Immunostimulatory compositions
Immunostimulatory compositions using nucleic acid plasmids and liposome vehicles with guanine-rich CpG motifs stimulate TLR21, effectively combating pathogens and reducing antibiotic reliance.
Patent Information
- Application Number
- JP2023134080
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-12-15
- Filing Date
- 2023-08-21
- Publication Date
- 2025-10-27
- Estimated Expiration
- 2038-12-07
AI Technical Summary
Current methods for stimulating non-specific immune responses against pathogens are inadequate, particularly in large animal production and human medicine, where antibiotic resistance is a significant concern, and there is a need for alternatives to antibiotic treatment.
Immunostimulatory compositions comprising nucleic acid plasmids and liposome delivery vehicles, combined with immunostimulatory oligonucleotides containing guanine nucleotide-rich sequences and CpG motifs, are administered to induce immune responses through Toll-like receptor 21 (TLR21) activation.
These compositions effectively stimulate a non-specific immune response, enhancing the body's defense against pathogens and reducing the reliance on antibiotics, thereby addressing antibiotic resistance.
Smart Images

Figure 0007760560000036 
Figure 0007760560000037 
Figure 0007760560000038
Abstract
Description
[Technical Field]
[0001] REFERENCE TO RELATED APPLICATIONS This application is filed under European Patent Application Nos. EP17207740.6, EP17207746.3, and EP17207750.5 (each filed on December 15, 2017). Priority and the benefit of the present invention are claimed, the disclosures of which are incorporated herein by reference in their entireties. Be absorbed.
[0002] Array List This application contains a Sequence Listing which has been submitted electronically in ASCII format, the entirety of which is hereby incorporated by reference. The ASCII copy was dated November 30, 2018 and is incorporated herein by reference. It was created on , named BHC_168027_SL.TXT, and is 92,167 in size. It's a part-time job.
[0003] FIELD OF THE INVENTION Compositions and methods for stimulating Toll-like receptor protein 21 (TLR21) are provided More specifically, immunostimulatory oligonucleotides and compositions, immunostimulatory oligonucleotides Methods for making the oligonucleotides and compositions, and methods for stimulating TLR21 are described herein. will be disclosed. [Background technology]
[0004] Background of the Invention The vertebrate immune system recognizes invading pathogens and initiates cell signaling pathways to promote infection. Some of these molecular mechanisms are particularly The antibody is a biomolecule that is specific to a specific microorganism and recognizes the surface antigen of a single pathogen. Unfortunately, pathogen-specific defense mechanisms do not develop acquired resistance until infection is established. It is not completely effective because some animals cannot tolerate it, and in some cases the pathogen They are evolving stealth methods to evade acquired defenses.
[0005] Vertebrates also recognize infection more generally, and this recognition is mediated by elevated cytokine expression. This defense is based on the recognition of pathogen-associated molecular patterns by cellular receptors. It can be induced by binding to PAMPs (proteases, phosphodiesterases (PAMPs)). This interaction can initiate an immune response. For example, Toll-like receptor proteins TLR21 is the chicken functional homolog of mammalian TLR9 and is unmethylated They can recognize CpG motifs, which have a higher CpG in microorganisms than in vertebrates. Known methodologies include the use of plasmids or plasmids containing unmethylated CpG motifs. By administering oligonucleotides, this non-specific immune response pathway can be exploited, and CpG Activation of TLR21 by motif-containing nucleic acids is involved in immune responses to microbial infections It has been shown that the administered immunostimulatory plasma activates cell signaling. The nucleotides or oligonucleotides alone cannot induce a sufficient response to fight infection. Sometimes it doesn't exist.
[0006] Large animal producers are in dire need of alternatives to antibiotic treatment of infections. Consumers are demanding antibiotic-free animal products from these producers, and at the same time, The increasing incidence of infections caused by drug-resistant pathogens has led to the need for prophylactic antibiotic use in large populations. Similarly, antibiotic resistance is a national emergency in human medicine. With the emergence of drug-resistant bacteria such as multidrug-resistant Staphylococcus aureus (MRSA), Hospitals and medical offices are becoming ground zero for this. Summary of the Invention [Problem to be solved by the invention]
[0007] Therefore, immunostimulatory compositions and methods for eliciting non-specific immune responses against pathogens are available. The disclosed methods and compositions address these and other important needs. It is directed towards the essentials. [Means for solving the problem]
[0008] Immunomodulatory compositions comprising nucleic acid plasmids and liposome delivery vehicles; and immunostimulators. The guanine nucleotide-rich sequence and the guanine nucleotide-rich sequence at or near the 5' end of the reactive oligonucleotide and an immunostimulatory oligonucleotide having at least one CpG motif. Disclosed herein are insulting compositions.
[0009] Also, immunomodulatory compositions containing nucleic acid plasmids and immunostimulatory oligonucleotides are combined. combining the immunostimulatory composition to form an immunostimulatory composition; centrifuging the immunostimulatory composition to obtain a supernatant and and forming a pellet; and isolating the pellet. Disclosed herein are methods for preparing the products.
[0010] Immunostimulatory oligonucleotide and immune modulator compositions are subject t) administering to a subject a subject in need thereof an immunostimulatory agent comprising: The oligonucleotide is guanidinium-3-phosphate dehydrogenase (GDH) at or near the 5' end of the immunostimulatory oligonucleotide. a nucleotide-rich sequence and at least one CpG motif, The method further includes a method wherein the composition comprises a non-coding nucleic acid plasmid and a cationic lipid delivery vehicle. Provided.
[0011] Immunostimulatory oligonucleotides and immunomodulatory compositions, or immunostimulatory oligonucleotides The immunostimulatory composition comprising the oxalate and the immunomodulatory composition is administered to the subject. Also disclosed is a method for inducing an immune response in an elephant, wherein the immunostimulatory oligonucleotide The oligonucleotide contains a guanine nucleotide at or near the 5' end of the immunostimulatory oligonucleotide. The immunomodulatory composition comprises a non-codon-enriched sequence and at least one CpG motif. The carrier comprises a nucleic acid plasmid and a cationic lipid delivery vehicle. [Brief explanation of the drawings]
[0012] The foregoing summary, as well as the following detailed description, will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the disclosed compositions and methods, the drawings include illustrative examples of the compositions and methods. Although exemplary embodiments are shown, the compositions and methods are not limited to the specific embodiments disclosed. In the drawings: [Figure 1] FIG. 1 shows the chemical structure of a cholesteryl moiety attached to a tetraethylene glycol linker. [Figure 2] Figures 2A and 2B compare the immunogenicity of immunostimulatory plasmid DNA, plasmid DNA complexed with cationic liposomes, and immunostimulatory oligonucleotides. Figure 2A compares the immunogenicity of immunostimulatory plasmid DNA ("pDNA") and pDNA complexed with cationic liposomes ("pDNA-F"). Figure 2B compares the immunogenicity of pDNA, pDNA-F, and the immunostimulatory oligonucleotide GCGT3-TG4T with a 5'-cholesteryl modification ("5Chol-GCGT3-TG4T"). [Figure 3]Figures 3A and 3B compare the immunogenicity of immunostimulatory plasmid DNA, immunostimulatory plasmid DNA complexed with cationic liposomes, immunostimulatory oligonucleotides, and combinations thereof. Figure 3A compares the immunogenicity of pDNA, pDNA-F, 5Chol-GCGT3-TG4T, pDNA combined with 5'Chol-GCGT3-TG4T ("pDNA-5Chol-GCGT3-TG4T"), and pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5Chol-GCGT3-TG4T"), where the immunostimulatory oligonucleotides are at nM concentrations and pDNA and pDNA-F are at μg / ml concentrations. Figure 3B shows the difference in immunogenicity between pDNA, pDNA-F, 5Chol-GCGT3-TG4T, pDNA combined with 5′Chol-GCGT3-TG4T (“pDNA-5Chol-GCGT3-TG4T”), and pDNA-F combined with 5Chol-GCGT3-TG4T (“pDNA-F-5Chol-GCGT3-TG4T”), where the immunostimulatory oligonucleotides are at pM concentrations and pDNA and pDNA-F are at ng / ml concentrations; [Figure 4] Figure 4 shows the ability of pDNA-F fractions to stimulate TLR21-mediated immune responses in HEK293-bsd-cTLR21 cells. Specifically, the immunogenicity of pDNA-F stored at 4°C was compared with that of pDNA-F obtained in the pellet ("pDNA-F pellet") and supernatant ("pDNA-F supernatant") of centrifuged samples. [Figure 5] 5A and 5B graphically show the ability of pDNA-F-5Chol-GCGT3-TG4T and 5Chol-GCGT3-TG4T at high and low concentrations, respectively, to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells. [Figure 6]Figures 6A and 6B compare the ability of pDNA-F-5Chol-GCGT3-TG4T at high and low concentrations to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells, respectively, with that of 5Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F 5Chol pellet") and supernatant ("pDNA-F 5Chol Uberstand") of centrifuged pDNA-F samples. [Figure 7] Figures 7A and 7B compare the ability of 5Chol-GCGT3-TG4T to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells at high and low concentrations, respectively, with that of 5Chol-GCGT3-TG4T obtained in the pellet ("5Chol pellet") and supernatant ("5Chol Uberstand") of centrifuged pDNA-F samples. [Figure 8] Figures 8A and 8B compare the ability of high and low concentrations of 5Chol-GCGT3-TG4T ("5Chol-GCGT3-TG4T 4°C") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells, respectively, with that of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T"). [Figure 9] Figures 9A and 9B compare the ability of high and low concentrations of pDNA-F combined with 5-Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells, respectively, with that of pDNA-F combined with 5-Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F / 5-Chol-GCGT3-TG4T pellet") and supernatant ("pDNA-F / 5-Chol-GCGT3-TG4T supernatant") of centrifuged pDNA-F samples. [Figure 10]Figures 10A and 10B compare the ability of high and low concentrations of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells with that of pDNA-F and the immunostimulatory oligonucleotide 5-Chol-GCGT3-TG4T, respectively. [Figure 11] Figures 11A and 11B compare the ability of high and low concentrations of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells, respectively, with that of pDNA-F combined with 5Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F-5-Chol-GCGT3-TG4T pellet") and supernatant ("pDNA-F-5-Chol-GCGT3-TG4T") of centrifuged pDNA-F samples. [Figure 12] Figures 12A and 12B compare the ability of high and low concentrations of pDNA-F, the immunostimulatory oligonucleotide GCGT3-TG4T, and pDNA-F complexed with GCGT3-TG4T ("pDNA-F-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells. [Figure 13] Figures 13A and 13B compare the ability of high and low concentrations of pDNA-F combined with the immunostimulatory oligonucleotide GCGT3-TG4T ("pDNA-F-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells, respectively, with that of pDNA-F combined with the immunostimulatory oligonucleotide GCGT3-TG4T obtained in the pellet ("pDNA-F-GCGT3-TG4T pellet") and supernatant ("pDNA-F-GCGT3-TG4T supernatant") of centrifuged pDNA-F samples. [Figure 14]Figure 14 shows the results of the mean hemagglutination inhibition (HI) titer (Log2) (with standard deviation) for ODN1 (GCGT3-TG4T-5Chol) on day 14 (upper panel) and day 21 (lower panel) post-vaccination (pv). Asterisks indicate significance levels (* = significant to **** = highly significant). [Figure 15] FIG. 15 shows the results of the mean HI titer (Log2) (with standard deviation) for ODN1 (GCGT3-TG4T-5Chol) during the entire study. [Figure 16] Figure 16 shows the results of the mean HI titer (Log2) (with standard deviation) for ODN2 (GCGT3-TG4T) on days 14 (upper panel) and 21 (lower panel) after vaccination. Asterisks indicate significance levels (* = significant to **** = highly significant). [Figure 17] FIG. 17 shows the results of the mean HI titer (Log2) (with standard deviation) for ODN2 (GCGT3-TG4T) during the entire study. [Figure 18] Figure 18 shows the results of the mean HI titer (Log2) (with standard deviation) for ODN3 (2006-PTO) on days 14 (upper panel) and 21 (lower panel) after vaccination. Asterisks indicate significance levels (* = significant to **** = highly significant). [Figure 19] FIG. 19 shows the results of the mean HI titer (Log2) (with standard deviation) for ODN3 (2006-PTO) during the entire study. [Figure 20] Figure 20 shows the results of the mean HI titers (Log2) (with standard deviations) for the positive and negative control test articles at days 14 (top panel) and 21 (bottom panel) post-vaccination. Asterisks indicate the significance level (*=significant to ****=highly significant). [Figure 21] Figure 21 shows the results of the mean HI titers (Log2) (with standard deviations) for the positive and negative control test articles during the entire study. [Figure 22]FIG. 22 shows the results of the mean HI titers (Log2) (with standard deviation) at the optimal concentration of ODN during the entire study compared to NDV vaccine alone. [Figure 23] FIG. 23 shows the results of mean HI titers (Log2) (with standard deviation) at optimal concentrations of ODN at pv day 14 (top panel) and day 21 (bottom panel) compared to NDV vaccine alone. DETAILED DESCRIPTION OF THE INVENTION
[0013] DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS The disclosed compositions and methods are made in conjunction with the accompanying drawings, which form a part of this disclosure. The disclosed compositions can be more readily understood by reference to the following detailed description. The products and methods are not limited to the specific compositions and methods described and / or illustrated herein. and the terminology used herein is for the purpose of describing particular embodiments only by way of example. and are understood not to be intended to limit the claimed compositions and methods. stomach.
[0014] Unless otherwise stated, no information is provided regarding possible mechanisms or modes of action or reasons for improvement. The descriptions provided are meant to be merely exemplary, and the disclosed compositions and methods are not intended to be limiting unless such disclosure is made in a way that would be construed as limiting the scope of the invention. Depending on the accuracy or imprecision of the suggested mechanism or mode of action or reason for improvement. It should not be constrained.
[0015] In this context, the foregoing description refers to compositions and methods of using the compositions. When describing or claiming features or embodiments relating to a composition, such features or embodiments The embodiments are equally applicable to methods of using said compositions. When describing or claiming a feature or embodiment relating to a method of using a composition, Such features or embodiments are equally applicable to compositions.
[0016] When a range of values is expressed, another embodiment includes any range from one particular value and / or Further, references to values stated in ranges include all values within that range. All ranges are inclusive and combinable. Use the preceding "about" Where values are expressed as approximations, the particular value forms another embodiment. It is understood that reference to a particular number is at least Contains that particular value.
[0017] For clarity, the disclosed compositions described herein in the context of separate embodiments Certain features of the products and methods may be provided in combination in a single embodiment. Conversely, it should be understood that for the sake of brevity, the disclosed embodiments may be described in the context of a single embodiment. The various features of the compositions and methods described may be provided separately or in any subcombination. This may be done.
[0018] As used herein, the singular forms "a," "an," and "the" refer to the plural. include.
[0019] As used herein, "co-administered" refers to a Immunomodulatory compositions in combination with immunostimulatory oligonucleotides to achieve a stimulatory effect. The immunomodulatory composition and the immunostimulatory oligonucleotide are administered separately. The compositions may be administered simultaneously or together as a single composition. When the composition and the immunostimulatory oligonucleotide are separate compositions, they may be either The immunomodulatory compositions may be co-administered simultaneously or sequentially in any order. and the immunostimulatory oligonucleotide, with a time interval of 1 minute, 1 hour, or even 1 day or more between administration. There may be a delay above.
