of the condition or disease. The progression or severity of an indicator may be determined by objective or subjective measures known to those of skill in the art.

[0054] "Animal" refers to a human or non-human animal, including, but not limited to, a mouse, rat, rabbit, dog, cat, pig, and a non-human primate, including, but not limited to, a monkey and chimpanzee.

[0055] "Antisense activity" means any detectable and / or measurable activity resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid, or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level for the target in the absence of the antisense compound.

[0056] "Antisense compound" refers to a compound comprising an oligonucleotide and, optionally, one or more additional mechanisms, such as a conjugate group or a terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0057] "Antisense inhibition" refers to a reduction in the level of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid compared to the level of the target nucleic acid in the absence of the antisense compound.

[0058] An "antisense mechanism" is any mechanism involving hybridization of a compound with a target nucleic acid, the result or effect of which is either target degradation or target occupancy, with the concomitant stalling of, for example, the cellular machinery involved in transcription or splicing.

[0059] "Antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid, or a region or segment thereof. In certain embodiments, an antisense oligonucleotide is capable of specifically hybridizing to a target nucleic acid, or a region or segment thereof.

[0060] "Bicyclic nucleoside" or "BNA" refers to a nucleoside containing a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety consisting of two rings, with the second ring formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.

[0061] "Branched group" means a group of atoms having at least three positions capable of forming covalent bonds to at least three groups. In certain embodiments, the branched group provides multiple reactive sites for linking tethered ligands to oligonucleotides via conjugate linkers and / or cleavable moieties.

[0062] "Cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a specific cell type.

[0063] "cEt" or "constrained ethyl" means a ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon, the bridge having the formula: 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0064] "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0065] "Chemical modification" in a compound describes the substitution or change by chemical reaction of any such unit compared to the original state of that unit in the compound. "Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or a modified nucleobase. "Modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0066] A "chemically distinct region" refers to a region of a compound that is chemically different in some way from another region of the same compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically different from a region having nucleotides without the 2'-O-methoxyethyl modification.

[0067] "Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions, each position having multiple subunits.

[0068] "Cleavable bond" means any chemical bond that can be split. In certain embodiments, the cleavable bond is selected from an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a disulfide, or a peptide.

[0069] "Cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0070] "Complementary" with respect to an oligonucleotide means that the nucleobase sequence of such oligonucleotide, or one or more regions thereof, matches the nucleobase sequence of another oligonucleotide or nucleic acid, or one or more regions thereof, when the two nucleobase sequences are aligned in opposite directions. Nucleobase matches, i.e., complementary nucleobases, as described herein, unless otherwise specified, include the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( m The term "fully complementary" or "100% complementary" refers to an oligonucleotide in which the nucleobases match at every nucleoside, without any nucleobase mismatches.

[0071] "Conjugate group" means a group of atoms attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0072] "Conjugate linker" means a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0073] "Conjugate moiety" means a group of atoms attached to an oligonucleotide via a conjugate linker.

[0074] "Contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.

[0075] "Designing" or "designed to" refers to the process of designing a compound that will specifically hybridize with a selected nucleic acid molecule.

[0076] "Diluent" means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in an injectable composition can be a liquid, such as a saline solution.

[0077] "Differentially modified" refers to chemical modifications or chemical substituents that differ from one another, including the absence of modification. Thus, for example, an MOE nucleoside and an unmodified DNA nucleoside are "differently modified" even if the DNA nucleoside is unmodified. Similarly, DNA and RNA are "differently modified" even if both are naturally occurring, unmodified nucleosides. Nucleosides that contain identical but different nucleobases are not differentially modified. For example, a nucleoside containing a 2'-OMe-modified sugar and an unmodified adenine nucleobase is not differentially modified compared to a nucleoside containing a 2'-OMe-modified sugar and an unmodified thymine nucleobase.

[0078] "Dose" refers to a specific amount of a compound or pharmaceutical agent provided in a single administration or over a specific period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose may require a volume that is not easily accommodated in a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reactions in individuals. In other embodiments, a compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. A dose may be expressed as the amount of pharmaceutical agent per hour, day, week, or month.

[0079] A "dosage regimen" is a combination of doses designed to achieve one or more desired effects.

[0080] "Double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, wherein one of the two oligomeric compounds comprises an oligonucleotide.

[0081] "Effective amount" means an amount of a compound sufficient to achieve a desired physiological result in an individual in need of the compound. The effective amount may vary from individual to individual, depending on the health and physical condition of the individual receiving treatment, the taxonomic group of the individual receiving treatment, the formulation of the composition, an evaluation of the individual's medical condition, and other relevant factors.

[0082] "Efficacy" means the ability to produce a desired effect.

[0083] "Expression" includes all processes by which a gene's coded information is converted into structures present and operating in a cell, including, but not limited to, the products of transcription and translation.

[0084] "Gapmer" means an oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions. The internal region may be referred to as the "gap," and the external regions may be referred to as the "wings."

[0085] "Hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0086] "Immediately adjacent" means that there are no intervening elements between elements of the same type that are immediately adjacent (e.g., there are no intervening nucleobases between immediately adjacent nucleobases).

[0087] "Individual" means a human or non-human animal selected for treatment or therapy.

[0088] "Inhibiting expression or activity" refers to a reduction or inhibition of expression or activity compared to expression of the activity in an untreated or control sample, and does not necessarily indicate a complete elimination of expression or activity.

[0089] "Internucleoside linkage" means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

[0090] An "extension oligonucleotide" is an oligonucleotide disclosed herein, eg, one that has one or more additional nucleosides relative to a parent oligonucleotide.

[0091] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside bond.

[0092] "Linker nucleoside" means a nucleoside that connects an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of the compound. The linker nucleoside is not considered part of the oligonucleotide portion of the compound, even if it is contiguous to the oligonucleotide.

[0093] " Mismatched " or " non-complementary " refers to the nucleobase of the first oligonucleotide that is not complementary to the corresponding nucleobase of the second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.For example, nucleobases, including but not limited to universal nucleobases, inosine and hypoxanthine, can hybridize with at least one nucleobase, but are still mismatched or non-complementary to the hybridized nucleobase.As another example, when the first and second oligonucleotides are aligned, the nucleobase of the first oligonucleotide that cannot hybridize with the corresponding nucleobase of the second oligonucleotide or target nucleic acid is a mismatched nucleobase or a non-complementary nucleobase.

[0094] "Modulating" refers to changing or adjusting the mechanisms in a cell, tissue, organ, or organism. For example, modulating PNPLA3 RNA can mean increasing or decreasing the level of PNPLA3 RNA and / or PNPLA3 protein in a cell, tissue, organ, or organism. A "modulator" is something that brings about a change in a cell, tissue, organ, or organism. For example, a PNPLA3 compound can be a modulator that reduces the amount of PNPLA3 RNA and / or PNPLA3 protein in a cell, tissue, organ, or organism.

[0095] "MOE" means methoxyethyl.

[0096] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

[0097] "Motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0098] "Natural" or "naturally occurring" means something found in nature.

[0099] "Non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0100] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0101] "Nucleobase" refers to a heterocyclic moiety that can pair with a base of another nucleic acid. As used herein, "naturally occurring nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleobases" are naturally occurring nucleobases that have been chemically modified. "Universal bases" or "universal nucleobases" are nucleobases other than naturally occurring and modified nucleobases, and can pair with any nucleobase.

[0102] "Nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage.

[0103] "Nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. "Modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0104] "Oligomeric compound" means a compound comprising a single oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group.

[0105] "Oligonucleotide" refers to a polymer of linked nucleosides, each of which may be independently modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 80 linked nucleosides. "Modified oligonucleotide" refers to an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. "Unmodified oligonucleotide" refers to an oligonucleotide that does not contain any sugar modifications, nucleobase modifications, or internucleoside modifications.

[0106] "Parent oligonucleotide" means an oligonucleotide whose sequence is used as a basis for designing additional oligonucleotides of similar sequence but differing in length, motif, and / or chemical structure. The newly designed oligonucleotides may have identical or overlapping sequences to the parent oligonucleotide.

[0107] "Parenteral administration" means administration via injection or infusion, and includes subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, or intracranial administration, such as intrathecal or intraventricular administration.

[0108] "Patatin-like phospholipase domain-containing 3," abbreviated as PNPLA3 and also referred to as adiponutrin (ADPN), acylglycerol O-acyltransferase, calcium-independent phospholipase A2 epsilon (iPLA2-epsilon), hypothetical protein dJ796I17.1, or DJ796I17.1, is a 481-amino acid protein encoded by the Pnpla3 gene. PNPLA3 has hydrolase activity against triglycerides and retinyl esters and promotes lipid droplet remodeling in hepatocytes and hepatic stellate cells. As described herein, PNPLA3 is an amino acid member of the patatin-like phospholipase domain-containing family of proteins expressed in the ER and lipid droplets. PNPLA3 is highly expressed in the liver in humans. As used herein, "PNPLA3" can refer to any nucleic acid or protein of PNPLA3. "PNPLA3 nucleic acid" refers to any nucleic acid encoding PNPLA3. For example, in certain embodiments, PNPLA3 nucleic acids include DNA sequences encoding PNPLA3, RNA sequences transcribed from DNA encoding PNPLA3 (including genomic DNA containing introns and exons), and mRNA sequences encoding PNPLA3. "PNPLA3 mRNA" refers to the mRNA encoding the PNPLA3 protein. Targets may be referred to in either uppercase or lowercase.

[0109] "PNPLA3 specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of PNPLA3 RNA and / or PNPLA3 protein at the molecular level. For example, PNPLA3 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, and other agents that can inhibit the expression of PNPLA3 RNA and / or PNPLA3 protein.

[0110] "Pharmaceutically acceptable carrier or diluent" means any substance that is suitable for use in administration to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution such as PBS or water for injection.

[0111] "Pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound, such as an oligomeric compound or an oligonucleotide, i.e., a salt that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects.

[0112] "Pharmaceutical agent" means a chemical compound that provides a therapeutic benefit when administered to an individual.

[0113] "Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can include one or more compounds or salts thereof and a sterile aqueous solution.

[0114] "Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

[0115] "Phosphorus moiety" means a group of atoms that includes a phosphorus atom. In certain embodiments, the phosphorus moiety includes a mono-, di-, or triphosphate, or a phosphorothioate.

[0116] "Portion" refers to a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

[0117] "Prevent" refers to delaying or forestalling the onset, development, or progression of a disease, disorder, or condition for a period ranging from minutes to an indefinite period.

[0118] "Prodrug" refers to a compound in a form outside the body that, when administered to an individual, is metabolized to another form within the body or its cells. In certain embodiments, the metabolized form is the active or more active form of the compound (e.g., a drug). Typically, prodrug conversion within the body is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.

[0119] "Reduce" means to decrease to a smaller degree, size, amount, or number.

[0120] A "RefSeq number" is a unique combination of letters and numbers assigned to a sequence to indicate that the sequence is for a specific target transcript (e.g., target gene). Such sequences and information about the target gene (collectively, the gene record) can be found in gene sequence databases, including the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the Japan DNA Data Bank (the latter three organize the International Nucleotide Sequence Database Collaboration, or INSDC).

[0121] A "region" is defined as a portion of a target nucleic acid that has at least one distinguishable structure, function, or characteristic.

[0122] "RNAi compound" means an antisense compound that acts at least in part through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

[0123] A "segment" is defined as a smaller or subportion of a region within a nucleic acid.

[0124] "Side effects" refer to physiological disorders and / or symptoms resulting from treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and fatigue. For example, increased serum aminotransferase levels may indicate hepatotoxicity or liver function abnormalities. For example, increased bilirubin may indicate hepatotoxicity or liver function abnormalities.

[0125] "Single-stranded" in reference to a compound means that the compound has only one oligonucleotide. "Self-complementary" means that the oligonucleotide is at least partially hybridized to itself. A compound consisting of one oligonucleotide, where the oligonucleotide is self-complementary, is a single-stranded compound. A single-stranded compound can bind to a complementary compound to form a duplex.

[0126] A "site" is defined as a unique nucleobase position within a target nucleic acid.

[0127] "Specifically hybridizable" refers to an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and the target nucleic acid to induce a desired effect, but exhibits minimal or no effect on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

[0128] "Specifically inhibit," with respect to a target nucleic acid, means reducing or inhibiting expression of the target nucleic acid, but having a lesser effect, a minimal effect, or no effect on non-target nucleic acids. Reduction does not necessarily indicate complete elimination of expression of the target nucleic acid.

[0129] "Standard cell assay" means the assay described in the Examples and any reasonable modifications thereof.

[0130] "Standard in vivo experiments" means procedures described in the Examples and reasonable modifications thereof.

[0131] A "stereorandom chiral center," in the context of a population of molecules of the same molecular formula, refers to a chiral center having random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom center may, but need not, be the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random if it arises from a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0132] "Sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" or "unmodified sugar" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) moiety as found in DNA (an "unmodified DNA sugar moiety"). "Modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate. "Modified furanosyl sugar moiety" refers to a furanosyl sugar containing a non-hydrogen substituent in place of at least one hydrogen or hydroxyl group of the unmodified sugar moiety. In certain embodiments, the modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic and non-bicyclic sugars.

[0133] "Sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group within an oligonucleotide, such as an internucleoside linkage, a conjugate group, or a terminal group. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary compounds or nucleic acids.

[0134] "Synergistic" or "synergizing" refers to a combination effect that is greater than the sum of the effects of each component alone at the same dose.

[0135] "Target gene" refers to a gene that encodes a target.

[0136] "Targeting" refers to the specific hybridization of a compound to a target nucleic acid so as to induce a desired effect.

[0137] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid that can be targeted by the compounds described herein.

[0138] "Target region" means a portion of a target nucleic acid to which one or more compounds are targeted.

[0139] "Target segment" means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0140] "Terminal group" means a chemical group or group of atoms covalently attached to the terminus of an oligonucleotide.

[0141] "Therapeutically effective amount" means an amount of a compound, pharmaceutical agent, or composition that confers a therapeutic benefit on an individual.

[0142] "Treating" refers to administering a compound or pharmaceutical composition to an animal to effect an alteration or amelioration of a disease, disorder, or condition in the animal.

[0143] Specific Embodiments Certain embodiments provide methods, compounds and compositions for inhibiting PNPLA3 (PNPLA3) expression.

[0144] Certain embodiments provide compounds targeting PNPLA3 nucleic acids. In certain embodiments, the PNPLA3 nucleic acid has a sequence set forth in RefSeq or GenBank Accession Nos. NM_025225.2 (incorporated by reference and disclosed herein as SEQ ID NO: 1); NC_000022.11 truncated from nucleotides 43921001 to 43954500 (incorporated by reference and disclosed herein as SEQ ID NO: 2); AK123806.1 (incorporated by reference and disclosed herein as SEQ ID NO: 3); BQ686328.1 (incorporated by reference and disclosed herein as SEQ ID NO: 4); BF762711.1 (incorporated by reference and disclosed herein as SEQ ID NO: 5); DA290491.1 (incorporated by reference and disclosed herein as SEQ ID NO: 6); and the sequences listed as SEQ ID NOs: 7, 8, 9, and 10. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0145] In certain embodiments, the compound comprises a modified oligonucleotide 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or an oligomeric compound.

[0146] Certain embodiments provide a compound comprising a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOS: 17 to 2169. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0147] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0148] Certain embodiments provide a compound comprising a modified oligonucleotide that is 12 to 30 linked nucleosides in length and complementary to nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, and 25844-25912 of SEQ ID NO:2, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0149] In certain embodiments, compounds target nucleotides 5567-5620 of a PNPLA3 nucleic acid. In certain embodiments, compounds target within nucleotides 5567-5642, 5644-5731, 5567-5731, or 5567-5620 of a PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, compounds have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 5567-5642, 5644-5731, 5567-5731, or 5567-5620 of a PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides.

[0150] In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portion of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0151] In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0152] In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.

[0153] In certain embodiments, the compound targeting PNPLA3 is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. As described in the Examples section below, of over 2,384 compounds screened, IONs 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, and 975612 emerged as top lead compounds.

[0154] In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and / or at least one modified nucleobase.

[0155] In certain embodiments, any of the aforementioned modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.

[0156] In certain embodiments, modified oligonucleotides comprise at least one modified internucleoside linkage, for example, a phosphorothioate internucleoside linkage.

[0157] In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified nucleobase, eg, 5-methylcytosine.

[0158] In certain embodiments, any of the foregoing modified oligonucleotides comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises a sequence set forth in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length and has a nucleobase sequence that comprises a sequence set forth in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length and has a nucleobase sequence consisting of the sequence set forth in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.

