Method for producing nucleic acid oligomers

By employing a trichloroacetic acid solution with controlled formaldehyde concentration and non-nucleotide linkers, the synthesis of nucleic acid oligomers is made more efficient, addressing yield issues in conventional methods.

JP7759323B2Active Publication Date: 2025-10-23SUMITOMO CHEM CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2022535389
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-07-09
Filing Date
2021-07-08
Publication Date
2025-10-23
Estimated Expiration
2041-07-08

AI Technical Summary

Technical Problem

Conventional methods for synthesizing nucleic acid oligomers using trichloroacetic acid solutions yield inefficiently and require improvements to enhance production efficiency.

Method used

A method involving the use of a trichloroacetic acid solution with a controlled formaldehyde concentration, typically below a certain level, and incorporating non-nucleotide linkers, such as those with an amino acid backbone, to improve the synthesis process.

Benefits of technology

This approach enhances the yield of nucleic acid oligomers by optimizing the reaction conditions, leading to more efficient production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007759323000044
    Figure 0007759323000044
  • Figure 0007759323000001
    Figure 0007759323000001
  • Figure 0007759323000002
    Figure 0007759323000002
Patent Text Reader

Abstract

The purpose of the present invention is to provide an efficient method for producing a nucleic acid oligomer. The purpose of the present invention is to provide a method for producing a nucleic acid oligomer represented by formula (2) (in the formula, the symbols have the same meanings as in the description), the method including a step for reacting a nucleic acid oligomer represented by formula (1) (in the formula, the symbols have the same meanings as in the description) and a trichloroacetic acid solution in which the molar ratio of formaldehyde and trichloroacetic acid (formaldehyde mol / trichloroacetic acid mol) is 11×10-5 or less.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2020-118316 (filed July 9, 2020), the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for producing a nucleic acid oligomer. [Background technology]

[0003] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are known as nucleic acid drugs.

[0004] Nucleic acid oligomers can be synthesized by solid-phase synthesis, in which nucleic acid oligomers synthesized by extending nucleic acids on a solid support are cleaved from the solid support, and then, for nucleic acid oligomers containing ribose, the protecting group of the hydroxyl group at the 2'-position of the ribose is removed by deprotection to produce the desired nucleic acid oligomer. In solid-phase synthesis, nucleoside phosphoramidites (hereinafter referred to as "amidites") are used as raw materials, and it is known that the protecting group of the hydroxyl group at the 5'-position is deprotected using a trichloroacetic acid solution. However, the yield of nucleic acid oligomers synthesized using conventional trichloroacetic acid solutions is not necessarily satisfactory, and synthesis is inefficient (Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2006 / 022323 Summary of the Invention [Problem to be solved by the invention]

[0006] An object of the present invention is to provide a method for efficiently producing a nucleic acid oligomer. [Means for solving the problem]

[0007] As a result of extensive research conducted by the present inventors to achieve the above-mentioned object, they have provided an efficient method for producing nucleic acid oligomers, characterized in that when synthesizing nucleic acid oligomers, a trichloroacetic acid solution having a formaldehyde concentration below a certain level is used, or trichloroacetic acid is used after improving its quality.

[0008] The present invention includes, but is not limited to, the following aspects. Term 1. Equation (1): [ka] (In the formula, G 2 represents a protecting group for a hydroxyl group, B a each independently represents the same or different nucleobase which may be protected with a protecting group; R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group, R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position of ribose, or an ethylidene group bonded to the carbon atom at 4' position of ribose; Y's are independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 200, W1 represents an OZ group and X1 represents an R group, or W1 represents an OV group and X1 represents an OZ group; V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or greater, the nucleic acid oligomer represented by formula (1) may have a non-nucleotide linker incorporated between each nucleotide. The molar ratio of formaldehyde to trichloroacetic acid (mol of formaldehyde / mol of trichloroacetic acid) is 11 x 10 -5 with a trichloroacetic acid solution of formula (2):

[0009] [ka] (In the formula, G 2 , B a , R, Y, X1, W1 and n are as defined above, and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. A method for producing a nucleic acid oligomer represented by the formula:

[0010] Item 2. A method for producing a nucleic acid oligomer represented by formula (2) according to the preceding item 1, which further comprises a step of removing the group represented by Z from the nucleic acid oligomer represented by formula (2) produced in the step, and a step of removing the protecting groups of the hydroxyl groups and the nucleic acid bases, to produce a nucleic acid oligomer represented by formula (2'):

[0011] [ka] (In the formula, Y and n are as defined above, B c are each independently the same or different and represent a nucleobase; G 4 are each independently the same or different and represent a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined above, and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group, and W3 represents a hydroxyl group. A method for producing a nucleic acid oligomer represented by the formula:

[0012] Item 3. The nucleic acid oligomer represented by formula (2) is optionally extended in chain length by the amidite method to obtain the formula (3):

[0013] [ka] (In the formula, G 2 , B a , R, Y, X1 and W1 are as defined above; G 5 teeth,

[0014] [ka] or a hydrogen atom, R 1 , R 2 and R 3 is as described above, and m is an integer that satisfies m≧n. obtaining a nucleic acid compound represented by the formula: From the compound represented by formula (3), a compound represented by formula (4):