[0020] As used herein, "fusing" refers to the process of combining two chemically reactive species. In the context of this disclosure, fusion refers in most cases to the creation of a chemical bond between In this case, it refers to the incorporation of a specific element into an oligonucleotide. A run of thymine nucleotides It can be fused to the 3' end of a oligonucleotide.
[0021] As used herein, "G-quartet sequence" refers to a sequence that is a G-quartet sequence. The "sense" is a sequence in which an oligonucleotide interacts with another G-quartet sequence to form a G-quartet. Consecutive guanine residues near the 5' end of the oligonucleotide allow for the formation of a tet. G-quartets are stretches of nucleic acid residues that enhance the immunostimulatory properties of nucleic acids. For example, an oligonucleotide containing a G-quartet sequence interacts with the G-quartet to form a G-quartet sequences occurring in the promoter region of genes can regulate gene expression. The G-quartet sequence is not limited to any particular sequence. However, an example of a G-quartet sequence is TGGGGT.
[0022] As used herein, "G-wire sequence" refers to a )," "G wire sequence," "G wire sequence (Gwire sequence), and related terms refer to multiple, most frequently 2 A plurality of guanine nucleotides is defined as a group of at least four consecutive guanine nucleotides. The oligonucleotide is located at or near the 5' end of the oligonucleotide and contains two or more non-guanine amino acids. The G-wire sequence is separated by nucleotides (i.e., thymine). It can interact with G-wire arrays to form G-wire structures. The G-wire structure can enhance the immunostimulatory properties of nucleic acids. An exemplary G-wire sequence is: GGGGTTGGGG (SEQ ID NO: 257) or GGGGTTGGGGTTTT (SEQ ID NO: No. 258).
[0023] As used herein, the term "guanine nucleotide-rich sequence" refers to a sequence that is rich in guanine nucleotides. nucleotide-enriched sequence), "guanine-enriched sequence" "Guanine enriched sequence" is a sequence containing continuous guanine. A run of consecutive guanine cleotides) (usually between 4 and 6 guanine nucleotides) or nucleic acids region, typically at or near the 5' end of the oligonucleotide, have more guanine nucleotides than thymine, cytosine, or guanine nucleotides The guanine-rich sequences disclosed herein refer to sequences containing any of the following: The G-quartet and G-wire sequences can enhance the immunostimulatory properties of nucleotides. Both are types of guanine nucleotide-rich sequences.
[0024] As used herein, "immunomodulatory composition" means a composition that The term "position" refers to at least the immunogenic nucleic acid plasmid and liposome. In some embodiments of the compositions and methods of the present disclosure, Therefore, the nucleic acid plasmid may not encode a specific immunogen, and the inherent characteristics of the nucleic acid plasmid may be In some embodiments, the liposome delivery vehicle may be cationic. It is on-
[0025] "immunogenic nucleic acid plasmid" "lasmids" are nuclear molecules that, when detected by the immune system of a vertebrate, induce an immune response. Some immunogenic nucleic acid plasmids are expressed in some vertebrate organisms. an increased percentage of CpGs compared to naturally occurring nucleic acid plasmid sequences in Without being bound by theory, the increased CpG dinucleotide motif Nucleotide motifs are present in bacterially derived nucleic acids, and therefore, such CpG-rich nucleic acids are host-derived. Immunogenic nucleic acid plasmids are naturally occurring nucleic acid vectors that are considered foreign to the primary immune defense. It may include non-substituted nucleotides and nucleotide derivatives.
[0026] As used herein, "immunostimulatory composition" refers to a compound that is "composition" includes immunomodulatory compositions and immunostimulatory oligonucleotides. In some embodiments, the immunostimulatory oligonucleotide and the immunomodulatory The composition comprises a single formulation that is an immunostimulatory composition. The soluble oligonucleotide may be physically associated with the liposome delivery vehicle of the immunomodulatory composition. do.
[0027] As used herein, "inserting" means to insert an oligonucleotide. Adding a specific nucleotide(s) at a specific position during the synthesis of a nucleic acid This means that.
[0028] As used herein, "parallel orientation" refers to n) refers to the directional interaction between different oligonucleotides. For example, The individual oligonucleotides oriented in the 3' direction are in parallel orientation.
[0029] As used herein, "percent identity" refers to a sequence of a sequence that is identical to a sequence of a nucleic acid. "y") and similar terms refer to two or more nucleic acids, polynucleotides, proteins, or polypeptides. used to describe the sequence relationships between polypeptides, and (a) the reference sequence, (b) the ratio (c) a comparison window, (d) a term including the sequence identity, and (e) a percentage of sequence identity. understood in the context of and in relation to
[0030] (a) "Reference sequence" means a sequence reference. A reference sequence is a defined sequence used as a foundation. A reference sequence may be a subset or the entirety of a particular sequence. e.g., a full-length cDNA or a segment of a gene sequence, or a complete cDNA or It may be a gene sequence.
[0031] (b) The "comparison window" is a polynucleotide and includes reference to a particular contiguous segment of a polynucleotide sequence, The sequences can be compared to a reference sequence, and the comparison window is used to determine optimal alignment of the two sequences. The portion of the polynucleotide sequence in a window is a reference sequence (which may contain additions, substitutions, or deletions). may contain additions, substitutions, or deletions (i.e., gaps) compared to a sequence containing no deletions Those skilled in the art will recognize errors relative to the reference sequence due to the inclusion of gaps in the polynucleotide sequence. To avoid too high similarity, gap penalties are typically introduced, and Understand that it will be subtracted from the number of matches.
[0032] (c) Methods of aligning sequences for comparison are well known in the art. The optimal alignment of sequences for Ady. Appl. Math., 2:482, 1981, by the local homology algorithm Needleman and Wunsch, J. Mol. Biol., 48:443, 1970 by the homology alignment algorithm; earson and Lipman, Proc. Natl. Acad. Sci. USA, 8 :2444,1988 similarity search method; these algorithms performed by computerized implementations of, including but not limited to, :CLUSTAL in the PC / Gene program by Intel ligenetics,Mountain View,Calif.,GAP,BEST FIT, BLAST, FASTA, and TFASTA in the Wisconsin in Genetics Software Package,Genetics Co mputer Group (GCG),7 Science Dr.,Madison , Wis., USA; The CLUSTAL program is funded by Higgins and Sharp , Gene, 73: 237-244, 1988; Corpet et al., Nucleic Acids Research, 16:881-90,1988;Huang et al., Com puter Applications in Biosciences,8:1-6, 1992; and Pearson et al., Methods in Molecular Biology ology, 24:7-331, 1994. Database similarity search The BLAST family of programs can be used for nucleotide databases BLASTN for nucleotide query sequences against sequences; protein databases BLASTX for nucleotide query sequences against sequences; nucleotide database TBLASTN for protein query sequences against a sequence; and nucleotide sequences Includes TBLASTX for nucleotide query sequences against database sequences. rrent Protocols in Molecular Biology,Cha pter 19, Ausubel et al. Eds., Greene Publishing and and Wiley-Interscience, New York, 1995. Newer versions or programs of the above programs will no doubt be available in the future. and can be used in conjunction with the present disclosure.
[0033] (d) "Percent Identity" is a comparison win It refers to a number determined by comparing two optimally aligned sequences across a set of sequences. In this case, for optimal alignment of two sequences, the polynucleotide sequences in the comparison window are Some of the columns represent additions, substitutions, or deletions compared to the reference sequence (which does not contain additions, substitutions, or deletions). or deletions (i.e., gaps). The percentage is the number of identical nucleobases in both sequences. Determine the number of positions that occur in each sequence to obtain the number of matched positions, and by the total number of positions in the comparison window and multiplying the result by 100. to obtain a percentage of sequence identity.
[0034] A "therapeutically effective amount" refers to an amount of an immunomodulatory composition and / or a therapeutically effective amount of an active ingredient to treat a subject. Or it refers to the amount of immunostimulatory oligonucleotide or immunostimulatory composition.
[0035] A "synergistically effective amount" is an amount that provides a synergistic or greater than additive effect in treating a subject. As used herein, the term "immunomodulatory composition" refers to the amount of immunostimulatory oligonucleotide that is present in a given amount of an immunomodulatory composition and / or an immunostimulatory oligonucleotide. The term "subject" as used herein is intended to mean any animal, especially birds. "Avian species" includes chickens, domestic turkeys, This includes, but is not limited to, waterfowl and any other food source poultry.
[0036] As used herein, "treating" and similar terms means , reducing the severity and / or frequency of symptoms of the infection, Eliminate the underlying causes of the condition, reduce the frequency or severity of the condition and / or its underlying causes. reduces the likelihood and / or severity of illness caused directly or indirectly by infectious agents. This refers to improving or repairing damage caused by
[0037] Various terms relating to the described aspects are used throughout the specification and claims. Such terms should be given their ordinary meaning in the art unless otherwise specified. Other specifically defined terms may be used in a manner consistent with the definitions provided herein. should be interpreted.
[0038] Immunomodulatory compositions comprising nucleic acid plasmids and liposomal delivery vehicles, and immunostimulatory agents. A guanine nucleotide-rich sequence and a few Immunostimulatory compositions containing immunostimulatory oligonucleotides having at least one CpG motif. Compositions are provided herein.
[0039] Immunostimulatory oligonucleotides, as described herein, interact with TLR21. Immunostimulatory oligonucleotides can act to induce an immune response in a host organism. At least one unmethylated dinucleotide that interacts with an expressed pathogen recognition receptor The immunostimulatory oligonucleotides also contain CpG motifs. These sequences facilitate or inhibit the folding of the DNA strand into a quaternary structure. and promoting aggregation of one or more immunostimulatory oligonucleotides having a guanine-rich or guanine-rich sequence. The guanine-rich sequence need not be composed exclusively of guanine nucleotides, but may be enriched in guanine nucleotides. Guanine-rich sequences are described above and throughout these disclosures. As illustrated, typically, the oligonucleotide is attached at or near the end (4 nucleotides). Further manipulation of the oligonucleotide sequence and structure can be used to generate immunostimulatory oligonucleotides. The ability of oligonucleotides to stimulate TLR21 can be further enhanced. One embodiment of the present invention is a method for preparing an immunostimulatory oligonucleotide comprising administering to a subject the immunostimulatory oligonucleotide at the 5' end or within four nucleotides of the 5' end of the immunostimulatory oligonucleotide. At least one CpG motif and a guanine-rich sequence beginning with a nucleotide Both of these compositions include immunostimulatory compositions containing one immunostimulatory oligonucleotide.
[0040] In some embodiments of the present disclosure, guanine nucleotide tran to the 5' end of CpG-containing immunostimulatory oligonucleotides The addition of can significantly improve the immunogenicity of immunostimulatory oligonucleotides. The position of guanine-rich sequences in oligonucleotides influences the enhancement of TLR21 activation Not only does the sequence content have an effect, but the sequence content also has an effect. For this reason, In embodiments, the guanine-rich sequence comprises multiple consecutive guanine nucleotides.
[0041] In some embodiments, the guanine-rich sequence comprises a first plurality of consecutive guanine nucleosides. In some embodiments, the first plurality of guanine nucleotides comprises 2 to 8 guanine nucleotides. In some embodiments, the first plurality of guanine nucleotides comprises guanine nucleotides. In some embodiments, the first plurality of guanine nucleotides comprises two guanine nucleotides. The nucleotides include three guanine nucleotides. In some embodiments, the first The plurality of guanine nucleotides comprises four guanine nucleotides. In the example, the first plurality of guanine nucleotides comprises five guanine nucleotides. In some embodiments, the first plurality of guanine nucleotides includes six guanine nucleotides. In some embodiments, the first plurality of guanine nucleotides comprises seven guanine nucleotides. In some embodiments, the first plurality of guanine nucleotides comprises eight guanine nucleotides. In yet other embodiments, the first plurality of guanine nucleotides comprises , containing more than eight guanine nucleotides.
[0042] In some embodiments of the invention, the oligonucleotide has the following SEQ ID NO: Including: SEQ ID NOs: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 4 8, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, or 143. In other embodiments, a guanine-rich sequence are TTAGGG, TTAGGGTTAGGG (SEQ ID NO: 261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO: 262), TTAGGG, TT AGGGTTAGGGTTTT (SEQ ID NO: 263), TGTGGGTGTGTGTGGG (SEQ ID NO: 269), GGAGG, TGGAGGC, or TGGAGGCTGGAGG C (SEQ ID NO: 264). In yet another embodiment, the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, Includes 137 or 138.
[0043] A single run of guanine nucleotides e nucleotides) are not the only 5' modifications that can enhance TLR21 stimulation For example, adenine-, cytosine-, and thymine-rich sequences also contain CpG motifs. can be added to the 5' end of the oligonucleotide, and Enhanced TLR, albeit less than that induced by guanine-rich sequences 21 stimulation. A single multiple guanine residue at the 5' end of the oligonucleotide stimulates TLRs. 21 stimulation, but additional multiple guanine nucleotides in guanine-rich sequences may further enhance the stimulatory properties of the oligonucleotide. wherein the oligonucleotide of the present disclosure comprises a first plurality of guanine nucleotides and at least The second CpG motif contains a second plurality of guanine nucleotides between the first CpG motif and the second CpG motif.
[0044] In some embodiments, the plurality of guanine nucleotides comprises a G-quartet sequence. In some embodiments, the first plurality of guanine nucleotides, the second plurality of guanine The nucleotides, or both, contain a G-quartet sequence. It also allows for interactions between oligonucleotides, as defined above. Although not intended, the interaction at the 5' end of the oligonucleotide is a CpG dinucleotide. allowing for enrichment of tide motifs and a corresponding enhanced opportunity for recognition by TRL21 In some embodiments, the immunostimulatory composition comprises a G-quartet sequence. further comprising at least one additional oligonucleotide, wherein said oligonucleotide The oligonucleotide and at least one additional oligonucleotide have a parallel orientation in the quaternary structure. In some embodiments, the G-quartet sequence comprises TGGGGT.
[0045] It can be added to or near the 5' end of an oligonucleotide containing a CpG motif. Another guanine-rich sequence is a G-wire sequence. and the second plurality of guanine nucleotides comprises a G-wire sequence. In another embodiment, the G-wire sequence comprises SEQ ID NO: 257 or 258. The G-wire sequences are SEQ ID NOs: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, or GCGT-Gwire3. The nucleotide may be a non-guanine nucleotide, a nucleotide analog, or any other spacer. Alternatively, they may be separated by a linker. For example, in some embodiments of the present disclosure, The one plurality of guanine nucleotides and the second plurality of guanine nucleotides are at least As used herein, the term "space" refers to a sequence of nucleotides that are separated by one nucleotide. A "spacer" is a spacer between similar nucleotide motifs, i.e., two CpG motifs. refers to a chemical bond between two nucleotides or between two guanine nucleotide-rich sequence motifs, while The term "linker" refers to the link between different nucleotide motifs, i.e., guanine The chemistry between a nucleotide-rich sequence and another nucleotide motif, such as a CpG motif The terms "spacer" and "linker" refer to any aspect of an oligonucleotide. However, the spacer is used to clearly state what is being discussed. The structures disclosed herein for the linker are interchangeable with the structures disclosed herein for the linker. It will be understood by those skilled in the art that the same may be true for the same device, and vice versa.
[0046] Without being bound by any particular theory, the G-wire sequence is The oligonucleotides interact with other oligonucleotides with G-wire sequences and aggregate. It is possible to make it possible to form an oligonucleotide having a G-wire sequence. The conformation assumed by aggregation is called the G-wire conformation. The accumulation of these oligonucleotides and their CpG motifs enhances TLR21. This can lead to targeted stimulation.
