APOC3-targeted antisense nucleic acid

Abstract

The present invention provides: an antisense oligomer having a base sequence represented by SEQ ID NO: 26, an antisense oligomer having a base sequence represented by SEQ ID NO: 26 with one to six bases substituted, deleted, inserted or added, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable hydrate thereof; an oligonucleotide conjugate resulting from the bonding of the foregoing and a molecule that can binds to asialoglycoprotein receptor; and a pharmaceutical composition that includes the foregoing.

Description

[Technical Field]

[0001] The present invention relates to an antisense nucleic acid that targets APOC3, and a pharmaceutical composition containing the same. [Background technology]

[0002] The causal relationship between lipids and atherosclerosis was clinically established with the discovery of statins and subsequent drug intervention trials. Statins have a powerful effect in lowering low-density lipoprotein cholesterol (LDL-C), and a certain reduction in LDL-C reduces the risk of cardiovascular events to a certain extent, regardless of underlying risk factors. However, the question of how to address the "residual risk" that statins do not address has become an issue.

[0003] Mendelian randomization (MR) studies have revealed that genes responsible for hypercholesterolemia and hypertriglyceridemia (TG) also cause atherosclerosis, strongly suggesting that these dyslipidemias are one of the keys to residual risk. Accordingly, active drug discovery research is being conducted targeting these causative genes.

[0004] For example, International Publication No. 2018-216785 (Patent Document 1) describes an antisense nucleic acid that targets PCSK9, one of the genes responsible for hypercholesterolemia, and a pharmaceutical containing the same. The antisense nucleic acid described in this publication is a gapmer-type nucleic acid having several modified nucleic acid bases on both sides.

[0005] Furthermore, International Publication No. 2004-093783 (Patent Document 2) describes an antisense oligonucleotide (ASO) targeting apolipoprotein C3 (APOC3), one of the causative genes for hypertriglyceridemia. Hypertriglyceridemia is a type of dyslipidemia characterized by blood triglyceride levels of 150 mg / dL or higher. APOC3 plays multiple roles in lipoprotein clearance, inhibiting the uptake of lipoproteins into the liver and inhibiting lipoprotein lipase (LPL). Epidemiological studies have shown that individuals with APOC3 hypofunction or loss-of-function mutations have lower blood triglyceride levels and a lower risk of coronary artery disease, making APOC3 a good target for drug discovery in hypertriglyceridemia. Patent Document 2 describes an ASO with a "5-10-5" gapmer structure consisting of a central gap region consisting of 10 DNA fragments and 5'- and 3'-wing regions each consisting of five nucleotides flanking the central gap region, in which the nucleotides in both wing regions are 2'-O-methoxyethyl (2'-MOE) modified and all internucleoside linkages are replaced with phosphorothioate (PS) linkages. Volanesorsen (trade name: Waylivra®), an APOC3 inhibitor containing the active ingredient ISIS 304801, disclosed in this patent application, has demonstrated efficacy in patients with hyperchylomicronemia, including LPL deficiency, and was expected to be a new therapeutic agent for primary hypertriglyceridemia and the more common atherosclerotic hypertriglyceridemia. However, serious adverse events associated with high-dose administration were reported, and the U.S. Food and Drug Administration (FDA) rejected the application for approval due to safety concerns. The European Medicines Agency (EMA) approved the drug only for familial hyperchylomicronemia, with a conditional approval.

[0006] Therefore, there is a need for the development of novel nucleic acid drugs that can inhibit APOC3 expression at lower doses and can be safely used widely for the treatment of atherosclerosis-induced dyslipidemia. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 2018-216785 Brochure [Patent Document 2] International Publication No. 2004-093783 Pamphlet Summary of the Invention [Problem to be solved by the invention]

[0008] An invention described in this specification aims to provide an antisense nucleic acid that targets APOC3 and has high activity so that the dose can be reduced, a conjugate containing the antisense nucleic acid, and a pharmaceutical containing the same. [Means for solving the problem]

[0009] The present inventors designed ASOs complementary to the 5'UTR, coding region, and 3'UTR of APOC3 mRNA, synthesized them with some of their constituent nucleotides modified with a cross-link between the 2' and 4' sugar positions, and introduced them into cultured cells. They found that among these ASOs, ASOs complementary to specific regions of APOC3 mRNA had significantly superior inhibitory activity against APOC3 gene expression. When the target region overlapped with the sequence described in Patent Document 2, 2',4'-bridge-modified ASOs exhibited higher inhibitory activity against APOC3 expression than 2'-MOE-modified ASOs. Furthermore, as shown in the examples, antisense oligomers having the base sequence shown in SEQ ID NO: 26, antisense oligomers having a base sequence in which 1 to 6 bases have been substituted, deleted, inserted or added from the base sequence shown in SEQ ID NO: 26, and conjugates thereof showed high APOC3 expression inhibitory activity and blood TG level reducing effect without causing any adverse events when administered in vivo to non-human primates. Based on these findings, the present inventors have conducted further research and have completed the present invention. [Effects of the Invention]

[0010] This specification can provide antisense nucleic acids targeting APOC3, conjugates, and pharmaceuticals containing the same, which have high activity and can be administered at reduced doses. [Brief explanation of the drawings]

[0011] [Figure 1] FIG. 1 shows the results of in vitro first screening of antisense nucleic acids targeting human APOC3 mRNA using the CEM method. [Figure 2] FIG. 2 shows the results of in vitro second screening of antisense nucleic acids targeting human APOC3 mRNA using the CEM method. [Figure 3] FIG. 3 shows a comparison of the inhibitory effects of known drugs (comparative examples) and antisense nucleic acid Np.26 on human APOC3 mRNA expression in Huh-7. [Figure 4] Figure 4 shows the selective suppression effect of a GalNAc conjugate of antisense nucleic acid No. 26 on human APOC3 mRNA expression in human liver chimeric mice. Figure 4a shows the effect on mouse hepatocytes remaining in the human liver chimeric mice, and Figure 4b shows the effect on human hepatocytes in the human liver chimeric mice. [Figure 5] FIG. 5 shows the blood triglyceride-lowering effect of a GalNAc conjugate of antisense nucleic acid No. 26 in cynomolgus monkeys. [Figure 6] FIG. 6 shows the results of in vitro activity evaluation of antisense nucleic acids targeting human APOC3 mRNA. [Figure 7] FIG. 7 shows the blood triglyceride-lowering effect of a GalNAc conjugate of antisense nucleic acid No. 26 in cynomolgus monkeys. [Figure 8] FIG. 8 shows the APOC3 mRNA expression suppression effect of a GalNAc conjugate of antisense nucleic acid No. 26 in cynomolgus monkeys. [Figure 9] FIG. 9 shows the time course of serum ALT levels in cynomolgus monkeys administered a GalNAc conjugate of antisense nucleic acid No. 26. [Figure 10] FIG. 10 shows the time course of serum creatinine levels in cynomolgus monkeys administered a GalNAc conjugate of antisense nucleic acid No. 26. [Figure 11] FIG. 11 shows the time course of serum ALT levels in cynomolgus monkeys administered various doses of a GalNAc conjugate of antisense nucleic acid No. 26. [Figure 12] FIG. 12 shows the time course of serum creatinine levels in cynomolgus monkeys administered various doses of a GalNAc conjugate of antisense nucleic acid No. 26. [Figure 13] FIG. 13 shows the in vitro APOC3 mRNA expression suppression activity of antisense nucleic acid No. 26-3 (SEQ ID NO: 38) analogs. DETAILED DESCRIPTION OF THE INVENTION

[0012] The following describes embodiments of the present invention. The present invention is not limited to the embodiments described below, and also includes appropriate modifications of the embodiments described below within the scope obvious to those skilled in the art.