[0015] [ka] (In the formula, G 5 , R, Y and m are as defined above; G 4are each independently the same or different and represent a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, B C are each independently the same or different and represent a nucleobase; X2 represents a hydroxyl group and W2 represents an OV group, or X2 represents an R group and W2 represents a hydroxyl group, and V represents a protecting group for a hydroxyl group. The compound represented by The compound of formula (4) is further deprotected to give a compound of formula (5):

[0016] [ka] (In the formula, G 4 , B c , Y and m are as defined above; R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' is as defined above, and X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group, and W3 represents a hydroxyl group. 2. The method according to item 1 above, further comprising the step of producing a nucleic acid oligomer represented by the formula: Item 4. The production method according to any one of items 1 to 3 above, wherein the non-nucleotide linker is a linker comprising an amino acid backbone. Item 5. The production method according to the preceding item 4, wherein the linker comprising an amino acid skeleton has a structure selected from the group consisting of the following formulae (A14-1), (A14-2) and (A14-3):

[0017] [ka] (In the formula, Y is as defined above.) Item 6. The production method according to any one of items 1 to 5 above, wherein the trichloroacetic acid solution contains at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents. Item 7. The molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) is 54 x 10 -6 7. The method for producing a semiconductor device according to any one of the preceding items 1 to 6, wherein the semiconductor device comprises: Item 8. The molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) is 27 x 10 -6 7. The method for producing a semiconductor device according to any one of the preceding items 1 to 6, wherein the semiconductor device comprises: Item 9. The method according to any one of items 1 to 8 above, wherein the nucleic acid oligomer is ribonucleic acid (RNA). Item 10. The method according to any one of items 1 to 8 above, wherein the nucleic acid oligomer is ribonucleic acid (RNA) and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6). Formula (6):

[0018] [ka] (In the formula, q represents an integer of 1 to 5, R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom from the 2'-hydroxyl group of ribose, and E W represents an electron-withdrawing group.) Section 11.R a and R b are simultaneously hydrogen atoms and E W 11. The method according to item 10 above, wherein is a cyano group. Item 12. The method according to any one of items 1 to 11 above, wherein the nucleic acid oligomer is an oligomer having a chain length of 40 or more. Item 13. The method according to any one of items 1 to 11 above, wherein the nucleic acid oligomer is an oligomer having a chain length of 50 or more. Item 14. The method according to any one of items 1 to 11 above, wherein the nucleic acid oligomer is an oligomer having a chain length of 60 or more. Item 15. The method according to any one of items 1 to 11 above, wherein the nucleic acid oligomer is an oligomer having a chain length of 80 or more. Item 16. The method according to any one of items 1 to 11 above, wherein the nucleic acid oligomer is an oligomer having a chain length of 100 or more. Item 17. The molar ratio of formaldehyde to trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) is 11 x 10 -5 Below is a trichloroacetic acid solution. Item 18. The molar ratio of formaldehyde to trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) is 54 x 10 -6 18. The trichloroacetic acid solution according to item 17, which is: Item 19. The molar ratio of formaldehyde to trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) is 27 x 10 -6 18. The trichloroacetic acid solution according to item 17, which is: Item 20. A method for producing trichloroacetic acid according to any one of Items 17 to 19, comprising a step of obtaining purified trichloroacetic acid by azeotropically distilling off formaldehyde from a solution containing crude trichloroacetic acid containing formaldehyde and a solvent that forms an azeotropic distillation with formaldehyde. Item 21. The method according to item 20, wherein the boiling point of the azeotropic solvent is 198°C or lower. Item 22. The method according to item 20 or 21, wherein the azeotropic solvent is dichloromethane, acetonitrile, or an aromatic organic solvent. Item 23. The method according to item 22, wherein the aromatic organic solvent is toluene. Item 24. A method for producing a nucleic acid oligomer, comprising the step of purifying trichloroacetic acid according to Item 20 above, and the step according to any one of Items 1 to 3 above, using the purified trichloroacetic acid obtained in the step. Item 25. A production method according to any one of Items 1 to 16 and 20 to 24, comprising a step of selecting the trichloroacetic acid solution according to any one of Items 17, 18 and 19 as the trichloroacetic acid solution. [Effects of the Invention]

[0019] The present invention provides an efficient method for producing nucleic acid oligomers, which is expected to improve the yield of the produced nucleic acid oligomers. [Brief explanation of the drawings]

[0020] [Figure 1] FIG. 1 shows Scheme A, a typical example of producing a nucleic acid oligomer represented by formula (5) from a nucleic acid oligomer represented by formula (1). In the figure, G1 can be any group capable of functioning as a protecting group for a hydroxyl group, and a wide variety of known protecting groups used in amidite compounds can be used. Each G3 is independently an alkyl group, whether identical or different, or two G3s may be bonded to each other to form a cyclic structure. Each G3 is independently an alkyl group, whether identical or different, such as a methyl group, ethyl group, propyl group, or isopropyl group, and more preferably both are isopropyl groups. Other symbols are as described above. DETAILED DESCRIPTION OF THE INVENTION

[0021] A method for obtaining the nucleic acid oligomer represented by the formula (2) by reacting the nucleic acid oligomer represented by the formula (1) with a trichloroacetic acid solution having a formaldehyde concentration below a certain level will be described.