[0047] Guanine-rich sequences can be linked by nucleotides, nucleotide analogs, or other linkers. Therefore, in some embodiments of the present disclosure, In embodiments, the oligonucleotide comprises a guanine-rich sequence and at least one downstream C As used herein, "downstream" refers to a sequence of a nucleic acid sequence that further comprises a linker between the downstream and downstream pG motifs. "Downstream" refers to the 5' to 3' direction; i.e., the "downstream" nucleotide nucleotide or motif is a nucleotide or motif that is 3' of the comparison sequence element "Upstream" means in the 3' to 5' direction; i.e., The nucleotide or motif is the nucleotide or motif that is 5' of the comparison sequence element. The linker is directly adjacent to either a guanine-rich sequence or a CpG motif. Rather, the linker should be spaced apart between the guanine-rich sequence and the linker, as well as between the CpG No intervening sequence exists between the two sequence motifs, regardless of the intervening sequence between the motifs and the linker. In some embodiments of the present disclosure, the linker must have at least three The linker may also be free of nitrogenous bases. For example, some In this embodiment, the linker is hexaethylene glycol, propanediol, triethylene In another example, the oligonucleotide having a linker is a propylene glycol, or a derivative thereof. The nucleotides are 2006-PDE5dG4-X1 or 2006-PDE5dG4- Includes X3.
[0048] The dinucleotide CpG motifs present in the oligonucleotides of the present disclosure are derived from chicken It is thought to be a PAMP recognized by TLR21 in the Although the nucleotides present on the oligonucleotides can stimulate TLR21, Multiple CpGs can increase the intensity of stimulated TLR21 signals. Therefore, in some embodiments of the present invention, the at least one CpG motif is In some embodiments, the at least one CpG motif comprises two, three, four, or five CpG motifs. In some embodiments, the at least one CpG motif comprises six or more CpG motifs. In some embodiments, the at least one CpG motif comprises two CpG motifs. In some embodiments, the at least one CpG motif comprises three CpG motifs. In some embodiments, the at least one CpG motif comprises four CpG motifs. In some embodiments, at least one CpG motif is four CpG motifs. Includes.
[0049] In some embodiments of the oligonucleotides of the present disclosure, each CpG motif from other CpG motifs by at least one nucleotide or nucleotide analogue In some embodiments, the at least one nucleotide may be separated from two or more In other embodiments, the number of intervening nucleotides is three thymine nucleotides. The at least one nucleotide may be 1 to 4, depending on the sequence of the nucleotide. In some embodiments, the oligonucleotide is SEQ ID NO: 217, 2 The nucleotides adjacent to the CpG motif include 18, 219, or 220. itself, together with CpG sequence elements (e.g., XCGX, where X = any nucleotide). In some embodiments, the oligonucleotides of the present disclosure comprise GCGA, GCGG, ACGC, CCGC, GCGT, TCGC, or any combination thereof The CpG sequence element is
[0050] In some embodiments of the present disclosure, the CpG motif has four nucleotides. In some embodiments, the oligonucleotide comprises at least one CpG sequence element. In some embodiments, the oligonucleotide comprises at least two CpG sequence elements. In some embodiments, the oligonucleotide comprises at least three CpG sequence elements. In some embodiments, the oligonucleotide comprises at least four CpG sequence elements. The oligonucleotide comprises at least five CpG sequence elements. The nucleotides comprise at least six CpG sequence elements. The oligonucleotides may contain more than 8, 10, 15, or even 20 CpG sequence elements. Includes ent.
[0051] In other embodiments of the oligonucleotides of the present disclosure, each of the CpG motifs is The combination of a sequencer or spacer and at least one nucleotide allows the In some embodiments, the nucleic acid is free from at least one CpG motif. The chief is a spacer or a combination of a spacer and at least one nucleotide. Thus, it is separated from the nearest other CpG motif, while being separated from at least two other CpGs. The motifs are adjacent to each other. Separate CpG motifs are then separated by the designed oligonucleotides. Although CpG motifs adjacent to each other can enhance the immune stimulatory ability of TLR21, It is recognized that this can stimulate
[0052] The spacer used to linearly separate the CpG motifs is The spacer may be any linkage that bridges at least a portion of the oligonucleotides. It may be composed of deoxyribose phosphate bridges, multiple carbon chains, or repeating chemical units, but is not necessarily One essential property of the spacer is that it The ability to form a chemical bond with the nucleotide backbone. In this case, the spacer is a deoxyribose phosphate bridge. In some embodiments, it may contain a nitrogenous base, while in other embodiments it may contain deoxyribose phosphate. The acid bridge is abasic. In some embodiments, the oligonucleotide is It contains column number 221, which contains an abasic deoxyribose phosphate bridge.
[0053] In another embodiment of the present disclosure, the spacer comprises a carbon chain. The carbon chain may be 2 to 12 carbon atoms. The terminal alcohol group may contain the terminal alcohol and It is advisable to use diols containing carbon chains, as they can react with the phosphate groups and / or phosphate groups. In some embodiments, the carbon chain comprises two carbon atoms, and in some embodiments, In some embodiments, the carbon chain is derived from ethanediol. The oxide comprises ODN-X2, where X2 is ethanediol.
[0054] Other embodiments of the present disclosure provide carbon chains comprising 3 carbon atoms. In some embodiments, the carbon chain is derived from 1,3-propanediol. In some embodiments, the oligonucleotide is CG-Gw2X2, CG-Gw2X2 -2 or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2 X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2- 2, CG-G4T16X2-3, CG-G4T16X2-4, or CG-G4T16X 2-5, where X2 is a three carbon chain; 2006-PDE5dG4-X2, where X2 is a three carbon chain derived from propanediol; or SEQ ID NO: 250, and X4 is a three-carbon chain derived from propanediol.
[0055] In yet other embodiments of the present disclosure, the oligonucleotide comprises a carbon chain spacer, wherein the carbon chain comprises 4 carbon atoms. In some embodiments, the oligonucleotide is derived from 1,4-butanediol. The nucleotide comprises ODN-X4, where X4 is derived from 1,4-butanediol. It is a four-carbon chain.
[0056] In yet another aspect of the present disclosure, the oligonucleotide comprises a sequence having repeating chemical units. For example, in some embodiments, the repeating chemical unit is ethylene glycol. The repeating chemical unit may be repeated 2 to 12 times. In some embodiments, The ethylene glycol is repeated six times. Thus, in some embodiments, the oligo The nucleotide contains CCGC-Gw2X1, where X1 is derived from hexaethylene glycol. It is a spacer.
[0057] A guanine nucleotide run on the 3' end of the oligonucleotide cleotide runs) result in little, if any, TLR21 stimulation However, other nucleotide sequences may confer enhanced immunogenicity to oligonucleotides. Specifically, in some embodiments of the present disclosure, the oligonucleotides contain tritiamine nucleotides. In some embodiments, the oligonucleotide may further comprise a 3' end. 4, 205, 206, 207, 208, 209, 210, 211, 212, 213, 21 4, or 215 inclusive.
[0058] For each oligonucleotide disclosed herein, one of skill in the art can determine whether the nucleotide is a nucleotide. It is understood that the oligonucleotides in some embodiments may be substituted with nucleotide analogs. Although oligonucleotides contain a phosphodiester backbone, the oligonucleotides disclosed herein Other embodiments include a phosphorothioate backbone. In some circumstances, it may be easier and more cost effective to manufacture.
[0059] In some embodiments of the present disclosure, the oligonucleotide is an oligonucleotide immunogen. The antibody may contain a lipid moiety which may result in increased immunogenicity. One possible explanation for this is that the lipid moiety may increase the bioavailability of the oligonucleotide. In some embodiments, the lipid moiety may function to enhance the This lipid "cap" is located at or near the 5' end of the peptide, preventing degradation. inhibiting, increasing the solubility, improving the stability of the oligonucleotide in a pharmaceutical composition, or In some embodiments, the lipid moiety is cholesteryl. be.
[0060] The efficacy of the immunostimulatory oligonucleotides and immunostimulatory compositions can be determined by administering the compositions. and the concentration required to induce a response that is half the maximal response that can be achieved by The median effective concentration (EC 50 ) can be characterized by the concentration The lower the , the more potent the oligonucleotide. indicates that the immunostimulatory composition has an EC 50 In some embodiments, , E.C. 50 In some embodiments, the EC 50 is approximately In some embodiments, the EC 50 is about 200-300p In some embodiments, EC50 The concentration is between about 300 and 400 pM. In some embodiments, EC 50 is between about 400 and 500 pM. , E.C. 50 In some embodiments, the EC 50 is about 60 In some embodiments, the EC 50 is about 700-800pM In some embodiments, EC 50 is between about 800 and 900 pM. In one embodiment, EC 50 The EC500-EC5000 ranges from approximately 900 to 1 nM. 0 is less than about 100 pM.
[0061] Regarding the concentration of oligonucleotides in the immunostimulatory composition, in some embodiments, the oligonucleotides The concentration of the oligonucleotide is between about 0.1 and 10 nM. The concentration of the nucleotide is between about 10 and 20 nM. The concentration of the oligonucleotide is between about 20 and 30 nM. The concentration of the oligonucleotide is between about 30 and 40 nM. In some embodiments, the concentration of the oligonucleotide is between about 40 and 50 nM. In some embodiments, the concentration of the oligonucleotide is between about 50 and 60 nM. In some embodiments, the concentration of the oligonucleotide is between about 70 and 70 nM. In some embodiments, the concentration of the oligonucleotide is between about 80 and 90 nM. In some embodiments, the concentration of the oligonucleotide is between about 90-100 nM. In still other embodiments, the concentration of the oligonucleotide is less than about 20 nM. It is full.
[0062] The immunostimulatory composition, in some embodiments of the present disclosure, comprises a G-wire array. The G-wire sequence may further comprise at least one additional oligonucleotide comprising , facilitating the aggregation of other oligonucleotides with the same or similar G-wire sequence. Therefore, one embodiment of the immunostimulatory composition comprises at least one G-wire array. The immunostimulatory composition may further comprise a further oligonucleotide. In some embodiments, the oligonucleotides include a plurality of oligonucleotides, At least one further oligonucleotide has a G-wire conformation. do.
[0063] The ability of oligonucleotides to stimulate TLR21 was enhanced by inserting additional CpG motifs. This can be further enhanced in accordance with some aspects of the present invention by In the above, at least one CpG motif is a plurality of CpG motifs, and The G motif contains two, three, four, or five CpG motifs. The distance between the oligonucleotides can affect the TLR21 stimulatory properties of the oligonucleotides. For this reason, some embodiments of the disclosed oligonucleotides may be used to provide a nucleic acid sequence that is complementary to the CpG motif. The insertion of at least one nucleotide or nucleotide analog into said at least one The at least one nucleotide may be two or three thymine nucleotides.
[0064] Other embodiments provide for including a spacer between each of the CpG motifs. The spacer is located between the 3' end of one adjacent nucleotide strand and the 5' end of the other nucleotide strand. In some embodiments, the spacer is a deoxyribonucleotide. The phosphate bridge is a phosphate bridge, which in some embodiments may be abasic.
[0065] The spacer may, in some aspects, comprise a carbon chain. In some embodiments, the carbon chain comprises two carbon atoms. In some embodiments, the carbon chain is derived from ethanediol. Other embodiments provide carbon chains containing 3 carbon atoms. In some embodiments, the carbon chain is derived from 1,3-propanediol. contains 4 carbon atoms, and in some embodiments the carbon chain is derived from 1,4-butanediol In yet other embodiments, the spacer comprises repeating chemical units. In some embodiments, the repeating chemical unit is ethylene glycol, and in some embodiments, the spacer is hydroxyl. It is derived from hexaethylene glycol.
[0066] Representative oligonucleotides of the present disclosure are identified in Table 1. [Table 1] TIFF0007760560000002.tif223168 TIFF0007760560000003.tif220169 TIFF0007760560000004.tif218169 TIFF0007760560000005.tif223169 TIFF0007760560000006.tif220168 TIFF0007760560000007.tif222169 TIFF0007760560000008.tif222169 TIFF0007760560000009.tif221169 TIFF0007760560000010.tif220169 TIFF0007760560000011.tif162168
[0067] The immunogenic nucleic acid plasmids described herein are rich in CpG motifs. In the present invention, immunogenic nucleic acid plasmids are prepared by incorporating CpG motifs found in vertebrate nucleic acid sequences. contains more than 20% CpG motifs compared to the frequency of
[0068] In some aspects, the present disclosure provides immunogenic nucleic acid plasmids that do not contain antibiotic resistance genes. In some embodiments, the plasmid contains a full-length or functional selectable or sequenced gene. It does not include nucleic acid sequences encoding removable markers. The pGCMB75.6 plasmid carried is a full-length or functional selectable or screenable vector. The sequence of pGCMB75.6 is SEQ ID NO:2. 65 (Table 1A). In some embodiments, the plasmids described herein does not encode an immunogen.
[0069] In some embodiments, the immunogenic plasmid contains a selectable or non-selectable gene that is not an antibiotic resistance gene. or a nucleic acid sequence encoding a screenable marker gene. The pLacZMB75.6 plasmid described herein contains a screenable marker. The sequence of pLacZMB75.6 is set forth in SEQ ID NO: 268. In yet other embodiments, the plasmid will contain an antibiotic resistance gene. For example, pMB75.6 contains a nucleic acid sequence encoding resistance to the antibiotic kanamycin. The sequence of pMB75.6 is provided in SEQ ID NO:266.
[0070] Nucleotide of pMB75.6, pGCMB75.6, or pLacZMB75.6 plasmid The nucleotide sequence can be varied to some extent without significantly adversely affecting its immunostimulatory properties. In some embodiments, pGCMB75.6 (SEQ ID NO: 265) ) comprising or consisting of a nucleic acid sequence having at least 89% sequence identity with the sequence of Immunogenic nucleic acid plasmids are provided. In some embodiments, the immunogenic plasmid is pG At least 75%, at least 76%, at least at least 77%, at least 78%, at least 79%, at least 80%, at least 8 1%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, At least 95%, at least 96%, at least 97%, at least 98%, or In some embodiments, the immunogenic nucleic acid comprises a nucleic acid sequence having at least 99% sequence identity. The acid plasmid contains the sequence of pGCMB75.6 (SEQ ID NO: 265).
[0071] In some embodiments, the sequence of pLacZMB75.6 (SEQ ID NO: 268) and at least Immunogenic nucleic acid plasmids are provided that contain nucleic acid sequences with 84% sequence identity. In some embodiments, the immunogenic plasmid is pLacZMB75.6 (SEQ ID NO: 268). At least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, At least 88%, at least 89%, at least 90%, at least 91%, at least At least 92%, at least 93%, at least 94%, at least 95%, at least 96% , having at least 97%, at least 98%, or at least 99% sequence identity In some embodiments, the immunogenic nucleic acid comprises or consists of the nucleic acid sequence pLa Contains a plasmid having the sequence of cZMB75.6 (SEQ ID NO: 268).
[0072] In some embodiments, the sequence has at least 80% sequence identity with the sequence of SEQ ID NO: 266. Immunogenic nucleic acid plasmids comprising the nucleic acid sequences are provided. In some aspects, the immunogenic plasmids The plasmid has at least 75%, at least 76%, or at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, At least 82%, at least 83%, at least 84%, at least 85%, at least At least 86%, at least 87%, at least 88%, at least 89%, at least 90% , at least 91%, at least 92%, at least 93%, at least 94%, at least at least 95%, at least 96%, at least 97%, at least 98%, or at least In some embodiments, the nucleic acid sequence comprises or consists of a nucleic acid sequence having at least 99% sequence identity to the nucleic acid sequence. , the immunogenic nucleic acid plasmid comprises the sequence of SEQ ID NO:266.
