Macrophages use their own calreticulin as a guide to ingest cancer cells

Abstract

SOLUTION: Therapeutic and diagnostic methods are provided, where the methods relate to induction of expression of calreticulin on phagocytic cells. Specifically, the methods relate to macrophage-mediated programmed cell removal (PrCR), the methods comprising either: increasing PrCR by contacting a phagocytic cell with a toll-like receptor (TLR) agonist; or down-regulating PrCR by contacting a phagocytic cell with Bruton's tyrosine kinase (BTK). In some embodiments, an activator of TLR signaling or a BTK agonist is provided in combination with CD47 blockade.SELECTED DRAWING: Figure 1

Description

[Background technology]

[0001] The reticuloendothelial system (RES) is part of the immune system. The RES consists of phagocytes located in the reticular connective tissue, primarily monocytes and macrophages. The RES consists of 1) circulating monocytes, 2) resident macrophages in the liver, spleen, lymph nodes, thymus, submucosa of the respiratory and gastrointestinal tract, bone marrow, and connective tissue, and 3) macrophage-like cells, including dendritic cells in lymph nodes, Langerhans cells in the skin, and microglia in the central nervous system.

[0002] These cells accumulate in the lymph nodes and spleen. The RES functions to eliminate pathogens, circulating particulate matter, and senescent or damaged hematopoietic cells.

[0003] To remove foreign cells or particles in the innate immune response, macrophage-mediated phagocytosis is triggered when phosphatidylserine receptors (PSRs) react with phosphatidylserine (PS), which can then be externalized from the membranes of dead cells, such as apoptotic and necrotic cells. The interaction between PS and PSR then plays a key role in the clearance of apoptotic cells by macrophages. Once phagocytosis is carried out by macrophages, the inflammatory response is reduced by an increase in factors such as IL-10, TGF-β, and prostaglandin E2 (PGE2). The strict balance between pro- and anti-inflammatory responses in both innate and adaptive immunity plays a crucial role in maintaining cellular homeostasis and protecting the host from foreign invasion.

[0004] The causal relationship between inflammation and tumor progression is a widely accepted concept. Data currently support the concept of cancer immunosurveillance—one of the physiological functions of the immune system is to recognize and destroy transformed cells. However, some tumor cells can escape recognition and destruction by the immune system. Once tumor cells escape, the immune system can participate in their growth, for example, by promoting tumor angiogenesis.

[0005] Both adaptive and innate immune cells are involved in the surveillance and elimination of tumor cells, but monocytes / macrophages may be the first line of defense for tumors because they rapidly colonize and secrete cytokines that attract and activate dendritic cells (DCs) and natural killer (NK) cells, which in turn can mount adaptive immune responses against transformed cells.

[0006] Malignant cell transformation occurs through the progression of genetic mutations and epigenetic reprogramming that activates oncogenes and inactivates tumor suppressor pathways, leading to the inheritance of several characteristics shared by most cancer cells, including self-sufficiency in growth signals, insensitivity to anti-growth signals, tissue invasion and metastasis, poorly regulated replicative capacity, sustained angiogenesis, and evasion of cell death by various pathways, including apoptosis. In addition to these intrinsic cell properties, recent evidence suggests that many cancers are also able to evade the immune system by several different mechanisms.

[0007] Studying the mechanisms by which cells avoid phagocytic elimination can provide clues to methods for improving the success of hematopoietic and progenitor stem cell transplants, as well as improved methods for removing cancer cells from the body. The present invention fulfills these and other needs. Summary of the Invention

[0008] Therapeutic and diagnostic methods are provided, which relate to macrophage-mediated programmed cell elimination (PrCR). It is shown herein that phagocytes, e.g., macrophages, respond to TLR signaling by upregulating calreticulin (CRT) expression on the phagocyte surface. CRT on the phagocyte surface interacts with target cells, e.g., cancer cells, to initiate PrCR. Upregulation of CRT by phagocytes has been shown to involve the Bruton's tyrosine kinase (Btk) signaling pathway, and inhibition of Btk downregulates calreticulin on the phagocyte surface, thereby reducing PrCR. The methods of the present invention can increase PrCR by contacting phagocytes with a TLR agonist or downregulate PrCR by contacting phagocytes with a BTK inhibitor. Contacting can be performed ex vivo, e.g., to stimulate phagocytes for therapeutic purposes, or in vivo for therapeutic purposes. Expression of CRT on the phagocyte surface provides a biomarker for determining the phagocytic capacity of cells.