[0159] In certain embodiments, the compound comprises or consists of a nucleobase length of 12 to 30 nucleobases having a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, and the modified oligonucleotide comprises a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; The gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0160] In certain embodiments, the compound comprises or consists of a modified oligonucleotide, wherein the modified oligonucleotide is 16 linked nucleosides in length and consists of the sequence of SEQ ID NO: 1089, wherein the modified oligonucleotide a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; A gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0161] In certain embodiments, the compound consists of a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is 16 linked nucleosides in length and consists of the sequence of SEQ ID NO: 1089, and wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; a gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and a conjugate group is positioned at the 5' terminus of the modified oligonucleotide; [ka] is.

[0162] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. 2173 ~ 2175 and modified oligonucleotides having a nucleobase sequence at least 90% identical to any one of:

[0163] In some embodiments, in individuals with an I148M mutation, the compound targeting PNPLA3 consists of the sequence of SEQ ID NO: 115, and the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 in an individual with the I148M mutation further comprises a conjugate group, the conjugate group being positioned at the 5' end of the modified oligonucleotide, [ka] is.

[0164] In certain embodiments, the compound comprises or consists of ION 916333, which has the following chemical structure, or a salt thereof: [ka]

[0165] In certain embodiments, the compound comprises or consists of ION 975616, which has the following chemical structure, or a salt thereof: [ka]

[0166] In certain embodiments, the compound comprises or consists of the sodium salt of 975616, which has the following chemical structure: [ka]

[0167] In certain embodiments, the compound comprises or consists of ION 975613, which has the following chemical structure, or a salt thereof: [ka]

[0168] In certain embodiments, the compound comprises or consists of the sodium salt of ION 975613, which has the following chemical structure: [ka]

[0169] In certain embodiments, the compound comprises or consists of ION 975612, which has the following chemical structure, or a salt thereof: [ka]

[0170] In certain embodiments, the compound comprises or consists of the sodium salt of ION 975612, which has the following chemical structure: [ka]

[0171] In certain embodiments, the compound comprises or consists of ION 916789, which has the following chemical structure, or a salt thereof: [ka]

[0172] In certain embodiments, the compound comprises or consists of the sodium salt of ION 916789, which has the following chemical structure: [ka]

[0173] In certain embodiments, the compound comprises or consists of ION 916602, which has the following chemical structure, or a salt thereof: [ka]

[0174] In certain embodiments, the compound comprises or consists of the sodium salt of ION 916602, which has the following chemical structure: [ka]

[0175] In any of the foregoing embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding PNPLA3.

[0176] In any of the foregoing embodiments, the compound may be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0177] In any of the foregoing embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

[0178] In certain embodiments, the compound comprises a modified oligonucleotide described herein and a conjugate group. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises at least one N-acetylgalactosamine (GalNAc), at least two N-acetylgalactosamine (GalNAc), or at least three N-acetylgalactosamine (GalNAc).

[0179] In certain embodiments, a compound or composition provided herein comprises a pharmaceutically acceptable salt of a modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

[0180] In certain embodiments, a compound or composition described herein has at least one in vitro IC of less than 2 μM, less than 1.5 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, less than 0.5 μM, less than 0.4 μM, less than 0.3 μM, less than 0.2 μM, less than 0.1 μM, less than 0.05 μM, less than 0.04 μM, less than 0.03 μM, less than 0.02 μM, or less than 0.01 μM. 50 It is active by having

[0181] In certain embodiments, the compounds or compositions described herein are well tolerated as indicated by at least one of a 4-fold, 3-fold, or 2-fold increase in alanine transaminase (ALT) or aspartate transaminase (AST) levels compared to control animals, or a 30%, 20%, 15%, 12%, 10%, 5%, or 2% increase in liver, spleen, or kidney weight compared to control animals. In certain embodiments, the compounds or compositions described herein are well tolerated as indicated by the absence of an increase in ALT or AST compared to control animals. In certain embodiments, the compounds or compositions described herein are well tolerated as indicated by the absence of an increase in liver, spleen, or kidney weight compared to control animals.

[0182] Certain embodiments provide compositions comprising a compound of any of the preceding embodiments, or any pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, a composition having any of the foregoing viscosities comprises a compound provided herein at a concentration of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL, or about 300 mg / mL. In certain embodiments, a composition having any of the aforementioned viscosities and / or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

[0183] Specific indicators Certain embodiments provided herein relate to a method for inhibiting PNPLA3 expression by administering a compound that targets PNPLA3, which can be useful for treating, preventing, or ameliorating PNPLA3-related diseases in individuals. In certain embodiments, the compound can be a PNPLA3-specific inhibitor. In certain embodiments, the compound can be an antisense compound, an oligomeric compound, or an oligonucleotide that targets PNPLA3.

[0184] Examples of PNPLA3-related diseases that can be treated, prevented, and / or ameliorated using the methods provided herein include liver disease, NAFLD, fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. Certain compounds provided herein relate to compounds and compositions that reduce liver damage, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in animals.

[0185] In certain embodiments, a method for treating, preventing, or ameliorating a PNPLA3-associated disease in an individual comprises administering to the individual a compound comprising a PNPLA3-specific inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a PNPLA3-associated disease. In certain embodiments, the disease is liver disease. In certain embodiments, the compound comprises an antisense compound targeted to PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.In certain embodiments, administration of the compound ameliorates, protects against, or prevents liver damage, fatty liver, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation in an animal.

[0186] In certain embodiments, a method for treating, preventing, or ameliorating liver injury, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in an animal comprises administering to the individual a compound comprising a PNPLA3-specific inhibitor, thereby treating, preventing, or ameliorating liver injury, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 12 to 30 linked nucleosides in length and includes at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.In certain embodiments, administering the compound ameliorates, protects against, or prevents liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a PNPLA3-related disease.

[0187] In certain embodiments, a method for inhibiting PNPLA3 expression in an individual suffering from or at risk of suffering from a PNPLA3-related disease comprises administering a compound comprising a PNPLA3-specific inhibitor to the individual, thereby inhibiting PNPLA3 expression in the individual. In certain embodiments, administering the compound inhibits PNPLA3 expression in the liver. In certain embodiments, the disease is liver disease. In certain embodiments, the individual suffers from or is at risk of suffering from NAFLD, fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the individual suffers from or is at risk of suffering from liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeting PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to an individual. In certain embodiments, administering the compound ameliorates, protects against, or prevents liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation.

[0188] In certain embodiments, a method for inhibiting PNPLA3 expression in a cell comprises inhibiting PNPLA3 expression in the cell by contacting the cell with a compound comprising a PNPLA3-specific inhibitor. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of an individual suffering from or at risk of suffering from liver injury, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeting PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 12 to 30 linked nucleosides in length and includes at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound.

[0189] In certain embodiments, the method for reducing or inhibiting liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases or liver fat accumulation in individuals who suffer from or are at risk of suffering from diseases related to PNPLA3 comprises administering to the individual a compound comprising a PNPLA3 specific inhibitor, thereby reducing or inhibiting liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases or liver fat accumulation in the individual.In certain embodiments, the individual suffers from or is at risk of suffering from NAFLD, fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis or primary sclerosing cholangitis.In certain embodiments, the compound comprises an antisense compound that targets PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising a nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612.In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a PNPLA3-associated disease.

[0190] Certain embodiments are directed to compounds comprising PNPLA3-specific inhibitors used to treat diseases associated with PNPLA3. In certain embodiments, the disease is NAFLD, fatty liver, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide of 16-30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.

[0191] Certain embodiments are directed to compounds comprising PNPLA3-specific inhibitors for use in reducing or inhibiting liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in individuals with or at risk of developing NAFLD, fatty liver, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 12 to 30 linked nucleosides in length and includes at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound.

[0192] Certain embodiments are directed to the use of a compound comprising a PNPLA3-specific inhibitor for manufacturing or preparing a medicament for treating a PNPLA3-associated disease. Certain embodiments are directed to the use of a compound comprising a PNPLA3-specific inhibitor for preparing a medicament for treating a PNPLA3-associated disease. In certain embodiments, the disease is liver disease. In certain embodiments, the disease is NAFLD, fatty liver, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 12 to 30 linked nucleosides in length and includes at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that comprises the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17 to 2169. In certain embodiments, a compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, a compound comprises a modified oligonucleotide that has a nucleobase sequence that comprises any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded.In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0193] Certain embodiments are directed to the use of compounds comprising PNPLA3 specific inhibitors for producing or preparing medicines to reduce or inhibit liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases or liver fat accumulation in individuals who suffer from or are at risk of suffering from liver diseases related to PNPLA3.In certain embodiments, the liver disease is NAFLD, fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis or primary sclerosing cholangitis.Certain embodiments are directed to the use of compounds comprising PNPLA3 specific inhibitors for preparing medicines to treat diseases related to PNPLA3. In certain embodiments, the disease is NAFLD, fatty liver, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeted to PNPLA3. In certain embodiments, the compound comprises an oligonucleotide targeted to PNPLA3. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In certain embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound.

[0194] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. 2173 ~ 2175 and modified oligonucleotides having a nucleobase sequence at least 90% identical to any one of:

[0195] In some embodiments, in individuals with an I148M mutation, the compound targeting PNPLA3 consists of the sequence of SEQ ID NO: 115, and the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 in an individual with the I148M mutation further comprises a conjugate group, the conjugate group being positioned at the 5' end of the modified oligonucleotide, [ka] is.

[0196] Certain PNPLA3 variants Further embodiments of the present disclosure relate to individuals with specific mutations in patatin-like phospholipase domain-containing protein 3 (PNPLA3). The isoleucine to methionine mutation at position 148 of the PNPLA3 protein (referred to herein as "PNPLA3 I148M," "I148M," "148I allelic variant," or "PNPLA3 rs738409 polymorphism"; amino acid residues are numbered relative to human PNPLA3) may be a strong genetic determinant of nonalcoholic steatohepatitis (NASH). The PNPLA3 I148M mutant protein exhibits reduced enzymatic activity. It has been discovered that certain treatments, such as the compounds described herein, may be unexpectedly effective treatments for liver disease in individuals, such as human patients, with the PNPLA3 I148M mutation. As used herein, an individual "has" or "contains" an I148M mutation in PNPLA3 means that the individual has a mutation in the nucleotide sequence of the gene encoding PNPLA3 that corresponds to a substitution of isoleucine to methionine at position 148 of the PNPLA3 protein.

[0197] In some embodiments, the present disclosure provides a method of treating an individual suffering from or at risk of suffering from liver disease, the method comprising administering a compound that targets PNPLA3 to the individual having an I148M mutation in PNPLA3.

[0198] In some embodiments, treating an individual with liver disease means slowing or stopping the progression of the disease. In some embodiments, treating an individual with liver disease means returning the individual's liver from a diseased state to a normal, healthy state, for example, as measured by the amount of liver lipids and / or scar tissue and / or the amount of liver function compared to a healthy individual. In some embodiments, if an individual has the PNPLA3 I148M mutation and suffers from liver disease, they are treated with a method that does not substantially increase their liver lipids. In some embodiments, the method reduces the individual's liver lipids by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%. Methods for measuring the amount of liver lipids are known to those skilled in the art and include, for example, Oil Red O staining of liver biopsies, magnetic resonance spectroscopy (MRS), and lipoprotein subfraction assays.

[0199] In some embodiments, if an individual has the PNPLA3 I148M mutation and suffers from liver disease, the individual is treated by a method that does not substantially increase scar tissue in the liver.Methods for measuring the amount of scar tissue in the liver are known to those skilled in the art.In some embodiments, the method reduces the scar tissue in the liver of an individual by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%.Methods for measuring the amount of scar tissue are known to those skilled in the art, and include, for example, imaging tests such as ultrasound, computed tomography (CT), magnetic resonance imaging (MRI), ultrasound elastography, magnetic resonance elastography, and / or acoustic radiation force impulse imaging; blood tests; and liver biopsy.

[0200] In some embodiments, if an individual has the PNPLA3 I148M mutation and suffers from liver disease, the individual is treated with a method that does not substantially decrease the individual's liver function. In some embodiments, after treatment with the method, the individual's liver function increases. In some embodiments, after treatment with the method, the individual's liver function increases by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%. In some embodiments, after treatment with the method, the individual's liver function is about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or more than about 99% of the liver function of a healthy individual. Methods for measuring liver function are known to those skilled in the art and include, for example, measuring the levels of one or more of alanine transaminase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), albumin, and bilirubin.

[0201] In some embodiments, treating an individual at risk of developing liver disease means preventing or reducing the likelihood that the individual will develop the disease, for example, by reducing liver lipids and / or scar tissue, or any other compounds, e.g., proteins, polynucleotides, that may cause or exacerbate the development of liver disease.

[0202] For example, examples of liver diseases, including diseases associated with PNPLA3, are described herein. In some embodiments, the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the liver disease is fatty liver. In some embodiments, the method provides a highly effective treatment for liver disease, such as fatty liver, when administered to an individual with the I148M mutation in PNPLA3.

[0203] In some embodiments, the present disclosure provides a method for reducing one or more of liver damage, fatty liver, hepatitis, liver fibrosis, and hepatic fat synthesis in an individual, comprising administering a compound that targets PNPLA3 to an individual having a PNPLA3 I148M mutation. In some embodiments, the method reduces or inhibits hepatitis. In some embodiments, the method reduces or inhibits liver fibrosis.

[0204] In some embodiments, treating liver disease in an individual includes reducing one or more of liver damage, fatty liver, hepatitis, liver fibrosis, and hepatic fat synthesis. Examples of liver diseases are described herein. In some embodiments, the method is highly effective in reducing one or more of liver damage, fatty liver, hepatitis, liver fibrosis, and hepatic fat synthesis in an individual with an I148M mutation in PNPLA3. In some embodiments, the method is highly effective in reducing one or more of fatty liver, hepatitis, and hepatic fibrosis in an individual with an I148M mutation in PNPLA3.

[0205] In some embodiments, reducing or preventing hepatitis includes reducing liver macrophage levels. Liver macrophage levels can be quantified, for example, by immunohistochemical staining for macrophage antigen 2 (Mac2), which is expressed on the surface of inflammatory macrophages. In some embodiments, liver macrophage levels, as measured, for example, by immunohistochemical staining for Mac2 in liver sections from the individual, are reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to an individual not administered a compound targeting PNPLA3.

[0206] In some embodiments, reducing hepatic macrophage levels comprises reducing the amount of monocyte chemoattractant protein 1 (MCP1) in the liver, e.g., in hepatocytes. MCP1 is also known as chemokine (C-C motif) ligand 2 (CCL2) and small molecule-inducible chemokine A2, and its receptor, CC chemokine receptor 2 (CCR2), plays a role in recruiting monocytes, dendritic cells, and macrophages to sites of inflammation in the liver. In some embodiments, reducing MCP1 expression in the liver reduces hepatic macrophage levels. In some embodiments, reducing MCP1 expression in the liver reduces hepatic inflammation. In some embodiments, reducing hepatic macrophage levels comprises reducing the amount of haptoglobin in the liver, e.g., in hepatocytes. Haptoglobin is an acute-phase protein typically produced in the liver and adipose tissue in response to inflammation, infection, and / or tissue injury. Haptoglobin can attract monocytes and macrophages, in part, through its interaction with CCR2, as described herein. In some embodiments, reducing haptoglobin expression in the liver reduces hepatitis.

[0207] In some embodiments, the present disclosure provides a method for reducing protein levels of one or more of haptoglobin, MCP1, and TIMP2 in an individual, the method comprising administering to the individual having an I148M mutation in PNPLA3 a compound that targets PNPLA3.

[0208] Haptoglobin and its role in hepatitis are described herein. In some embodiments, a method reduces haptoglobin protein levels in an individual with an I148M mutation in PNPLA3. In some embodiments, a method reduces haptoglobin expression in an individual with an I148M mutation in PNPLA3. In some embodiments, the haptoglobin protein level is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to an individual not administered a compound targeting PNPLA3. Methods for measuring haptoglobin levels in a sample are known to those skilled in the art and may include, for example, spectrophotometry, immunoassay, electrophoresis, etc. In some embodiments, haptoglobin levels in a sample from an individual, e.g., an individual with PNPLA3 I148M, are measured by a turbidimetric assay, e.g., using an ABX Pentra instrument. In some embodiments, haptoglobin protein levels in a sample from an individual, e.g., an individual with PNPLA3 I148M, are measured by a colorimetric assay, e.g., the PHASE™ Range haptoglobin colorimetric assay.