[0013] antisense nucleic acids The first invention described in this specification relates to an antisense oligomer, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable hydrate thereof (hereinafter, these are also collectively referred to as the antisense nucleic acid of the present invention).

[0014] The length of the base sequence of the oligonucleotide (antisense oligomer) used in the present invention is not particularly limited. For example, the length of the base sequence of the antisense oligomer may be any of 10 to 25 bases, 12 to 22 bases, 13 to 21 bases, 14 to 20 bases, 13 to 16 bases (14 to 16 bases), 13 to 15 bases (14 or 15 bases), or 14 bases.

[0015] Examples of pharmaceutically acceptable salts of antisense oligomers include salts formed with inorganic bases, ammonia, organic bases, inorganic acids, and halide ions (e.g., Cl), as well as internal salts. Examples of inorganic bases include alkali metals (e.g., Na, K) and alkaline earth metals (e.g., Ca, Mg). Examples of organic bases include trimethylamine, triethylamine, choline, procaine, ethanolamine, and the like. Examples of inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, and the like. Pharmaceutically acceptable hydrates of antisense oligomers may be any hydrate.

[0016] Examples of antisense oligomers in the antisense nucleic acids of the present invention include antisense oligomers having the nucleotide sequence set forth in SEQ ID NO: 26, antisense oligomers having a nucleotide sequence in which 1 to 6 nucleotides have been substituted, deleted, inserted, or added from the nucleotide sequence set forth in SEQ ID NO: 26, pharmaceutically acceptable salts thereof, and pharmaceutically acceptable hydrates thereof. The nucleotide sequences specified by SEQ ID NOs include linear and cyclic ones. Furthermore, examples of constituent units of antisense oligomers in the antisense nucleic acids of the present invention include ribonucleotides (RNA) and deoxyribonucleotides (DNA). These nucleotides may be modified or unmodified.

[0017] The nucleotide residue contains a sugar, a base, and a phosphate as its constituent elements. Ribonucleotides have a ribose residue as the sugar and adenine (A), guanine (G), cytosine (C), 5-methylcytosine (mC), and uracil (U) (which can be replaced with thymine (T)) as bases. Deoxyribonucleotide residues have a deoxyribose residue as the sugar and adenine (dA), guanine (dG), cytosine (dC), 5-methylcytosine (dmC), and thymine (dT) (which can be replaced with uracil (dU)) as bases. Hereinafter, nucleotides containing adenine, guanine, (5-methyl)cytosine, uracil, and thymine may be referred to as adenine nucleotide, guanine nucleotide, (5-methyl)cytosine nucleotide, uracil nucleotide, and thymine nucleotide, respectively.

[0018] Preferred examples of antisense oligomers having a nucleotide sequence in which 1 to 6 bases have been substituted, deleted, inserted or added relative to the nucleotide sequence shown in SEQ ID NO: 26 include antisense oligomers having a nucleotide sequence shown in any of SEQ ID NOs: 26 and 37 to 41, and antisense oligomers having a nucleotide sequence in which 1 or 2 bases have been substituted, deleted, inserted or added relative to the nucleotide sequence shown in any of SEQ ID NOs: 26 and 37 to 41. Of these, the antisense oligomer having the nucleotide sequence shown in SEQ ID NO: 26 is more preferred. SEQ ID NO: 26: agaatactgtccct SEQ ID NO: 37: tgagaatactgtccct SEQ ID NO: 38: gagaatactgtccct SEQ ID NO: 39: agaatactgtccctt SEQ ID NO: 40: tgagaatactgtccctt SEQ ID NO: 41: actgagaatactgtcccttt

[0019] A preferred example of the antisense nucleic acid of the present invention is an oligonucleotide, such as an antisense oligomer, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable hydrate thereof, which is complementary to the human apolipoprotein C3 (APOC3) gene and has the activity of inhibiting expression of the APOC3 gene. This antisense nucleic acid is capable of binding to the APOC3 gene. Preferably, this antisense nucleic acid is capable of forming a double-stranded nucleic acid with the APOC3 gene. This antisense nucleic acid binds to the APOC3 gene and has the activity of degrading APOC3 mRNA or inhibiting the biosynthesis of APOC3 protein. The activity of these can be evaluated using the CEM method, for example, as shown in the following examples.

[0020] The human APOC3 gene has the nucleotide sequence shown in SEQ ID NO: 33 and encodes the amino acid sequence shown in SEQ ID NO: 34. Human APOC3 genes include not only those having the nucleotide sequence shown in SEQ ID NO: 33, but also mutants that can occur in the human body, and also include genes consisting of the nucleotide sequence shown in SEQ ID NO: 33 with one or several (2, 3, 4, 5, or 6) nucleotides substituted, deleted, inserted, or added. The binding site of the antisense nucleic acid of the present invention with the human APOC3 gene can be confirmed using known methods.

[0021] A preferred example of the antisense nucleic acid of the present invention has a modified site in which either or both of the sugar moiety and the phosphate linkage moiety of at least one nucleotide constituting the oligonucleotide are modified.

[0022] Preferred examples of the antisense nucleic acid of the present invention are: a first modification site in which a sugar moiety of at least one nucleotide constituting the oligonucleotide is modified, in a region of 2 to 7 bases from the 5' end; The oligonucleotide has a second modification site in a region of 2 to 4 bases from the 3' end, where the sugar moiety of at least one nucleotide constituting the oligonucleotide is modified. Such modifications make the compound less susceptible to degradation by nucleases and it can remain in the body for a long period of time after administration.

[0023] Known modifications can be appropriately employed. An example of the modification is a bridge structure between the 4' and 2' positions. Examples of the bridge structure are α-L-methyleneoxy, beta-D-methyleneoxy, and ethyleneoxy. Other examples of the bridge structure are oxyamino (4'-CH2-NH-O-2'), N-methyloxyamino (4'-CH2-NCH3-O-2'), unsubstituted amide (4'-CO-NH-2'), N-methylamide (4'-CO-NCH3-2'), acetamide (4'-CH2-CO-NH-2'), N-methylacetamide (4'-CH2-CO-NCH3-2'), N-oxyacetamide (4'-CH2-CO-NH-O-2'), and N-methyl-N-oxyacetamide (4'-CH2-CO-NCH3-O-2'). These can be synthesized by the methods described in WO2011 / 052436 or WO2012 / 029870.

[0024] Other examples of the bridged structure include amino (4'-CH2-NH-2') and N-methylamino (4'-CH-NCH3-2'), which can be synthesized by the methods described in, for example, Kumar R. et al., Bioorg. & Med. Chem. Lett., 1998, 8, 2219-2222; Singh SK et al., J. Org. Chem., 1998, 63, 10035-39.

[0025] These bridged structures are introduced into the nucleosides that make up an oligonucleotide to form a bridged artificial nucleoside. When multiple bridged artificial nucleosides are present in an oligonucleotide, the bridged structures may all be the same or may be different, and there is no particular limitation. The content of bridged artificial nucleosides in an oligonucleotide is not particularly limited. Examples of lower limits are 5%, 7%, 10%, 15%, 20%, or 25% by number, and examples of upper limits are 100%, 90%, 80%, 70%, or 60% by number.