[0073] In some embodiments, the sequence of pMB75.6_AscI (SEQ ID NO: 267) and at least Immunogenic nucleic acid plasmids containing nucleic acid sequences with 80% sequence identity are provided. In some embodiments, the immunogenic plasmid has at least 75% identical sequence to SEQ ID NO: 267, at least 75% identical sequence to SEQ ID NO: 267. at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, At least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93% , at least 94%, at least 95%, at least 96%, at least 97%, at least or a nucleic acid sequence having 98%, or at least 99%, sequence identity with the In some embodiments, the immunogenic nucleic acid plasmid comprises the sequence of SEQ ID NO: 267. include. [Table 2] TIFF0007760560000013.tif220169 TIFF0007760560000014.tif221168 TIFF0007760560000015.tif220168 TIFF0007760560000016.tif219168 TIFF0007760560000017.tif220169 TIFF0007760560000018.tif220169 TIFF0007760560000019.tif168169
[0074] Under high stringency conditions, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, or or a nucleic acid sequence that hybridizes to SEQ ID NO: 268, capable of stimulating an immune response. Further provided herein are immunogenic nucleic acids or immunogenic plasmids that can be used to express the immunogenic nucleic acids or plasmids. Nucleic acid sequences include those that are homologous, substantially similar, or identical to the nucleic acids described herein. In some embodiments, the homologous nucleic acid sequence is SEQ ID NO: 265 or the respective homolog At least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104 1%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 9 1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 10 In other embodiments, the homologous nucleic acid sequence has a percent identity of SEQ ID NO: 268. or at least about 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% In other embodiments, the homologous nucleic acid sequence has SEQ ID NO: 26 6 or at least about 75%, 76%, 77%, 78% for each complementary sequence ,79%,80%,81%,82%,83%,84%,85%,86%,88%,89% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity. In other embodiments, the homologous nucleic acid sequence has SEQ ID NO:2 67 or at least about 75%, 76%, 77%, 78% or more of the respective complementary sequences %, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 88%, 89 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or 100% sequence similarity. Sequence similarity is determined by the method of Altschul, SF et al. BLAST, as described in J. Mol. Biol. 215:403-10, 1990. Numerous algorithms known in the art can be used to calculate the nucleic acid sequence, such as: may differ in sequence from the nucleic acids listed above due to the degeneracy of the genetic code. A string is 18 nucleotides, more usually 30 or more nucleotides, and for comparison purposes It may include the entire nucleic acid sequence of the composition.
[0075] As used herein, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, or SEQ ID NO: Nucleic acids capable of hybridizing to 268 are contemplated. The lysis conditions included ≥50°C and 0.1x SSC (15 mM sodium chloride / 1. Other conditions include hybridization in 5 mM sodium citrate. The buffer was 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% Decaffeinated solution in a solution of streptavidin sulfate and 20 μg / ml denatured sheared salmon sperm DNA at 42 °C overnight Incubation followed by washing in 0.1×SSC at about 65° C. Suitable hybridization conditions are those that are at least about 80%, 85%, or more similar to the specific conditions above. %, 90%, or 95% stringency of hybridization conditions. Other stringent hybridization conditions are known in the art and are set forth in this disclosure. It can also be used to identify nucleic acid homologs of ols in Molecular Biology,Unit 6,pub.John Wiley & Sons, NY 1989).
[0076] The nucleotide sequences of immunogenic nucleic acid plasmids do not significantly adversely affect their immunogenicity. It is understood that the nucleic acid sequence may be varied to some extent without adversely affecting the overall nucleic acid sequence. The nucleic acid sequence of the amino acid molecules usually differs by one or more nucleotides. The deletion may be a mutation, insertion, or a combination thereof. Techniques for spontaneous mutagenesis are known in the art. Methods for site-directed mutagenesis include , Gustin et al., Biotechniques 14:22, 1993; Barany , Gene 37:111-23, 1985; Colicelli et al., Mol.Gen. Genet. 199:537-9, 1985; and Sambrook et al., Molecules lar Cloning: A Laboratory Manual, CSH Pres. s 1989, pp. 15.3-15.108, and all references thereto. In summary, the present invention provides a method for stimulating an innate immune response in a subject. The present invention relates to nucleic acid plasmid molecules capable of carrying out the same, and variants or mutants thereof. The invention also provides intermediate RNAs encoded by the described nucleic acids, as well as the nucleic acids described herein. Any resulting amino acid sequence encoded by the described nucleic acid plasmids Includes.
[0077] In some embodiments, the nucleotide sequence of the immunogenic nucleic acid plasmid is SEQ ID NO:26 5, 266, 267, or 268, the immunogenic nucleic acid primers CpG dinucleotides in the smid are preferably left intact. The nucleotide sequence of the plasmid is modified to eliminate CpG dinucleotides In this case, the sequence of the immunogenic nucleic acid plasmid is the total number of CpG dinucleotides in the nucleic acid plasmid. The immunogenic nucleic acid may be modified at another location so that the sequence remains the same. It is also possible to introduce additional CpG dinucleotides in addition to those present. For example, the immunogenic nucleic acid plasmids described herein contain at least about 200, at least about 220, at least about 240, at least about 260, at least about 270, at least about 275, at least about 280, at least about 283, at least about 285, or or at least about 288 CpG dinucleotides. The pathogenic nucleic acid plasmid contains 283 CpG dinucleotides. In this embodiment, the nucleotide sequence of pGCMB75.6 or pLacZMB75.6 CpG dinucleotides are introduced into the plasmid in addition to those already present in the plasmid.
[0078] In some embodiments, the nucleotide sequence of the immunogenic nucleic acid plasmid is If different from the sequence provided in the above, the type of CpG motif in the immunogenic nucleic acid may be expressed in the cytosolic nucleus. These are generated as a result of acid surveillance molecules (i.e., TLR21 and / or TLR9). For example, by increasing the number of immunostimulatory CpG motifs, and generating at least one cytosolic nucleic acid surveyor that responds to the immunogenic nucleic acid plasmid. Alternatively, the number of non-immunostimulatory CpG motifs can be increased. and increasing the level of the nucleic acid in the cytosol to decrease activation of at least one cytosolic nucleic acid surveillance molecule. In some embodiments, the number of stimulatory and non-stimulatory CpG motifs may be altered. and enhancing the activation of at least one cytosolic nucleic acid surveillance molecule, The activation of one cytosolic nucleic acid surveillance molecule can be reduced.
[0079] Suitable immunogenic nucleic acid plasmid molecules include the immunogenic-encoding nucleic acids described herein and Coding nucleic acid sequences include any immunogenic non-coding nucleic acid. The non-coding sequences encode at least part of the protein or peptide. According to the present invention, a "non-coding" nucleic acid does not encode a protein fragment. The term "empty vector ( "empty vector" can be used interchangeably with the term "non-code" , especially those containing no gene inserts, such as plasmid vectors, which do not contain protein-encoding portions. refers to a nucleic acid sequence encoded by the nucleic acid plasmids described herein. Expression of the protein is not required to induce an immune response; therefore, A sequence need not include any coding sequence operably linked to a transcription control sequence. At least one nucleic acid sequence (DNA or Further benefits may be obtained by including a nucleotide sequence (e.g., a nucleotide sequence or RNA) in the immunomodulatory composition (e.g., a nucleotide sequence or RNA). i.e., antigen-specific and enhanced immunity). Such nucleic acid sequences can be included in the immunogenic nucleic acid plasmids described herein. or may be contained in a separate nucleic acid (e.g., a separate plasmid) in the composition.
[0080] In some embodiments of the immunomodulatory compositions described herein, the immunomodulatory composition The product comprises a liposome delivery vehicle and an immunogenic nucleic acid plasmid as described herein. Suitable immunomodulatory compositions include at least one of the following: 151 A1 and 2013 / 0295167 A1, and the contents of both is incorporated herein by reference in its entirety.
[0081] Suitable liposome delivery vehicles are capable of delivering nucleic acid molecules to the tissue of a treated subject. In some embodiments, the liposome delivery vehicle comprises a lipid composition that can Stable in the subject for a sufficient amount of time to deliver the acid molecule and / or biological agent. For example, the liposome delivery vehicle may remain in the liquid state for at least about 5 minutes. The antibody is also stable in the recipient subject for about 1 hour, or for at least about 24 hours.
[0082] The liposome delivery vehicles described herein are useful for delivering nucleic acid molecules into cells. The nucleic acid molecule comprises one or more proteins that can fuse with the plasma membrane of a cell. If the nucleic acid:liposome complex encodes a protein, the nucleic acid:liposome complex may, in some embodiments, be delivered per milligram (mg) of total tissue protein per microgram (μg) of nucleic acid obtained Transfection of at least about 1 picogram (pg) of protein to be expressed For example, the transfection efficiency of a nucleic acid:liposome complex is determined by the amount of delivered At least about 100 μg of expressed protein per mg of total tissue protein per μg of nucleic acid expressed 10 pg; or expressed proteins per mg of total tissue protein per μg of nucleic acid delivered The transfection efficiency of the complex may be at least about 50 pg of the protein. 1 phenotype of protein expressed per mg of total tissue protein per μg of nucleic acid achieved The amount may be as low as one fg, but the above amounts are more preferred.
[0083] In some embodiments, the liposome delivery vehicles of the present invention have a diameter of about 100 to 500 nm. For example, liposome delivery vehicles have a diameter of approximately 150-450 nm. nm or about 200-400 nm.
[0084] Suitable liposomes include, for example, those commonly used in gene delivery methods known to those skilled in the art. In some embodiments, liposomes may be used. The drug delivery vehicle may comprise multilamellar vesicles (MLVs), extruded lipids, or both. In some embodiments, the liposome delivery vehicle is cationic. Methods for preparing MLVs are known in the art. In some embodiments, the liposome delivery vehicle is a polycation. Liposomes having a cationic lipid composition (i.e., cationic liposomes) and / or Liposomes having a cholesterol backbone attached to polyethylene glycol. As a typical cationic liposome composition, N-[1-(2,3-dioleyloxy)propanol] Pyr-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylol Ammonium chloride (DOTAP) and cholesterol, 1-[2-(oleoyl o [Oxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)-imidazolinium chloride Dimethyldioctadecylammonium bromide (DOTIM) and cholesterol DDAB and cholesterol, and combinations thereof. In some embodiments, the liposome delivery vehicle is N-[1- (2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride Dodecyl ether (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propanol] Dopyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxy Diethyl)imidazolinium chloride (DOTIM) and cholesterol; and di Composed of methyldioctadecylammonium bromide (DDAB) and cholesterol In some embodiments, the lipid pair used as a delivery vehicle comprises a lipid pair selected from the group: The liposome composition for this purpose comprises DOTIM and cholesterol.
[0085] Complexation of liposomes with the immunogenic nucleic acid plasmids described herein is well known in the art. or by using conventional methods, as described in U.S. Pat. No. 6,693,086, the contents of which are incorporated herein by reference in their entirety. This can be achieved as described in the literature (incorporated herein by reference). The appropriate concentration of nucleic acid plasmid to be added is sufficient to induce a systemic immune response. The amount of immunogenic nucleic acid plasmid delivered to a subject includes a concentration effective to deliver the amount of immunogenic nucleic acid plasmid to a subject, for example, about 0. 1 μg to approximately 10 μg of immunogenic nucleic acid plasmid is combined with approximately 8 nmol of liposomes. Approximately 0.5 μg to 5 μg of immunogenic nucleic acid plasmid can be cultured in approximately 8 nmol of liposomes. or about 1.0 μg of immunogenic nucleic acid plasmid can be combined with about 8 nm The immunogenic nucleic acid plasmid in the composition can be combined with a liposome. The ratio (μg immunogenic nucleic acid plasmid:nmol lipid) is at least about 1:1 Acid plasmid: lipid (by weight) (e.g., 1 μg immunogenic nucleic acid plasmid: 1 nmol lipid) For example, the ratio of immunogenic nucleic acid plasmid to lipid can be at least about 1:5, It may be at least about 1:10, or at least about 1:20. The percentage is based on the amount of lipid in the composition, not the total amount of lipid in the composition. The ratio of immunogenic nucleic acid plasmid to lipid in the compositions of the present invention is suitably about 1:1 by weight. About 1:80 immunogenic nucleic acid plasmid:lipid (by weight): about 1:2 to about 1:40 immunogenic Immunogenic nucleic acid plasmid:lipid (by weight); about 1:3 to about 1:30 immunogenic nucleic acid:lipid (by weight) or about 1:6 to about 1:15 immunogenic nucleic acid plasmid:lipid (by weight). .
[0086] The concentration of the immunomodulatory composition may be cytotoxic if elevated above a threshold. so that the concentrations of the immunomodulatory compositions as contemplated in this disclosure are non-cytotoxic; That is, levels below this threshold. As used herein, an abnormal cellular condition (e.g., growth failure, growth retardation, irregular growth, In some embodiments, immunomodulation refers to a condition characterized by a decreased immune response (microscopic appearance, and / or decreased immune responsiveness). The concentration of the composition is about 0.1 to about 250 ng / ml. In some embodiments, the concentration In some embodiments, the concentration of the immunomodulatory composition is about 0.1 to about 200 ng / ml. In other embodiments, the concentration of the immunomodulatory composition is about 0.1 to about 150 ng / ml. In yet other embodiments, the concentration of the immunomodulatory complex is about 0.1 to about 100 ng / ml. In other embodiments, the immunomodulatory composition has a concentration of about 1 to about 250 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is about 10 to about 250 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is from about 50 ng to about 25 In some embodiments, the concentration of the immunomodulatory composition is from about 100 to about 100 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is about 150 In yet other embodiments, the concentration of the immunomodulatory composition is about 2 to about 250 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is about 0 to about 250 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is 120 ng / ml or less. It is cytotoxic.
[0087] As used herein, a pharmaceutical composition comprising the immunostimulatory composition described above and a pharmaceutically acceptable carrier is provided. The immunomodulatory composition may be administered prior to or simultaneously with the immunostimulatory oligonucleotide. The individual immunomodulatory compositions and immunostimulatory agents may be administered at the same time or at different times. The pharmaceutical carrier for the oligonucleotide may be, but need not be, the same carrier. Pharmaceutically acceptable carriers include those administered intravenously, intramuscularly, intramammary, intradermally, intraperitoneally, subcutaneously, or by spray. , aerosol, in ovo, mucous membrane, transdermal, immersion, oral, intraocular, intratracheal, intranasal, pulmonary, rectal, or The composition is adapted for administration by a route selected from other means known to those skilled in the art. An acceptable carrier can be a diluent, adjuvant, excipient, or vehicle, and immunostimulatory compositions, or immunomodulatory compositions and immunostimulatory oligonucleotides. Such vehicles include water and oil (of petroleum, animal, vegetable, or synthetic origin). liquids such as peanut oil, soybean oil, mineral oil, sesame oil, etc.) For example, 0.4% saline and 0.3% glycine can be used. These solutions are sterile and generally free of particulate matter. They can be sterilized using conventional, well-known sterilization techniques. The composition may be sterilized by techniques such as filtration. The composition may contain pH adjusting and buffering agents, stabilizing agents, and the like. Agents required to approximate physiological conditions, such as thickeners, lubricants, and colorants The compounds of the present invention in such pharmaceutical preparations may contain physiologically acceptable auxiliary substances. The concentration of the molecule may vary widely, i.e., less than about 0.5% by weight, and typically at least about 1% by weight to 1.5% by weight. 5 or 20% by weight, depending on the particular mode of administration selected, as needed. The choice of the appropriate ion exchange media is based on the amount of ion exchange media that can be used, the fluid capacity, viscosity, etc. Suitable vehicles and formulations containing Remin are described, for example, below. gton:The Science and Practice of Pharmac y,21 st Edition,Troy,D.Bed.,Lipincott Wil liams and Wilkins,Philadelphia,PA 2006,P art 5, Pharmaceutical Manufacturing pp 69 1-1092 (see especially pp. 958-989).