[0209] MCP1 and its role in hepatitis are described herein. In some embodiments, a method reduces MCP1 protein levels in an individual with an I148M mutation in PNPLA3. In some embodiments, a method reduces MCP1 expression in an individual with an I148M mutation in PNPLA3. In some embodiments, the MCP1 protein level is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to an individual not administered a compound targeting PNPLA3. Methods for measuring MCP1 levels in a sample are known to those skilled in the art and include, for example, immunoassays (e.g., ELISA), immunoblots, electrophoresis, chromatography, etc. In some embodiments, the protein level of MCP1 in a sample from an individual, eg, an individual with PNPLA I148M, is measured by immunoblotting a liver sample from the individual.

[0210] In some embodiments, the method reduces the protein level of TIMP2 in individuals with an I148M mutation in PNPLA3. In some embodiments, the method reduces the expression of TIMP2 in individuals with an I148M mutation in PNPLA3. Tissue inhibitor of metalloproteinase 2 (TIMP2) is a member of the TIMP family, which is generally a natural inhibitor of the matrix metalloproteinase (MMP) group of peptidases involved in the degradation of extracellular matrix. TIMP2 expression has been shown to be elevated in activated human hepatic stellate cells and fibrotic rat liver (see, e.g., Xu et al., Gut 54(1):142-151, 2005; and Peng et al., Exp Biol Med 238(6):668-677, 2013). Furthermore, TIMP2 can inhibit the collagenolytic activity of matrix metalloproteinase 2 (MMP2), which is elevated in experimental models of liver fibrosis and in humans with chronic liver disease (see, e.g., Linden et al., Mol Metab 22:49-61, 2019). In some embodiments, TIMP2 inhibits MMP2, resulting in a reduction in liver fibrosis. In some embodiments, TIMP2 protein levels are reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to individuals not administered a compound targeting PNPLA3. Methods for measuring TIMP2 levels in a sample are known to those skilled in the art and include, for example, immunoassays (e.g., ELISA), immunoblotting, electrophoresis, chromatography, etc. In some embodiments, the protein level of TIMP2 in a sample from an individual, eg, an individual with PNPLA I148M, is measured by immunoblotting a liver sample from the individual.

[0211] In some embodiments, the individual has a heterozygous I148M mutation in PNPLA3. As used herein, a "heterozygous" mutation means that one allele is mutated (the other allele is non-mutated, i.e., wild-type). In some embodiments, the individual has a homozygous I148M mutation in PNPLA3. As used herein, a "homozygous" mutation means that the two alleles have the same mutation. In some embodiments, the individual has a compound heterozygous mutation at position 148 of PNPLA3. As used herein, a "compound heterozygous" mutation means that each of the two alleles has a different mutation. For example, a compound heterozygous mutation at position 148 of PNPLA3 can contain an I148M mutation in one allele and a different mutation in the other allele. In some embodiments, a compound heterozygous mutation at position 148 of PNPLA3, in which one allele is I148M, has the same phenotype as a homozygous I148M mutation in PNPLA3. In some embodiments, a compound heterozygous mutation at position 148 of PNPLA3, where one allele is I148M, has a different phenotype than either a homozygous I148M mutation or a heterozygous I148M mutation of PNPLA3. In some embodiments, individuals with a PNPLA3 I148M mutation in at least one allele are at increased risk of liver disease. In some embodiments, individuals with a homozygous PNPLA3 I148M mutation are at increased risk of liver disease. In some embodiments, methods provided herein provide unexpectedly effective treatments for liver disease in individuals with a PNPLA3 I148M mutation in at least one allele. In some embodiments, methods provided herein provide unexpectedly effective treatments for liver disease in individuals with a homozygous PNPLA3 I148M mutation.

[0212] In some embodiments, the individual is a human individual. In some embodiments, the individual is an animal, such as a cow, horse, dog, cat, rat, or mouse. In embodiments where the individual is not human, those skilled in the art will understand that the number of amino acid residues in PNPLA3 may not be identical to that of human PNPLA3. Those skilled in the art can determine the residue corresponding to residue 148 in human PNPLA3 by using sequence alignment methods known in the art, such as BLAST, Clustal, HMMER, etc.

[0213] In some embodiments, the method herein comprises administering a compound targeting PNPLA3 to an individual having an I148M mutation in PNPLA3. In some embodiments, the compound targeting PNPLA3 in an individual having an I148M mutation is an antisense compound targeting PNPLA3. Antisense compounds are described herein. In some embodiments, the antisense compound targeting PNPLA3 in an individual having an I148M mutation is a small interfering RNA (siRNA). In some embodiments, the antisense compound targeting PNPLA3 in an individual having an I148M mutation is: 5'-GGUCCUCUCAGAUCUUGUGtt-3' (SEQ ID NO: 2173 ), 5'-GGAGUGAGUGACAACGUACtt-3' (SEQ ID NO: 2174 ), or 5'-GGUUCUUGGAAGAGAAGGGtt-3' (SEQ ID NO: 2175 )

[0214] In some embodiments, in an individual with the I148M mutation, a compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleic acid base sequence that is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to any of SEQ ID NOs: 2170-2172.

[0215] In some embodiments, the compound targeting PNPLA3 in an individual with an I148M mutation is an antisense oligonucleotide (ASO). ASOs are described herein. In some embodiments, the compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide 8 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide 12 to 30 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 17-2169. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to SEQ ID NO:115.

[0216] In some embodiments, a compound comprises a modified oligonucleotide 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobases that are 100% complementary to an equal length portion of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO:2, and wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2. In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a complementary nucleobase sequence within nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO:2, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2.

[0217] In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobase portions complementary to equal length portions of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of a PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2. In some embodiments, the compound comprises a modified oligonucleotide 8 to 80 linked nucleosides in length, the modified oligonucleotide having a nucleobase sequence comprising a 16 nucleobase portion complementary to an equal length portion of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2 over the entire length of the nucleobase sequence.

[0218] In any of the aforementioned methods or uses, the compound may target PNPLA3. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, e.g., a modified oligonucleotide 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences set forth in SEQ ID NOs: 1-10. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl modified sugar, and the modified nucleobase is 5-methylcytosine. In certain embodiments, a modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides, a 5' wing segment consisting of linked nucleosides, and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0219] In any of the above embodiments, the modified oligonucleotide is 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 16 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences listed in SEQ ID NOs: 1-10.

[0220] In any of the above methods or uses, the compound comprises or consists of a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 17 to 2169, the modified oligonucleotide comprising: a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0221] In any of the foregoing methods or uses, the compound comprises or consists of a modified oligonucleotide 16 linked nucleosides in length having a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; A gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0222] In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115. In some embodiments, a compound targeting PNPLA3 in an individual with an I148M mutation comprises a modified oligonucleotide having a nucleobase sequence at least 90% identical to SEQ ID NO: 115.2173 ~ 2175 and modified oligonucleotides having a nucleobase sequence at least 90% identical to any one of:

[0223] In some embodiments, in individuals with an I148M mutation, the compound targeting PNPLA3 consists of the sequence of SEQ ID NO: 115, and the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; The gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 in an individual with the I148M mutation further comprises a conjugate group, the conjugate group being positioned at the 5' end of the modified oligonucleotide, [ka] is.

[0224] In certain embodiments, the compound comprises or consists of ION 916333, which has the following chemical structure, or a salt thereof: [ka]

[0225] In certain embodiments, the compound comprises or consists of ION 975616, which has the following chemical structure, or a salt thereof: [ka]

[0226] In certain embodiments, the compound comprises or consists of the sodium salt of ION 975616, which has the following chemical structure: [ka]

[0227] In certain embodiments, the compound comprises or consists of ION 975613, which has the following chemical structure, or a salt thereof: [ka]

[0228] In certain embodiments, the compound comprises or consists of the sodium salt of ION 975613, which has the following chemical structure: [ka]

[0229] In certain embodiments, the compound comprises or consists of ION 975612, which has the following chemical structure, or a salt thereof: [ka]

[0230] In certain embodiments, the compound comprises or consists of the sodium salt of ION 975612, which has the following chemical structure: [ka]

[0231] In certain embodiments, the compound comprises or consists of ION 916789, which has the following chemical structure, or a salt thereof: [ka]

[0232] In certain embodiments, the compound comprises or consists of the sodium salt of ION 916789, which has the following chemical structure: [ka]

[0233] In certain embodiments, the compound comprises or consists of ION 916602, which has the following chemical structure, or a salt thereof: [ka]

[0234] In certain embodiments, the compound comprises or consists of the sodium salt of ION 916602, which has the following chemical structure: [ka]

[0235] In any of the aforementioned methods or uses, the compound may be administered parenterally. For example, in certain embodiments, the compound may be administered via injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal administration or intraventricular administration.

[0236] Specific compounds In certain embodiments, the compounds described herein may be antisense compounds. In certain embodiments, the antisense compounds comprise or consist of oligomeric compounds. In certain embodiments, the oligomeric compounds comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides have a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid.

[0237] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides, hi certain embodiments, the modified oligonucleotides have a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid.

[0238] In certain embodiments, the compound or antisense compound is single-stranded. Such single-stranded compounds or antisense compounds comprise or consist of oligomeric compounds. In certain embodiments, such oligomeric compounds comprise or consist of oligonucleotides and, optionally, conjugate groups. In certain embodiments, the oligonucleotides are antisense oligonucleotides. In certain embodiments, the oligonucleotides are modified. In certain embodiments, the oligonucleotides of single-stranded antisense compounds or oligomeric compounds comprise self-complementary nucleobase sequences.

[0239] In certain embodiments, the compound is double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, thymine nucleobases in the modified oligonucleotide are replaced by uracil nucleobases. In certain embodiments, the compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16 to 30 linked nucleosides in length and the second modified oligonucleotide is 16 to 30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of SEQ ID NOs: 17-2169.

[0240] In certain embodiments, antisense compounds are double-stranded.Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to target nucleic acid, and a second oligomeric compound having a region complementary to the first oligomeric compound.The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide, and optionally a conjugate group.The oligonucleotide of the second oligomeric compound of such double-stranded antisense compounds can be modified or unmodified.Either or both of the oligomeric compounds of the double-stranded antisense compounds can comprise a conjugate group.The oligomeric compound of the double-stranded antisense compounds can comprise non-complementary overlapping nucleosides.

[0241] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNA-targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

[0242] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of a target segment of a targeted target nucleic acid.

[0243] In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 12 to 30 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 12 to 22 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 14 to 30 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 14 to 20 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 15 to 30 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 15 to 20 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 16 to 30 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 16 to 20 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 17 to 30 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 17 to 20 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides 18 to 30 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 18 to 20 linked subunits in length. In certain embodiments, the compounds described herein comprise oligonucleotides 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, or 20 to 30 subunits in length, respectively. In certain embodiments, the compounds described herein comprise oligonucleotides 14 linked subunits in length.In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 16 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 17 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 18 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 19 linkage subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 20 linkage subunits. In other embodiments, the compounds described herein comprise oligonucleotides with a length of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linkage subunits. In certain such embodiments, the compounds described herein comprise oligonucleotides of linked subunit lengths of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, or a range defined by any two of the foregoing values. In some embodiments, the linked subunits are nucleotides, nucleosides, or nucleobases.

[0244] In certain embodiments, the compound may further comprise an additional mechanism or element, such as a conjugate group, attached to the oligonucleotide. In certain embodiments, such a compound is an antisense compound. In certain embodiments, such a compound is an oligomeric compound. In embodiments where the conjugate group comprises a nucleoside (i.e., the nucleoside that attaches the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

[0245] In certain embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation) or the 3' end (3' truncation). A shortened or truncated compound targeting a PNPLA3 nucleic acid may have two subunits deleted from the 5' end of the compound or two subunits deleted from the 3' end of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

[0246] When a single additional subunit is present in an extended compound, the additional subunit may be located at the 5'-end or the 3'-end of the compound. When more than one additional subunit is present, the additional subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5'-end (5'-addition) or the 3'-end (3'-addition) of the compound. Alternatively, the additional subunits may be dispersed throughout the compound.

[0247] It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and / or introduce mismatched bases without losing activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992,89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001,93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998,16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemical properties, and motifs can lead to significant differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009,52,10; Egli et al. J. Am. Chem. Soc. 2011,133,16642).

[0248] In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also referred to as small interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function, at least in part, through the RISC pathway to degrade and / or capture target nucleic acids (and thus include microRNA / microRNA mimic compounds). As used herein, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules capable of mediating sequence-specific RNAi, such as small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotides, small interfering nucleic acids, small interfering modified oligonucleotides, chemically modified siRNA, and post-transcriptional gene silencing RNA (ptgsRNA). As used herein, the term "RNAi" is also intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetics.

[0249] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeting PNPLA3 described herein. In certain embodiments, the compounds may be double-stranded. In certain embodiments, the compounds comprise a first strand comprising at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases of any one of SEQ ID NOs: 17-2169, and a second strand. In certain embodiments, the compounds comprise a first strand comprising a nucleobase sequence of any one of SEQ ID NOs: 17-2169, and a second strand. In certain embodiments, the compounds comprise a first strand comprising a ribonucleotide having uracil (U) instead of thymine (T) in any one of SEQ ID NOs: 17-2169. In certain embodiments, the compounds comprise (i) a first strand comprising a nucleobase sequence complementary to a site on PNPLA3 that targets any of SEQ ID NOs: 17-2169, and (ii) a second strand. In certain embodiments, the compound contains one or more modified nucleotides in which the 2'-position of the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound contains at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are alternately arranged for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the strand of the dsRNA compound. In certain embodiments, the compound contains one or more linkages other than the naturally occurring phosphodiester linkage between adjacent nucleotides. Examples of such linkages include phosphoramide linkages, phosphorothioate linkages, and phosphorodithioate linkages. The compound may also be a chemically modified nucleic acid molecule, as taught in U.S. Pat. No. 6,673,661. In another embodiment, the compound comprises one or two capped chains, for example as disclosed by WO 00 / 63364, filed April 19, 2000.

[0250] In certain embodiments, the first strand of the compound is an siRNA guide strand, and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first strand or the second strand of the compound can comprise a conjugate group.

[0251] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeting PNPLA3 described herein. In certain embodiments, the compounds are single-stranded. In certain embodiments, such compounds are single-stranded RNAi (ssRNAi) compounds. In certain embodiments, the compounds comprise at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions of any one of SEQ ID NOS: 17-2169. In certain embodiments, the compounds comprise the nucleobase sequence of any one of SEQ ID NOS: 17-2169. In certain embodiments, the compounds comprise ribonucleotides in which uracil (U) substitutes for thymine (T) in any one of SEQ ID NOS: 17-2169. In certain embodiments, the compounds comprise a nucleobase sequence complementary to a site on PNPLA3 that targets any of SEQ ID NOS: 17-2169. In certain embodiments, the compounds comprise one or more modified nucleotides in which the 2'-position of the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are alternately arranged for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the compound strand. In certain embodiments, the compound comprises one or more linkages other than naturally occurring phosphodiester linkages between adjacent nucleotides. Examples of such linkages include phosphoramide linkages, phosphorothioate linkages, and phosphorodithioate linkages. The compound may also be a chemically modified nucleic acid molecule, such as those taught in U.S. Patent No. 6,673,661. In another embodiment, the compound comprises a capped chain, such as those disclosed in International Publication No. WO 00 / 63364, filed April 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.In certain embodiments, the compound may include a conjugate group.

[0252] Specific mechanisms In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein can hybridize to a target nucleic acid to produce at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that produces significant undesired antisense activity.

[0253] In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently "DNA-like" to induce RNase H activity. Furthermore, in certain embodiments, one or more non-DNA-like nucleosides are tolerated within the gap of a gapmer.

[0254] In certain antisense activity, the compounds or part of compounds described herein are loaded into RNA-induced silencing complex (RISC), which ultimately leads to the cleavage of target nucleic acid.For example, certain compounds described herein lead to the cleavage of target nucleic acid by Argonaute.The compound that is loaded into RISC is an RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0255] In certain embodiments, hybridization of a compound described herein to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in alteration of splicing of the target nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0256] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or animal.

[0257] Target Nucleic Acids, Target Regions, and Nucleotide Sequences In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is located entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is located at least 50% within an intron.

[0258] Nucleotide sequences encoding PNPLA3 include, but are not limited to, the following: RefSeq number or GenBank accession number NM_025225.2 (incorporated by reference and disclosed herein as SEQ ID NO: 1); GenBank accession number NC_000022.11 truncated from nucleotides 43921001 to 43954500 (incorporated by reference and disclosed herein as SEQ ID NO: 2); AK123806.1 (incorporated by reference and disclosed herein as SEQ ID NO: 3); BQ686328.1 (incorporated by reference and disclosed herein as SEQ ID NO: 4); BF762711.1 (incorporated by reference and disclosed herein as SEQ ID NO: 5); DA290491.1 (incorporated by reference and disclosed herein as SEQ ID NO: 6); and the sequences listed as SEQ ID NOs: 7, 8, 9 and 10.