[0026] At least one nucleotide at the first modification site and the second modification site preferably has a modified sugar containing a 2'-modification. The 2'-modification may be a known modification. The 2'-modification may be a bridge structure between the 4' and 2' positions. These can be synthesized, for example, according to the method described in WO 2011 / 052436. Examples of 2'-modifications in modified sugars that contain 2'-modifications are: 2'-OMe or 2'-OCH2CH2OMe (wherein Me represents a methyl group), A modified sugar containing a 2'-modification is a locked nucleic acid sugar (LNA) (a sugar modified with a group designated -O-CH2- located between C2 and C4 of the sugar moiety). Alternatively, an example of a 2'-modification in a modified sugar that includes a 2'-modification is 2'-F (fluoro). Alternatively, the modified sugar containing a 2'-modification is AmNA (a sugar modified with a group designated -N(CH3)-CO- located between C2 and C4 of the sugar moiety). Additionally, at least one nucleotide in the first modification site and the second modification site may be an unmodified nucleotide (RNA or DNA).

[0027] In the sugar phosphate backbone, for example, the phosphate group can be modified. In the sugar phosphate backbone, the phosphate group closest to the sugar residue is called the α-phosphate group. The α-phosphate group is negatively charged, and the charge is uniformly distributed over the two oxygen atoms not bonded to the sugar residue. Of the four oxygen atoms in the α-phosphate group, the two oxygen atoms not bonded to the sugar residue in the phosphodiester bond between nucleotide residues are hereinafter also referred to as "non-linking oxygens." On the other hand, the two oxygen atoms bonded to the sugar residue in the phosphodiester bond between nucleotide residues are hereinafter referred to as "linking oxygens." The α-phosphate group is preferably modified, for example, to become uncharged or to have an asymmetric charge distribution at the non-linking oxygens.

[0028] The phosphate group may, for example, substitute for the non-bonding oxygen. The oxygen can be substituted with any of the following atoms: S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen), and OR (R is an alkyl group or an aryl group), and is preferably substituted with S. Either or both of the non-bonding oxygens may be substituted, and preferably either or both are substituted with S. More specifically, examples of the modified phosphate group include phosphorothioate, phosphorodithioate, phosphoroselenate, boranophosphate, boranophosphate ester, phosphonate hydrogen, phosphoramidate, alkyl or aryl phosphonate, and phosphotriester. Among the antisense nucleic acids of the present invention, those having modifications at the phosphate binding site include, for example, The phosphate bond of at least one nucleotide is any one selected from the group consisting of phosphorothioate bond, phosphorodithioate bond, alkylphosphonate bond, phosphoramidate bond, and boranophosphate bond. Among these modifications of the phosphate bond, phosphorothioate bond is preferred.

[0029] Alternatively, the phosphate group may be substituted with a non-phosphorus-containing linker. Examples of such linkers include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Preferred examples include a methylenecarbonylamino group and a methylenemethylimino group. Alternatively, the phosphate group may be substituted with another non-phosphorus-containing linker. Examples of such linkers include those described in "Med. Chem. Commun., 2014, 5, 1454-1471."

[0030] In a preferred embodiment, at least half, more preferably at least two-thirds, of the phosphate groups are modified by one or more of the above-mentioned phosphate group modifications, and even more preferably, all of the phosphate groups are modified. For example, in the case of a 15-mer antisense nucleic acid, at least eight, preferably at least ten, and more preferably all of the phosphate groups are modified, for example, by phosphorothioation or phosphorodithioation. Substitution of non-bonded oxygen atoms at phosphodiester bonds with sulfur atoms is important for improving nuclease resistance and tissue distribution of antisense nucleic acids.

[0031] Of the antisense oligomers having the base sequence shown in any of the above-mentioned SEQ ID NOs: 26 and 37 to 41, preferred are the following Nos. 26-1 (sometimes simply referred to as "No. 26") to 26-6, which may be substituted, deleted, inserted, or added as described above, or further modified. No. 26-1: AGAatactgtcCCt (SEQ ID NO: 26) No.26-2:TgAg A atactgtcCCt (SEQ ID NO: 37) No.26-3:GAg A atactgtcCCt (SEQ ID NO: 38) No.26-4:AG A atactgtccCTt (SEQ ID NO: 39) No.26-5:TgAg A atactgtccCTt (SEQ ID NO: 40) No.26-6:AcTgag A atactgtcccTtT (SEQ ID NO: 41) Further, other preferred antisense oligomers having the base sequence shown in SEQ ID NO: 38 are Nos. 26-7 to 26-13 below, which may also be subjected to the above-mentioned substitutions, deletions, insertions, additions or further modifications. No.26-7:GAG R A atactgtcCCt (SEQ ID NO: 38) No.26-8:GAG F A atactgtcCCt (SEQ ID NO: 38) No.26-9:GA GA atactgtcCCt (SEQ ID NO: 38) No.26-10:GAG F A R atactgtcCCt (SEQ ID NO: 38) No.26-11:GA R G A atactgtcCCt (SEQ ID NO: 38) No.26-12:GA F G A atactgtcCCt (SEQ ID NO: 38) No.26-13:G A G A atactgtcCCt (SEQ ID NO: 38) Capital letters indicate LNA (Locked Nucleic Acid) (C indicates 5-methylcytosine LNA). Lowercase letters indicate DNA, Uppercase letters + underline indicate 2'-O-Me modifications; N R represents RNA(2'-OH) ("N" represents any base; the same applies below), N F indicates 2'-Fluoro modification, Each internucleoside bond represents a phosphorothioate bond.

[0032] In another preferred embodiment, the present invention provides A single-stranded oligonucleotide that inhibits expression of the APOC3 gene, a nucleotide sequence complementary to 10 or more consecutive nucleotide sequences in a target region consisting of any one of nucleotide sequences selected from the group consisting of nucleotide sequences at positions 438 to 526, 361 to 381, and 333 to 351 in a nucleic acid encoding APOC3, the nucleotide sequence being represented by SEQ ID NO: 33; the single-stranded oligonucleotide has a length of 10 to 25 nucleotides; the sugar moiety of at least one nucleoside constituting the single-stranded oligonucleotide is modified with a bridge between the 2'-position and the 4'-position of the sugar; Single-stranded oligonucleotide to provide. Here, the term "single-stranded oligonucleotide" includes not only the free form but also its pharmaceutically acceptable salt or pharmaceutically acceptable hydrate. The terms "pharmaceutically acceptable salt" and "hydrate" have the same meanings as defined above.

[0033] As used herein, "antisense oligonucleotide (ASO)" refers to a single-stranded oligonucleotide that specifically hybridizes to a sequence consisting of 10 or more consecutive nucleotides in a target nucleic acid. Furthermore, "inhibiting APOC3 gene expression" encompasses any manner in which, as a result, contacting an ASO with a cell reduces the expression level of APOC3 protein and decreases APOC3 activity compared to when the ASO is not contacted. Examples include degradation of the target RNA by RNase H (e.g., by gapmers) and inhibition of protein synthesis through specific and stable hybridization with the target RNA. The degree of expression inhibition is not particularly limited as long as it is statistically significant. For example, an ASO can be considered to have APOC3 gene expression inhibitory activity when the expression level of APOC3 mRNA or protein is reduced by 20% or more, preferably 50% or more, and more preferably 75% or more compared to when the ASO is not contacted with the cell.

[0034] Specifically, the ASO of the present invention targets a region of APOC3 mRNA consisting of the nucleotide sequence set forth in SEQ ID NO: 33 (where "t" is replaced with "u"), which is comprised of a nucleotide sequence selected from the group consisting of nucleotide sequences at positions 438 to 526, 361 to 381, and 333 to 351. The ASO contains a nucleotide sequence complementary to at least 10 consecutive nucleotides in the region. Here, "complementary" refers not only to a sequence that is completely complementary to the target sequence (i.e., hybridizes without mismatches), but also to a sequence containing one to several (e.g., 1, 2, 3, 4, or 5) nucleotide mismatches, preferably one or two nucleotides, as long as it can hybridize with APOC3 mRNA under physiological conditions in human cells. For example, the ASO may have an identity of 90% or more, preferably 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, and most preferably 100%, to the complementary strand of the target nucleotide sequence in APOC3 mRNA. In the present invention, "nucleotide sequence identity" can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3). Furthermore, the complementarity of individual bases is not limited to the formation of Watson-Crick base pairs with the target base, but also includes the formation of Hoogsteen base pairs and wobble base pairs.