[0088] Combining an immunomodulatory composition with an immunostimulatory oligonucleotide to form an immunostimulatory composition centrifuging the immunostimulatory composition to produce a supernatant and a pellet; and isolating the pellet. Provided herein.
[0089] Centrifuging the immunostimulatory composition causes sedimentation of the immunostimulatory composition. Isolation of the supernatant can be performed by pouring off the supernatant as long as part of the pellet remains. This can be achieved by removing the supernatant by rinsing or other means. It is expected that some pellet will be lost during removal of the supernatant. The immunostimulatory composition may remain in the supernatant even after centrifugation. In such a scenario, Thus, the supernatant may retain immunostimulatory properties. It is desirable to have almost all of the immunostimulatory composition in the pellet, but some remain in the supernatant. If the supernatant is centrifugated at 8,000 rpm, a higher centrifugation speed should be used. If the solution contains an immunostimulatory composition after centrifugation at 14,000 rpm, the solution may be centrifuged at 14,000 rpm. If increased, the remaining immunostimulatory composition may be decreased.
[0090] and administering an immunostimulatory oligonucleotide and an immunomodulatory composition. Also provided herein are methods for stimulating total lymphocyte receptor 21 (TLR21), wherein the immune The stimulatory oligonucleotide is located at or near the 5' end of the immunostimulatory oligonucleotide. containing a guanine nucleotide-rich sequence and at least one CpG motif, and The composition comprises a non-coding nucleic acid plasmid and a cationic lipid delivery vehicle.
[0091] Immunostimulatory oligonucleotides and immunomodulatory compositions can be administered intravenously, intramuscularly, intramammary, or intradermally. Intraperitoneal, subcutaneous, spray, aerosol, intraocular, mucosal, transdermal, immersion, oral, intraocular, intratracheal, Administered by a route selected from intranasal, pulmonary, rectal, or other means known to those skilled in the art. In some embodiments, the immunomodulatory composition and the immunostimulatory oligonucleotide are The immunostimulatory composition and the immunomodulatory composition are administered sequentially. The two may be simultaneous or simultaneous.
[0092] Concentrations of the immunomodulatory composition may be cytotoxic when greater than 250 μg / ml, and this Toxicity may exceed the offset of any immunostimulatory effects of the immunomodulator. In some embodiments, the concentration of the immunomodulatory agent is about 200 μg / ml. With administration of oligonucleotides, no cytotoxic levels are observed below the 10 μM range. Higher concentrations of immunostimulatory oligonucleotides may be tolerated by the recipient. In some embodiments of the present disclosure, the concentration of the immunostimulatory oligonucleotide is about 10 μM In some embodiments, the immunostimulatory oligonucleotide The concentration is about 2 μM, and in some embodiments, the concentration of the immunomodulatory composition is about 1 μM. The concentration of oligonucleotides is higher than that of the cytotoxicity, which is a limiting factor associated with the administration of immunomodulatory compositions. As such, in some embodiments, the immunomodulatory composition is present in a non-cytotoxic amount.
[0093] In each embodiment of the methods presented herein, the immunomodulatory composition and the immunostimulatory oligonucleotide The nucleotides can be in any embodiment or aspect as described above.
[0094] Also included are methods for treating rheumatoid arthritis, including administering any of the embodiments of the immunostimulatory compositions described herein. Also provided are methods for eliciting an immune response in elephants. can be achieved by administering the immunostimulatory oligonucleotides and immunomodulatory compositions described herein. and (b) administering to a subject a therapeutically effective amount of ... [Example]
[0095] The following examples are provided to further describe some of the embodiments disclosed herein. The examples are intended to illustrate, not limit, the disclosed embodiments. It is not intended to be.
[0096] The immunomodulatory composition used in the following examples consisted of a cationic lipid (DOTIM and cholesterol). A composition comprising a nucleotide sequence of ... The cationic lipid component was [1-[2-[9-(Z)-octadecenoyloxy] ]-2-[8](Z)-heptadecenyl]-3-[hydroxyethyl]imidazolinium chloride (DOTIM) and synthetic neutral lipid cholesterol, with a diameter of approximately 200 nm. Formulated to form liposomes (see U.S. Pat. No. 6,693,086) The non-coding DNA component was a 4292 base pair non-coding DNA plasmid produced in E. coli. pMB75.6 (SEQ ID NO: 266), which is negatively charged and positively charged associated with (cationic) liposomes (see U.S. Pat. No. 6,693,086). In the examples, "immunostimulatory nucleic acid plasmid" The term "pMB75.6" refers to pMB75.6. Point.
[0097] Example 1: Combination of TLR21-active oligodeoxynucleotides with immunomodulatory compositions The activity of immunomodulatory compositions on TLR21 was investigated. Specifically, HEK293-NF κB-bsd-cTLR21 cells were plated at 10,000 cells / well in 45 μl of growth medium. These cells were seeded into 384-well plates at 1000 kJ / well. The cells were exposed to iodide and incubated at 37°C for 3-4 days. 10 ml of culture supernatant was added per well. 1 μl was transferred to a 384-well plate and 90 μl of 50 mM NaHCO3 / Na2CO3 , 2 mM MgCl2, 5 mM para-nitrophenyl phosphate (pNP) (pH 9 6) was added, and the reaction rate was determined by measuring the kinetics of the change in optical density over time at 405 nM. was determined (mOD405nm / min).
[0098] Immunostimulatory nucleic acid plasmid alone, at the concentration range considered (up to 2 μg / ml), It was proven to be inactive, whereas liposomally formulated immunostimulatory nucleic acid plasmids ( pDNA-F) showed a weak but clear signal with a bell-shaped curve, and its interaction with TLR21 However, TLR21-stimulating activity was not observed in the presence of ATP, which interacted with this receptor. 5-Chol-GCGT3-T, an oligonucleotide ligand optimized for It was several orders of magnitude lower compared to G4T (SEQ ID NO: 1) (FIGS. 2A and 2B). [Table 3]
[0099] The activity of the immunomodulatory composition pDNA-F on TLR21 indicates that this receptor is indeed an immune receptor. Although this suggests that immunomodulatory compositions may be a component of the in vivo effects of the immunomodulatory compositions, the immunomodulatory compositions are not TL Being a fairly weak ligand for R21, this receptor is the only and dominant receptor. It may not be a family receptor. Example 2: 5-Chol-GCGT3-TG4T and Immunostimulatory Nucleic Acid Plasmids and Immunization Combination with Regulatory Compositions Immunostimulatory nucleic acid plasmid alone in a 200 μg / ml solution and immunomodulator composition, and Prepare a 2 μM solution of 5-Chol-GCGT3-TG4T in 100 μL of PBS and incubate at 4°C for 2 hours. From this solution, serial 1:2 dilutions were then prepared and diluted according to the protocol in Example 1. Starting with a 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) according to H EK293-bsd-cTLR21 cells were treated with 5-Chol-GCGT3-TG4T All samples showed strong TLR21 stimulatory activity, and the only test The compound had a slightly higher peak value and an EC value of 2.44 pM. 50 (Figure 3A, Table 3). Slightly low V max Except for the fact that 5-Chol-GCGT3-TG4T and immunostimulation The combination of the 5-Chol- Compared with GCGT3-TG4T alone (2.11 pM), EC 50 Little change in In contrast, the liposome-containing sample (immunostimulatory oligonucleotide) did not produce any significant effects (Figure 3A, Table 3). The oligonucleotide 5-Chol-GCGT3-TG4T and immunomodulatory composition The activity was maximal and the signal was reduced at low concentrations (Fig. 3A). Closer examination of the (pM) yielded a calculated EC 50 A prescribed activity In this concentration range, the immunomodulatory composition exhibited a potent plateau (Figure 3B, Table 3). It is also completely inactive (Fig. 3B) and has a lower EC 50 not be involved in [Table 4]
[0100] The results showed that TLR21-stimulating ODN 5-Chol-GCGT3-TG4T was non-cytotoxic. The combination of any of the immunostimulatory nucleic acid plasmids or immunomodulatory compositions at concentrations Furthermore, the TLR21-stimulating ODN 5-Chol-GC The combination of GT3-TG4T and immunomodulatory compositions inhibits EC of TLR21 activation 50 Regarding and are synergistic.
[0101] Example 3: Centrifugation of immunomodulatory compositions and TLR21 activity A solution of the immunomodulatory composition with a plasmid concentration of 200 μg / ml was added to 14,000 rp The mixture was centrifuged at 4°C for 2 hours in an Eppendorf tabletop centrifuge. The non-centrifuged aliquot was stored at 4°C for 2 hours. The supernatant was removed and saved, and the pellet was The immunomodulatory composition was found to have some weak TLR21 stimulatory activity. As previously established (see Example 1), 2 mg / Titration starting at 1000 ml of plasmid content was performed using the TLR21 assay. Prepared for.
[0102] Centrifugation of the immunomodulatory composition produced a pellet that was difficult to resuspend with a pipette. All of the TLR21 stimulating activity of the immunomodulatory composition was found in the pellet after centrifugation and not in the supernatant. The resuspended liposomes were stored at 4°C. Higher EC for TLR21 stimulation compared to liposomes 50 This effect is This may be due to alterations of the liposomes after centrifugation (e.g., incomplete resuspension / dispersion).
[0103] Example 4: Combination of 5-Chol-GCGT3-TG4T with an immunomodulatory composition Plasmid concentration of 200 μg / ml and 2 μM 5-Chol-GCGT3-TG4 An immunomodulatory composition / 5-Chol-GCGT3-TG4T solution containing 5- A 2 μM solution of Chol-GCGT3-TG4T was also prepared. Both samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were centrifuged in an Eppendorf tabletop centrifuge for 1 minute. Centrifuge remaining ink for use in Example 5 at 4,000 rpm and 4 °C for 2 hours. The incubations were stored at 4°C for analysis according to this Example 4. Both samples demonstrated potent TLR21 stimulatory activity, possibly as a result of the cytotoxicity of the immunomodulatory composition. or the immunomodulatory composition / 5-Chol-GCGT3-TG4T combination at higher concentrations The signal was strongly reduced at V (Fig. 5A). max The values are based on the immunological status of the sample. The results were similar when the components of the nodal composition were considered at low toxic concentrations (Fig. 5B, Table 4). et al., calculated EC of the combined immunomodulatory composition / 5-Chol-GCGT3-TG4T 50 was 4-fold lower than that of 5-Chol-GCGT3-TG4T alone (Fig. 5B, Table 4 ). [Table 5]
[0104] Example 5: Immunomodulatory composition / 5-Chol-GCGT3-TG4T and 5-Chol- Centrifugation of GCGT3-TG4T Plasmid concentration of 200 μg / ml and 2 μM 5-Chol-GCGT3-TG4 An immunomodulatory composition / 5-Chol-GCGT3-TG4T solution containing 5- A 2 μM solution of Chol-GCGT3-TG4T was also prepared. Both samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were eluted at 14,000 rpm at 4°C. The mixture was centrifuged for 2 hours in a Pendorff tabletop centrifuge. The supernatant was removed and saved, while the pellet was The samples were resuspended in 100 μl. Serial 1:2 dilutions were then made from these solutions. HEK293 starting at 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) -bsd-cTLR21 cells containing only 5-Chol-GCGT3-TG4T The results were compared with the samples.
[0105] Centrifugation of the Immunomodulatory Composition / 5-Chol-GCGT3-TG4T Combination Clear yielded a visible pellet, whereas 5-Chol-GCGT3-TG4T No visible pellets were observed. The TG4T combination pellet ("pDNA-f 5Chol pellet") was resuspended. However, in the TLR21 assay as described in Example 1, It contained virtually all of the stimulatory activity (Figures 6A and 6B), with only traces detected in the supernatant. ("pDNA-F 5Chol Uberstand") (Figure 6B, Table 4), but the original The EC 50 of The results show that after mixing with the immunomodulatory composition, 5-Chol-GCGT3 This suggests that TG4T is quantitatively physically associated with the liposomal fraction. When ol-GCGT3-TG4T alone was centrifuged, the soluble compounds were separated. (Figures 7A and 7B), remaining almost exclusively in the supernatant (estimated 99%, Table 4).
[0106] Example 6: Combination of 5-Chol-GCGT3-TG4T with an immunomodulatory composition Plasmid concentration of 200 μg / ml and 2 μM 5-Chol-GCGT3-TG4 An immunostimulatory composition was prepared containing 2 μM of 5-Chol-GCGT3-TG4T. Both samples were incubated at 4°C for 2 hours. 100 μl of these solutions were An aliquot was centrifuged at 14,000 rpm for 2 hours at 4°C in an Eppendorf tube for use in Example 7. The remaining incubation was centrifuged in a Dorf tabletop centrifuge, while the remaining incubation was centrifuged in accordance with this Example 6. The supernatant was removed and saved, while the pellet was collected by 200 μl centrifugation and stored at 4° C. for analysis. From these solutions, serial 1:2 dilutions were then made and the results were compared with those in the protocol of Example 1. into HEK293-bsd-cTLR21 cells for TLR21 analysis according to the call. The starting plasmid concentration was 20 nM (and 2 μg / ml plasmid concentration), and -Chol-GCGT3-TG4T alone was compared with a sample containing only Chol-GCGT3-TG4T.
[0107] Both samples ("5-Chol-GCGT3-TG4T" and "pDNA-F / 5-Cho l-GCGT3-TG4T) showed potent TLR21 stimulating activity, but the immunomodulatory composition / 5-Chol-GCGT3-TG4T combination ("pDNA-F / 5-Chol-GC GT3-TG4T) at high concentrations, possibly as a result of the cytotoxicity of the immunomodulatory composition. A strong reduction signal was observed (Figure 8A). The stimulatory activity of the immunomodulatory composition-containing sample was confirmed at a low toxic concentration. When considering the above, each V max The values were very similar (Figure 8B, Table 5). , EC of immunomodulatory composition / 5-Chol-GCGT3-TG4T 50 The calculated value is 5-Cho 2 times lower than l-GCGT3-TG4T (5-Chol-GCGT3-TG4T) alone (Figure 8B, Table 5). [Table 6]
[0108] Example 7: Immunomodulatory composition / 5-Chol-GCGT3-TG4T and 5-Chol- Centrifugation of GCGT3-TG4T Centrifugation of the immunomodulatory composition / 5-Chol-GCGT3-TG4T combination was The 5-Chol-GCGT3-TG4T produced a pellet that looked crisp. No visible pellets were observed. The pellet of the TG4T combination was difficult to resuspend, but the TL In the R21 assay, it ("pDNA-F / 5-Chol-GCGT3-TG4T The pellets (Table 9B) contained virtually all of the stimulatory activity, but not the original samples. EC that is higher than the fee 50 The supernatant (pDNA-F / 5-Chol-G) was Only traces were detected in the CGT3-TG4T supernatant (Fig. 9B, Table 5). After mixing with the immunomodulatory composition, 5-Chol-GCGT3-TG4T was mixed with the liposome fraction. Both fractions were centrifuged and separated into immunomodulatory composition / 5-Cho l-GCGT3-TG4T (“pDNA-F / 5-Chol-GCGT3-TG4T”) Compared to. Example 8: Combination of 5-Chol-GCGT3-TG4T with an immunomodulatory composition Plasmid concentration of 200 μg / ml and 2 μM 5-Chol-GCGT3-TG4 A solution of the immunomodulatory composition of T was prepared. 2 μM 5-Chol-GCGT3-TG4T sample Both samples were incubated at 4°C for 2 hours. 100 μl of each of these solutions was Coat the Eppendorf tubes at 14,000 rpm for 2 hours at 4°C for use in Example 9. The remaining incubate was centrifuged in a benchtop centrifuge. The supernatant was removed and saved, while the pellet was collected by centrifugation at 100 μl and stored at 4° C. for further analysis. From these solutions, serial 1:2 dilutions were then prepared and the results were compared with those of Example 1. Following the protocol, 20 nM plus 20 nM of ... Starting with a medium concentration (and 2 μg / ml plasmid concentration), 5-Chol-GCGT3- Comparison was made with a sample containing only TG4T.