[0259] Hybridization In some embodiments, hybridization occurs between the compounds disclosed herein and PNPLA3 nucleic acids. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[0260] Hybridization can occur under a variety of conditions, which are sequence-dependent and determined by the nature and composition of the hybridizing nucleic acid molecules.

[0261] Methods for determining whether a sequence can specifically hybridize with a target nucleic acid are known in the art. In certain embodiments, the compounds provided herein can specifically hybridize with PNPLA3 nucleic acid.

[0262] Complementarity An oligonucleotide is said to be complementary to another nucleic acid if the nucleobase sequence of the oligonucleotide, or one or more regions thereof, matches the nucleobase sequence of another oligonucleotide or nucleic acid, or one or more regions thereof, when the two nucleobase sequences are aligned in opposite directions. Nucleobase matches or complementary nucleobases described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside and may contain one or more nucleobase mismatches. An oligonucleotide is fully complementary, or 100% complementary, if such an oligonucleotide has a nucleobase match at every nucleoside without any nucleobase mismatches.

[0263] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleobases between the compound and the PNPLA3 nucleic acid may be tolerated as long as the compound remains specifically hybridized to the target nucleic acid. Furthermore, the compound may hybridize to one or more segments of the PNPLA3 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).

[0264] In certain embodiments, the compounds provided herein or specified portions thereof are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a PNPLA3 nucleic acid, target region, target segment, or specified portion thereof, or up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a PNPLA3 nucleic acid, target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or specified portions thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any value between these ranges, complementary to a PNPLA3 nucleic acid, target region, target segment, or specified portion thereof. The percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

[0265] For example, a compound in which 18 of the 20 nucleobases of the compound are complementary to the target region and thus specifically hybridize will exhibit 90% complementarity. In this example, the remaining non-complementary nucleobases can be clustered or dispersed with complementary nucleobases, and do not need to be contiguous with each other or with complementary nucleobases. Thus, an 18-nucleobase compound with four non-complementary nucleobases flanked by two regions that are completely complementary to the target nucleic acid will have an overall complementarity of 77.8% with the target nucleic acid. The percent complementarity of a compound with a region of a target nucleic acid can be routinely determined using BLAST (basic local alignment search tool) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), which are well known in the art. Percent homology, sequence identity, or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489) with default settings.

[0266] In certain embodiments, the compounds described herein or specific portions thereof are fully complementary (i.e., 100% complementary) to a target nucleic acid or specific portion thereof. For example, a compound can be fully complementary to a PNPLA3 nucleic acid, or a target region, or a target segment, or a target sequence thereof. As used herein, "fully complementary" means that each nucleobase of a compound is complementary to a corresponding nucleobase of a target nucleic acid. For example, a 20-nucleobase compound is fully complementary to a 400-nucleobase target sequence as long as there is a corresponding 20-nucleobase portion of the target nucleic acid that is fully complementary to the compound. "Fully complementary" can also be used in reference to specific portions of a first nucleic acid and / or a second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase compound can be "fully complementary" to a 400-nucleobase target sequence. A 20 nucleobase moiety of a 30 nucleobase compound is fully complementary to a target sequence if the target sequence has a corresponding 20 nucleobase moiety, each nucleobase of which is complementary to the 20 nucleobase moiety of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0267] In certain embodiments, the compounds described herein contain one or more mismatched nucleobases relative to a target nucleic acid. In certain such embodiments, such mismatches reduce antisense activity against the target, but further reduce activity against non-targets. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain such embodiments, the mismatches are located particularly within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain such embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain such embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain such embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3' end of the wing region. In certain such embodiments, the mismatches are located particularly within an oligonucleotide lacking a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0268] The non-complementary nucleobase position may be at the 5'-end or 3'-end of the compound. Alternatively, multiple non-complementary nucleobases may be present at internal positions of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobases are located in the wing segments of a gapmer oligonucleotide.

[0269] In certain embodiments, compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, or that are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase to a target nucleic acid, e.g., a PNPLA3 nucleic acid, or a specified portion thereof.

[0270] In certain embodiments, compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, or that are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase to a target nucleic acid, e.g., a PNPLA3 nucleic acid, or a specified portion thereof.

[0271] In certain embodiments, the compounds described herein also include compounds that are complementary to a portion of a target nucleic acid. As used herein, a "portion" refers to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, a compound is complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

[0272] identity The compounds provided herein may also have a percent identity defined relative to a compound represented by a specific nucleotide sequence, SEQ ID NO:, or specific ION number, or a portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is identical to a sequence disclosed herein if it has the same nucleic acid base pairing ability. For example, an RNA containing uracil instead of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. Shortened and extended versions of the compounds described herein, as well as compounds with non-identical bases compared to the compounds provided herein, are also contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. The percent identity of a compound is calculated according to the number of bases with identical base pairing relative to the compared sequence.

[0273] In certain embodiments, the compounds described herein or portions thereof are 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to, or at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs disclosed herein, or portions thereof. In certain embodiments, the compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a compound or portion thereof represented by a particular nucleotide sequence, SEQ ID NO:, or ION number, or any percentage therebetween, and the compounds include oligonucleotides having one or more mismatched nucleobases. In certain such embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0274] In certain embodiments, the compounds described herein comprise or consist of antisense compounds.In certain embodiments, a portion of the antisense compound is compared with a portion of the target nucleic acid of equal length.In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared with a portion of the target nucleic acid of equal length.

[0275] In certain embodiments, the compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared with a portion of the same length of the target nucleic acid. In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases is compared with a portion of the same length of the target nucleic acid.

[0276] Specific modified compounds In certain embodiments, the compounds described herein comprise or consist of oligonucleotides comprised of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA (i.e., at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage).

[0277] Modified Nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0278] 1. Modified sugar moiety In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to substitutions in other types of modified sugar moieties.

[0279] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety comprising one or more acyclic substituents (including, but not limited to, substituents at the 2', 4', and / or 5' positions). In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is selected from the following: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) and R m and R n are each independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10and alkyl, as well as those 2'-substituents described in U.S. Patent Nos. 6,531,584 to Cook et al.; 5,859,221 to Cook et al.; and 6,005,087 to Cook et al. Particular embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from the following: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for linear non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in WO 2015 / 106128 to Manoharan et al. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., International Publication No. 2008 / 101157 and Rajeev et al., U.S. Patent Application Publication No. 2013 / 0203836.

[0280] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) and R m and R n are each independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.

[0281] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0282] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, OCH3, and OCH2CH2OCH3.

[0283] Nucleosides containing modified sugar moieties, e.g., non-bicyclic modified sugar moieties, are referred to according to the position of the substitution on the sugar moiety of the nucleoside. For example, a nucleoside containing a 2'-substituted sugar moiety or a 2-modified sugar moiety is referred to as a 2'-substituted nucleoside or a 2'-modified nucleoside.

[0284] Certain modified sugar moieties include a bridging sugar substituent that forms a second ring to result in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4'-2'-linked sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE"), and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845 to Seth et al., U.S. Pat. No. 7,569,686 to Bhat et al., U.S. Pat. No. 7,569,686 to Sway ... No. 7,741,457 to Seth et al. and U.S. Pat. No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,283 to Seth et al.), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,425 to Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al. and U.S. Pat. No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., U.S. Pat. No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,425 to Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al. and U.S. Pat. No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., U.S. Pat. No. 8,022,193 to Zhou, et al.), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2', and analogs thereof (see, e.g., U.S. Pat. No. 8,278,426 to Seth et al.), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein R, R a, and R b are each independently H, a protecting group, or C1 to C 12 alkyl (see, for example, US Pat. No. 7,427,672 to Imanishi et al.).

[0285] In certain embodiments, such a 4' to 2' bridge is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-; During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; R a and R b are each independently H, a protecting group, hydroxyl, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and J1 and J2 are each independently H, C1-C 12Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl, or a protecting group.

[0286] Additional bicyclic sugar moieties are known in the art, see, for example, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al. al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al. al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther., 2001, 3,239-243; U.S. Patent No. 7,053,207 to Wengel et al., U.S. Patent No. 6,268,490 to Imanishi et al., U.S. Patent No. 6,770,748 to Imanishi et al., U.S. Patent Re. 44,779 to Imanishi et al.; U.S. Patent No. 6,794,499 to Wengel et al., U.S. Patent No. 6,670,461 to Wengel et al.; No. 7,034,133 to Wengel et al.; U.S. Pat. No. 8,080,644 to Wengel et al.; U.S. Pat. No. 8,034,909 to Wengel et al.; U.S. Pat. No. 8,153,365 to Wengel et al.; U.S. Pat. No. 7,572,582 to Wengel et al.; and U.S. Pat. No. 6,525,191 to Ramasamy et al.; WO 2004 / 106356 to Torsten et al.; Engel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al. No. 8,268,980; U.S. Patent No. 8,546,556 to Seth et al.; U.S. Patent No. 8,530,640 to Seth et al.; U.S. Patent No. 9,012,421 to Migawa et al.; U.S. Patent No. 8,501,805 to Seth et al.; U.S. Patent Application Publication No. 2008 / 0039618 to Allerson et al.; and U.S. Patent Application Publication No. 2015 / 0191727 to Migawa et al.

[0287] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In exemplary embodiments of this specification, when the configuration of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified, it is the β-D configuration unless otherwise specified.

[0288] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0289] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4' sulfur atom and substitutions at the 2' position (see, e.g., U.S. Pat. Nos. 7,875,733 to Bhat et al. and 7,939,677 to Bhat et al.) and / or the 5' position.

[0290] In certain embodiments, the sugar surrogate comprises a ring with more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), altritol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906), which can also be referred to as F-THP or 3'-fluorotetrahydropyran, and has the following formula: [ka] Nucleosides containing additional modified THP compounds having wherein, for each of said modified THP nucleosides, independently: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that joins a modified THP nucleoside to the remainder of an oligonucleotide, or one of T3 and T4 is an internucleoside linking group that joins a modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linkage conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, or substituted C1-C6 alkyl. alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)N1J2, and CN, where X is O, S, or NJ1, and J1, J2, and J3 are each independently H or C1-C6 alkyl.

[0291] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0292] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used herein, the term "morpholino" refers to the following structure: [ka] means a sugar substitute having the formula:

[0293] In certain embodiments, morpholinos may be modified, for example, by adding various substituents to or varying from the above morpholino structures. Such sugar surrogates are referred to herein as "modified morpholinos."

[0294] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in U.S. Patent Application Publication No. 2013 / 130378 to Manoharan et al.

[0295] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.

[0296] 2. Modified nucleobases The modification or substitution of nucleobase (or base) is structurally distinguishable from naturally occurring nucleobase or synthetic unmodified nucleobase, but functionally interchangeable with naturally occurring nucleobase or synthetic unmodified nucleobase. Both natural nucleobase and modified nucleobase can participate in hydrogen bonding. Such nucleobase modification can impart nuclease stability, binding affinity, or some other beneficial biological properties to antisense compounds.

[0297] In certain embodiments, the compound described herein comprises modified oligonucleotide.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobase, which are referred to as abasic nucleosides.

[0298] In certain embodiments, modified nucleobases are selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thiolalkyl, 8-hydroxyl cytosine, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808 to Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0299] Publications that teach the preparation of the above-mentioned specific modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Manoharan et al., U.S. Patent Application Publication No. 2003 / 0158403; Manoharan et al., U.S. Patent Application Publication No. 2003 / 0175906; Dinh et al., U.S. Patent No. 4,845,205; Spielvogel et al., U.S. Patent No. 5,130,302; Rogers et al., U.S. Patent No. 5,134,066; Bischofberger et al., U.S. Patent No. 5,134,066; No. 175,273 to Urdea et al.; U.S. Pat. No. 5,367,066 to Urdea et al.; U.S. Pat. No. 5,432,272 to Benner et al.; U.S. Pat. No. 5,434,257 to Matteucci et al.; U.S. Pat. No. 5,457,187 to Gmeiner et al.; U.S. Pat. No. 5,459,255 to Cook et al.; U.S. Pat. No. 5,484,908 to Froehler et al.; U.S. Pat. No. 5,502,177 to Matteucci et al.; U.S. Pat. No. 5,525,711 to Hawkins et al. ;Haralambidis et al., U.S. Patent No. 5,552,540;Cook et al., U.S. Patent No. 5,587,469;Froehler et al., U.S. Patent No. 5,594,121;Switzer et al., U.S. Patent No. 5,596,091;Cook et al., U.S. Patent No. 5,614,617;Froehler et al., U.S. Patent No. 5,645,985;Cook et al., U.S. Patent No. 5,681,941;Cook et al., U.S. Patent No. 5,811,534;Cook et al., U.S. Patent No. 5, No. 750,692 to Cook et al.; U.S. Pat. No. 5,948,903 to Cook et al.; U.S. Pat. No. 5,587,470 to Cook et al.; U.S. Pat. No. 5,457,191 to Cook et al.; U.S. Pat. No. 5,763,588 to Matteucci et al.; U.S. Pat. No. 5,830,653 to Froehler et al.; U.S. Pat. No. 5,808,027 to Cook et al.; U.S. Pat. No. 6,166,199 to Cook et al.; and U.S. Pat. No. 6,005,096 to Matteucci et al.

[0300] In certain embodiments, the compound that targets PNPLA3 nucleic acid comprises one or more modified nucleobases.In certain embodiments, the modified nucleobase is 5-methylcytosine.In certain embodiments, each cytosine is 5-methylcytosine.

[0301] 3. Modified internucleoside linkages The naturally occurring internucleoside linkage in RNA and DNA is a 3'-5' phosphodiester linkage. In certain embodiments, compounds described herein having one or more modifications, i.e., non-naturally occurring internucleoside linkages, are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0302] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each phosphorothioate in each oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages of a specific, independently selected stereochemical configuration. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, the methods described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0303] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereorandom or may be of a specific stereochemical configuration.

[0304] In certain embodiments, the compound that targets PNPLA3 nucleic acid comprises one or more modified internucleoside linkages.In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages.In certain embodiments, each internucleoside linkage of antisense compound is phosphorothioate internucleoside linkage.

[0305] In certain embodiments, the compounds described herein include oligonucleotides. Oligonucleotides with modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not contain a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0306] In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. Two main classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"), containing phosphodiester linkages ("P=O"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH-O-); and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Compared to the naturally occurring phosphate linkage, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages containing a chiral atom can be prepared as racemic mixtures or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0307] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonates, and amides (see, e.g., "Carbohydrate Modifications in Antisense Research"; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH2 moieties.

[0308] In certain embodiments, an oligonucleotide comprises modified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, the internucleoside linkages are arranged in a gap motif. In such embodiments, the internucleoside linkages in each of the two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the wings are phosphodiester linkages and the internucleoside linkages in the gap are phosphorothioate linkages. Because the nucleoside motifs are independently selected, such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif, and if a gapped nucleoside motif is present, the wing length and gap length may or may not be the same.

[0309] In certain embodiments, the oligonucleotide comprises a region with alternating internucleoside linkage motifs. In certain embodiments, the oligonucleotide comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate.

[0310] In certain embodiments, an oligonucleotide comprises at least six phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide comprises at least eight phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide comprises at least ten phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide comprises at least one block of at least six consecutive phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide comprises at least one block of at least eight consecutive phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide comprises at least one block of at least ten consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within three nucleosides of the 3' end of the oligonucleotide.

[0311] In certain embodiments, the oligonucleotide comprises one or more methylphosphonate linkages. In certain embodiments, the oligonucleotide having a gapmer nucleoside motif comprises a linkage motif that comprises all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is present in the central gap of the oligonucleotide having a gapmer nucleoside motif.

[0312] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be reduced, or the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be reduced and the number of phosphodiester internucleoside linkages may be increased, while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while maintaining nuclease resistance.

[0313] 4. Specific motifs In certain embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides can have motifs, e.g., patterns of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified sugar moieties, unmodified sugar moieties, and differentially modified sugar moieties, nucleobases, and / or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif describes a nucleobase modification independent of the nucleobase sequence).

[0314] a specific sugar motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise one or more types of modified and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.

[0315] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif, which includes two outer regions, or "wings," and a central or internal region, or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides in which at least a portion of the sugar moieties of the nucleosides in each wing differ from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moieties of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap comprises one or more nucleosides that have a sugar moiety that differs from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0316] In certain embodiments, the gapmer wing comprises 1 to 5 nucleosides. In certain embodiments, the gapmer wing comprises 2 to 5 nucleosides. In certain embodiments, the gapmer wing comprises 3 to 5 nucleosides. In certain embodiments, all of the nucleosides in the gapmer are modified nucleosides.