[0035] Alternatively, a "complementary nucleotide sequence" refers to a nucleotide sequence that hybridizes with a target sequence under stringent conditions. Here, "stringent conditions" include, for example, those described in *Current Protocols in Molecular Biology*, John Wiley & Sons, pp. 6.3.1-6.3.6, 1999, such as hybridization in 6xSSC (sodium chloride / sodium citrate) at 45°C, followed by one or more washes at 0.2xSSC / 0.1% SDS at 50-65°C. However, those skilled in the art can appropriately select hybridization conditions that provide equivalent stringency.

[0036] In a preferred embodiment, the region in APOC3 mRNA targeted by the ASO of the present invention is a region consisting of any one of nucleotide sequences selected from the group consisting of nucleotide sequences at positions 438 to 451, 448 to 461, 498 to 511, 513 to 526, 368 to 381, and 333 to 346 in the nucleotide sequence represented by SEQ ID NO: 33, and a nucleotide sequence adjacent thereto. Here, "a nucleotide sequence adjacent thereto" refers to a nucleotide sequence of 10 nucleotides or less, preferably 5 nucleotides or less, adjacent to the 5'- and 3'-ends of each of the regions specified by nucleotide number. The same applies hereinafter.

[0037] In a more preferred embodiment, the region in APOC3 mRNA targeted by the ASO of the present invention is a region consisting of the nucleotide sequence from positions 438 to 451 in the nucleotide sequence represented by SEQ ID NO: 33 and the nucleotide sequence adjacent thereto. A preferred embodiment of the ASO of the present invention that targets this region includes an antisense oligomer having a base sequence represented by any of SEQ ID NOs: 26 and 37 to 41, described above, more specifically, the above antisense nucleic acids Nos. 26-1 to 26-13.

[0038] The ASO of the present invention has a target sequence consisting of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) consecutive nucleotides, preferably 14 or more (e.g., 14, 15, 16, 17, 18, 19, 20) consecutive nucleotides in any of the target regions described above, and contains a nucleotide sequence complementary to that target sequence.

[0039] As described above, the building blocks of the ASO of the present invention include RNA and DNA, which may be modified or unmodified. Examples of RNA and DNA residues and modified nucleotide residues are the same as those described above.

[0040] The ASO of the present invention is characterized in that the sugar moiety of at least one nucleoside is modified with a bridge between the 2' and 4' positions of the sugar. The 2',4'-bridge modification can increase the binding strength to target RNA and metabolic stability (nuclease resistance) in vivo due to its bridged structure. Among the above-mentioned bridged artificial nucleic acids, LNA, AmNA, GuNA, and scpBNA are more preferred. Preferably, the ASO of the present invention contains two or more bridged artificial nucleic acid residues (e.g., 2, 3, 4, or 5 or more). The position of the bridged artificial nucleic acid residues is not particularly limited as long as it does not adversely affect the APOC3 expression inhibitory activity. For example, when the ASO of the present invention is a gapmer type (described below), in a preferred embodiment, all or some of the nucleotide residues in the wing region are modified with bridged artificial nucleic acids.

[0041] In addition to the sugar-linking modifications described above, the ASOs of the present invention may also contain other sugar modifications, modifications at the phosphate linkage, or modifications at the base moiety, examples of which include those described above.

[0042] Among the ASOs of the present invention, preferred examples of ASOs that target a region consisting of any nucleotide sequence selected from the group consisting of nucleotide sequences at positions 448 to 461, 498 to 511, 513 to 526, 368 to 381, and 333 to 346 in the nucleotide sequence represented by SEQ ID NO: 33, and a nucleotide sequence adjacent thereto, include those having the following nucleotide sequences, respectively. SEQ ID NO: 28: gagagcactgagaa (target sequence: 438-451) SEQ ID NO: 30: tattgggaggccag (target sequence: 498-511) SEQ ID NO: 32: cttcttgtccagct (target sequence: 513-526) SEQ ID NO: 23: atggataggcaggt (target sequence: 368-381) SEQ ID NO: 18: caggcagccacggc (target sequence: 333-346)

[0043] In a preferred embodiment, ASOs having nucleotide sequences represented by SEQ ID NOs: 28, 30, 32 and 23 include the following: SEQ ID NO: 28: GAGagcactgaGAa SEQ ID NO: 30: TATtgggaggcCAg SEQ ID NO: 32: CTTcttgtccaGCt SEQ ID NO: 23: ATGgataggcaGGt SEQ ID NO: 18: CAGgcagccacGGc Capital letters indicate LNA (Locked Nucleic Acid) (C indicates 5-methylcytosine LNA). Lowercase letters indicate DNA, Each internucleoside bond represents a phosphorothioate bond.

[0044] In a preferred embodiment, the ASO of the present invention (1) the 5' wing region located at the 5' end; (2) a 3' wing region located at the 3' end; and (3) a deoxygap region located between region (1) and region (2) A gapmer ASO is a nucleic acid having DNA (deoxygap region) and nucleic acids (wing regions) to which modifications or crosslinks have been introduced, and the DNA strand serves as the backbone to form a heteroduplex with a target RNA complementary to the backbone, and the target RNA is degraded by RNase H present in cells. The constituent nucleotides of the wing regions may be RNA or DNA.

[0045] The 5' and 3' wing regions of the gapmer ASO of the present invention are each independently 2 to 7 nucleotides in length, preferably 3 to 5 nucleotides in length, and more preferably 3 nucleotides in length. The length of the deoxygap region of the gapmer ASO of the present invention is 7 to 10 nucleotides in length, preferably 8 to 10 nucleotides in length, and more preferably 8 nucleotides in length. The total length of the gapmer ASO of the present invention is, for example, 12 to 25 nucleotides in length, and preferably 14 to 20 nucleotides in length. Therefore, the gapmer ASO of the present invention can be appropriately adjusted by those skilled in the art under conditions that satisfy all of the specified ranges for the wing region length, deoxygap region length, and total length.

[0046] More specifically, the gapmer-type ASO of the present invention is preferably, for example, a 14-nucleotide long "3-8-3" type gapmer, a "3-9-2" type gapmer, a "2-9-3" type gapmer, or a "4-8-2" type gapmer; a 15-nucleotide long "3-9-3" type gapmer, a "4-8-3" type gapmer; a 16-nucleotide long "5-8-3" type gapmer, a "4-9-3" type gapmer; a 17-nucleotide long "5-8-4" type gapmer, a "6-8-3" type gapmer; an 18-nucleotide long "6-8-4" type gapmer, a "6-9-3" type gapmer; or a 20-nucleotide long "7-10-3" type gapmer.

[0047] In the gapmer ASO of the present invention, the sugar moiety of at least one nucleoside constituting the 5' and 3' wing regions is preferably modified by a bridge between the 4' and 2' positions of the sugar. Examples of such bridge modifications include modifications using the aforementioned bridged artificial nucleic acids. Preferred are LNA, AmNA, GuNA, and scpBNA. In a preferred embodiment, the gapmer ASO of the present invention has two or more (e.g., 2, 3, 4, or 5) nucleotide residues constituting each of the 5' and 3' wing regions substituted with bridged artificial nucleic acids.

[0048] In a preferred embodiment, the DNA residues that make up the deoxygap region of the gapmer-type ASO of the present invention are not sugar-modified.