[0009] In one embodiment of the present invention, a TLR signaling activator or a BTK agonist is provided in combination with CD47 blockade, and PrCr is increased compared to cell ablation in the presence of either agent as monotherapy. In some embodiments, a cell population comprising macrophages is contacted in vitro or ex vivo with a dose of a TLR agonist or a BTK agonist effective to increase CRT on the cell surface of macrophages by at least about 25%, at least about 50%, or at least about 75%, and may increase expression by two-fold, three-fold, five-fold, or more compared to unstimulated cells. The level of phagocytosis of cells treated in this manner may be at least about 25%, at least about 50%, or at least about 75%, and may increase phagocytosis by two-fold, three-fold, five-fold, or more compared to unstimulated cells. In the presence of an agent that blocks the interaction of CD47 with SIRPα, the incremental increase in phagocytosis of cells treated with an effective amount of a TLR agonist or BTK agonist can be at least about 25%, at least about 50%, at least about 75%, and can increase phagocytosis by 2-fold, 3-fold, 5-fold, or more compared to cells treated with a TLR agonist in the absence of CD47 blockade. In some embodiments, the CD47 is an antibody. In some embodiments, the antibody is hu5F9-G4.

[0010] For in vivo treatment, a TLR agonist or BTK agonist can be administered in an effective amount and for a period of time sufficient to increase PrCr in the recipient, e.g., as determined by phagocytosis of tumor cells by phagocytes. The TLR agonist or BTK agonist can be co-administered or simultaneously administered with an effective amount of an agent that blocks the interaction between CD47 and SIPα. The TLR agonist or BTK agonist can be co-administered or simultaneously administered with an agent that specifically targets cancer cells, e.g., an antibody directed against a tumor-selective target.

[0011] Phagocytic cells treated ex vivo with a TLR agonist or a BTK agonist can be administered to an individual for cancer treatment, with the cells administered systemically or locally, for example, to the tumor site. The cells can be co-administered with or simultaneously administered with an effective amount of an agent that blocks the interaction between CD47 and SIPα. The cells can be contacted with tumor cells or tumor cell antigens ex vivo prior to administration. The cells can be co-administered with or simultaneously administered with an agent that specifically targets cancer cells, such as an antibody directed against a tumor-selective target.

[0012] The phagocytic ability of phagocytes, e.g., macrophages, can be determined by measuring the expression of CRT on the cell surface, with an increase in CRT corresponding to an increase in phagocytic ability. In some embodiments, calreticulin expression on the macrophage cell surface is measured by, but not limited to, contacting the cells with a CRT-specific antibody and measuring the amount of bound antibody, for example, by flow cytometry, ELISA, immunohistochemistry, etc., as known in the art. In some such embodiments, the measuring step is performed after treating the cells with a TLR agonist ex vivo. In some embodiments, the measurement is compared to a default level or control cells not treated with a TLR agonist. In some embodiments, cells with a default level of CRT are administered to an individual for cancer treatment, where the cells are administered systemically or locally, e.g., to a tumor site.

[0013] In another embodiment of the invention, a BTK inhibitor, including but not limited to ibrutinib, an anti-BTK antibody, or the like, is provided in a therapeutic dose to an individual suffering from excessive or unwanted PrCR, including, but not limited to, myelodysplastic syndrome (MDS), autoimmune hemolytic anemia, immune thrombocytopenic purpura (ITP), autoimmune diseases including rheumatoid arthritis, systemic lupus erythematosus, and the like. The administered amount of the BTK inhibitor is sufficient to reduce CRT expression on phagocytes, e.g., by at least about 25%, at least about 50%, or at least about 75%, resulting in a two-fold, three-fold, five-fold, or greater reduction in expression compared to unstimulated cells. The level of phagocytosis of cells treated in this manner can be reduced by at least about 25%, at least about 50%, or at least about 75%, resulting in a two-fold, three-fold, five-fold, or greater reduction in phagocytosis compared to unstimulated cells. [Brief explanation of the drawings]