[0317] In certain embodiments, the gapmer gap contains 7 to 12 nucleosides. In certain embodiments, the gapmer gap contains 7 to 10 nucleosides. In certain embodiments, the gapmer gap contains 8 to 10 nucleosides. In certain embodiments, the gapmer gap contains 10 nucleosides. In certain embodiments, each nucleoside in the gapmer gap is an unmodified 2'-deoxynucleoside.

[0318] In certain embodiments, the gapmer is a deoxygapmer. In such embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

[0319] In certain embodiments, a modified oligonucleotide has a fully modified sugar motif, where each nucleoside of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside of the region contains a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region contains the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each uniformly modified nucleoside contains the same 2'-modification.

[0320] B specific nucleobase motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine.

[0321] In certain embodiments, a modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides of the 5' end of the oligonucleotide.

[0322] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is present in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0323] C. specific internucleoside linkage motifs In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is essentially a phosphate internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is phosphorothioate (P=S). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is independently selected from phosphorothioate internucleoside linkages and phosphate internucleoside linkages. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage within at least one wing, at least one phosphodiester linkage being a non-terminal internucleoside linkage, and the remaining internucleoside linkages being phosphorothioate internucleoside linkages. In certain such embodiments, the phosphorothioate linkages are all stereorandom. In certain embodiments, the phosphorothioate linkages within the wing are all (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0324] 5. Specific Modified Oligonucleotides In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification, motif, and total length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Furthermore, in certain cases, oligonucleotides are described by their total length or range, and by the lengths or length ranges of two or more regions (e.g., regions of nucleosides having specific sugar modifications). In such circumstances, it may be possible to select a number for each range that results in an oligonucleotide with a total length outside the specified range. In such circumstances, both elements must be met. For example, in certain embodiments, a modified oligonucleotide may be comprised of 15-20 linked nucleosides and have a sugar motif comprised of three regions A, B, and C, where region A is comprised of 2-6 linked nucleosides with a particular sugar motif, region B is comprised of 6-10 linked nucleosides with a particular sugar motif, and region C is comprised of 2-6 linked nucleosides with a particular sugar motif. Such embodiments do not include modified oligonucleotides in which A and C each comprise 6 linked nucleosides and B comprises 10 linked nucleosides (even if the number of nucleosides is allowed within the required ranges for A, B, and C). This is because the total length of such an oligonucleotide would be 22, which exceeds the upper limit (20) for the total length of a modified oligonucleotide.In this specification, when a description of an oligonucleotide does not mention one or more parameters, such parameters are not limited. Thus, a modified oligonucleotide that is described only as having a gapmer sugar motif, without further description, can have any length, internucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0325] Specific conjugate compounds In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3'-terminus and / or 5'-terminus of the oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5'-terminus of the oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5'-terminus of the oligonucleotide.

[0326] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the compound oligonucleotide has a nucleobase sequence complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to a pre-mRNA. In certain embodiments, the oligonucleotide is complementary to a sense transcript.

[0327] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0328] Specific conjugate groups In certain embodiments, oligonucleotides are covalently bound to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.In certain embodiments, the conjugate group imparts new properties to the bound oligonucleotide, such as a fluorophore or reporter group, which allows the detection of the oligonucleotide.

[0329] Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), fatty chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO 2014 / 179620).

[0330] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0331] In certain embodiments, the conjugate moiety comprises an active drug substance such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0332] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain embodiments, the conjugate group is a single chemical bond (i.e., the conjugate moiety is attached to the oligonucleotide via the conjugate linker by a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0333] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0334] In certain embodiments, conjugate linkers, including those described above, are known in the art to be useful for attaching bifunctional linking moieties, such as conjugate groups, to parent compounds, such as the oligonucleotides provided herein. Generally, bifunctional linking moieties contain at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0335] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Included are alkynyls, and a non-limiting list of preferred substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0336] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleoside to be cleaved from the compound after reaching the target tissue. Thus, the linker nucleosides are typically attached to each other and to the remainder of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0337] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where a compound includes an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the compound also includes a conjugate group containing a conjugate linker that includes linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound may include (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group containing 1 to 10 linker nucleosides contiguous with a nucleoside of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is greater than 30. Alternatively, a compound may include a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is 30 or less. Unless otherwise indicated, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0338] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, compounds containing certain conjugate moieties are better taken up by certain cell types, and it is desirable for the conjugate group to be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide upon uptake. Therefore, certain conjugates may typically contain one or more cleavable moieties within the conjugate linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0339] In certain embodiments, the cleavable bond is selected from an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0340] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0341] 3. Specific Cell-Targeting Conjugate Moieties In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula: [ka] (wherein n is 1 to about 3, when n is 1, m is 0, and when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0).

[0342] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0343] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently attached to a branched group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently attached to a branched group.

[0344] In certain embodiments, the cell-targeting moiety comprises a branched-chain group comprising one or more groups selected from an alkyl group, an amino group, an oxo group, an amido group, a disulfide group, a polyethylene glycol group, an ether group, a thioether group, and a hydroxyamino group. In certain embodiments, the branched-chain group comprises a branched-chain aliphatic group comprising a group selected from an alkyl group, an amino group, an oxo group, an amido group, a disulfide group, a polyethylene glycol group, an ether group, a thioether group, and a hydroxyamino group. In certain such embodiments, the branched-chain aliphatic group comprises a group selected from an alkyl group, an amino group, and an ether group. In certain such embodiments, the branched-chain aliphatic group comprises a group selected from an alkyl group, an amino group, and an ether group. In certain such embodiments, the branched-chain aliphatic group comprises a group selected from an alkyl group and an ether group. In certain such embodiments, the branched-chain group comprises a monocyclic or polycyclic ring system.

[0345] In certain embodiments, each tether of the cell targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a straight-chain aliphatic group containing one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a straight-chain aliphatic group containing one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether contains at least one phosphorus linking group or a neutral linking group. In certain embodiments, each tether contains a chain length of about 6 to about 20 atoms. In certain embodiments, each tether contains a chain length of about 10 to about 18 atoms. In certain embodiments, each tether contains a chain length of about 10 atoms.

[0346] In certain embodiments, each ligand of the cell-targeting moiety has affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has affinity for at least one type of receptor on the surface of mammalian hepatocytes. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and fucose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises two GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises one GalNAc ligand.

[0347] In certain embodiments, each ligand of the cell targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, 47, 5798-5808, which are incorporated herein by reference in their entireties). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, the amino sugar can be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycolyl-α-neuraminic acid. For example, the thio sugar can be selected from 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

[0348] In certain embodiments, the conjugate group has the formula: [ka] The cell-targeting moiety comprises:

[0349] In certain embodiments, the conjugate group has the formula: [ka] The cell-targeting moiety comprises:

[0350] In certain embodiments, the conjugate group has the formula: [ka] The cell-targeting moiety comprises:

[0351] In certain embodiments, the compounds described herein comprise a conjugate group described herein as "LICA-1." LICA-1 is shown below, without the optional cleavable moiety at the end of the conjugate linker: [ka]

[0352] In certain embodiments, the compounds described herein comprise LICA-1, and the cleavable moiety in the conjugate linker has the formula: [ka] where "oligo" is an oligonucleotide.

[0353] Representative publications that teach the preparation of the above-mentioned specific conjugate groups and compounds containing conjugate groups, tethers, conjugate linkers, branched groups, ligands, cleavable moieties, and other modifications include, but are not limited to, U.S. Pat. Nos. 5,994,517, 6,300,319, 6,660,720, 6,906,182, 7,262, 7,362, 7,462, 7,562, 7,662, 7,762, 7,862, 7,9 ... ,177, U.S. Patent No. 7,491,805, U.S. Patent No. 8,106,022, U.S. Patent No. 7,723,509, U.S. Patent No. 9,127,276, U.S. Patent Application Publication No. 2006 / 0148740, U.S. Patent Application Publication No. 2011 / 0123520, WO 2013 / 033230 pamphlet and WO 2012 / 037254 pamphlet, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; and Valentijn et al., Tetrahedron, 1997, 53, 759-770, each of which is incorporated herein by reference in its entirety.

[0354] In certain embodiments, the compounds described herein comprise modified oligonucleotides comprising a gapmer or fully modified motif and a conjugate group comprising at least 1, 2, or 3 GalNAc ligands. In certain embodiments, the compound comprises a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al. al., Tetrahedron,1997,53,759-770;Kim et al.,Tetrahedron Lett,1997,38,3487-3490;Lee et al.,Bioconjug Chem,1997,8,762-765;Kato et al.,Glycobiol,2001,11,821-829;Rensen et al. al.,J Biol Chem,2001,276,37577-37584;Lee et al.,Methods Enzymol,2003,362,38-43;Westerlind et al.,Glycoconj J,2004,21,227-241;Lee et al.,Bioorg Med Chem Lett,2006,16(19),5132-5135;Maierhofer et al.,Bioorg Med Chem,2007,15,7661-7676;Khorev et al.,Bioorg Med Chem,2008,16,5216-5231;Lee et al.,Bioorg Med Chem,2011,19,2494-2500;Kornilova et al.,Analyt Biochem,2012,425,43-46;Pujol et al.,Angew Chemie Int Ed Engl,2012,51,7445-7448;Biessen et al.,J Med Chem,1995,38,1846-1852;Sliedregt et al.,J Med Chem,1999,42,609-618;Rensen et al.,J Med Chem,2004,47,5798-5808;Rensen et al.,Arterioscler Thromb Vasc Biol,2006,26,169-175;van Rossenberg et al.,Gene Ther,2004,11,457-464;Sato et al.,J Am Chem Soc,2004,126,14013-14022;Lee et al.,J Org Chem,2012,77,7564-7571;Biessen et al.,FASEB J,2000,14,1784-1792;Rajur et al.,Bioconjug Chem,1997,8,935-940;Duff et al. al.,Methods Enzymol,2000,313,297-321;Maier et al.,Bioconjug Chem,2003,14,18-29;Jayaprakash et al.,Org Lett,2010,12,5410-5413;Manoharan,Antisense Nucleic Acid Drug Dev,2002,12,103-128;Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; WO 1998 / 013381; WO 2011 / 038356; WO 1997 / 046098; WO 2008 / 098788; WO 2004 / 101619; WO 2012 / 037254; WO 2011 / 120053; WO 2011 / 100131;International Publication No. WO 2011 / 163121; International Publication No. WO 2012 / 177947; International Publication No. WO 2013 / 033230; International Publication No. WO 2013 / 075035; International Publication No. WO 2012 / 083185; International Publication No. WO 2012 / 083046; International Publication No. WO 2009 / 082607; International Publication No. WO 2009 / 134487; International Publication No. WO 2010 / 144740; International Publication No. WO 2010 / 148013; International Publication No. WO 997 / 020563; WO 2010 / 088537; WO 2002 / 043771; WO 2010 / 129709; WO 2012 / 068187; WO 2009 / 126933; WO 2004 / 024757; WO 2010 / 054406; WO 2012 / 089352; WO 2012 / 089602; WO 2013 / 16 6121; WO 2013 / 165816; U.S. Pat. No. 4,751,219; U.S. Pat. No. 8,552,163; U.S. Pat. No. 6,908,903; U.S. Pat. No. 7,262,177; U.S. Pat. No. 5,994,517; U.S. Pat. No. 6,300,319; U.S. Pat. No. 8,106,022; U.S. Pat. No. 7,491,805; U.S. Pat. No. 7,491,805; U.S. Pat. No. 7,582,744; U.S. Pat. No. 8,137,695; U.S. Pat. US Patent Nos. 6,383,812; US Patent No. 6,525,031; US ​​Patent No. 6,660,720; US Patent No. 7,723,509; US Patent No. 8,541,548; US Patent No. 8,344,125; US Patent No. 8,313,772; US Patent No. 8,349,308; US Patent No. 8,450,467; US Patent No. 8,501,930; US Patent No. 8,158,601; US ​​Patent No. 7,262,177; US Patent No. 6,906,182;U.S. Patent Nos. 6,620,916; 8,435,491; 8,404,862; 7,851,615; U.S. Patent Application Publication Nos. 2011 / 0097264; 2011 / 0097265; 2013 / 0004427; 2005 / 0164235; 2006 / 0148740; 2008 / 0281044 No. 2010 / 0240730; U.S. Patent Application Publication No. 2003 / 0119724; U.S. Patent Application Publication No. 2006 / 0183886; U.S. Patent Application Publication No. 2008 / 0206869; U.S. Patent Application Publication No. 2011 / 0269814; U.S. Patent Application Publication No. 2009 / 0286973; U.S. Patent Application Publication No. 2011 / 0207799; U.S. Patent Application Publication No. 2012 / 0136042; U.S. Patent Application Publication No. 2012 / 0 165393; U.S. Patent Application Publication No. 2008 / 0281041; U.S. Patent Application Publication No. 2009 / 0203135; U.S. Patent Application Publication No. 2012 / 0035115; U.S. Patent Application Publication No. 2012 / 0095075; U.S. Patent Application Publication No. 2012 / 0101148; U.S. Patent Application Publication No. 2012 / 0128760; U.S. Patent Application Publication No. 2012 / 0157509; U.S. Patent Application Publication No. 2012 / 0230938; U.S. Patent Application Publication No. US Patent Application Publication No. 2013 / 0109817; US Patent Application Publication No. 2013 / 0121954; US Patent Application Publication No. 2013 / 0178512; US Patent Application Publication No. 2013 / 0236968; US Patent Application Publication No. 2011 / 0123520; US Patent Application Publication No. 2003 / 0077829; US Patent Application Publication No. 2008 / 0108801; and US Patent Application Publication No. 2009 / 0203132, each of which is incorporated by reference in its entirety.

[0355] Compositions and methods for formulating pharmaceutical compositions The compounds described herein may be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0356] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of a compound and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. The compositions and methods for formulating pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0357] The compounds described herein that target PNPLA3 nucleic acid can be used in pharmaceutical compositions by combining the compounds with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, a pharmaceutical composition comprising a compound that targets PNPLA3 nucleic acid and a pharmaceutically acceptable diluent is used in the methods described herein. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0358] Pharmaceutical compositions containing the compounds provided herein include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that, upon administration to an animal, including a human, can provide (directly or indirectly) a biologically active metabolite or residue thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of the compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0359] Prodrugs may involve the incorporation at one or both ends of the compound of additional nucleosides that are cleaved by endogenous nucleases in the body to form the active compound.

[0360] In certain embodiments, the compound or composition further comprises a pharmaceutically acceptable carrier or diluent.

[0361] Certain selected compounds Approximately 2,384 newly designed compounds of various lengths, chemical structures, and motifs were tested in vitro in several cell types for their effects on human PNPLA3 mRNA (Example 1). Of the 2,384 compounds tested for single-dose efficacy in vitro, over 400 selected compounds were tested for dose-dependent inhibition in A431 cells (Example 2). Of the over 400 compounds tested by dose-response assay, the compounds were further screened for high-dose tolerability in a BALB / c mouse model, and 87 oligonucleotides were selected for in vivo efficacy in a PNPLA3 transgenic mouse model.

[0362] Of the 87 oligonucleotides tested in the transgenic mouse model, 23 were selected for further tolerability testing in the preclinical Rodel model. In the in vivo rodent tolerability model, body and organ weights, liver function markers (such as alanine transaminase, aspartate transaminase, and bilirubin), and kidney function markers (such as BUN and creatinine) were measured. In the CD1 mouse model and Sprague-Dawley rat model, IONs 975591, 975605, 975612, 975613, 975616, 975617, 975735, 975736, 994282, and 994284 were found to be tolerable (Examples 5 and 6).

[0363] These compounds were further tested for efficacy in a multi-dose assay in PNPLA3 transgenic mice (Example 7).

[0364] IONs 994284, 97605, 975616, 994282, 975613, 975617, 975735, 975736 and 975612 were tested for tolerability in cynomolgus monkeys (Example 8). Treatment with the compounds was well tolerated in the monkeys.

[0365] Thus, provided herein are compounds having any one or more of the improved properties. In certain embodiments, the compounds described herein are potent and tolerable. [Example]

[0366] The following example describes the screening process for identifying lead compounds that target PNPLA3. IONs 994284, 97605, 975616, 994282, 975613, 975617, 975735, 975736, and 975612 provided high efficacy and tolerability.