[0022] The molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution of the present invention (mol of formaldehyde / mol of trichloroacetic acid) is usually 11 × 10 -5 Less than or equal to 54 x 10 -6 Less than or equal to 27×10 -6The trichloroacetic acid solution of the present invention is exemplified by one containing formaldehyde within the above-mentioned range of molar ratio of formaldehyde to trichloroacetic acid. High-performance liquid chromatography is one method for measuring the formaldehyde concentration in a trichloroacetic acid solution. In high-performance liquid chromatography, formaldehyde and acetylacetone are reacted, the amount of the resulting 3,5-diacetyl-1,4-dihydrolutidine is measured, and the formaldehyde concentration is calculated. Thus, a solution having the above-mentioned range of molar ratio of formaldehyde to trichloroacetic acid can be selected. The solution may be directly prepared, for example, by the azeotropic method described below, or a desired solution may be selected.

[0023] The concentration of trichloroacetic acid in the trichloroacetic acid solution is usually 0.1 to 1.2M, preferably 0.1 to 0.6M, and more preferably 0.1 to 0.3M.

[0024] The dilution solvent for trichloroacetic acid is not particularly limited as long as it is not involved in the reaction, but examples thereof include dichloromethane, acetonitrile, an aromatic organic solvent, water, or any mixed solvent, preferably at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and an aromatic organic solvent, more preferably an aromatic organic solvent. An example of the aromatic organic solvent is toluene.

[0025] The reaction temperature in the above reaction is preferably 0 to 40°C, more preferably 10 to 30°C.

[0026] The formaldehyde in the trichloroacetic acid solution can be removed and reduced by azeotropy with any solvent or any mixed solvent. The azeotropic solvent is not particularly limited as long as it has a boiling point lower than that of trichloroacetic acid, but examples thereof include dichloromethane, acetonitrile, an aromatic organic solvent, or any mixed solvent, preferably dichloromethane, acetonitrile, or an aromatic organic solvent, more preferably an aromatic organic solvent. An example of the aromatic organic solvent is toluene.

[0027] The boiling point of the azeotropic solvent is preferably 200°C or lower, more preferably 198°C or lower.

[0028] The trichloroacetic acid solution can be stored in a glass, plastic, or metal container. As a plastic container, a container made of polyethylene or polypropylene can be used, and as a metal container, a container made of SUS or Hastelloy can be used. The oxidizing solution can be stored under an air atmosphere or an inert gas atmosphere, and the inert gas can be argon, nitrogen, carbon dioxide, helium, or the like.

[0029] An example of a nucleic acid compound having a protecting group at the 5'-hydroxyl group is the nucleic acid compound of the above formula (1). An example of a nucleic acid compound produced by reacting with a trichloroacetic acid solution is the nucleic acid compound of the above formula (2). In the formulas (1) and (2), Q' may be the same or different and may represent a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose. Specific examples of compounds represented by Q' in the formula (1) and (2) above include the structures represented by LNA-1, LNA-2, or LNA-3 in the following formula (7).

[0030] [ka] (In the formula, B a represents an optionally protected nucleobase.

[0031] More specifically, the group represented by Z having a structure consisting of a solid phase carrier and a linking group connecting the solid phase carrier with the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of the nucleic acid oligomer includes a structure represented by the following formula (8):

[0032] [ka] In formula (8), Sp represents a spacer. The spacer (Sp) may be, for example, one having the structural formula shown in formula (9) below.

[0033] [ka]

[0034] Linker may be, for example, a structure shown in the following formula (10), or a structure in which the structure of formula (10) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, Linker may be a structure shown in the following formula (11).

[0035] [ka] (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0036] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0037] The method for synthesizing a nucleic acid oligomer by solid phase synthesis, which includes the deprotection step using a trichloroacetic acid solution, typically includes the following steps: (1) deprotecting the 5'-hydroxyl group of a nucleoside whose hydroxyl group is protected and which is bound to a solid phase support via a linker; (2) a step of coupling the 5'-hydroxyl group generated in the above step with a phosphoramidite compound to obtain a phosphite triester compound; (3) oxidizing the phosphite triester produced in the previous step to convert it to a phosphate triester to produce an extended nucleic acid molecule, or optionally converting it to a thiophosphate triester; (4) a step of synthesizing a nucleic acid molecule on a solid support by repeating a series of reaction cycles consisting of the steps (1) to (3), i.e., a step of deprotecting the hydroxyl group at the 5' position of the generated nucleic acid molecule, a step of coupling the hydroxyl group at the 5' position with an amidite compound, and a step of oxidizing the generated phosphite triester, any number of times; and (5) A step of subjecting the nucleic acid molecule on the solid phase carrier produced in step (4) to a step of excision and deprotection to release it from the solid phase carrier, thereby producing a nucleic acid oligomer from which the protecting groups have been removed. However, the method for synthesizing the nucleic acid oligomer may include, following step (2) or (3), a step of capping the 5'-position hydroxyl group that did not undergo the coupling reaction with the phosphoramidite compound, or a capping step may be added between any of the steps in the series of reaction cycles that make up step (4).