[0049] Furthermore, gapmer ASOs of the present invention can be modified by base modifications in the deoxygap region or dual modifications in the wing regions to reduce toxicity, as described, for example, in WO 2018 / 155450.

[0050] Oligonucleotide conjugates The second invention described in this specification relates to oligonucleotide conjugates having the antisense nucleic acids of the invention. The conjugate has a structure in which the antisense nucleic acid of the present invention is bound to a molecule capable of binding to the asialoglycoprotein (ASGP) receptor. The conjugate, including its preparation method, is described, for example, in International Publication No. 2018-216785.

[0051] The oligonucleotide conjugate comprises one or more linearly linked molecules containing molecules capable of binding to the ASGP receptor (ASGP receptor-binding molecules) at the 5'-end, 3'-end, or both ends of any of the above-mentioned antisense nucleic acids. Since the ASGP receptor has the function of transporting glycoproteins containing sugar chains with terminal galactose or its analogs exposed in the liver and processing them, when two or more molecules containing ASGP receptor-binding molecules are linked, it is desirable that each molecule containing an ASGP receptor-binding molecule be linked in such a manner that the ASGP receptor-binding molecule portion can be exposed at its terminal (e.g., the ASGP receptor-binding molecule is linked to the side chain of a linker having a main chain and a side chain, and the main chain of the linker is linearly linked and bound to the terminal of the antisense nucleic acid). Therefore, hereinafter, when the phrase "an ASGP receptor-binding molecule is linked to the terminal of an antisense nucleic acid" is used to mean that the molecule containing the ASGP receptor-binding molecule is linked via a portion other than the ASGP receptor-binding molecule. The number of ASGP receptor-binding molecules may be 2 or more, or 3 or more, or may be 10 or less, 7 or less, or 5 or less. When ASGP receptor-binding molecules are bound to both ends of the antisense nucleic acid, the number of ASGP receptor-binding molecules is, for example, 4 or more and 20 or less.

[0052] Examples of ASGP receptor binding molecules are asialoglycoproteins, and more specific examples are lactose, galactose, N-acetylgalactosamine (GalNAc), galactosamine, N-formylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, N-iso-butanoylgalactosamine, and derivatives thereof. A preferred example of ASGP receptor binding molecule is GalNAc.APOC3 protein is the protein that is mainly expressed in hepatocyte, and the effective delivery of antisense to liver can further reduce the dose.As shown in Example, by conjugating GalNAc to antisense nucleic acid as the ligand for ASGP receptor, which is the receptor that is specifically expressed in hepatocyte, the activity of antisense nucleic acid in liver can be increased by 10 times or more.

[0053] The ASGP receptor binding molecule may be linked to the antisense nucleic acid via a known linker.

[0054] For example, when two or more molecules capable of binding to ASGP receptors are bound to an oligonucleotide, the linker may be configured such that two or more main-chain linkers are linked to the oligonucleotide, and the molecules capable of binding to ASGP receptors are linked to each main-chain linker via side-chain linkers branched from the main chain. The main-chain linker is not particularly limited, and examples thereof include linear or branched, saturated or unsaturated carbon chain spacers. Here, when the side-chain linker contains a heteroatom as described below, the carbon chain may form a heterocycle together with the carbon atoms of the main chain. The length of the carbon chain is not particularly limited, but from the viewpoint of the degree of freedom of binding of the molecules capable of binding to the ASGP receptor to the ASGP receptor, the lower limit of the number of carbon atoms is preferably 2 or more, and the upper limit may be, for example, 18 or less, 16 or less, 12 or less, 10 or less, 8 or less, 6 or less, 5 or less, or 4 or less. Specific examples include ethylene chains, propylene chains, butylene chains, isopropylene chains, pentylene chains, hexylene chains, heptylene chains, octylene chains, nonylene chains, decylene chains, dodecylene chains, tetradecylene chains, hexadecylene chains, and octadecylene chains. The two or more main chain linkers in a conjugate may be the same or different. The side chain linker is also not particularly limited, and examples include linear or branched, saturated or unsaturated (which may contain heteroatoms or heterocycles) carbon chain spacers. The length of the carbon chain is not particularly limited, and examples include those having approximately 5 to 50 carbon atoms. The combination of these main chain linkers and side chain linkers may be simply referred to as a linker. In order to promote proper metabolism in cells, the linker in the present invention preferably has a structure with a high degree of freedom, and preferably has a structure that allows the molecules that can bind to the ASGP receptor to be flexibly accommodated in the spatially advantageous arrangement of the ASGP receptor. By having such a linker structure, the molecules that can bind to the ASGP receptor can be linked with individual degrees of freedom. For example, when the main chain linker is a linear saturated carbon chain, the degree of freedom is higher than when it has a cyclic structure.The bond between the molecule capable of binding to the ASGP receptor and the oligonucleotide, i.e., the bond between the linker and the oligonucleotide, can be exemplified by a phosphodiester bond or a phosphorothioate bond, but a phosphodiester bond is preferred from the viewpoint of proper metabolism in cells and efficient action of the oligonucleotide on the target mRNA. An example in which a molecule capable of binding to the ASGP receptor is linked via a suitable linker is given below.

[0055] Specific examples of the conjugate are Compound A1 and Compound B1 shown below. In these compounds, three ASGP receptor-binding molecules are bound to antisense nucleic acids. In Compound A1 and Compound B1, the three-dimensional wavy line portion represents the antisense nucleic acid.

[0056] [ka]

[0057] [ka]

[0058] As explained above, the number of ASGP receptor-binding molecules is not limited to three, and may be, for example, 1 or 2 or more and 10 or less. The general formulas (A) and (B) of the conjugates, in which Compound A1 and Compound B1 are representative compounds, respectively, are shown below.

[0059] [ka]

[0060] [ka]

[0061] For example, a compound of formula (B) in which the number of ASGP receptor-binding molecules is four (n=4) (corresponding to compound B2 used in Examples 9 and 10) is also a preferred example of a conjugate. The ASGP receptor-binding molecules having the structures of formula (A) and formula (B) may have appropriate substituents introduced therein. Furthermore, the length of the alkylene moiety in the linker may be appropriately changed.

[0062] Pharmaceutical compositions and medicaments The third invention described in this specification relates to a pharmaceutical composition or a pharmaceutical for inhibiting the expression of APOC3 protein, which comprises an effective amount of the antisense nucleic acid of the present invention as an active ingredient. Examples of the pharmaceutical include a therapeutic agent for hypertriglyceridemia and a therapeutic agent for primary hyperchylomicronemia. A fourth invention described in this specification relates to a pharmaceutical composition or pharmaceutical for inhibiting the expression of APOC3 protein, which contains an effective amount of the above-mentioned oligonucleotide conjugate as an active ingredient. Examples of the pharmaceutical include a therapeutic agent for hypertriglyceridemia and a therapeutic agent for primary hyperchylomicronemia.

[0063] Hypertriglyceridemia (TG), a condition characterized by a blood TG level of 150 mg / dL or higher, is recognized as a risk factor for coronary artery disease. Apolipoproteins play multiple roles in lipoprotein clearance, including inhibiting hepatic uptake of lipoproteins and inhibiting the enzyme lipoprotein lipase (LPL). Epidemiological studies have shown that individuals with loss-of-function or loss-of-function mutations in APOC3 have a 44% lower TG level and a 41% lower risk of coronary artery disease (Jorgensen, A.B., Frikke-Schmidt, R., Nordestgaard, B.G., and Tybjaerg-Hansen, A. (2014). Loss-of-function mutations in APOC3 and risk of ischemic vascular disease. N Engl J Med 371, 32-41.). APOC3 is therefore considered a good drug target for treating hypertriglyceridemia. The antisense nucleic acids and conjugates of the present invention inhibit the expression of APOC3 protein, and are therefore effective as pharmaceutical compositions for inhibiting the expression of APOC3 protein, or as therapeutic agents for hypertriglyceridemia (TG).