[0367] Non-Limiting Disclosure and Incorporation by Reference Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice, these sequences may be modified by any combination of chemical modifications. Those of skill in the art will readily recognize that designations such as "RNA" or "DNA" to describe modified oligonucleotides are, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH as opposed to the natural 2'-H in DNA) or an RNA with a modified base (thymine (methylated uracil) as opposed to the natural uracil in RNA).

[0368] Thus, the nucleic acid sequences provided herein, including but not limited to those in the Sequence Listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those nucleic acids with modified nucleobases. As a further example, and without limitation, an oligonucleotide having the nucleobase sequence "ATCGATCG" encompasses all oligonucleotides having such a nucleobase sequence, whether modified or unmodified, including but not limited to such compounds containing RNA bases, e.g., those having the sequence "AUCGAUCG," some DNA bases and some RNA bases, e.g., "AUCGATCG," as well as other modified nucleobases, e.g., "AT m CGAUCG" ( m C represents a cytosine base containing a methyl group at the 5-position).

[0369] Certain compounds (e.g., modified oligonucleotides) described herein possess one or more asymmetric centers, which give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), e.g., as α or β for sugar anomers, or as (D) or (L) for amino acids, etc. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the indicated compound. Compounds provided herein that are depicted or described without a defined stereochemistry include all such possible isomers, including stereorandom and optically pure forms thereof. Similarly, unless otherwise indicated, all tautomeric forms of the compounds provided herein are included. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

[0370] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein containing hydrogen atoms include:1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 Examples include S.

[0371] While the specific compounds, compositions, and methods described herein have been described with properties in accordance with particular embodiments, the following examples serve only to illustrate, but are not intended to limit, the compounds described herein. Each of the references cited in this application is incorporated herein by reference in its entirety.

[0372] Example 1: Antisense inhibition of human PNPLA3 in A431 cells Design antisense oligonucleotides that target PNPLA3 nucleic acid, and test their effect on PNPLA3 mRNA in vitro.Antisense oligonucleotides are tested in a series of experiments with similar culture conditions.The results of each experiment are shown in separate tables below.

[0373] The newly designed chimeric antisense oligonucleotides in the table below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments containing three nucleosides in the 5' and 3' directions. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosine.

[0374] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below targets either the human PNPLA3 mRNA, designated herein as SEQ ID NO: 1 (GenBank Accession No. NM_025225.2), or the human PNPLA3 genomic sequence, designated herein as SEQ ID NO: 2 (GenBank Accession No. NC_000022.11, truncated from nucleotides 43921001 to 43954500). "n / a" indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0375] Test 1 A431 cells cultured at a density of 20,000 cells per well were transfected with 4,000 nM of antisense oligonucleotide by free uptake. After approximately 24 hours of treatment, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS36070 (forward sequence CCTTGGTATGTTCCTGCTTCA, herein designated SEQ ID NO: 11; reverse sequence GTTGTCACTCACTCCTCCATC, herein designated SEQ ID NO: 12; probe sequence TGGCCTTATCCCTCCTTCCTTCAGA, herein designated SEQ ID NO: 13) was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to the total RNA content measured by RIBOGREEN®. Results are shown as the percentage inhibition of PNPLA3 relative to untreated control cells.

[0376] [Table 1]

[0377] [Table 2]

[0378] [Table 3]

[0379] [Table 4]

[0380] [Table 5]

[0381] [Table 6]

[0382]

Table 7

[0383]

Table 8

[0384]

Table 9

[0385]

Table 10

[0386]

Table 11

[0387]

Table 12

[0388]

Table 13

[0389]

Table 14

[0390]

Table 15

[0391] Table 16

[0392] Table 17

[0393]

Table 18

[0394] Table 19

[0395] Table 20

[0396] Table 21

[0397] Table 22

[0398] Table 23

[0399] Table 24

[0400] Table 25

[0401] Table 26

[0402] Table 27

[0403] Table 28

[0404] Table 29

[0405] Table 30

[0406] Table 31

[0407] Table 32

[0408]

Table 33

[0409] Table 34

[0410] Table 35

[0411] Table 36

[0412] Table 37

[0413] Table 38

[0414] Table 39

[0415] Table 40

[0416] Table 41

[0417] Table 42

[0418] Table 43

[0419] Table 44

[0420] Table 45

[0421] Table 46

[0422] Table 47

[0423] Table 48

[0424] Table 49

[0425] Table 50

[0426] Table 51

[0427] Table 52

[0428] Table 53

[0429] Table 54

[0430] Table 55

[0431] Table 56

[0432] Table 57

[0433] Table 58

[0434] Table 59

[0435] Table 60

[0436] Table 61

[0437] Table 62

[0438] Table 63

[0439] Table 64

[0440] Table 65

[0441] Table 66

[0442] Table 67

[0443] Table 68

[0444] Table 69

[0445] [Table 70]

[0446] Human primer probe set RTS36075 (forward sequence TGAGGCTGGAGGGAGATG, designated herein as SEQ ID NO: 14; reverse sequence GCTCATGTATCCACCTTTGTCT, designated herein as SEQ ID NO: 15; probe sequence CTAGACCACCTGCGTCTCAGCATC, designated herein as SEQ ID NO: 16) was also used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of PNPLA3 relative to untreated control cells.

[0447] [Table 71]

[0448] [Table 72]

[0449] [Table 73]

[0450] [Table 74]

[0451] [Table 75]

[0452] [Table 76]

[0453] Test 2 A431 cells cultured at a density of 5,000 cells per well were transfected with 1,000 nM of antisense oligonucleotide by free uptake. After approximately 24 hours of treatment, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS36070 was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are shown as the percentage inhibition of PNPLA3 relative to untreated control cells.

[0454] [Table 77]

[0455] [Table 78]

[0456] [Table 79]

[0457] [Table 80]

[0458] [Table 81]

[0459] [Table 82]

[0460] [Table 83]

[0461] Table 84

[0462] Table 85

[0463] Table 86

[0464] Table 87

[0465] Table 88

[0466] Table 89

[0467] Table 90

[0468]

Table 91

[0469] Table 92

[0470] Table 93

[0471] [Table 94]

[0472] [Table 95]

[0473] [Table 96]

[0474] [Table 97]

[0475] [Table 98]

[0476] [Table 99]

[0477] Example 2: Dose-dependent antisense inhibition of human PNPLA3 in A431 cells Gapmers from Example 1 that showed significant in vitro inhibition of PNPLA3 mRNA were selected and tested at various doses in A431 cells. Antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are shown in separate tables below. Cells were seeded at a density of 10,000 cells per well and transfected by free uptake with different concentrations of antisense oligonucleotides, as specified in the table below. After approximately 16 hours of treatment, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS36070 was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to the total RNA content measured by RIBOGREEN®. Results are shown as the percentage inhibition of PNPLA3 relative to untreated control cells.

[0478] The half-maximal inhibitory concentration (IC 50 ) PNPLA3 mRNA levels were significantly reduced in cells treated with antisense oligonucleotides in a dose-dependent manner.

[0479] [Table 100]

[0480] [Table 101]

[0481] [Table 102]

[0482] [Table 103]

[0483] [Table 104]

[0484] Table 105

[0485] Table 106

[0486] Table 107

[0487] Table 108

[0488] Table 109

[0489] Table 110

[0490] Table 111

[0491] Table 112

[0492] Table 113

[0493] Table 114

[0494] [Table 115]

[0495] [Table 116]

[0496] [Table 117]

[0497] [Table 118]

[0498] [Table 119]

[0499] [Table 120]

[0500] [Table 121]

[0501] [Table 122]

[0502] Example 3: Tolerance of modified oligonucleotides targeting human PNPLA3 in BALB / c mice BALB / c mice are a versatile mouse model frequently used for safety and efficacy studies. Mice were treated with selected antisense oligonucleotides from the studies described above, and changes in the levels of various plasma chemical markers were assessed.

[0503] Selected Ionis oligonucleotides from the above studies were conjugated with a 3'-THA-C6-GalNAc3-(3R,5S)-5-(hydroxymethyl)pyrrolidin-3-olphosphate end cap (hereafter referred to as 3'-THA).

[0504] treatment Groups of 6-7 week old male mice received a single subcutaneous injection of 200 mg / kg of modified oligonucleotide. One group of male BALB / c mice was injected with PBS. Mice were euthanized 72-96 hours after the single injection, and plasma was collected for further analysis.

[0505] To evaluate the effects of modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). Modified oligonucleotides that caused changes in transaminase levels outside the range expected for antisense oligonucleotides were excluded from further testing. Oligonucleotides deemed tolerable in this study and selected for further evaluation are listed in the table below. "Parent Oligo" refers to the Ionis oligonucleotide described in the study above and conjugated to 3'-THA and tested in this study.

[0506] [Table 123]

[0507] [Table 124]

[0508] [Table 125]

[0509] [Table 126]

[0510] Example 4: Effect of antisense inhibition of PNPLA3 in a transgenic mouse model We used a PNPLA3 transgenic mouse model derived from wild-type C57BL / 6 mice generated by the University of California, Irvine. The mouse model contains a genomic construct containing the entire fosmid of the PNPLA3 gene, kindly provided by the University of Washington. We evaluated the efficacy of Ionis oligonucleotides in this model.

[0511] treatment Transgenic mice were maintained on a 12-hour light-dark cycle and fed regular Purina mouse chow ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. Antisense oligonucleotides (ASOs) were prepared in buffered saline (PBS) and sterilized by filtration through a 0.2 micron filter. For injection, oligonucleotides were dissolved in 0.9% PBS.

[0512] hPNPLA3 Tg mice were divided into groups of two mice each. Groups received subcutaneous injections of Ionis oligonucleotide at a dose of 2.5 mg / kg on days 1 and 8. One group of four mice received subcutaneous injections of PBS on days 1 and 8. A saline-injected group served as a control group for comparison of the oligonucleotide-treated groups.

[0513] RNA analysis On day 10, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. PNPLA3 mRNA levels were measured using both primer probe sets RTS36070 and RTS36075. Results are shown as percent change in mRNA relative to the PBS control, normalized to RIBOGREEN®. As shown in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant decrease in PNPLA3 mRNA compared to the PBS control. A "0" indicates that the oligonucleotide did not inhibit mRNA expression.

[0514] [Table 127]

[0515] [Table 128]

[0516] [Table 129]

[0517] Example 5: Tolerance of modified oligonucleotides targeting human PNPLA3 in CD1 mice CD1® mice (Charles River, MA) are a versatile mouse model frequently utilized for safety and efficacy studies. Mice were treated with selected Ionis antisense oligonucleotides from the studies described above and assessed for changes in the levels of various plasma chemistry markers.

[0518] Selected Ionis oligonucleotides from the above study were conjugated with a 5'-trishexylamino-(THA)-C6GalNAC3 end cap (hereafter referred to as 5'-THA). The Ionis oligonucleotides tested are listed in the table below. "Unconjugated parent ION number" refers to the Ionis oligonucleotide described in the in vitro study above, with the same sequence. "3'-THA counterpart ION number" refers to the 3'-THA conjugated oligonucleotide evaluated in the mouse study above, with the same sequence.

[0519] [Table 130]

[0520] treatment Groups of four CD1 mice each received a weekly subcutaneous injection of 15 mg / kg Ionis oligonucleotide on day 4 with one loading dose (8 doses total) for six weeks. One group of male CD1 mice received subcutaneous injections of PBS for six weeks. Mice were euthanized 48 hours after the final dose, and organs and plasma were collected for further analysis.

[0521] Plasma chemistry markers To assess the effects of Ionis oligonucleotides on liver and kidney function, plasma levels of transaminases (ALT and AST), albumin, total bilirubin, and creatinine were measured at week 3 using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). The results are shown in the table below. Ionis oligonucleotides that caused changes in the levels of any liver or kidney function markers outside the range expected for an antisense oligonucleotide were excluded from further testing.

[0522] [Table 131]

[0523] Hematology Assays At week 6, blood from select groups of mice was sent to IDEXX BioResearch for platelet count measurements. The results are shown in the table below. Ionis oligonucleotides that caused changes in platelet counts outside the range expected for antisense oligonucleotides were excluded from further testing.

[0524] [Table 132]

[0525] Example 6: Tolerance of modified oligonucleotides targeting human PNPLA3 in Sprague-Dawley rats Sprague-Dawley rats are a versatile model used to evaluate safety and efficacy. Rats were treated with Ionis antisense oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

[0526] treatment Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow, diet5001, ad libitum. Groups of four Sprague-Dawley rats each received a weekly subcutaneous injection of 15 mg / kg Ionis oligonucleotides with a single loading dose on day 4 (8 doses total) for 6 weeks. 48 hours after the final dose, rats were euthanized and organs and plasma were collected for further analysis.

[0527] Plasma chemistry markers To evaluate the effects of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured, and the results, expressed in IU / L, are shown in the table below. Plasma levels of bilirubin, creatinine, albumin, and BUN were also measured using the same clinical chemistry analyzer, and the results, expressed in mg / dL, are also shown in the table below. Ionis oligonucleotides that caused changes in the levels of any liver function markers outside the range expected for antisense oligonucleotides were excluded from further testing.

[0528] [Table 133]

[0529] renal function To assess the effects of Ionis oligonucleotides on renal function, urinary levels of protein and creatinine were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). The ratios of total protein to creatinine are shown in the table below. Ionis oligonucleotides that caused changes in ratio levels outside the range expected for antisense oligonucleotides were excluded from further testing.

[0530] [Table 134]

[0531] Organ weight Liver, heart, spleen, and kidney weights were measured at the end of the study and are shown in the table below. Ionis oligonucleotides that caused any changes in organ weight outside the range expected for an antisense oligonucleotide were excluded from further study.

[0532] [Table 135]

[0533] Example 7: Effect of antisense inhibition of PNPLA3 in a transgenic mouse model Ionis oligonucleotides were tested in a multi-dose assay in the hPNPLA3 Tg model.

[0534] treatment Transgenic mice were maintained on a 12-hour light-dark cycle and fed regular Purina mouse chow ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. Antisense oligonucleotides (ASOs) were prepared in buffered saline (PBS) and sterilized by filtration through a 0.2 micron filter. For injection, oligonucleotides were dissolved in 0.9% PBS.

[0535] Test 1 hPNPLA3 Tg mice were divided into groups of four mice each. Groups received weekly subcutaneous injections of Ionis oligonucleotides at doses of 5 mg / kg, 1 mg / kg, or 0.25 mg / kg, administered on days 1, 5, 8, 15, and 23. One group of four mice received subcutaneous injections of PBS on days 1, 5, 8, 15, and 23. A saline-injected group served as a control group for comparison of the oligonucleotide-treated groups.

[0536] RNA analysis On day 26, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. PNPLA3 mRNA levels were measured using both primer probe sets RTS36070 and RTS36075. Results are shown as percent change in mRNA relative to the PBS control, normalized to RIBOGREEN®. As shown in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant dose-dependent decrease in PNPLA3 mRNA compared to the PBS control.

[0537] [Table 136]

[0538] Test 2 hPNPLA3 Tg mice were divided into groups of four mice each. Groups received weekly subcutaneous injections of Ionis oligonucleotides at doses of 5 mg / kg, 2.5 mg / kg, 1 mg / kg, 0.5 mg / kg, or 0.25 mg / kg, administered on days 1, 5, 8, 15, and 23. One group of four mice received subcutaneous injections of PBS on days 1, 5, 8, 15, and 23. A saline-injected group served as a control group for comparison of the oligonucleotide-treated groups.

[0539] RNA analysis On day 26, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. PNPLA3 mRNA levels were measured using both primer probe sets RTS36070 and RTS36075. Results are shown as percent change in mRNA relative to the PBS control, normalized to RIBOGREEN®. As shown in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant dose-dependent decrease in PNPLA3 mRNA compared to the PBS control.

[0540] [Table 137]

[0541] Example 8: Effects of modified oligonucleotides targeting human PNPLA3 in cynomolgus monkeys Cynomolgus monkeys were treated with selected Ionis antisense oligonucleotides from the studies described in the Examples above. The tolerability of the antisense oligonucleotides was assessed.

[0542] treatment Prior to testing, monkeys were housed in an isolation facility, during which time they were observed daily for overall health. Monkeys were 2-4 years old and weighed 2-4 kg. Nine groups of five male cynomolgus monkeys were randomly assigned to receive subcutaneous injections of Ionis oligonucleotide or PBS in a clockwise fashion between four different sites on their backs. Monkeys received 10 mg / kg of Ionis oligonucleotide twice weekly (days 1, 5, 9, and 14) for the first two weeks, followed by once weekly for the next 10 weeks on days 21, 28, 35, 42, 49, 56, 63, 70, 77, and 84. A control group of five cynomolgus monkeys was injected with PBS in a similar manner and served as a control group.