[0038] More specifically, step (5) is carried out by subjecting the nucleic acid molecules on the solid support produced in step (4) to the following reactions in steps (5-1) and (5-2) in that order, followed by the reaction in step (5-3). The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer in which the protecting group has been removed from the nucleic acid molecule released from the solid support, or a nucleic acid oligomer in which the 5'-terminal hydroxyl group has been protected, can be produced. (5-1) a reaction for deprotecting the protecting group of the hydroxyl group at the 5' end of a nucleic acid molecule; (5-2) a reaction to cleave and release the nucleic acid molecule from the solid support; and (5-3) A reaction to remove the protecting group of the hydroxyl group at the 2'-position or 3'-position of the 3'-end of the ribose constituting a nucleic acid molecule.

[0039] The scheme of steps (1) to (5) is shown in Figure 1. The deprotection reaction in step (1) or step (4) shown in Figure 1 is carried out using the trichloroacetic acid solution. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0040] The nucleic acid compound of formula (1) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method and used to produce the nucleic acid compound of formula (3). The nucleic acid compound alone can be excised from the nucleic acid compound bound to the solid support of formula (3) to obtain the nucleic acid oligomer of formula (4), which can then be further deprotected to obtain the nucleic acid oligomer of formula (5). The substituents in each formula are explained in more detail below.

[0041] B a and a nucleobase optionally protected by a protecting group represented by cThe nucleic acid base represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0042] B a The protecting group for the nucleic acid base, which may be protected by a protecting group represented by the formula (I), is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, a 4-methylbenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.

[0043] B a More specifically,

[0044] [ka]

[0045] (In the above formula, R 4represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group. represents a group represented by any one of the following:

[0046] B c More specifically, the above B a Specific examples include groups obtained by removing the protecting group from the above.

[0047] G 5 is preferably the following group:

[0048] [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0049] R 1 , R 2 and R 3 Preferably, one of G is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.5 is a 4,4'-dimethoxytrityl group (DMTr group).

[0050] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group for a hydroxyl group, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0051] G 2 is preferably an alkyl group substituted with an electron-withdrawing group, such as a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, or a trialkylamino group, and is preferably a cyano group.

[0052] G 2 Particularly preferred as are the following groups:

[0053] [ka]

[0054] R 1 , R 2 , R 3 and G 2The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0055] In the method of the present invention, the amidite compound can be used in its free state or in its salt form. Examples of salts of the amidite compound include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, and crystalline polymorphs.

[0056] R preferably represents a protected hydroxyl group. When R represents a protected hydroxyl group, the protecting group for the hydroxyl group represented by V may be any group that can be used in the amidite method, such as a 2'-tert-butyldimethylsilyl (TBS) group, a 2'-bis(2-acetoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, a 2'-para-tolylsulfonylethoxymethyl (TEM) group, or a 2'-EMM group (WO 2006 / 022323). In addition, those described in WO 2013 / 027843 and WO 2019 / 208571 can be used. V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. Furthermore, when the nucleic acid oligomer produced by the method of the present invention is a ribonucleic acid (RNA), or when the nucleic acid oligomer contains ribose, the protecting group of the hydroxyl group at the 2'-position of the ribose is preferably the protecting group represented by the formula (6). W An example of such a protecting group is a protecting group represented by formula (12) having a cyano group as the electron-withdrawing group.

[0057] [ka] (In the formula, q, R a and R b has the same definition as in the above formula (6). More preferably, in the group represented by formula (12), q is 1 and R a and R b and are simultaneously hydrogen atoms.

[0058] The protecting group represented by formula (12) can be synthesized, for example, according to the description in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used for producing a nucleic acid compound. For the nucleic acid elongation reaction, an amidite compound of formula (13) shown in Scheme A of FIG. 1 is used.

[0059] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific, non-limiting examples include linkers represented by formula (A14-1), (A14-2), or (A14-3) (for example, as described in International Publication No. 2019 / 074110). In addition to these linkers, examples include linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110.

[0060] [ka] (In the formula, Y is as defined above.)

[0061] Nucleotides and amidites in which the R group in formula (13) and the R′ group in formula (5) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0062] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups in alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups. More specific examples include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl moieties in hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl. More specific examples of hydroxyalkylammonium ions include trishydroxymethylammonium ions. G 4 preferably represents a hydrogen atom.

[0063] G 5 represents a hydrogen atom or a protecting group for the hydroxyl group, and when representing a protecting group, 1 represents the same protecting group. 5 is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid elongation reaction.

[0064] Y is preferably an oxygen atom.

[0065] W1 and X1 are preferably such that W1 represents an OZ group and X1 represents an R group.

[0066] W2 and X2 are preferably such that W2 represents a hydroxyl group and X2 represents an R group.

[0067] Preferably, W3 and X3 each independently represent a hydroxyl group.

[0068] R' is preferably a hydroxyl group.

[0069] In the synthesis of nucleic acid compounds by the amidite method in steps (1) to (5), nucleic acid extension reactions can be carried out according to generally known methods (e.g., the methods described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881), except for the deprotection step related to the present invention in step (1) or step (5) in the scheme of Figure 1. Each step will be described below.