[0064] Hyperchylomicronemia is a disease in which chylomicrons accumulate in the blood. Chylomicrons are produced in the small intestine and transport dietary nutrients (mainly triglycerides and certain vitamins) absorbed from the small intestine to tissues throughout the body. The triglycerides contained in chylomicrons are broken down in the blood, and the resulting fatty acids are absorbed into tissues throughout the body. The LPL enzyme breaks down these triglycerides. When the function of LPL is inhibited, chylomicrons accumulate, resulting in hyperchylomicronemia. As described above, APOC3 protein inhibits the activity of the LPL enzyme. The antisense nucleic acids and conjugates of the present invention inhibit the expression of APOC3 protein and are therefore effective as therapeutic agents for hyperchylomicronemia.

[0065] Pharmaceutical compositions and medicaments contain an effective amount of the antisense nucleic acid or oligonucleotide conjugate of the present invention as an active ingredient. These may contain a single antisense nucleic acid or oligonucleotide conjugate as an active ingredient, or two or more types of antisense nucleic acid or oligonucleotide conjugate as active ingredients. In addition to the active ingredient, pharmaceutical compositions and medicaments may also contain a known pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers include, but are not limited to, excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, flavorings such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolidone, dispersants such as surfactants, diluents such as water and physiological saline, and base waxes. Pharmaceutical compositions and medicaments may be administered orally or parenterally (e.g., injections). Pharmaceutical compositions and medicaments may be prepared according to known methods.

[0066] The pharmaceutical compositions and medicaments of the present invention can be administered orally or parenterally, with parenteral administration being preferred. Suitable formulations for parenteral administration (e.g., subcutaneous injection, intramuscular injection, local injection (e.g., intraventricular administration), intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, isotonicity agents, etc. Other examples include aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, etc. Such formulations can be packaged in unit-dose or multi-dose containers, such as ampoules or vials. Alternatively, the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that requires only dissolving or suspending in an appropriate sterile vehicle immediately before use.

[0067] The content of the antisense nucleic acid or oligonucleotide conjugate of the present invention in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the total pharmaceutical composition.

[0068] The dosage of the pharmaceutical composition or medicament may be adjusted appropriately taking into consideration, for example, the age, sex, weight, dosage form, and number of administrations of the subject to be administered. For example, an effective amount per administration may be 0.01 μg to 1 g, or 0.1 μg to 0.1 g, of the antisense nucleic acid or oligonucleotide conjugate of the present invention per 50 kg body weight.

[0069] This specification also provides the use of the antisense nucleic acid or oligonucleotide conjugate of the present invention in the manufacture of a pharmaceutical composition for inhibiting expression of APOC3 protein, a therapeutic agent for hypertriglyceridemia, or a therapeutic agent for primary hyperchylomicronemia.

[0070] This specification also provides methods for inhibiting expression of APOC3 protein in a subject (human), methods for treating hypertriglyceridemia, and methods for treating primary hyperchylomicronemia, which comprise the step of administering to the subject (human) an antisense nucleic acid or oligonucleotide conjugate of the present invention. [Example]

[0071] Antisense nucleic acid synthesis Antisense oligonucleotides (or modified versions thereof) were synthesized according to conventional methods. Antisense nucleic acids can be synthesized using a known automated nucleic acid synthesizer (e.g., manufactured by Applied Biosystems, Dainippon Seiki Co., Ltd., etc.). Examples of methods for synthesizing antisense nucleic acids include solid-phase synthesis using phosphoramidites and solid-phase synthesis using hydrogen phosphonates, as disclosed, for example, in Tetrahedron Letters 22, 1859-1862 (1981) and WO 2011 / 052436. Yamamoto, T., Sawamura, M., Wada, F., Harada-Shiba, M., and Obika, S. (2016). Serial incorporation of a monovalent GalNAc phosphoramidite unit into hepatocyte-targeting antisense oligonucleotides. Modified nucleic acids No. 1 to No. 32 (Table 1) were synthesized with reference to the method described in Bioorg Med Chem 24, 26-32.

[0072] [Table 1] [Example]

[0073] Antisense nucleic acid screening Huh-7, a human hepatoma cell line, was seeded onto a 96-well plate at 5000 cells / well and cultured for 24 hours in DMEM (10% FBS, 1% penicillin, 1% streptomycin). The culture medium was then resuspended in CaCl2+ containing each antisense antibody with a 2',4'-linked sugar moiety (LNA) modification to a final concentration of 200 nM. 2+The medium was replaced with enrichment medium (CEM: DMEM with 10% FBS, 9 mM CaCl2) and cultured for another 24 hours. After that, cDNA was prepared from the cell lysate using SuperPrep® II Cell Lysis & RT Kit for qPCR (TOYOBO Co., Ltd.) and analyzed using StepOnePlus TM GAPDH mRNA and APOC3 mRNA were quantified using the following probes in a real-time PCR system (Applied Biosystems). The expression level of APOC3, normalized with GAPDH, was calculated as a relative value, with the value for non-antisense treatment (NT) set at 1. The results are shown in Figure 1. Human GAPDH mRNA: hs02786624_g1 Human APOC3 mRNA: hs00906501_g1 [Example]

[0074] Antisense nucleic acid screening In Example 2, five antisense nucleic acids (No. 23, No. 26, No. 28, No. 30, No. 32) targeting the 3'UTR showed high APOC3 expression inhibitory activity. The sugar moiety 2',4'-bridged nucleic acid was replaced with AmNA, and the concentration dependency of APOC3 gene expression inhibition was examined. Huh-7, a human hepatoma-derived cell line, was seeded onto a 96-well plate at 5000 cells / well and cultured in DMEM (supplemented with 10% FBS, 1% penicillin, and 1% streptomycin) for 24 hours. The culture medium was then resuspended in Ca 2+ 1000 ribonucleotides containing each AmNA-modified antisense to final concentrations of 8, 40, and 200 nM. 2+ The medium was replaced with enrichment medium (CEM: DMEM with 10% FBS, 9 mM CaCl2) and cultured for another 24 hours. After that, cDNA was prepared from the cell lysate using SuperPrep® II Cell Lysis & RT Kit for qPCR (TOYOBO Co., Ltd.) and analyzed using StepOnePlus TMGAPDH mRNA and APOC3 mRNA were quantified using the following probes in a real-time PCR system (Applied Biosystems). The expression level of APOC3, normalized with GAPDH, was calculated as a relative value, with the value for non-treatment with antisense (NT) set at 1. The results are shown in Figure 2. All antisense nucleic acids inhibited APOC3 expression in a concentration-dependent manner. Human GAPDH mRNA: hs02786624_g1 Human APOC3 mRNA: hs00906501_g1 [Example]

[0075] Comparison with existing drugs Huh-7, a human hepatoma-derived cell line, was seeded onto a 96-well plate at 5,000 cells / well and cultured in DMEM (10% FBS, 1% penicillin, 1% streptomycin) for 24 hours. The culture medium was then resuspended in CaCl2+ medium containing a modified antisense nucleic acid (antisense nucleic acid No. 26 (LNA modified)) having the base sequence shown in SEQ ID NO: 26 at a final concentration of 100 nM or 200 nM. 2+ The medium was replaced with enrichment medium (CEM: DMEM with 10% FBS, 9 mM CaCl2) and the cells were cultured for another 24 hours. cDNA was prepared from cell lysates using SuperPrep® II Cell Lysis & RT Kit for qPCR (TOYOBO Co., Ltd.), and then analyzed using StepOnePlus TM GAPDH mRNA and APOC3 mRNA were quantified using the following probes in a real-time PCR system (Applied Biosystems), and the expression level of APOC3 corrected for GAPDH was calculated. Human GAPDH mRNA: hs02786624_g1 (applied biosystems) Human APOC3 mRNA: hs00906501_g1 (applied biosystems)

[0076] The base sequence of antisense nucleic acid No. 26 (LNA modified) was as follows: AGAatactgtcCCt (SEQ ID NO: 26) (Uppercase letters indicate LNA, and lowercase letters indicate DNA.)