[0109] Both samples showed strong TLR21 stimulating activity, but 5-Chol-GCGT3-TG4 T / immunomodulatory composition combination (“pDNA-F / 5-Chol-GCGT3-TG4T” ) showed a signal that was strongly reduced at high concentrations, similar to the immunomodulatory composition alone ("pDNA-F"). The immunostimulation of the immune system showed a significant increase in the number of cells in the IL-16-positive cells (Figure 10A), which is likely a result of the cytotoxicity of the immunomodulatory composition. The 5-Chol-GCGT3-TG4T oligonucleotide ("5-Chol-GCGT3-TG4T") is an immunomodulatory composition. The V max The values were very similar when considering the stimulatory activity of the sample immunomodulatory composition components at subtoxic concentrations. (Figure 10B, Table 6). However, the combined immunomodulatory composition / 5-Chol-GC EC5 of GT3-TG4T (“pDNA-F / 5-Chol-GCGT3-TG4T”) The calculated value of 0 is the same as that of 5-Chol-GCGT3-TG4T alone (5-Chol-GCGT3 The immunomodulatory composition alone ("Bay 9 -TG4T") was 4-fold lower (Figure 10B, Table 6). 8-F") showed only minimal activity, and its additive effect was similar to that of 5-Chol-GCGT3-T Increased activity of the immunomodulatory composition / 5-Chol-GCGT3-TG4T relative to G4T alone I can't explain gender. [Table 7]
[0110] Example 9: Centrifugation of immunomodulatory compositions Centrifugation of the immunomodulatory composition / 5-Chol-GCGT3-TG4T combination clearly demonstrated The 5-Chol-GCGT3-TG4T resulted in a pellet that was visible to the naked eye. No visible pellet was observed. Immunomodulatory Composition / 5-Chol-GCGT3-TG 4T combination pellet (pDNA-F / 5-Chol-GCGT3-TG4T pellet) The TLR21 antibody ("TLR21 antibody") was difficult to resuspend, whereas the TLR21 antibody ("TLR21 antibody") was difficult to resuspend. In the case of serotonin-dependent stimulatory activity, the serotonin-dependent stimulatory activity was >95% (Fig. 11B), but it was significantly lower than that of the original sample. High EC 50The supernatant (pDNA-F / 5-Chol-GCGT3-TG4 Only a small fraction (<5%) was detected in the lysate (i.e., the “supernatant”) (Fig. 11B, Table 6), suggesting poor immune regulation. At the same concentration of the composition ("pDNA-F / 5-Chol-GCGT3-TG4T"), the non-centrifuged fraction This result indicates that after mixing with the immunomodulatory composition, 5-Ch This indicates that ol-GCGT3-TG4T is quantitatively physically associated with the liposomal fraction. To suggest.
[0111] Example 10: Combination of GCGT3-TG4T with immunomodulatory compositions 200 μg / ml plasmid concentration and 2 μM GCGT3-TG4T (SEQ ID NO: 25 2;5-CholGCGT3-TG4T (SEQ ID NO: 1) with the same oligonucleotide sequence An immunomodulatory composition solution containing 2 μM cholesteryl-modified cholinesterase inhibitor was also prepared. GCGT3-TG4T samples were prepared and both samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were incubated at 14,000 rpm for 2 hours at 4° C. Centrifuge in an Eppendorf tabletop centrifuge for use at 1°C for incubation. The remainder was stored at 4°C for analysis according to this Example 10. The supernatant was removed and stored. Meanwhile, the pellet was resuspended in 100 μl. From these solutions, serial 1:2 dilutions were then made. A dilution was prepared and transfected with HEK293-bsd-cTLR21 cells according to the protocol in Example 1. administered to the cells, starting at a 20 nM plasmid concentration (and 2 μg / ml plasmid concentration), Comparison was made with a sample containing only GCGT3-TG4T.
[0112] Both samples showed potent TLR21 stimulatory activity, but the GCGT3-TG4T / immunomodulatory composition The combination of the product ("pDNA-F / 5-Chol-GCGT3-TG4T") is probably immunogenic. As a result of the cytotoxicity of the immunomodulatory composition, a strongly diminished signal was observed at high concentrations (Figure 12 A). The stimulatory activity of the immunomodulatory composition components of the samples was examined at subtoxic concentrations (Fig. 12B, Table 7), each V max The values were very similar. However, the immunomodulatory composition / GCGT EC of 3-TG4T combination 50 The calculated values are for GCGT3-TG4T alone (Table 7). The immunomodulatory composition alone ("pDNA-F") showed only minimal activity. The additive effect was greater than that of the immunomodulatory composition / GCGT3-TG4T compared to GCGT3-TG4T alone. The increased activity of G4T cannot be explained. [Table 8]
[0113] Example 11: Centrifugation of immunomodulatory composition / GCGT3-TG4T Centrifugation of the immunomodulatory composition / GCGT3-TG4T combination resulted in clearly visible pigmentation. The immunomodulatory composition / GCGT3-TG4T combination pellet was resuspended. However, in the TLR21 assay described in Example 1, it was The original sample ("pDNA-F / GCGT3-TG4T pellet") was T3-TG4T) 50 However, the supernatant (pDNA-F / GCGT3 It contained more than three times the stimulatory activity of the TG4T supernatant (Figure 13B, Table 7). The results showed that after mixing with the immunomodulatory composition, GCGT3-TG4T was able to induce cholesteryl-induced Although not as efficient as derivatized 5-CholGCGT3-TG4T, liposome fraction and quantification This suggests that they are physically related to each other.
[0114] Those skilled in the art will be able to make numerous changes and modifications to the preferred embodiments of the present invention. and such changes and modifications may be made without departing from the spirit of the invention. It will be understood, therefore, that the appended claims are to be construed as limiting the true spirit of the invention. and all such equivalent variations that fall within its scope.
[0115] The disclosure of each patent, patent application, and publication cited or described in this document is incorporated by reference in its entirety. is incorporated herein by reference. Example 12: Immunostimulants in a Newcastle disease vaccination model in chickens In vivo study of the efficacy of Determine the suitability and efficacy of ODN1, ODN2, and ODN3 as immunostimulatory agents To assess the efficacy of steroids, each was tested at three different concentrations.
[0116] The following immunostimulants were investigated: ODN1:[CholTEG]-TGGGGTTTTTTTTGCGTTTTTGC GTTTTTGCGTTTT (“5Chol-GCGT3-TG4T”) (SEQ ID NO: 1) ([CholTEG] = 5'-triethylene glycol-linked cholesteryl modification) , ODN2:TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGT TTT (“GCGT3-TG4T”) (SEQ ID NO: 252), ODN3:tcgtcgttttgtcgttttgtcgtt (“2006-P TO”) (SEQ ID NO: 3).
[0117] Each immunostimulant was administered at a suboptimal concentration of inactivating agent according to Table 9. The suboptimal N For the preparation of the NDV vaccine, the NDV antigen batch was diluted 50-fold in NDV-negative allantoic fluid (AF). The ODN1, ODN2, and The efficacy of ODN3 in combination with a suboptimal dose of Newcastle disease vaccine was tested. Serological responses were measured and compared with a similar suboptimal NDV vaccine without immunostimulants. Antibody titers were measured at different time points after vaccination to confirm whether the addition of an immune stimulant increased the immune response earlier. To determine the optimal dose of each of the three ODNs, Three different doses of 100ng, 1000ng and 5000ng were used for the suboptimal NDV vaccine. These nine immune stimulant groups were supplemented with different doses of the immune stimulant. In addition, five control groups were included in the study, which consisted of suboptimal ND without any immunostimulants. V vaccine group, undiluted NDV vaccine group, negative control group (immunization in combination with adjuvant) stimulant) and polyinosinic:polycytidylic acid (Poly I:C) at two different concentrations The test consisted of two positive control groups (Table 8).
[0118] The following parameters were tested: chicken health (data not shown) and blood cells. Serological testing by agglutination inhibition (HI) assay. [Table 9]
[0119] Chickens enrolled in treatment groups T01-T14 received either the test product or In the T13 and T14 groups, two animals were lost before the start of the study. Instead of 10 chickens per group, 9 were vaccinated.
[0120] Treatment groups T01, T02, T03, T04, T05, T06, T07, T08 and T0 Chickens were assigned to 9 groups and given one of three different immune stimulants (ODNs). Suboptimal NDV suspensions (each at three different concentrations: 100, 1000, 5000 For the preparation of water-in-oil emulsion, NDV antigen suspension was The suspension and immunostimulant (aqueous phase) were mixed with the adjuvant Stimune (oil phase) in a ratio of 4:5. The ratio was as follows (Table 9). [Table 10] TIFF0007760560000028.tif123168
[0121] Chickens assigned to the control group of T10 were given a suboptimal NDV suspension without any immunostimulant. The vaccine was administered in a 4:5 ratio using the liquid (in adjuvant (Stimune)).
[0122] Chickens assigned to the control group T11 were injected with undiluted NDV suspension ( The mice were vaccinated with a 4:5 ratio of adjuvant (in Stimune).
[0123] The chickens in the T12 group were given immunostimulant 1 (3 chickens), immunostimulant 2 (3 chickens), and and immunostimulant 3 (3 birds) (in adjuvant (Stimune)) at a ratio of 4:5. One chicken was inoculated with dilution buffer (individual) in adjuvant (Stimune). The vaccine was administered using a vaccine (self-specific).
[0124] Chickens assigned to the control groups T13 (n=9) and T14 (n=9) were given two concentrations of The highest concentrations of NDV in combination with Poly I:C (10,000 ng and 100 μg) were Suboptimal NDV suspension (in adjuvant (Stimune)) was vaccinated at a ratio of 4:5. I sowed it. Administration of test or control product Thaw an inactivated NDV strain Ulster suspension stored at -70°C and incubate for 50 minutes in the negative allantoic fluid. Suboptimal vaccine doses were created by 2-fold dilution. Immunostimulants were administered according to the study design. The resulting aqueous phase was added in a 4:5 ratio according to the vaccination preparation scheme shown in Table 9. During preparation, all vaccine components except the Stimune adjuvant were mixed with the vaccine. The vaccine components were placed on melting ice. The prepared vaccine was injected immediately after preparation (0.5 ml, intramuscularly). inside the meat).
[0125] Your overall health will be monitored daily by experienced biotechnologists from the day of your arrival until the end of the study. I did it. Serum collection On study days 0 (pre-vaccination), 7, 14, and 21, all chickens Blood samples for serological testing were collected from each patient. The blood samples were labeled with the study number, a unique The samples were labeled with their identification and collection date. Depending on the amount of blood collected, serum was diluted to approximately 0. It was divided into two 5 ml aliquots and stored at -20±5°C. Hemagglutination inhibition (HI) assay Briefly, serial dilutions of sera were incubated with 8 HAU (hemagglutinating units) of NDV strain Ulst. The HAU were titrated and incubated with er for 60 minutes at room temperature. Chicken red blood cells were then added and incubated at 4°C for 45 minutes, after which the cells were allowed to clot. A negative control serum and three positive control sera (low, medium and high antibody titers) were recorded. Each assay was included.
[0126] The HI titer results were expressed as the reciprocal of the highest serum dilution that completely inhibited agglutination, and this was used as the final titer. Logarithmic transformation was performed to Log2 titers.
[0127] statistics Logarithmically transformed HI results were summarized by animal (see Tables 62-65). The mean and standard deviation of antibody titers were calculated for each treatment group. Statistical analysis was performed using nonparametric methods. The Mann-Whitney t-test was used. result No clinical symptoms or adverse events related to vaccination were observed in any group. All the chickens looked healthy.
[0128] However, two chickens were euthanized due to pecking behavior that began 6 days before the start of the study. On the day of vaccination, the chickens were given Poly They were assigned to I:C groups T13 (#11658) and T14 (#11676). He recovered within a week of vaccination. ODN1, GCGT3-TG4T-5Chol As Log2 titers for 100ng, 1000ng and 5000ng ODN1 dose groups The individual HI results are presented in Table 10. The mean HI titers and standard deviations for these groups are: Compared to the mean titers of the diluted NDV vaccine group, Figure 14 (day 14 post-vaccination (pv) and 21 days) and Figure 15 (all data).
[0129] The GCGT3-TG4T-5Chol group received a diluted NDV vaccine (mean HI titer: 4.8 On day 14 of pv, the HI titer was significantly higher than that of the control. This was the case for all three doses; 100 ng: mean HI titer 6.2 Log2 / SD 1.4 (p=0.0214), 1000ng: mean HI titer 6.9 Log2 / SD 1.1 (p=0.0003) and 5000ng: mean HI 5.9 Log2 / SD 0.7 (p=0.0243).
[0130] However, on day 21 of pv, the NDV vaccine HI titer was 6.2 Log2 / SD1.0. When compared, the 1000 ng concentration was very close to significant, but no significant differences were observed at any concentration. 100ng: Mean HI titer 6.9 Log2 / SD 0.8 (p=0.1995 ); 1000ng: Mean HI titer 7.3 Log2 / SD 0.9 (p=0.0527); and 5000ng: mean HI 6.7 Log2 / SD 0.9 (p=0.4523) (Figure 14 ). [Table 11]
[0131] ODN2,GCGT3-TG4T As Log2 titers for 100ng, 1000ng and 5000ng ODN1 dose groups The individual HI results are presented in Table 11. The mean HI titers and standard deviations for these groups are: Compared with the mean titers of the diluted NDV vaccine group, Figure 16 (pv days 14 and 21) and and Figure 17 (all data).
[0132] The ODN2, GCGT3-TG4T group received a diluted NDV vaccine (mean HI titer: 4.8L og2 / SD1.0), which showed significantly higher HI titers than og2. The case occurred 14 days after vaccination; 100ng: mean HI titer 7.1 Log2 / SD 1.2 (p=0.0003), 1000ng: mean HI titer 6.4 Log2 / SD0 .7 (p=0.0027), and 5000ng: mean HI titer 6.1 Log2 / SD1 .1 (p=0.0236). On day 21, NDV vaccine (HI titer 6.2 Log2 / S A mean H of 7.6 Log2 / SD 0.8 (p=0.0083) compared with D 1.0 A significant difference was observed only at the 100 ng dose with a titer of 1. The mean HI titers at 0 ng were 7.1 Log2 / 0.6 (p=0.0696) and 0 ng, respectively. The mean mean was 7.2 Log2 / SD1.0 (p=0.0956) (Figure 16). [Table 12]
[0133] ODN3,2006-PTO Log2 power of the 100ng, 1000ng and 5000ng ODN1 dose groups measured Individual HI results, expressed as titers, are shown in Table 12. Outliers were observed during triplicate HI assay runs. This result was observed for animal 11570 on day 21, which was due to a pipetting error ( This is most likely caused by the lack of sufficient AF added. This result was omitted from the final analysis (highlighted in Table 12). For each specimen and date, the mean HI titer was based on duplicate determinations.