[0070] (Nucleic acid extension reaction) As used herein, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may also be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0071] The chain length of the nucleic acid oligomer may be, for example, 20 mer or more (i.e., n≧19), 40 mer or more (i.e., n≧39), 50 mer or more (i.e., n≧49), 60 mer or more (i.e., n≧59), 80 mer or more (i.e., n≧79), 100 mer or more (i.e., n≧99), 2 to 200 mer (i.e., 1≦n≦199), 10 to 150 mer (i.e., 9≦n≦149), or 15 to 110 mer (i.e., 14≦n≦109).

[0072] The deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the oligonucleotide chain supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, trichloroacetic acid, trifluoromethanesulfonic acid, dichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0073] The condensation step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (13) shown in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The phosphoramidite used for nucleic acid elongation is an amidite compound represented by formula (13) or (A9) to (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl. The nucleoside phosphoramidite used has its 5' hydroxyl group protected with a protecting group (e.g., DMTr). The condensation step can be carried out using an activating agent or condensing agent that activates the nucleoside phosphoramidite. Examples of activating agents or condensing agents include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0074] The nucleoside phosphoramidite (hereinafter referred to as amidite) represented by formula (13) in Scheme A of FIG. 1 is as follows: formula:

[0075] [ka] (In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0076] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0077] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphorous group to a phosphate group, for example, iodine can be used as an "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, triethylamine, or the like can be used as a base to promote the reaction. The solvent is not particularly limited as long as it is not involved in the reaction, and examples include acetonitrile, tetrahydrofuran (THF), and mixed solvents of these in any ratio. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The appropriate reaction time is usually 1 to 30 minutes. The amount of reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per 1 mol of the compound supported on the solid phase support.

[0078] When converting a phosphite triester group to a thiophosphate triester group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio. The oxidation step may be performed after the capping step, or conversely, the capping step may be performed after the oxidation step; the order is not limited.

[0079] In step (5-1), the protecting group for the 5'-hydroxyl group of the nucleotide introduced at the end of elongation may be used for column purification using the protecting group for the 5'-hydroxyl group as a tag after cleavage from the solid phase support and deprotection of the protecting group, as described below, or the protecting group for the 5'-hydroxyl group may be deprotected after column purification.

[0080] In step (5-2), after the synthesis of a nucleic acid having a desired sequence is completed, an amine compound is reacted with the nucleic acid to remove the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0081] In step (5-2), the nucleic acid oligomer elongated to a desired chain length on the solid phase support is usually cleaved from the solid phase support using concentrated aqueous ammonia as a cleavage agent.

[0082] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0083] In step (5-3), the protecting group of the hydroxyl group at the 2'- or 3'-position of the ribose of the nucleic acid compound (4) cleaved from the solid support in step (5-2) can be removed according to the method described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571, to obtain a deprotected nucleic acid oligomer (5).

[0084] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid oligomer produced by the method of the present invention is RNA.

[0085] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acid oligomers having the following sequences (A) and (B), which are described in International Publication No. 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 1) 21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 2) 21mer In sequences (A) and (B), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples include the nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid oligomer having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 3) 36mer Examples include the nucleic acid oligomer described in Japanese Patent No. 4965745. A typical example is a nucleic acid oligomer having the following sequence (D): Sequence (D): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' (SEQ ID NOs: 4 and 5) 49mer In sequence (D), "P" is represented by the partial structure separated by a wavy line in formula (A5) below. In addition, the description of sequence number 4 in the sequence listing indicates the base sequence of the following sequence (D1) from the 5' end of sequence (D) to before "P", and the description of sequence number 5 indicates the base sequence of the following sequence (D2) from after "P" to the 3' end of sequence (D). Sequence (D1): 5'-CCAUGAGAAGUAUGACAACAGCC-3' (SEQ ID NO: 4) 23mer Sequence (D2): 5'-GGCUGUUGUCAUACUUCUCAUGGUU-3' (SEQ ID NO: 5) 25mer An example is a nucleic acid oligomer having the following sequence (E), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (E): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 6) 67mer An example is a nucleic acid oligomer having the following sequence (F), which is described on page 173 of JP-A-2015-523856. Sequence (F): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 7) 94mer Examples include the nucleic acid oligomers described in JP-A-2017-537626. Typical examples include nucleic acid oligomers having the following sequences (G), (H), (I), and (J). Sequence (G): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 8) 100mer Sequence (H): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 9) 113mer Sequence (I): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 10) 113mer In sequence (I), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGC AAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 11) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. [Example]

[0086] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0087] <Measurement method> First, the various measurement methods used in the following tests are shown below.

[0088] Oligonucleotide purity was determined using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement Method 1: Measurement of Oligonucleotide Purity) [Table 1]

[0089] (Measurement Method 2: Measurement of Oligonucleotide Yield) The OD of the crude product 260 The OD was measured. 260 represents the absorbance of UV260nm per 10mm path length in 1mL solution (pH=7.5). It is generally known that 1OD = 40μg for RNA. 260 The yield was calculated based on the measured values.

[0090] (Measurement method 3: Measurement of formaldehyde concentration) One method for measuring formaldehyde concentration in trichloroacetic acid solution is high-performance liquid chromatography, which involves reacting formaldehyde with acetylacetone, measuring the amount of 3,5-diacetyl-1,4-dihydrolutidine obtained, and calculating the formaldehyde concentration.