[0543] During the study, monkeys were observed twice daily for signs of illness or distress. Any animals showing more than transient or mild pain or distress due to treatment, injury, or disease were treated with approved analgesics or medications to relieve pain by veterinary staff after consultation with the study director. Any animals in poor health or likely to be moribund were identified for further observation and possible euthanasia. On day 86, approximately 48 hours after the final dose, designated animals were euthanized by exsanguination while under deep anesthesia. The protocols described in the examples were approved by the Institutional Animal Care and Use Committee (IACUC).

[0544] Body and organ weight measurements Body and organ weights were measured to assess the effect of Ionis oligonucleotides on the animals' overall health. Body and organ weights were measured on day 86, and the data are shown in the table below. The results indicate that the effects of antisense oligonucleotide treatment on body and organ weights were within the range expected for antisense oligonucleotides. Notably, treatment with ION 945616 was well tolerated in terms of body and organ weight in the monkeys.

[0545] [Table 138]

[0546] Liver function To evaluate the effects of Ionis oligonucleotides on liver function, blood samples were collected from all study groups on Day 86. Monkeys were fasted overnight before blood collection. Blood was collected in tubes without anticoagulants to separate the serum. The tubes were kept at room temperature for at least 90 minutes and then centrifuged at 3,000 rpm for 10 minutes to obtain serum. Various levels of liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Corporation, Japan). Plasma levels of ALT and AST were measured and the results, expressed in IU / L, are shown in the table below. Bilirubin, a liver function marker, was similarly measured and expressed in mg / dL and is shown in the table below. The results demonstrate that the antisense oligonucleotides did not have any effects on liver function outside the range expected for antisense oligonucleotides.

[0547] [Table 139]

[0548] renal function To evaluate the effects of Ionis oligonucleotides on renal function, blood samples were collected from all study groups on day 86. Monkeys were fasted overnight before blood collection. Blood was collected in tubes without anticoagulants to separate serum. The tubes were kept at room temperature for at least 90 minutes, then centrifuged at 3,000 rpm for 10 minutes to obtain serum. BUN and creatinine levels were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Corporation, Japan). The results, expressed in mg / dL, are shown in the table below.

[0549] Plasma chemistry data demonstrate that the majority of Ionis oligonucleotides did not have any effects on renal function outside the range expected for antisense oligonucleotides.

[0550] [Table 140]

[0551] hematology To evaluate any effects of Ionis oligonucleotides on hematological parameters in cynomolgus monkeys, blood samples consisting of approximately 0.5 mL of blood were collected from each available test animal on Day 86. Samples were collected in tubes containing K2-EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cell (WBC) count, individual white blood cell counts (e.g., monocyte, neutrophil, and lymphocyte counts), platelet count, hemoglobin content, and hematocrit using an ADVIA2120i hematology analyzer (Siemens, USA).

[0552] The data show that the oligonucleotides did not cause any changes in blood parameters outside the range expected for antisense oligonucleotides at this dose.

[0553] [Table 141]

[0554] [Table 142]

[0555] Pro-inflammatory protein analysis To assess any inflammatory effects of Ionis oligonucleotides in cynomolgus monkeys, blood samples were collected for analysis. Monkeys were fasted overnight before blood collection. Approximately 1.5 mL of blood was collected from each animal and placed into tubes without anticoagulants for serum isolation. The tubes were kept at room temperature for at least 90 minutes, then centrifuged at 3,000 rpm for 10 minutes at room temperature to obtain serum. C-reactive protein (CRP), which is synthesized in the liver and serves as a marker of inflammation, and complement C3 were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Corporation, Japan).

[0556] Example 9: Viscosity measurement of antisense oligonucleotides targeting human PNPLA3 The viscosity of selected antisense oligonucleotides from the above test was measured to screen out antisense oligonucleotides with a viscosity greater than 40 centipoise (cP). Oligonucleotides with a viscosity greater than 40 cP have a viscosity lower than the optimal viscosity.

[0557] Oligonucleotides (32–35 mg) were weighed into glass vials, 120 μL of water was added, and the vials were heated to 50°C to dissolve the antisense oligonucleotides into solution. A portion of the preheated sample (75 μL) was pipetted into a microviscometer (Cambridge). The temperature of the microviscometer was set to 25°C to measure the viscosity of the sample. Another portion of the preheated sample (20 μL) was pipetted into 10 mL of water for a UV reading at 260 nM and 85°C (Cary UV instrument). The results are shown in the table below, where the concentration of each antisense oligonucleotide was 200 mg / mL, and the majority of the antisense oligonucleotide solutions showed optimal viscosity under the criteria described above.

[0558] [Table 143]

[0559] Example 10: Design of oligonucleotides at the site of ION 975616 An additional antisense oligonucleotide was designed to target PNPLA3 nucleic acids that overlaps the target site of ION 916333. This antisense oligonucleotide is an unconjugated version of ION 975616 and has a different chemical modification and motif.

[0560] The newly designed chimeric antisense oligonucleotides in the table below were designed as 3-10-3cEt gapmers or deoxy, MOE, and cEt oligonucleotides. The 3-10-3cEt gapmers are 16 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments containing three nucleosides in the 5' and 3' directions. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosine. The deoxy, MOE, and (S)-cEt oligonucleotides are 16 nucleosides in length, with nucleosides having either an MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The "Chemical Structure" column lists the sugar modification of each oligonucleotide. "k" indicates an (S)-cEt sugar modification, "d" indicates a deoxyribose, the number after "d" indicates the number of deoxyribose residues, and "e" indicates an MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosine. The "Start Site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence (SEQ ID NO: 2).

[0561] [Table 144]

[0562] Oligonucleotides were tested in a series of experiments. A-431 cells cultured at a density of 10,000 cells per well were treated by free uptake with modified oligonucleotides diluted to different concentrations. After approximately 48 hours of treatment, PNPLA3 mRNA levels were measured as previously described using the human PNPLA3 primer probe set RTS36070. PNPLA3 mRNA levels were adjusted according to the total RNA content measured by RIBOGREEN®. The IC of the oligonucleotides 50 IC of reference oligonucleotide relative to 50 The IC of the assay is the ratio 50 The ratios are shown in the table below: Thus, a higher ratio value indicates that the oligonucleotide is more active than the reference.

[0563] [Table 145]

[0564] Example 11: Screening and selection of antisense oligonucleotides against human PNPLA3 S-restricted ethyl (cET) modified 16-mer antisense oligonucleotides (ASOs) targeting the human Pnpla3 gene were screened and tested for efficacy in human HepG2 cells delivered by electroporation. The human cET ASO (5'-GAGTTAAGTGCTGGAC-3'; SEQ ID NO: 115) was selected for all subsequent pharmacological studies. A chemically matched scrambled control ASO (5'-GGCCAATACGCCGTCA-3'; SEQ ID NO: 115) was also selected for all subsequent pharmacological studies. 2176 ) was used to demonstrate the specificity of the target knockdown.

[0565] HepG2 cells were purchased from ATCC® (Manassas, VA). After thawing, cells were seeded into T-75 flasks and grown in minimum essential medium (MEM) containing 10% fetal bovine serum (FBS) (HyClone Laboratories, Logan, UT).

[0566] Cells were plated in 6-well or 24-well plates with cover slips for Oil Red O (ORO) staining. Cells were then incubated in MEM (2% FBS) and transfected with control or PNPLA3 ASO (1 μM), or control siRNA or PNPLA3 siRNA (10 nM) for 24 hours using Lipofectamine 3000 (Thermo Scientific, Waltham, MA) according to the manufacturer's instructions. Cells were then incubated in MEM (without FBS) for 24 hours and transfected anew. Control siRNA was a mixture of two negative control siRNA molecules (Ambion, Thermo Scientific, Waltham, MA). PNPLA3 siRNA was a mixture of three siRNA molecules (5'-GGUCCUCUCAGAUCUUGUGtt-3' (SEQ ID NO: 1)). 2173 ); 5'-GGAGUGAGUGACAACGUACtt-3' (SEQ ID NO: 2174 ); 5'-GGUUCUUGGAAGAGAAGGGtt-3' (SEQ ID NO: 2175 ) (Ambion, Thermo Scientific, Waltham, MA).

[0567] For Oil Red O (ORO) staining, images were acquired at 100x magnification using an Axio KS 400 Imaging System and Axio Vision 4.8 Software (Zeiss, Oberkochen, Germany). The ORO-stained area was quantified using BioPix iQ 2.1.4 software (BioPix AB, Gothenburg, Sweden).

[0568] Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Valencia, CA). First-strand complementary DNA was synthesized from the RNA using a reverse transcription kit (Applied Biosystems, Foster City, CA). PNPLA3 and β-actin mRNA expression in HepG2 cells transfected with control ASO, PNPLA3 ASO, control siRNA, or PNPLA3 siRNA was assessed by real-time quantitative polymerase chain reaction (PCR). TaqMan probes (PNPLA3 probe: Hs00228747_m1; β-actin probe: Hs01060665_g1) and master mix (Life Technologies, Carlsbad, CA) were used according to the manufacturer's protocol. Real-time quantitative PCR assays were performed using a CFX Real-Time PCR Detection System (Bio-Rad, Hercules, CA).

[0569] To verify whether knockdown of the PNPLA3 148M mutant protein affects intracellular triglyceride content, we silenced PNPLA3 in HepG2 cells (homozygous for the PNPLA3 148M / M mutation) using ASO and siRNA as described herein. Using the PNPLA3 ASO, we achieved approximately a 70% reduction in endogenous PNPLA3 mRNA expression (Figure 1A). When examining intracellular triglycerides by ORO staining, we observed a 40% reduction in intracellular lipid content by the PNPLA3 ASO (Figure 1B, C). To independently confirm these data, we silenced PNPLA3 in these cells using siRNA, and consistent results were observed (Figure 1D-F).

[0570] Example 12: Antisense oligonucleotide treatment of wild-type and PNPLA3 I148M knock-in mice The materials and methods used in the examples herein are further described in Linden et al., Molecular Metabolism 22:49-61, 2019, which is incorporated herein by reference in its entirety.

[0571] S-restricted ethyl (cET) modified 16mer ASOs targeting the mouse Pnpla3 gene were screened and tested for efficacy in primary mouse embryonic cortical neurons by free uptake. All subsequent pharmacological studies included the potent mouse ASO (5'-TATTTTTGGTGTATCC-3'; SEQ ID NO: 16). 2177 ) cET ASO lead was selected. This murine Pnpla3 ASO was modified by 5'-conjugation with tri-antennary N-acetylgalactosamine (GalNAc3) to further enhance in vivo hepatocyte targeting after subcutaneous administration. A chemically matched scrambled control GalNAc3-conjugated ASO (5'-GGCCAATACGCCGTCA-3'; SEQ ID NO: 1) was also selected. 2178 ) was used to demonstrate the specificity of target knockdown. A control GalNAc3-conjugated ASO administered at 10 mg / kg / week for 6 weeks to mice fed a NASH-inducing diet (D09100301, Research Diets, New Brunswick, NJ) had no effect on body weight gain, liver weight, plasma alanine aminotransferase (ALT), or liver triglyceride content compared with saline vehicle controls.

[0572] All animal experiments are conducted under humane conditions and approved by the Gothenburg Ethics Committee for Experimental Animals, Sweden. The facility is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).

[0573] The human PNPLA3 I148M mutation was introduced into the mouse Pnpla3 gene by homologous recombination, replacing the isoleucine codon at amino acid 148 with a methionine codon. Founder mice were backcrossed with C57BL / 6N female mice to generate heterozygous Pnpla3 148I / M mice. Sequence-confirmed heterozygous Pnpla3 148I / M mice were intercrossed to generate homozygous Pnpla3 148M / M mice for experiments and wild-type littermates (Pnpla3 148I / I) as controls for dietary challenge and ASO pharmacology studies. The correct genotypes of all experimental animals were confirmed by PCR before and after the study. Several experimental animals were also confirmed by cDNA sequencing. All animals were housed in transparent Makrolon cages with aspen wood chips as bedding, and the holding facility was temperature (21±1°C) and humidity (50±10%) controlled. Mice had free access to tap water and food on a 12-hour day-night cycle.

[0574] Female Pnpla3 148M / M mice (n = 21) and wild-type littermates (n = 19) (6–8 weeks of age) were fed a high-sucrose diet (70% sucrose diet; TD98090, Envigo, Huntingdon, UK) for 15 weeks. Female mice were used in this study to replicate the model established by Smagris et al. (Hepatology 61(1):108–118, 2015), who used female animals in their own high-sucrose diet experiments. Furthermore, in pilot experiments, female mice accumulated more triglycerides in the liver compared to male mice when fed this diet. Furthermore, female mice fed a high-sucrose diet accumulated more liver triglycerides than mice fed a normal chow diet containing (by energy percentage) 12% fat, 62% carbohydrate, and 26% protein (3 kcal / g total energy content (R3; Lactamin, Kimstad, Sweden)). After 5 weeks of high-sucrose diet, liver lipid levels were assessed using a magnetic resonance imaging (MRI)-derived marker, proton density fat fraction (PDFF). Subsequently, before treatment began, mice were assigned to GalNAc3-conjugated ASO test groups (n = 9–12 animals / group) based on random stratification of body weight and liver lipid content. During the final 8 weeks of the study, groups of mice received either control ASO or Pnpla3 ASO (administered at 5 mg / kg / week by subcutaneous injection twice weekly with saline as vehicle). Six weeks after ASO administration, liver lipid levels were again assessed using MRI. Non-fasted mice were metabolically synchronized for 24 hours by fasting from 8:00 AM to 8:00 PM, followed by re-feeding ad libitum from 8:00 PM to 8:00 AM, before being euthanized between 8:00 AM and 10:00 AM. Mice were euthanized with isoflurane (Forene, Abbot Scandinavia AB, Sweden), blood was collected, plasma was separated, and livers were harvested and sections (identical location of the left lobe in all mice) were fixed in 4% formaldehyde in PBS for histological examination or snap-frozen in liquid N2 and stored at -80°C.

[0575] Male Pnpla3 148M / M mice (n = 17) and wild-type littermates (n = 17) (6–8 weeks of age) were fed a high-fat (40% with 18% trans fat), high-carbohydrate (40% with 20% fructose), and high-cholesterol (2%) diet (NASH diet; D09100301, Research Diets, New Brunswick, NJ) for 26 weeks. In a separate experiment, liver Pnpla3 mRNA, triglyceride content, and plasma ALT levels were found to be elevated in wild-type male mice fed the NASH-inducing diet compared with mice fed a normal chow diet. Mice were assigned based on body weight to GalNAc3-conjugated ASO test groups (n = 8–9 mice per group). For the final 14 weeks, mice received either control or Pnpla3 ASO (5 mg / kg / week, twice weekly subcutaneous injections with saline as vehicle). As described above, non-fasted mice were metabolically synchronized for 24 hours before being euthanized between 8:00 and 10:00 AM. Mice were euthanized with isoflurane (Forene, Abbot Scandinavia AB, Sweden), blood was collected, and plasma was separated. Livers were harvested and sections (identical location in the left lobe for all mice) were fixed in 4% formaldehyde in PBS for histological examination or snap-frozen in liquid N2 and stored at -80°C.

[0576] Example 13: Effect of Pnpla3 ASO on fatty liver in wild-type and I148M mice fed a high-sucrose diet To evaluate the effect of Pnpla3 silencing on promoting hepatic lipogenesis and hepatic fat accumulation, homozygous Pnpla3 148M / M (mutant) knock-in female mice and wild-type littermates were fed a high-sucrose diet (70%) for 15 weeks, as described in Example 11. For the final 8 weeks of the experiment, mice of the two genotypes were treated with GalNAc3-conjugated Pnpla3 or GalNAc3-conjugated control ASO. No differences were observed between groups in body weight gain, food intake (Figures 2A and B), or ovarian white adipose tissue weight. Furthermore, treatment with Pnpla3 ASO did not affect plasma glucose or insulin levels. Compared with control ASOs, treatment with Pnpla3 ASOs significantly reduced Pnpla3 mRNA expression in the liver (98% reduction, p<0.0001) and PNPLA3 protein levels in lipid droplets in both Pnpla3 mutant knock-in and wild-type mice (Fig. 2C and D). Treatment with Pnpla3 ASOs did not affect Pnpla3 mRNA expression in white adipose tissue.