[0134] The mean HI titers and standard deviations of these groups were compared with the mean titers of the diluted NDV vaccine group. The results are shown in Figure 18 (days 14 and 21 of pv) and Figure 19 (all data).
[0135] The ODN3,2006-PTO group received a diluted NDV vaccine (mean HI titer: 4.8 Log 2 / SD1.0), which was significantly higher than that of the control group 14 days after vaccination. Applied to two doses on day 1; 1000ng: Mean HI titer: 6.3 Log2 / SD 1.2 (p=0.0081) and 5000ng: mean HI titer: 6.2 Log2 / SD 0.8 (p=0.0059). The mean HI titer for the 100 ng dose was 5.3 Log2 / SD 0.5 (p=0.2090). On day 21 of pv, the significant difference was : Only a mean HI titer of 7.3 Log2 / SD 0.6 (p=0.0296) was measured. DV vaccine; HI titer 6.2 Log2 / SD1.0 compared to 100 ng and No significant difference was observed at the 1000 ng dose, with the mean HI titer being 6.6 Log2 / S. D0.5 (p=0.7183) and 6.8Log2 / SD1.1 (p=0.1685) (Figure 18). [Table 13]
[0136] Control group 10 μg and 100 μg Poly I:C dose groups, diluted and undiluted NDV vaccines Individual HI results, expressed as Log2 titers for the HIV-1 strain and the negative control, are shown in Table 13. The mean HI titers and standard deviations of these groups were compared with the mean titers of the diluted NDV vaccine group. The results are shown in Figure 20 (days 14 and 21 of pv) and Figure 21 (all data).
[0137] The positive control group, Poly I:C, was treated with NDV vaccine (6.2 Log2 / S 100 μg dose: HI titer of 7.5 Log2 / SD on day 21 compared with D1.0 Significantly higher HI titers were observed only at 0.4 (p=0.0053). The mean HI titers on day 14 for the 00 μg dose group were 5.8 Log2 / SD1.3 (p < 0.01), respectively. =0.1859) and 5.5Log2 / SD0.8 (p=0.1609). The mean HI titer in the 10 μg dose group on day 21 was 6.4 Log2 / SD1.3 (p =0.7273) and the undiluted NDV vaccine (8.3 / SD0.5 and 8.5L). og2 / SD0.7) and the negative control group on days 14 and 21 after vaccination Compared with the diluted NDV group (4.8 / SD1.0 and 6.2Log2 / SD1.0, respectively). A significant difference (p<0.0001) was observed between the two groups (Figure 20). [Table 14]
[0138] conclusion The aim was to test the adjuvant activity of three different immunostimulants. The results showed that the NDV-mediated immune response was significantly improved by the administration of a suboptimal concentration of inactivated NDV and one of three different immunostimulants. To measure serological responses after vaccination with an oil emulsion vaccine containing and was tested by.
[0139] The following immunostimulants were investigated: ODN1:[CholTEG]-TGGGGTTTTTTTTGCGTTTTTGC GTTTTTGCGTTTT ("GCGT3-TG4T-5Chol") (SEQ ID NO: 1 ) ([CholTEG] = 5'-triethylene glycol-linked cholesteryl modification), ODN2:TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGT TTT ("GCGT3-TG4T") (SEQ ID NO: 252), ODN3:tcgtcgttttgtcgttttgtcgtt("2006-PT O") (SEQ ID NO: 3).
[0140] The backbones of ODN1 and ODN2 immunoglobulins were phosphodiester-linked, whereas the backbones of ODN3 The ODN was phosphorothioate-linked. The efficacy of each ODN was 100 ng, 1000 ng and 5000ng, complementing a suboptimal NDV vaccine. Ta.
[0141] Serological responses were measured on days 0 (before vaccination), 7, 14, and 2 after vaccination. The addition of these immune stimulants may also lead to an earlier immune response, as measured on day 1. We investigated whether there was a difference in the NDV levels on days 0 and 7 post-vaccination (pv). The antibody levels against NDV were 0.01% on day 7 except for one animal (#11618) in the undiluted NDV vaccine group. was not detected.
[0142] Serological responses, expressed as Log2HI titers, were significantly higher in undiluted and diluted samples on days 14 and 21 of pv. There was a significant difference (p<0.0001) between the optimal and suboptimal NDV vaccines, with the 50-fold dilution factor being the most effective. It was shown to be sufficient to produce a suboptimal vaccine dose.
[0143] The negative control group remained negative throughout the study period, and the non-NDV vaccine-administered immune stimulant was non- It has been shown not to elicit a specific immune response.
[0144] The positive control Poly I:C 100 μg dose group was naive on day 21. The HI titers were significantly higher than those of the NDV vaccine (p=0.0053), and this dose group was shown to be an effective positive control group.
[0145] The GCGT3-TG4T-5Chol (ODN1) group was administered at three doses; 100 ng (p = 0.0214), 1000ng (p=0.0003) and 5000ng (p=0.02 43) All were significantly higher on day 14 of pv compared to diluted NDV vaccine. However, no significant difference was observed on day 21 of pv.
[0146] The GCGT3-TG4T(ODN2) group was compared with the diluted NDV vaccine on day 14 of pv. When compared, three doses: 100 ng (p=0.0003), 1000 ng (p=0.0 0.027) and 5000ng (p=0.0236) all showed significantly higher HI titers. At day 21, a significant difference (p=0.0083) was observed only in the 100 ng dose group. It was determined.
[0147] The 2006-PTO (ODN3) group received two doses of NDV vaccine compared to the diluted NDV vaccine; 000ng (p=0.0081) and 5000ng (p=0.0059), pv14 On day 21, the HI titer was significantly higher than that on day 21 (p=0.029). 6) was measured only in the 5000 ng dose group.
[0148] In conclusion, the highest mean HI titer was achieved with 100 ng of GCGT3-TG4T(ODN2). Dose groups, observed at 7.1 Log2 (pv day 14) and 7.6 Log2 (pv day 21) This was observed on days 14 and 21 of pv when compared with the naive NDV vaccine. These show a 2.3 Log2 and 1.4 Log2 increase in titer, respectively.
[0149] Day 14 of pv in the 1000ng GCGT3-TG4T-5Chol (ODN1) dose group The titers on days 1 and 21 were 6.9 Log2 and 7.3 Log2, respectively, which were almost the same as those in the ODN2 group. On day 14 of pv, there was a significant difference between the ODN1 and ODN2 groups (p=0.751 3) was not observed.
[0150] The titers of the 5000ng 2006-PTO(ODN3) dose group were On the 1st and 21st days, the values were 6.2 Log2 and 7.3 Log2. The ODN3 group was significantly different from both the ODN1 and ODN2 groups (p=0.03 00) (Figures 22 and 23).
[0151] On day 21 of pv, no significant differences were observed among all ODN groups.
[0152] Therefore, these results suggest that all ODNs significantly increased serological and immunogenicity, especially at day 14 post-vaccination. It has been shown that the response can be significantly increased and that it can show an earlier onset of immunity. Indicates that. [Example]
[0153] Embodiment For further illustration, additional non-limiting embodiments of the present disclosure are set forth below.
[0154] For example, embodiment 1 is an immunostimulatory composition comprising: an immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle; and Guanine nucleotide-rich sites at or near the 5' end of immunostimulatory oligonucleotides Immunostimulatory oligonucleotides having a nucleotide sequence and at least one CpG motif.
[0155] Embodiment 2 is the immunostimulatory composition of embodiment 1, wherein the immunomodulatory composition The composition and the immunostimulatory oligonucleotide are present in synergistically effective amounts.
[0156] Embodiment 3 is the immunostimulatory composition of embodiment 1 or 2, wherein the immunostimulatory composition Immunostimulatory oligonucleotides contain ligands for cytosolic nucleic acid surveillance molecules. nothing.
[0157] Embodiment 4 is the immunostimulatory composition of embodiment 3, wherein the immune site The nucleic acid surveillance molecules are Toll-like receptors (TLRs).
[0158] Embodiment 5 is the immunostimulatory composition of embodiment 3 or 4, wherein the suppository The nuclear surveillance molecule in the cytosol is TLR21.
[0159] Embodiment 6 is an immunostimulatory composition of any one of the preceding embodiments, wherein and the immunomodulatory composition has a nucleic acid concentration of about 200 μg / ml.
[0160] Embodiment 7 is an immunostimulatory composition according to any one of the preceding embodiments, wherein The concentration of the immunostimulatory oligonucleotide is about 10 μM to 0.5 μM.
[0161] Embodiment 8 is the immunostimulatory composition of embodiment 7, wherein the immunostimulatory The concentration of the oligonucleotide is approximately 2 μM.
[0162] Embodiment 9 is an immunostimulatory composition of any one of the preceding embodiments, wherein and the immunomodulatory composition has a nucleic acid plasmid concentration greater than the immunostimulatory oligonucleotide concentration. It's also expensive.
[0163] Embodiment 10 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the immunomodulatory composition is present in a non-cytotoxic amount.
[0164] Embodiment 11 is an immunosuppressant according to any one of the preceding embodiments, further comprising a pharmaceutical carrier. It is an irritating composition.
[0165] Embodiment 12 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the liposome delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both. .
[0166] Embodiment 13 is an immunostimulatory composition according to any one of the preceding embodiments, Here, the liposome delivery vehicle is cationic.
[0167] Embodiment 14 is the immunostimulatory composition of embodiment 13, wherein the cationic lipase The transposomal delivery vehicle is N-[1-(2,3-dioleyloxy)propyl]-N,N , N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1 -(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride Chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl] -2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM ) and cholesterol; and dimethyldioctadecylammonium bromide (DD The lipid pair comprises a lipid pair selected from the group consisting of: α- and β-blockers (AB) and cholesterol.
[0168] Embodiment 15 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the nucleic acid plasmid is non-coding.
[0169] Embodiment 16 is an immunostimulatory composition according to any one of the preceding embodiments, Here, the nucleic acid plasmid is of bacterial origin.
[0170] Embodiment 17 is an immunostimulatory composition according to any one of the preceding embodiments, Here, the nucleic acid plasmid is immunogenic.
[0171] Embodiment 18 is the immunostimulatory composition of any one of embodiments 1 to 17, wherein the nucleic acid plasmid has at least 75% sequence identity with SEQ ID NO: 265. .
[0172] Embodiment 19 is the immunostimulatory composition of any one of embodiments 1 to 17, wherein the nucleic acid plasmid has at least 75% sequence identity with SEQ ID NO: 266. .
[0173] Embodiment 20 is the immunostimulatory composition of any one of embodiments 1 to 17, wherein the nucleic acid plasmid has at least 75% sequence identity with SEQ ID NO: 268. .
[0174] Embodiment 21 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the guanine nucleotide-rich sequence comprises a first plurality of guanine nucleotides.
[0175] Embodiment 22 is the immunostimulatory composition of embodiment 21, wherein the first The plurality of guanine nucleotides includes 3 to 8 guanine nucleotides.
[0176] Embodiment 23 is the immunostimulatory composition of embodiment 21 or 22, wherein: The immunostimulatory oligonucleotides are SEQ ID NOs: 16, 17, 18, 19, 20, 21, 3 0, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 7 0, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92 , 93, 96, 97, 100, 102, 104, 106, 108, 143, or 1 nothing.
[0177] Embodiment 24 is a method for preparing a guanine nucleotide sequence comprising the steps of: 23. The immunostimulatory composition of embodiment 21 or 22, further comprising anthraquinone nucleotides. do.
[0178] Embodiment 25 is the immunostimulatory composition of embodiment 24, wherein the immunostimulatory The active oligonucleotides are SEQ ID NOs: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, or GCGT-Gwire3.
[0179] Embodiment 26 is the immunostimulatory composition of embodiment 24 or 25, wherein: the first plurality of guanine nucleotides and the second plurality of guanine nucleotides Separated by at least two nucleotides.
[0180] Embodiment 27 is an immunostimulatory composition according to any one of embodiments 21 to 26. wherein the first plurality of guanine nucleotides and at least one CpG motif are Separated by at least three nucleotides.
[0181] Embodiment 28 is the immunostimulatory composition of any of embodiments 21 to 27, wherein The first plurality of guanine nucleotides and the at least one CpG motif are hexaethyl ethylene glycol, tetraethylene glycol, propanediol, or their derivatives are separated by
[0182] Embodiment 29 is the immunostimulatory composition of embodiment 28, wherein the hexa The structure of ethylene glycol is: TIFF0007760560000033.tif68156 Embodiment 30 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, Each CpG motif is separated from other CpG motifs by a spacer. It is separated from the
[0183] Embodiment 31 is the immunostimulatory composition of embodiment 30, wherein the spacer The sequence comprises at least one nucleotide or nucleotide analog.
[0184] Embodiment 32 is the immunostimulatory composition of embodiment 31, wherein the spacer The sar contains a deoxyribose phosphate bridge.
[0185] Embodiment 33 is the immunostimulatory composition of embodiment 32, wherein the deoxyribonucleotide The siliobose phosphate bridge is abasic.
[0186] Embodiment 34 is the immunostimulatory composition of embodiment 31, wherein the spacer The sar contains a carbon chain.
[0187] Embodiment 35 is the immunostimulatory composition of embodiment 34, wherein the carbon chain is derived from 1,3-propanediol.
[0188] Embodiment 36 is the immunostimulatory composition of embodiment 31, wherein the spacer The sar contains repeating chemical units.
[0189] Embodiment 37 is the immunostimulatory composition of embodiment 36, wherein the repeating The scientific unit is ethylene glycol.
[0190] Embodiment 38 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide contains at least one nucleotide analog. nothing.
[0191] Embodiment 39 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide further comprises a phosphodiester backbone.
[0192] Embodiment 40 is the immunostimulatory composition of any of embodiments 1 to 38, wherein wherein the immunostimulatory oligonucleotide further comprises a phosphorothioate backbone.
[0193] Embodiment 41 is an immunostimulatory composition according to any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide comprises a lipid moiety.
[0194] Embodiment 42 is the immunostimulatory composition of embodiment 41, wherein the lipid moiety is It's Resteril.
[0195] Embodiment 43 is an immunostimulatory composition according to any one of embodiments 41 to 42. wherein the lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide. do.
[0196] Embodiment 44 includes a CpG sequence element at the 5' end, the 3' end, or both. , an immunostimulatory composition according to any one of the preceding embodiments.
[0197] Embodiment 45 is the immunogen of embodiment 44, having at least two CpG sequence elements. It is an immunostimulant composition.
[0198] Embodiment 46 is the immunostimulatory composition of embodiment 44 or 45, wherein: The CpG sequence element is GCGA, GCGG, ACGC, CCGC, GCGT, or TC It's GC.
[0199] Embodiment 47 is a method for preparing an immunostimulatory composition according to any one of the preceding claims. 10. A method comprising: The immunostimulatory composition is combined with the immunostimulatory oligonucleotide to stimulate the immune system. forming sexual compositions; centrifuging the immunostimulatory composition to produce a supernatant and a pellet; and Isolating the pellet; Includes.