[0091] <Preparation of trichloroacetic acid solution> The trichloroacetic acid solutions with different formaldehyde concentrations used in the following tests were prepared by first preparing a trichloroacetic acid solution with a low formaldehyde concentration and then adding an aqueous formaldehyde solution to the resulting trichloroacetic acid solution.

[0092] <Solid-phase synthesis of oligonucleotides> Sequence (I): 5'-GGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 12) 20mer Sequence (II): 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 13) 50mer Sequence (III): 5'-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 14) 100mer In the sequences (I), (II), and (III), "A" is represented by the partial structure delimited by a wavy line in the following formula (A1). "C" is represented by the partial structure delimited by a wavy line in the following formula (A2). "G" is represented by the partial structure delimited by a wavy line in the following formula (A3). "U" is represented by the partial structure delimited by a wavy line in the following formula (A4). Note that "U" at the 3'-end is represented by the partial structure delimited by a wavy line in the following formula (A8). Furthermore, "G" at the 5'-end in sequence (I) is represented by the partial structure delimited by a wavy line in the following formula (A6), and "A" at the 5'-end in sequences (II) and (III) is represented by the partial structure delimited by a wavy line in the following formula (A7).

[0093] [ka]

[0094] [ka]

[0095] [ka]

[0096] [ka]

[0097] [ka]

[0098] [ka]

[0099] [ka]

[0100] [ka]

[0101] Oligonucleotides consisting of the above sequences (I), (II), and (III) were synthesized from the 3' to 5' ends by phosphoramidite solid-phase synthesis using Controlled Pore Glass (CPG) as the solid support and an NTS M-4MX-E (Nihon Techno Service Co., Ltd.) nucleic acid synthesizer. Synthesis was performed on an approximately 1 μmol scale. The synthesis used uridine EMM amidite (A11) described in Example 2 of US2012 / 0035246, cytidine EMM amidite (A9) described in Example 3, adenosine EMM amidite (A12) described in Example 4, and guanosine EMM amidite (A10) described in Example 5. A 3% trichloroacetic acid solution in toluene was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole as the condensing agent, iodine solution as the oxidizing agent, and phenoxyacetic anhydride solution and N-methylimidazole solution as the capping solution.

[0102] [ka]

[0103] [ka]

[0104] [ka]

[0105] [ka]

[0106] Next, specific examples of oligonucleotides (nucleic acid oligomers) produced by the method of the present invention will be described. In the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the above sequences (I), (II), and (III). The uridine derivatives described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle shown in the structural formula is a schematic representation of CPG.

[0107] [ka]

[0108] Example 1 Using controlled pore glass (CPG) loaded with 0.99 μmol of a uridine derivative and the amidites shown in formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (Nihon Techno Service Co., Ltd.). The automated synthesis procedure involved first pumping a 3% trichloroacetic acid toluene solution into the CPG, deprotecting the trityl protecting group at the 5' position. The formaldehyde concentration in the trichloroacetic acid solution used here could be measured using Measurement Method 3, and the molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) was 33 x 10 -7Next, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to the CPG, and a coupling reaction was carried out at the 5'-hydroxyl group. An oxidizing solution containing 50 mM iodine was then added to convert the phosphite group to a phosphate group. Subsequently, 0.1 M phenoxyacetic anhydride in acetonitrile and 10% N-methylimidazole / 10% 2,6-lutidine in acetonitrile were used as capping solutions to cap any reaction sites where coupling did not proceed. After repeating these steps a total of 19 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with 3% trichloroacetic acid in toluene, and the nucleic acid oligonucleotide shown in sequence (I) was synthesized on the CPG support. Next, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were added to the CPG support loaded with 0.99 μmol of oligonucleotide. The mixture was incubated at 40°C for 4 hours to liberate the nucleic acid oligomer from the solid support, followed by concentration to remove the solvent. The free oligonucleotide was then dissolved in 1.5 mL of dimethyl sulfoxide, followed by addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stirrer. 2.08 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) dehydrated with 4A molecular sieves was then added at room temperature while stirring. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the resulting product was measured using the method described in Measurement Method 1 above, and was found to be 72.6%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 4369 μg, which was equivalent to 4413 μg per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0109] Example 2 In the experiment of Example 1, a controlled pore glass (CPG) supporting 1.00 μmol of a uridine derivative and a 11×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5 A nucleic acid oligomer of sequence (I) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the product was found to be 71.4%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield per CPG carrying 1.00 μmol of uridine derivative was found to be 4236 μg. The results are shown in Table 2.