[0077] [Comparative Example 1] GAPDH mRNA and APOC3 mRNA were quantified in the same manner as in Example 4, except that an oligonucleotide (Gene Co., Ltd.) with the same sequence and modification (the central 10 nucleotides are DNA, the five nucleotides at both ends are 2'MOE modified, and all internucleotide bonds are phosphorothioate bonds) as volanesorsen (an antisense nucleic acid complementary to the base sequence shown at positions 3533-3552 of SEQ ID NO: 4 (the base sequence of the initial transcription product of APOC3) in Patent Document 2) was used instead of antisense nucleic acid No. 26 (LNA modified). The expression level of APOC3 corrected for GAPDH was calculated.

[0078] The measurement results of Example 4 and Comparative Example 1 were compared and expressed as relative values, with the value of non-antisense treatment set to 1. P values ​​were calculated using Student's t-test. The results are shown in Figure 3. As shown in Figure 3, it was found that antisense nucleic acid No. 26 exhibited significantly higher gene expression-inhibiting activity than the antisense nucleic acid of Comparative Example 1. In other words, it was shown that the sugar-bridge-modified antisense nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1 has higher activity than conventional pharmaceuticals, and therefore exhibits higher efficacy than conventional pharmaceuticals at lower doses. [Example]

[0079] To predict efficacy in humans, a single dose of 1 mg / kg of GalNAc-conjugated antisense nucleic acid No. 26 (LNA modified) with the structure of Compound A1 was subcutaneously administered to human liver chimeric mice (Phoenix Bio, Inc.), mice whose hepatocytes had been replaced with human hepatocytes. Seven days after administration, blood samples were collected and the livers were autopsied, and serum ALT levels and human APOC3 mRNA and human GAPDH mRNA in the liver were quantified. Human APOC3 mRNA was measured using StepOnePlus TM Human GAPDH mRNA was detected using the following Taqman probe and the following primers in a real-time PCR system (Applied Biosystems) with SYBR Green. P values ​​were calculated using Student's t-test. The results are shown in Figure 4.

[0080] Human APOC3 mRNA: hs00906501_g1 (applied biosystems) Human GAPDH mRNA: Fw 5'GCACCGTCAAGGCTGAGAAC3' (SEQ ID NO: 35) Rv 5'TGGTGAAGACGCCAGTGGA3' (SEQ ID NO: 36) XXXA^G^A^a^t^a^c^t^g^t^c^C^C^t(Array number 26) X represents an N-acetylgalactosamine (GalNAc)-containing monomer molecule of compound A1; Capital letters indicate LNA (Locked Nucleic Acid) (C indicates 5-methylcytosine LNA). Lowercase letters indicate DNA, The internucleoside bond ^ indicates a phosphorothioate bond.

[0081] As shown in Figure 4a, no effect was observed on mouse apoc3 mRNA remaining in the mouse liver, but as shown in Figure 4b, it specifically suppressed the expression of human apoc3 mRNA in human hepatocytes. [Example]

[0082] Efficacy confirmation test in cynomolgus monkeys To predict efficacy in humans, two male cynomolgus monkeys (4 years old), which share a relatively high genetic homology with apoC3, received a single subcutaneous administration of 3 mg / kg of antisense nucleic acid No. 26 (LNA-modified) conjugated with GalNAc having the structure of Compound A1. Blood samples were collected from the femoral vein two days before administration, three days after administration, and seven days after administration. Serum was obtained by centrifugation at 1,700 × g for 10 minutes. Serum triglyceride concentrations were measured using a JCA-BM6070 (JEOL Ltd.). As a result, a significant decrease in serum triglyceride levels was observed in both cynomolgus monkeys (Figure 5). [Example]

[0083] In vitro activity of 14-20mer antisense nucleic acids similar to antisense nucleic acid No. 26 In the same manner as in Example 1, antisense nucleic acid No. 26-2 (SEQ ID NO: 37) to antisense nucleic acid No. 26-6 (SEQ ID NO: 41), which are 14- to 20-mer antisense nucleic acids similar to antisense nucleic acid No. 26, were synthesized. No.26-2: TgAg A atactgtcCCt (SEQ ID NO: 37) No.26-3: GAg A atactgtcCCt (SEQ ID NO: 38) No. 26: AGAatactgtcCCt (SEQ ID NO: 26) No.26-4: AG A atactgtccCTt (SEQ ID NO: 39) No.26-5: TgAg A atactgtccCTt (SEQ ID NO: 40) No.26-6:AcTgag A atactgtcccTtT (SEQ ID NO: 41) Capital letters indicate LNA (Locked Nucleic Acid) (C indicates 5-methylcytosine LNA). Lowercase letters indicate DNA, Uppercase letters + underline indicate 2'-O-Me modifications; Each internucleoside bond represents a phosphorothioate bond.

[0084] The APOC3 expression inhibitory activity of antisense nucleic acid No. 26 and No. 26-2 to No. 26-6 was measured in the same manner as in Example 2. As a result, all of the antisense nucleic acid No. 26 derivatives (No. 26-2 to No. 26-6) exhibited high APOC3 expression inhibitory activity similar to that of antisense nucleic acid No. 26 (Figure 6). [Example]

[0085] To predict efficacy in humans, a single subcutaneous administration of 1 mg / kg of antisense nucleic acid No. 26 (LNA modified) conjugated with GalNAc having the structure of Compound B1 was performed in two male cynomolgus monkeys (2-5 years old), which are animals with a relatively high genetic homology to apoC3. Seven days after administration, autopsies were performed on the livers, and APOC3 mRNA and GAPDH mRNA in the liver were quantified. APOC3 mRNA and GAPDH mRNA were measured using StepOnePlus TM Detection was carried out using the following Taqman probe in a real-time PCR system (applied biosystems). Relative values ​​were calculated by setting the value in cynomolgus monkeys not administered antisense nucleic acid No. 26 at 1.

[0086] Cynomolgus monkey GAPDH mRNA: Mf04392546_g1 Cynomolgus monkey APOC3 mRNA: Mf02794312_m1 The results are shown in Figure 7. As shown in FIG. 7, a decrease of 85% or more in APOC3 mRNA was confirmed in both cynomolgus monkeys. [Example]

[0087] To confirm the efficacy of No. 26 (SEQ ID NO: 26), which is conjugated with four GalNAc molecules like compound B2, a single subcutaneous administration of 3 mg / kg was performed to 12 cynomolgus monkeys (3-5 years old, male).