[0200] Embodiment 48 is a method for stimulating toll-like receptor 21 (TLR21), comprising: administering an immunostimulatory oligonucleotide and an immunomodulatory agent composition, The immunostimulatory oligonucleotide is a nucleotide sequence that is nucleotide sequence nucleotide sequence nucleotide sequence nucleotide sequence nucleotide sequence nucleotide sequence nucleotide sequence or adjacent to the guanine nucleotide-rich sequence and at least one CpG motif. wherein the immunomodulatory composition comprises a non-coding nucleic acid plasmid and a lipid delivery vehicle. .
[0201] Embodiment 49 is the method of embodiment 48, wherein the immunomodulatory composition and and said immunostimulatory oligonucleotide are present in synergistically effective amounts.
[0202] Embodiment 50 is the method of embodiment 48 or 49, wherein the immune stimulating The oligonucleotide comprises a ligand for TLR21.
[0203] Embodiment 51 is the method of any one of embodiments 48 to 50, wherein the The immunomodulatory composition has a nucleic acid plasmid concentration of about 200 μg / ml.
[0204] Embodiment 52 is the method of any one of embodiments 48 to 51, wherein the The concentration of the immunostimulatory oligonucleotide is about 10 μM to 0.5 μM.
[0205] Embodiment 53 is the method of embodiment 52, wherein the immunostimulatory oligonucleotide The concentration of leutide is about 2 μM.
[0206] Embodiment 54 is the method of any one of embodiments 48 to 53, wherein the The immunomodulatory composition has a nucleic acid plasmid concentration higher than the immunostimulatory oligonucleotide concentration. stomach.
[0207] Embodiment 55 is the method according to any one of embodiments 48 to 54, wherein The immunomodulatory composition is present in a non-cytotoxic amount.
[0208] Embodiment 56 is the method according to any one of embodiments 48 to 55, wherein The immunomodulatory composition further comprises a pharmaceutical carrier.
[0209] Embodiment 57 is the method according to any one of embodiments 48 to 56, wherein The liposome delivery vehicle comprises multilamellar vesicles, extruded lipids, or both.
[0210] Embodiment 58 is the method of any one of embodiments 48 to 57, wherein the liposome The somatic delivery vehicle is cationic.
[0211] Embodiment 59 is the method of embodiment 58, wherein the cationic liposome The drug delivery vehicle is N-[1-(2,3-dioleyloxy)propyl]-N,N,N- Trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2 ,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2- Oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.
[0212] Embodiment 60 is the method of any one of embodiments 48 to 59, wherein The nucleic acid plasmid is non-coding.
[0213] Embodiment 61 is the method of any of embodiments 48 to 60, wherein the nucleus Acidiplasmids are of bacterial origin.
[0214] Embodiment 62 is the method of any one of embodiments 48 to 61, wherein the The nucleic acid plasmid is immunogenic.
[0215] Embodiment 63 is the method of any one of embodiments 48 to 62, wherein the The nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:265.
[0216] Embodiment 64 is the method of any one of embodiments 48 to 62, wherein the The nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:266.
[0217] Embodiment 65 is the method of any one of embodiments 48 to 62, wherein the The nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:268.
[0218] Embodiment 66 is the method of any one of embodiments 48 to 65, wherein the The guanine nucleotide-rich sequence comprises a first plurality of guanine nucleotides.
[0219] Embodiment 67 is the method of embodiment 66, wherein the first plurality of guanidines The guanine nucleotides contain 3 to 8 guanine nucleotides.
[0220] Embodiment 68 is the method of embodiment 66 or 67, wherein the immune stimulating The oligonucleotides are SEQ ID NOs: 1, 16, 17, 18, 19, 20, 21, 30, and 31. , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 5 8, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, Including 96, 97, 100, 102, 104, 106, 108 or 143.
[0221] Embodiment 69 is the method of any one of embodiments 48 to 68, wherein The immunostimulatory oligonucleotide comprises a first plurality of guanine nucleotides downstream of a second plurality of guanine nucleotides. The amino acid sequence further comprises a plurality of guanine nucleotides of the formula:
[0222] Embodiment 70 is the method of embodiment 69, wherein the immunostimulatory oligonucleotide The nucleotides are SEQ ID NOs: 141, 142, 176, 177, 178, 179, 180, 18 1, 182, 183, 184, 185, 186, 187, 188, 189, 192, 19 3, 194, 195, 196, 197, 198, 199, 200, 201, 202, 20 3, or GCGT-Gwire3.
[0223] Embodiment 71 is the method of embodiment 69 or 70, wherein the first plurality the first plurality of guanine nucleotides, the second plurality of guanine nucleotides, or both , in vitro, in vivo, or both Promotes the formation of quaternary structure.
[0224] Embodiment 72 is the method of embodiment 70 or 71, wherein the first and and a second plurality of guanine nucleotides in a quaternary structure having a G-wire conformation. Promotes the formation of structures.
[0225] Embodiment 73 is the method of any one of embodiments 70 to 72, wherein The first and second plurality of guanine nucleotides are at least are also separated by two nucleotides.
[0226] Embodiment 74 is the method of any one of embodiments 67 to 73, wherein The first plurality of guanine nucleotides and the at least one CpG motif are at least They are separated by three nucleotides.
[0227] Embodiment 75 is the method of any one of embodiments 67 to 73, wherein the The first plurality of guanine nucleotides and the at least one CpG motif are hexaethyl It is separated by ethylene glycol.
[0228] Embodiment 76 is the method of embodiment 75, wherein the hexaethyleneglycol The structure of cole is: TIFF0007760560000034.tif71157 Embodiment 77 is the method of any one of embodiments 48 to 76, wherein The immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, Each CpG motif in the G motif is separated by a spacer.
[0229] Embodiment 78 is the method of embodiment 77, wherein the spacer is at least Both contain one nucleotide or nucleotide derivative.
[0230] Embodiment 79 is the method of embodiment 78, wherein the spacer is a deoxyribonucleotide. It is a xylibose phosphate bridge.
[0231] Embodiment 80 is the method of embodiment 79, wherein the deoxyribose The phosphate bridge is abasic.
[0232] Embodiment 81 is the method of embodiment 78, wherein the spacer is a carbon chain. Includes.
[0233] Embodiment 82 is the method of embodiment 81, wherein the carbon chain is 1,3- It is derived from propanediol.
[0234] Embodiment 83 is the method of embodiment 78, wherein the spacer is a repeating Includes academic credits.
[0235] Embodiment 84 is the method of embodiment 83, wherein the repeating chemical unit is ethyl. It is lent glycol.
[0236] Embodiment 85 is the method of any one of embodiments 48 to 84, wherein The immunomodulatory composition, the immunostimulatory oligonucleotide, or both, comprises at least one Further included are nucleotide analogs of:
[0237] Embodiment 86 is the method of any one of embodiments 48 to 85, wherein the The immunostimulatory oligonucleotides contain a phosphodiester backbone.
[0238] Embodiment 87 is the method of any one of embodiments 48 to 85, wherein The immunostimulatory oligonucleotides contain a phosphorothioate backbone.
[0239] Embodiment 88 is the method of any one of embodiments 48 to 87, wherein The immunostimulatory oligonucleotide further comprises a lipid moiety.
[0240] Embodiment 89 is the method of embodiment 88, wherein the lipid moiety is Enhance the bioavailability of stimulatory oligonucleotides.
[0241] Embodiment 90 is the method of embodiment 88 or 89, wherein the lipid moiety is It's Steril.
[0242] Embodiment 91 is the method of any one of embodiments 88 to 90, wherein The lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide.
[0243] Embodiment 92 includes a CpG sequence element at the 5' end, the 3' end, or both. , a method according to any one of embodiments 48 to 91.
[0244] Embodiment 93 is a method according to embodiment 92, having at least two CpG sequence elements. It is the law.
[0245] Embodiment 94 is the method of embodiment 92 or 93, wherein the CpG sequence Column elements are GCGA, GCGG, ACGC, CCGC, GCGT, or TCGC .
[0246] Embodiment 95 is the method of any one of embodiments 48 to 94, wherein The immunomodulatory composition and the immunostimulatory oligonucleotide are administered simultaneously.
[0247] Embodiment 96 is directed to the immunostimulatory composition of any one of embodiments 1 to 46. A method for eliciting an immune response in a subject comprising administering
[0248] Embodiment 97 is an immunostimulatory composition comprising: Nucleic acid plasmids and liposome delivery vehicles; and An immunostimulatory oligonucleotide comprising SEQ ID NO:1.
[0249] Embodiment 98 is the immunostimulatory composition of embodiment 97, wherein the nucleic acid probe The plasmid has at least 75% sequence identity with SEQ ID NO:265.
[0250] Embodiment 99 is the immunostimulatory composition of embodiment 97, wherein the nucleic acid probe The plasmid has at least 75% sequence identity with SEQ ID NO:266.
[0251] Embodiment 100 is the immunostimulatory composition of embodiment 97, wherein the nucleus The acid plasmid has at least 75% sequence identity to SEQ ID NO:268.
[0252] Embodiment 101 is an immunostimulatory composition according to any one of embodiments 97 to 100. wherein the liposome delivery vehicle is a multilamellar vesicle lipid, an extruded lipid, or the like. Includes both.
[0253] Embodiment 102 is the immunostimulatory composition of embodiment 101, wherein the The transposomal delivery vehicle is cationic.
[0254] Embodiment 103 is the immunostimulatory composition of embodiment 102, wherein the cation The liposomal delivery vehicle is N-[1-(2,3-dioleyloxy)propyl]-N ,N,N-trimethylammonium chloride (DOTMA) and cholesterol;N- [1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylchloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]ethoxy] [2-hydroxyethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOT IM) and cholesterol; and dimethyldioctadecylammonium bromide ( The lipid pair is selected from the group consisting of DMSO (Dihydroxybenzoate), DMSO (Dihydroxybenzoate), and cholesterol.
[0255] Embodiment 104 is an immunostimulatory composition according to any one of embodiments 97 to 103. wherein the immunostimulatory oligonucleotide further comprises a 5' cholesteryl modification. .
[0256] Embodiment 105 is the immunostimulatory composition of embodiment 104, wherein the 5 The cholesteryl modification includes a triethylene glycol linker.
[0257] When introducing elements of the present disclosure or preferred embodiments thereof, the articles "a," "an," " "The" and "said" mean that there is one or more elements. In the figures, the words "comprising," "including," and "having" are used interchangeably. The term "having" is intended to be inclusive and does not include elements other than those listed. It means that there may be additional elements.
[0258] In view of the above, it will be appreciated that the several objects of the disclosure are achieved and other advantageous results attained. You will understand.
[0259] Various modifications may be made to the above described devices and methods without departing from the scope of the present disclosure. Therefore, all matters contained in the above description should be interpreted as illustrative only. It is intended that the terms "commonly used" and "uncommonly used" be used interchangeably and should not be construed in a limiting sense.
Claims
1. 1. An immunostimulatory composition comprising: a) an immunomodulatory composition comprising an immunogenic nucleic acid plasmid and a liposome delivery vehicle; and b) an immunostimulatory oligonucleotide comprising at least one CpG motif and a guanine nucleotide-rich sequence at the 5' end of the immunostimulatory oligonucleotide; Including, where: The guanine nucleotide-rich sequence comprises a first plurality of guanine nucleotides, and optionally, a second plurality of guanine nucleotides downstream of the first plurality of guanine nucleotides, wherein: the immunostimulatory oligonucleotide comprises a lipid moiety; The immunostimulatory composition.
2. The immunostimulatory composition of claim 1 , wherein the immunostimulatory oligonucleotide comprises a ligand for a cytosolic nucleic acid surveillance molecule.
3. 3. The immunostimulatory composition of claim 2, wherein the immunostimulatory oligonucleotide is a ligand for a Toll-like receptor (TLR).
4. The immunostimulatory composition of claim 3, wherein the Toll-like receptor (TLR) is TLR21.
5. The immunostimulatory composition of any one of claims 1 to 4, wherein the concentration of the nucleic acid plasmid in the immunomodulatory composition is greater than the concentration of the immunostimulatory oligonucleotide.
6. The immunostimulatory composition of any one of claims 1 to 5, wherein the composition further comprises a pharmaceutical carrier.
7. 10. The immunostimulatory composition of claim 1, wherein the liposome delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both.
8. The immunostimulatory composition of claim 1 , wherein the liposome delivery vehicle is a cationic liposome delivery vehicle.
9. 9. The immunostimulatory composition of claim 8, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the group consisting of N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.
10. The immunostimulatory composition of claim 1 , wherein the nucleic acid plasmid is non-coding.
11. The immunostimulatory composition of claim 1, wherein the nucleic acid plasmid has at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 265, 266 or 268.
12. 2. The immunostimulatory composition of claim 1, wherein the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least two nucleotides.
13. 13. The immunostimulatory composition of claim 12, wherein the first plurality of guanine nucleotides and the at least one CpG motif are separated by at least three nucleotides.
14. 14. The immunostimulatory composition of claim 12 or 13, wherein the first plurality of guanine nucleotides and the at least one CpG motif are separated by hexaethylene glycol, tetraethylene glycol, propanediol, or derivatives thereof.
15. 15. The immunostimulatory composition of claim 14, wherein the structure of hexaethylene glycol is: 【Chemical 1】
16. The immunostimulatory composition of claim 1, wherein the immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, each CpG motif of the plurality being separated from the other CpG motifs of the plurality by a spacer.
17. The immunostimulatory composition of claim 16, wherein the spacer comprises at least one nucleotide or nucleotide analog.
18. 18. The immunostimulatory composition of claim 17, wherein the spacer comprises a deoxyribose phosphate bridge.
19. 19. The immunostimulatory composition of claim 18, wherein the deoxyribose phosphate bridge is abasic.
20. The immunostimulatory composition of claim 17 , wherein the spacer comprises a carbon chain.
21. 21. The immunostimulatory composition of claim 20, wherein the carbon chain is derived from 1,3-propanediol.
22. The immunostimulatory composition of claim 17 , wherein the spacer comprises a repeating chemical unit.
23. 23. The immunostimulatory composition of claim 22, wherein the repeating chemical unit is ethylene glycol.
24. The immunostimulatory composition of any of claims 1 to 23, wherein the immunostimulatory oligonucleotide further comprises a phosphorothioate backbone.
25. The immunostimulatory composition of claim 1 , wherein the lipid moiety is cholesteryl.
26. 10. The immunostimulatory composition of claim 1, wherein the lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide.
27. 2. The immunostimulatory composition of claim 1, wherein the immunostimulatory oligonucleotide having at least one CpG motif comprises a CpG motif at the 5' end, the 3' end, or both the 5' and 3' ends.
28. 28. The immunostimulatory composition of claim 27, wherein the immunostimulatory oligonucleotide contains a CpG motif at both the 5' and 3' ends.
29. 29. The immunostimulatory composition of claim 27 or 28, wherein the CpG motif is GCGA, GCGG, ACGC, CCGC, GCGT, or TCGC.
30. A method for preparing the immunostimulatory composition of any one of claims 1 to 29, comprising: combining the immunomodulatory composition and the immunostimulatory oligonucleotide to form an immunostimulatory composition; centrifuging the immunostimulatory composition to produce a supernatant and a pellet; and Isolating the pellet The method comprising:
Citation Information
Patent Citations
nucleic acid lipophilic conjugate
JP2007506790A
Enhanced immune response in birds
JP2012526734A
Immunostimulant oligodeoxynucleotides
JP2014507131A
Immunostimulatory plasmid
JP2017512202A
Immunostimulatory nucleic acids
WO2004016805A2