[0110] (Reference example 1) In the experiment of Example 1, a controlled pore glass (CPG) supporting 0.97 μmol of a uridine derivative and a 26×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5 A nucleic acid oligomer of sequence (I) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the product purity was found to be 69.7%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 3982 μg, which was equivalent to 4105 μg per CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0111] Example 3 Using controlled pore glass (CPG) loaded with 1.01 μmol of a uridine derivative and the amidites shown in formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (II) was automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (Nihon Techno Service Co., Ltd.). The automated synthesis procedure involved first pumping a 3% trichloroacetic acid toluene solution into the CPG, deprotecting the trityl protecting group at the 5' position. The formaldehyde concentration in the trichloroacetic acid solution used here could be measured using Measurement Method 3, and the molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) was 33 x 10 -7Next, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to the CPG to induce a coupling reaction at the 5'-hydroxyl group. An oxidizing solution containing 50 mM iodine was then added to convert the phosphite group to a phosphate group. Subsequently, 0.1 M phenoxyacetic anhydride in acetonitrile and 10% N-methylimidazole / 10% 2,6-lutidine in acetonitrile were used as capping solutions to cap any reaction sites where coupling did not proceed. After repeating these steps a total of 49 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with 3% trichloroacetic acid in toluene, and the nucleic acid oligonucleotide shown in sequence (II) was synthesized on the CPG support. Next, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were added to the CPG support loaded with 1.01 μmol of oligonucleotide. The mixture was incubated at 40°C for 4 hours to liberate the nucleic acid oligomer from the solid support, followed by concentration to remove the solvent. The free oligonucleotide was then dissolved in 1.5 mL of dimethyl sulfoxide, followed by addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stirrer. 2.08 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) dehydrated with 4A molecular sieves was then added at room temperature while stirring. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the resulting product was measured using the method described in Measurement Method 1 above, and was found to be 43.1%. The yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and was found to be 9941 μg, which was equivalent to 9843 μg per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0112] Example 4 In the experiment of Example 3, a controlled pore glass (CPG) supporting 1.01 μmol of a uridine derivative and a 11×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5 A nucleic acid oligomer of sequence (II) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the product purity was 36.5%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 9710 μg, which was equivalent to 9614 μg per CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0113] (Reference example 2) In the experiment of Example 3, a controlled pore glass (CPG) supporting 1.02 μmol of a uridine derivative and a 26×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5 A nucleic acid oligomer of sequence (II) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the product was 33.2%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 9158 μg, which was equivalent to 8978 μg per CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0114] Example 5 Using controlled pore glass (CPG) loaded with 1.00 μmol of a uridine derivative and the amidites shown in formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (III) was automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (Nihon Techno Service Co., Ltd.). The automated synthesis procedure involved first pumping a 3% trichloroacetic acid toluene solution into the CPG, deprotecting the trityl protecting group at the 5' position. The formaldehyde concentration in the trichloroacetic acid solution used here could be measured using Measurement Method 3, and the molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) was 33 x 10 -7Next, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to the CPG to induce a coupling reaction at the 5'-hydroxyl group. An oxidizing solution containing 50 mM iodine was then added to convert the phosphite group to a phosphate group. Subsequently, 0.1 M phenoxyacetic anhydride in acetonitrile and 10% N-methylimidazole / 10% 2,6-lutidine in acetonitrile were used as capping solutions to cap any reaction sites where coupling did not proceed. After repeating these steps a total of 99 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with 3% trichloroacetic acid in toluene, and the nucleic acid oligonucleotide with the sequence shown in Sequence (III) was synthesized on the CPG support. Next, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were added to a CPG support loaded with 1.00 μmol of oligonucleotide. The mixture was incubated at 40°C for 4 hours to liberate the nucleic acid oligomer from the solid support, followed by concentration to remove the solvent. The free oligonucleotide was then dissolved in 1.5 mL of dimethyl sulfoxide, followed by addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stirrer. 2.08 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) dehydrated with 4A molecular sieves was then added at room temperature while stirring. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the resulting product was measured using the method described in Measurement Method 1 above, and was found to be 32.8%. Furthermore, when the yield of oligonucleotide was measured using the method described in Measurement Method 2, the yield per CPG carrying 1.00 μmol of uridine derivative was 15,722 μg. The results are shown in Table 2.

[0115] Example 6 In the experiment of Example 5, a controlled pore glass (CPG) supporting 1.01 μmol of a uridine derivative and a 11×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5A nucleic acid oligomer of sequence (III) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the product was 30.9%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 14,754 μg, which was equivalent to 14,608 μg per CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0116] (Reference example 3) In the experiment of Example 5, a controlled pore glass (CPG) supporting 0.97 μmol of a uridine derivative and a 26×10 mol mixture of formaldehyde and trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) were used. -5 A nucleic acid oligomer of sequence (III) was obtained in the same manner, except that a 3% trichloroacetic acid toluene solution was used. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the product was found to be 26.7%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above, and the yield was 13,283 μg, which was equivalent to 13,694 μg per CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0117] Example 7 The molar ratio of formaldehyde to trichloroacetic acid (mol formaldehyde / mol trichloroacetic acid) is 25 x 10 -5 300 mL of toluene was added to 30 g of trichloroacetic acid, and the toluene and formaldehyde were azeotropically distilled off using an evaporator at 40°C to obtain 34 g of a colorless, oily trichloroacetic acid solution. The formaldehyde contained in the obtained trichloroacetic acid solution was analyzed by the method described in Measurement Method 3, and the molar ratio of formaldehyde to trichloroacetic acid was found to be 25 x 10 -7 It was.