[0577] Six weeks of treatment with Pnpla3 ASO reduced liver lipid levels by 20% in Pnpla3 mutant knockin mice as measured by MRI (Figure 2F, p=0.025). After 8 weeks of treatment, Pnpla3 mutant knockin mice treated with Pnpla3 ASO showed reduced liver weight, reduced Oil Red O staining of hepatic neutral lipids (Figure 2E), and a 20% reduction in liver triglyceride content (p=0.038) as measured by biochemical analysis (Figure 2F), but no changes in circulating plasma triglyceride levels were observed (Figure 2G). Interestingly, treatment with Pnpla3 ASO did not affect liver weight, lipid levels, or liver triglyceride content in wild-type mice (Figure 2H-J). Pnpla3 mutant knock-in mice treated with control ASO had 30% higher liver triglyceride content than wild-type mice treated with control ASO (Pnpla3 mutant knock-in mice = 5.7 ± 0.4 g per 100 g liver, wild-type mice = 4.4 ± 0.5 g per 100 g liver, p = 0.046).

[0578] Example 14: Effect of Pnpla3 ASO on hepatitis and liver fibrosis in wild-type and I148M mice fed a NASH-inducing diet As described in Example 11, male Pnpla3 mutant knock-in mice (n = 17) and wild-type littermates (n = 17) were fed a NASH-inducing diet for 26 weeks. For the final 14 weeks of the experiment, mice of both genotypes were treated with GalNAc3-conjugated Pnpla3 or GalNAc3-conjugated control ASOs. No differences were observed between groups in body weight gain, food intake (Figures 3A and B), or epididymal white adipose tissue weight. Furthermore, treatment with Pnpla3 ASOs did not affect plasma glucose or insulin levels. Compared with control ASOs, treatment with Pnpla3 ASOs significantly reduced hepatic Pnpla3 mRNA expression (97%, p < 0.0001) and consistently reduced PNPLA3 protein levels in lipid droplets in both Pnpla3 mutant knock-in and wild-type mice (Figures 3C and D). Using the NASH diet for a longer treatment period than in the sucrose diet study (8 weeks versus 14 weeks, respectively), treatment with Pnpla3 ASO also reduced the expression of Pnpla3 mRNA levels in white adipose tissue.

[0579] Treatment with Pnpla3 ASO reduced plasma ALT levels in both genotypes (Pnpla3 mutant knockin mice, p = 0.0006; wild-type, p = 0.018), but did not alter plasma AST (Fig. 3E and F). Treatment with Pnpla3 ASO reduced liver weight only in Pnpla3 mutant knockin mice, and triglyceride content in both Pnpla3 mutant knockin mice (p = 0.002) and wild-type mice (p = 0.004), but no changes in circulating plasma triglyceride levels were observed (Fig. 3F).

[0580] Treatment with Pnpla3 ASO improved the fatty liver score (p = 0.007), lobular inflammation score (p = 0.018), NAFLD activity score (NAS) (p = 0.0003), and fibrosis stage (p = 0.031) in Pnpla3 mutant knock-in mice (Figure 4A), but only improved the fatty liver score (p = 0.003) and NAS (p = 0.036) in wild-type mice (Figure 4B). No hepatocyte ballooning was observed in either liver.

[0581] Example 15: Effect of Pnpla3 ASO on de novo sebum production and palmitoleic acid in wild-type and I148M mice fed a NASH-inducing diet Treatment with Pnpla3 ASO reduced Oil Red O staining of hepatic neutral lipids in both Pnpla3 mutant knock-in mice and wild-type mice (Figure 5A). Treatment with Pnpla3 ASO reduced mRNA expression of lipogenic genes, such as acetyl-CoA carboxylase 1 (Acc1) and stearoyl-CoA desaturase 1 (Scd1), in both genotypes (Figures 5B and C). This suggests a decrease in hepatic fat synthesis. Treatment with Pnpla3 ASO significantly reduced the relative amount of monounsaturated fatty acids (MUFAs, p = 6.1 × 10 in mutant and wild-type mice, respectively), regardless of genotype. -5 and 7.6 x 10 -6 ) and polyunsaturated fatty acids (PUFAs, p = 1.2 × 10 in the mutant and wild-type, respectively. -4 and 1.3 × 10 -5 ) increased (Figures 5D-E and 6). Specifically, palmitoleic acid (16:1) increased by 36% (p = 2.4 × 10) in the mutant and wild-type, respectively, compared with oleic acid, which decreased by only 2% (p = 0.034) and 5% (p = 0.001) in the mutant and wild-type, respectively. -4 ) and 30% (1.0 × 10 -9 ) decreased, so the reduction in MUFA became more dominant.

[0582] Example 16: Effect of Pnpla3 ASO on haptoglobin, McP1, and Timp2 protein levels in wild-type and I148M mice fed a NASH-inducing diet Treatment with Pnpla3 ASO reduced plasma haptoglobin levels (p = 0.0005) and liver macrophage content (p = 0.047) in Pnpla3 mutant knock-in mice, but not in wild-type littermates (Figures 7A-C). This suggests that suppression of Pnpla3 specifically reduced hepatitis in mutant mice. Treatment with Pnpla3 ASO reduced hepatic Mcp1 (Figure 7D) protein levels in Pnpla3 mutant knock-in mice. Treatment with Pnpla3 ASO did not alter hepatic protein expression levels of Il1β (Figure 7E), Il6 (Figure 7F), Tnfα (Figure 7G), or αSma (Figure 7H) in either genotype. Treatment with Pnpla3 ASO reduced hepatic collagen type I alpha 1 (Col1a1) mRNA expression in both Pnpla3 mutant knock-in mice and wild-type mice (Figures 8A and 8B). Treatment with Pnpla3 ASO reduced hepatic collagen as measured by immunohistochemistry in Pnpla3 mutant knock-in mice (p = 0.04) (Figures 8A-C). ASO treatment tended to reduce hepatic hydroxyproline levels, but the difference was not significant (Figures 8D and 8E). Treatment with Pnpla3 ASO reduced hepatic Timp2 protein levels in Pnpla3 mutant knock-in mice (p = 0.007) (Figure 9A). Treatment with Pnpla3 ASO did not alter hepatic protein expression levels of Mmp2 (Figure 9B), Timp1 (Figure 9C), or Tgfβr2 (Figure 9D) in either genotype. Furthermore, the present invention encompasses the following aspects. 1. A method of treating an individual suffering from or at risk of suffering from liver disease, comprising administering to said individual a compound that targets patatin-like phospholipase domain-containing protein 3 (PNPLA3); The individual has an I148M mutation in PNPLA3. 2. A method for reducing one or more of liver injury, hepatic steatosis, hepatitis, liver fibrosis, and hepatic fat synthesis in an individual, comprising administering to the individual a compound that targets patatin-like phospholipase domain-containing protein 3 (PNPLA3); The individual has an I148M mutation in PNPLA3. 3. A method for reducing protein levels of one or more of haptoglobin, MCP1, and TIMP2 in an individual, comprising administering to the individual a compound that targets patatin-like phospholipase domain-containing protein 3 (PNPLA3); The individual has an I148M mutation in PNPLA3. 4. The method according to item 1, wherein the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, and primary sclerosing cholangitis. 5. The method according to item 4, wherein the liver disease is fatty liver. 6. The method according to item 2, wherein the method reduces or prevents hepatitis or liver fibrosis. 7. The method according to item 2 or 6, wherein alleviating or preventing hepatitis comprises reducing macrophage levels in the liver. 8. The method of paragraph 7, wherein the level of macrophages in the liver is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by immunohistochemical staining of liver sections from the individual. 9. The method of paragraph 3, wherein the haptoglobin protein level is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by a colorimetric assay of the individual's serum or plasma. 10. The method of item 3, wherein the protein level of MCP1 is reduced by at least 20% when measured by immunoblotting a liver sample from the individual compared to the individual who has not been administered the compound targeting PNPLA3. 11. The method of item 3, wherein the protein level of TIMP2 is reduced by at least 20% when measured by immunoblotting a liver sample from the individual compared to the individual who has not been administered the compound targeting PNPLA3. 12. The method according to any one of items 1 to 11, wherein the individual has a homozygous I148M mutation in PNPLA3. 13. The method according to any one of items 1 to 12, wherein the individual is a human individual. 14. The method according to any one of items 1 to 13, wherein the compound targeting PNPLA3 is an antisense compound targeting PNPLA3. 15. The method of claim 14, wherein the antisense compound targeting PNPLA3 is a small interfering RNA (siRNA). 16. The method of item 14, wherein the antisense compound targeting PNPLA3 is an antisense oligonucleotide (ASO). 17. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length having a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 17 to 2169. 18. The method described in Item 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleic acid base sequence that is 8 to 80 nucleosides in length and includes any one of the nucleic acid base sequences of SEQ ID NOs: 17 to 2169. 19. The method according to item 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleic acid base sequence consisting of any one of SEQ ID NOs: 17 to 2169. 20. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, the modified oligonucleotide having a nucleobase sequence comprising at least 8 consecutive nucleobases that are 100% complementary to an equal length portion of nucleobases 5567 to 5642, 5644 to 5731, 5567 to 5731, 5567 to 5620, 13697 to 13733, 20553 to 20676, 20664 to 20824, 20553 to 20824, or 25844 to 25912 of SEQ ID NO: 2, and the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. 21. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, the modified oligonucleotide having a complementary nucleobase sequence within nucleobases 5567 to 5642, 5644 to 5731, 5567 to 5731, 5567 to 5620, 13697 to 13733, 20553 to 20676, 20664 to 20824, 20553 to 20824, or 25844 to 25912 of SEQ ID NO: 2, and the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. 22. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, the modified oligonucleotide having a nucleobase sequence comprising at least 8 consecutive nucleobase portions complementary to equal length portions of nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of a PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2, and the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2. 23. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, and the modified oligonucleotide has a nucleobase sequence comprising a 16 nucleobase portion complementary to an equal length portion of nucleobases 5567 to 5642, 5644 to 5731, 5567 to 5731, 5567 to 5620, 13697 to 13733, 20553 to 20676, 20664 to 20824, 20553 to 20824, or 25844 to 25912 of SEQ ID NO: 2. 24. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 linked nucleosides in length, and the modified oligonucleotide has a nucleic acid base sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. 25. The method of claim 14, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleic acid base sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. 26. The method of any one of items 17 to 25, wherein the modified oligonucleotide has a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2 over the entire length of the nucleic acid sequence. 27. The method of any one of paragraphs 17 to 26, wherein the modified nucleotide comprises at least one modification selected from at least one modified internucleoside linkage, at least one modified sugar, and at least one modified nucleobase. 28. The method of claim 27, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage. 29. The method of claim 27 or 28, wherein the modified sugar is a bicyclic sugar. 30. The method of claim 29, wherein the bicyclic sugar is selected from the group consisting of 4'-(CH2)-O-2'(LNA); 4'-(CH2)2-O-2'(ENA); and 4'-CH(CH3)-O-2'(cEt). 31. The method of paragraph 27 or 28, wherein the modified sugar is 2'-O-methoxyethyl. 32. The method according to any one of items 27 to 31, wherein the modified nucleobase is 5-methylcytosine. 33. The modified oligonucleotide: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; 33. The method of any one of items 17 to 32, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. 34. The method according to any one of items 17 to 33, wherein the compound targeting PNPLA3 is single-stranded. 35. The method according to any one of items 17 to 33, wherein the compound targeting PNPLA3 is double-stranded. 36. The method of any one of items 17 to 35, wherein the compound targeting PNPLA3 comprises a ribonucleotide. 37. The method of any one of items 17 to 29, wherein the compound targeting PNPLA3 comprises a deoxyribonucleotide. 38. The method of any one of items 17 to 37, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides. 39. The method of any one of items 17 to 37, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides. 40. The method of any one of items 17 to 37, wherein the modified oligonucleotide consists of 15 to 30 linked nucleosides. 41. The compound targeting PNPLA3 comprises a modified oligonucleotide 16 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, and wherein the modified oligonucleotide is a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; 15. The method of claim 14, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. 42. The compound targeting PNPLA3 comprises a modified oligonucleotide 16 linked nucleosides in length, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, and wherein the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; Item 15. The method of item 14, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, the 5' wing segment and the 3' wing segment comprise a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. 43. The method of any one of items 17 to 42, wherein the compound targeting PNPLA3 comprises a conjugate moiety and a conjugate linker. 44. The method of claim 43, wherein the conjugate group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands. 45. The method of claim 43 or 44, wherein the conjugate linker consists of a single bond. 46. ​​The method of claim 45, wherein the conjugate linker is cleavable. 47. The method of claim 45, wherein the conjugate linker comprises 1 to 3 linker nucleosides. 48. The method of any one of paragraphs 43 to 47, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. 49. The method of any one of paragraphs 43 to 47, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. 50. The compound targeting PNPLA3 is represented by the following formula or a salt thereof: [ka] Item 15. The method according to Item 14, comprising: 51. The compound targeting PNPLA3 comprises a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is 16 linked nucleosides in length and consists of the sequence of SEQ ID NO: 1089, and the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; the gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine; and the conjugate group is positioned at the 5' terminus of the modified oligonucleotide; [ka] Item 15. The method according to Item 14, wherein 52. The compound targeting PNPLA3 is represented by the following formula or a salt thereof: [ka] Item 15. The method according to Item 14, comprising: 53. The method of claim 52, wherein the compound targeting PNPLA3 is a modified oligonucleotide in the form of a pharmaceutically acceptable salt. 54. The method of claim 53, wherein the pharmaceutically acceptable salt is a sodium salt. 55. The method of claim 53, wherein the pharmaceutically acceptable salt is a potassium salt. 56. A method according to any one of paragraphs 1 to 55, wherein the compound targeting PNPLA3 is administered to the individual as a composition comprising the compound targeting PNPLA3 and a pharmaceutically acceptable carrier. 57. The method of any one of paragraphs 1 to 56, wherein the compound targeting PNPLA3 is administered parenterally to the individual. 58. The method of any one of paragraphs 1 to 14 or 16 to 57, wherein the compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleic acid base sequence at least 90% identical to SEQ ID NO: 115. 59. The compound targeting PNPLA3 is selected from the group consisting of SEQ ID NO: 2173 ~ 2175 Item 58. The method of any one of Items 1 to 15 or 17 to 57, comprising a modified oligonucleotide having a nucleobase sequence that is at least 90% identical to any one of the above. 60. The compound targeting PNPLA3 consists of the sequence of SEQ ID NO: 115, and the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; 15. The method of claim 14, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. 61. The compound targeting PNPLA3 further comprises a conjugate group, and the conjugate group is located at the 5' end of the modified oligonucleotide; [ka] Item 61. The method of item 60, wherein

Claims

1. 1. A medicament for treating an individual suffering from or at risk of suffering from liver disease, comprising a compound that targets patatin-like phospholipase domain-containing protein 3 (PNPLA3), the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), fatty liver, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis; the individual has an I148M mutation in PNPLA3 and is a human individual; The compound targeting PNPLA3 has the following formula or a salt thereof: 【Chemical 1】 A drug comprising:

2. 1. A medicament for reducing one or more of liver damage, fatty liver, hepatitis, liver fibrosis, and hepatic fat synthesis in an individual, the medicament comprising a compound that targets PNPLA3, the individual has an I148M mutation in PNPLA3 and is a human individual; The compound targeting PNPLA3 has the following formula or a salt thereof: 【Chemistry 2】 A drug comprising:

3. 1. A pharmaceutical agent for reducing protein levels of one or more of haptoglobin, MCP1, and TIMP2 in an individual, the agent comprising a compound that targets PNPLA3, the individual has an I148M mutation in PNPLA3 and is a human individual; The compound targeting PNPLA3 has the following formula or a salt thereof: 【Chemistry 3】 A drug comprising:

4. The drug according to claim 1, wherein the liver disease is fatty liver.

5. The drug of claim 2 , wherein the drug reduces or prevents hepatitis or liver fibrosis.

6. 10. The method of claim 2 or 5, wherein reducing or preventing hepatitis comprises reducing macrophage levels in the liver.

7. The drug of claim 6, wherein the level of macrophages in the liver is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by immunohistochemical staining of liver sections from the individual.

8. The drug of claim 3, wherein the haptoglobin protein level is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by a colorimetric assay of the individual's serum or plasma.

9. The drug of claim 3, wherein the protein level of MCP1 is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by immunoblotting a liver sample from the individual.

10. The drug of claim 3, wherein the protein level of TIMP2 is reduced by at least 20% compared to an individual who has not been administered the compound targeting PNPLA3, as measured by immunoblotting a liver sample from the individual.

11. The method of any one of claims 1 to 10, wherein the individual has a homozygous I148M mutation in PNPLA3.

12. The agent according to any one of claims 1 to 11, wherein the compound targeting PNPLA3 is a modified oligonucleotide in the form of a pharmaceutically acceptable salt.

13. The method of claim 12, wherein the pharmaceutically acceptable salt is a sodium salt.

14. The method of claim 12, wherein the pharmaceutically acceptable salt is a potassium salt.

Images