[0088] [ka]

[0089] Three days after administration (Group 1), 28 days (Group 2), 56 days (Group 3), and 91 days (Group 4) were spent, and three animals were collected for blood sampling and liver necropsies were performed. The collected blood was centrifuged (room temperature, 1700 × g, 10 minutes) to prepare serum, and ALT and creatinine concentrations were measured using an automated analyzer (JCA-BM6070, JEOL Ltd.). The autopsied livers were immersed in RNAlater (Thermo Fisher Scientific), refrigerated overnight, and then transferred to an ultra-low temperature freezer (-70°C) for storage. cDNA was prepared from total RNA extracted from the liver, and APOC3 mRNA and GAPDH mRNA in the liver were quantified. APOC3 mRNA and GAPDH mRNA were detected using the StepOnePlus™ Real-Time PCR System (Applied Biosystems) with the following Taqman probes. Relative values ​​were calculated, with the value in cynomolgus monkeys not administered the antisense set at 1. Cynomolgus monkey GAPDH mRNA: Mf04392546_g1 Cynomolgus monkey APOC3 mRNA: Mf02794312_m1 As a result, APOC3 mRNA in the liver was significantly reduced for more than 56 days after administration, as shown in Figure 8. Furthermore, as shown in Figures 9 and 10, although a temporary increase in serum ALT levels was observed, serum ALT and creatinine levels remained almost normal for more than 91 days after administration. [Example]

[0090] To confirm the safety of No. 26 (SEQ ID NO: 26), which is conjugated with four GalNAc molecules like Compound B2, single subcutaneous doses of 0.5, 1, 3, and 20 mg / kg were administered to male cynomolgus monkeys (2-4 years old, three monkeys per dose). For comparison, saline was administered to three monkeys. Blood samples were collected once on days 4, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, and 90 after administration. The collected blood was centrifuged (room temperature, 1700 × g, 10 minutes) to obtain serum, and the concentrations of ALT and creatinine were measured using an automatic analyzer (JCA-BM6070, JEOL Ltd.). As a result, although a temporary increase in ALT levels was confirmed, no dose-dependency was confirmed (Figure 11), and similar changes were observed in the saline-administered group, so this change is not thought to be due to the test substance. There was also no change in creatinine levels (Figure 12). [Example]

[0091] In vitro activity of antisense nucleic acid No. 26-3 (SEQ ID NO: 38) analogues Antisense nucleic acid No. 26-7 to No. 26-13, which are analogues of antisense nucleic acid No. 26-3 (sequence number 38), were synthesized, and their in vitro activities were measured at a concentration of 50 nM in the same manner as in Example 1, and evaluated in comparison with antisense nucleic acid No. 26 (sequence number 26). No.26-3:GAg A atactgtcCCt (SEQ ID NO: 38) No.26-7:GAG R A atactgtcCCt (SEQ ID NO: 38) No.26-8:GAG F A atactgtcCCt (SEQ ID NO: 38) No.26-9:GA GA atactgtcCCt (SEQ ID NO: 38) No.26-10:GAG F A R atactgtcCCt (SEQ ID NO: 38) No.26-11:GA R GA atactgtcCCt (SEQ ID NO: 38) No.26-12:GA F G A atactgtcCCt (SEQ ID NO: 38) No.26-13:G A G A atactgtcCCt (SEQ ID NO: 38) Capital letters indicate LNA (Locked Nucleic Acid) (C indicates 5-methylcytosine LNA). Lowercase letters indicate DNA, Uppercase letters and underlines indicate 2'-O-Me modifications. N R indicates RNA(2'-OH) ("N" indicates any base; the same applies below), N F indicates 2'-Fluoro modification, Each internucleoside bond represents a phosphorothioate bond. As a result, all of the antisense nucleic acid No. 26-3 analogs (No. 26-7 to No. 26-13) exhibited high APOC3 expression inhibitory activity similar to that of antisense nucleic acid No. 26 (FIG. 13).

[0092] The above examples have demonstrated that antisense nucleic acids having the sugar moiety cross-linking modification described in SEQ ID NO: 26 and their various derivatives and conjugates have significant effects compared to conventional pharmaceuticals, inhibiting the expression of APOC3 protein and being effective as active ingredients in therapeutic agents for hypertriglyceridemia and primary hyperchylomicronemia. [Industrial Applicability]

[0093] This invention can be used in the pharmaceutical industry.

[0094] This application is based on patent application No. 2020-55717 filed in Japan on March 26, 2020, the contents of which are incorporated herein by reference in their entirety.

Claims

1. An antisense oligomer having any of the following structures, or a pharmaceutically acceptable salt or hydrate thereof: AGAatactgtcCCt (SEQ ID NO: 26) TgAgAatactgtcCCt (SEQ ID NO: 37) GAgAatactgtcCCt (SEQ ID NO: 38) AGAatactgtccCTt (SEQ ID NO: 39) TgAgAatactgtccCTt (SEQ ID NO: 40) AcTgagAatactgtcccTtT (SEQ ID NO: 41) GAG Ｒ AatactgtcCCt (SEQ ID NO: 38) GAG Ｆ AatactgtcCCt (SEQ ID NO: 38) GAGAatactgtcCCt (SEQ ID NO: 38) GAG Ｆ A Ｒ atactgtcCCt (SEQ ID NO: 38) G.A. Ｒ GAatactgtcCCt (SEQ ID NO: 38) G.A. Ｆ GAatactgtcCCt (SEQ ID NO: 38) GAGAatactgtcCCt (SEQ ID NO: 38) The capital letter is C for the sugar part. ２ and C ４ Between -O-CH ２ - represents a bridge at the sugar moiety (C represents the C ２ and C ４ The gap is -O-CH ２ -bridged 5-methylcytosine), Lowercase letters indicate DNA, Uppercase letters + underline indicate 2'-O-Me modifications; N Ｒ represents RNA(2'-OH) ("N" represents any base; the same applies hereinafter), N Ｆ indicates a 2'-fluoro modification, Each internucleoside bond represents a phosphorothioate bond.

2. 2. The antisense oligomer of claim 1, wherein the antisense oligomer has the following structure: AGAatactgtcCCt (SEQ ID NO: 26)

3. 3. An oligonucleotide conjugate comprising the antisense oligomer according to claim 1 or 2, or a pharmaceutically acceptable salt or hydrate thereof, to one or both ends of the oligonucleotide chain of which a molecule capable of binding to an asialoglycoprotein receptor is attached, wherein the molecule capable of binding to an asialoglycoprotein receptor is at least one selected from the group consisting of lactose, galactose, N-acetylgalactosamine (GalNAc), galactosamine, N-formylgalactosamine, N-propionylgalactosamine, N-n-butanoylgalactosamine, and N-isobutanoylgalactosamine.

4. 4. The oligonucleotide conjugate of claim 3, the end of the oligonucleotide chain is linked to the molecule capable of binding to the asialoglycoprotein receptor via a linker; the linker comprises a main chain linker that binds to the end of the oligonucleotide chain, and a side chain linker that branches from the main chain and binds to a molecule that can bind to an asialoglycoprotein receptor, the main chain linker being a linear carbon chain selected from the group consisting of an ethylene chain, a propylene chain, a butylene chain, a pentylene chain, a hexylene chain, a heptylene chain, an octylene chain, a nonylene chain, a decylene chain, a dodecylene chain, a tetradecylene chain, a hexadecylene chain, and an octadecylene chain (provided that, when the side chain linker contains a heteroatom, it may or may not form a heterocycle together with the carbon atom of the main chain); The ends of the oligonucleotide chains and the backbone linker, and two or more of the asialoglycoproteins An oligonucleotide conjugate in which the main chain linkers are linked together by phosphodiester bonds when a molecule capable of binding to a protein receptor is added.

5. 10. A pharmaceutical composition comprising an effective amount of the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof, as an active ingredient. A pharmaceutical composition for inhibiting the expression of APOC3 protein.

6. 10. A pharmaceutical composition comprising an effective amount of the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof, as an active ingredient. A treatment for hypertriglyceridemia.

7. 10. A pharmaceutical composition comprising an effective amount of the antisense oligomer according to claim 1, or a pharmaceutically acceptable salt or hydrate thereof, as an active ingredient. A therapeutic agent for primary hyperchylomicronemia.

Images