[0118] [Table 2]

[0119] The results in Table 2 above show that when the trichloroacetic acid solution of the present invention, which has a formaldehyde concentration below a certain level, was used, nucleic acid oligomers were obtained in higher yields than when the trichloroacetic acid solutions of Reference Examples 1, 2, and 3 were used. [Industrial Applicability]

[0120] The present invention provides an efficient method for producing a nucleic acid oligomer, and is expected to improve the yield of the nucleic acid oligomer produced by the method. [Sequence List Free Text]

[0121] SEQ ID NOs: 1 to 14 in the sequence listing represent the base sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (1): 【Chemical 1】 (In the formula, G 2 represents a protecting group for a hydroxyl group, B a each independently represents the same or different nucleobase which may be protected with a protecting group; R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group, R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position of ribose, or an ethylidene group bonded to the carbon atom at 4' position of ribose; each Y is independently the same or different and represents an oxygen atom or a sulfur atom; n represents an integer of 1 to 200, W 1 represents an OZ group, and X 1 represents an R group, or W 1 represents an OV group, and X 1 represents an OZ group, V represents a protecting group for a hydroxyl group; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or greater, the nucleic acid oligomer represented by formula (1) may have a non-nucleotide linker incorporated between each nucleotide. with a trichloroacetic acid solution containing trichloroacetic acid and formaldehyde, wherein the molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) is 11 x 10 -5 Equation (2) is as follows: 【Chemistry 2】 (In the formula, G 2 , B a , R, Y, X 1 , W 1 and n is as defined above, and As defined in formula (1), non-nucleotide linkers may be incorporated between the nucleotides. A method for producing a nucleic acid oligomer represented by the formula:

2. The method according to claim 1, further comprising a step of removing a group represented by Z from a nucleic acid oligomer represented by formula (2) produced in the step, and a step of removing a protecting group of a hydroxyl group and a protecting group of a nucleic acid base, and a method for producing a nucleic acid oligomer represented by formula (2'): 【Chemistry 3】 (In the formula, Y and n are as defined above, B c are each independently the same or different and represent a nucleobase; G 4 are each independently the same or different and represent a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q′ is as defined above, and X 3 and W 3 each independently represents a hydroxyl group, or X 3 represents an R' group, and W 3 represents a hydroxyl group.) A method for producing a nucleic acid oligomer represented by the formula:

3. The nucleic acid oligomer represented by formula (2) is optionally extended in chain length by the amidite method to form a nucleic acid oligomer represented by formula (3): 【Chemistry 4】 (In the formula, G 2 , B a , R, Y, X 1 and W 1 is as described above, G 5 teeth, 【Chemistry 5】 or a hydrogen atom, R 1 , R 2 and R 3 is as described above, and m is an integer that satisfies m≧n. obtaining a nucleic acid compound represented by the formula: From the compound represented by formula (3), a compound represented by formula (4): 【Chemistry 6】 (In the formula, G 5 , R, Y and m are as defined above; G 4 are each independently the same or different and represent a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, B C are each independently the same or different and represent a nucleobase; X 2 represents a hydroxyl group, and W 2 represents an OV group, or X 2 represents an R group, and W 2 represents a hydroxyl group, and V represents a protecting group for a hydroxyl group. The compound represented by The compound of formula (4) is further deprotected to give a compound of formula (5): 【Chemistry 7】 (In the formula, G 4 , B c , Y and m are as defined above; R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q′ is as defined above, and X 3 and W 3 each independently represents a hydroxyl group, or X 3 represents an R' group, and W 3 represents a hydroxyl group.) The method of claim 1, further comprising the step of producing a nucleic acid oligomer represented by the formula:

4. The method according to any one of claims 1 to 3, wherein the non-nucleotide linker is a linker consisting of an amino acid backbone.

5. The method according to claim 4, wherein the linker comprising an amino acid skeleton has a structure selected from the group consisting of the following formulae (A14-1), (A14-2) and (A14-3): 【Chemistry 8】 (In the formula, Y is as defined above.)

6. The method according to any one of claims 1 to 5, wherein the trichloroacetic acid solution contains at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents.

7. The molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) is 54 × 10 -6 The manufacturing method according to any one of claims 1 to 6, wherein:

8. The molar ratio of formaldehyde to trichloroacetic acid in the trichloroacetic acid solution (mol formaldehyde / mol trichloroacetic acid) is 27 × 10 -6 The manufacturing method according to any one of claims 1 to 6, wherein:

9. The method according to any one of claims 1 to 8, wherein the nucleic acid oligomer is ribonucleic acid (RNA).

10. The method according to any one of claims 1 to 8, wherein the nucleic acid oligomer is ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6). Formula (6): 【Chemistry 9】 (In the formula, q represents an integer of 1 to 5, R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom; The * symbol indicates the point of attachment to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and E W represents an electron-withdrawing group.)

11. R a and R b are simultaneously hydrogen atoms, and E W The method according to claim 10, wherein is a cyano group.

12. The method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 40 or more.

13. The method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 50 or more.

14. The method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 60 or more.

15. The method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 80 or more.

16. The method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 100 or more.

Citation Information

Patent Citations

  • Phosphoramidite compound and method for producing oligo-rna

    WO2006022323A1

  • Amidite compound and method for producing polynucleotide using said compound

    WO2019208571A1