[0014] [Figure 1]Activation of TLR signaling leads to enhanced PrCR of live cancer cells. (A) Left: Schematic diagram showing PrCR of live tumor cells by macrophages. Blockade of CD47 leads to an imbalance of the "eat me" on the "don't eat me" pathway, which triggers tumor cell phagocytosis, either Fc-dependent (triggered by Fc-FcR interactions) or Fc-independent (shown in red, representing non-Fc cancer-specific "eat me" signals). Right: Phagocytosis assay showing CD47 blockade induced phagocytosis with SW620 cells (control IgG-treated, anti-CD47 antibody (B6H12)-treated, or CD47KO) as target cells and BMDM from RAG2- / -, γc- / - mice. Fc receptor blocker (FcRB) reversed phagocytosis of B6H12-treated cells to the same level as CD47KO cells. **P<0.01, t-test. (B) Phagocytosis assay showing screening of TLR agonists using SW620 cells (PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated, or CD47KO) and BMDM from BALB / c mice as target cells. The TLR agonists used in the screening were Pam3CSK4 (Pam, TLR1 / 2), heat-killed Listeria monocytogenes (HKLM, TLR2), poly(I:C) HMW (poly(I:C), TLR3), lipopolysaccharide (LPS, TLR4), flagellin from Salmonella typhimurium (FLA-ST, TLR5), Pam2CGDPKHPKSF (FSL-1, TLR6 / 2), imiquimod (Imi, TLR7), and class B CpG oligonucleotide (ODN1826, TLR9). The dashed lines indicate two-fold phagocytosis in the control macrophage group compared to each condition (PBS treatment, anti-CD47 antibody (Hu5F9-G4) treatment, or CD47KO). Error bars represent standard deviation (A and B). [Figure 2]Btk is a key signaling molecule that regulates PrCR in cancer cells. (A) Phagocytosis assay showing the combined screening of TLR agonists and various inhibitors targeting downstream signaling molecules using SW620 cells (control or CD47KO) and BMDM from RAG2- / -, γc- / - mice as target cells. The inhibitors used in the screening were PD98059 (PD, MEK inhibitor), LY294002 (LY, PI3K inhibitor), ibrutinib (Ibr, Btk inhibitor), and YVAD (YVAD, caspase-1 inhibitor). **P<0.01 (t-test, comparison between samples from the control or CD47KO group, Imi-control vs. other conditions). (B) Immunoblot showing Btk phosphorylation induced by TLR agonists (poly(I:C) HMW, LPS, imiquimod). When cells were simultaneously treated with TLR agonists and ibrutinib, the induction of Btk phosphorylation was attenuated. Total Btk showed no change. (C) and (D) Time-dependent effects of a Btk activator (imiquimod) (C) and inhibitor (ibrutinib) (D) on phagocytosis by BMDM from SW620 CD47KO and NSG mice as target cells. Error bars represent standard deviation (A, C, and D). [Figure 3]Btk regulates the cell surface exposure of CRT on macrophages to regulate PrCR in cancer cells. (A) CRT expression on macrophages was examined by cell surface biotinylation assay. Immunoblotting showed that cell surface CRT increased in response to Btk activation and decreased in response to Btk inhibition. Imi: imiquimod, Ibr: ibrutinib. (B) Increased cell surface exposure of CRT on macrophages induced by TLR agonists (poly(I:C) HMW, LPS, imiquimod) was examined by flow cytometry analysis. Dashed lines indicate the normalized phagocytic index for each condition (PBS treatment, anti-CD47 antibody (Hu5F9-G4) treatment, or CD47KO) in the control macrophage group. (D) Overexpression of CRT in J774 cells promoted phagocytosis. CRT expression was examined by immunoblotting. SW620 cells (control IgG- or anti-CD47 antibody (B6H12)-treated) were used as target cells. *P<0.05, **P<0.01 (t-test). Error bars represent standard deviation (C and D). [Figure 4]CRT is a key effector on macrophages in mediating PrCR of cancer cells. (A) Phagocytosis assays showing the effect of blocking CRT on macrophages or cancer cells. (Left) Schematic diagram showing the experimental design. Macrophages, target cells, or both were pretreated with CRT antibody and then subjected to phagocytosis assays. (Right) Phagocytosis assays showing that macrophage CRT is required for the phagocytosis of cancer cells by SW620 cells (control or CD47KO) and BMDM from RAG2- / -, γc- / - mice as target cells. (B) Macrophage phagocytic ability according to differential surface CRT expression levels. The definitions of the CRTLow, CRTMedium, and CRTHigh populations are described in Figures S8A-8B. (C) Normalized tumor cell phagocytosis (Y-axis) was plotted against normalized cell surface CRT expression (Log2, X-axis) on macrophages with SW620 cells (CD47KO) as target cells and BMDMs from RAG2- / -, γc- / -, or NSG mice. □: BMDMs from NSG mice treated with imiquimod for 0, 1, 6, 16, or 24 hours; △: BMDMs from RAG2- / -, γc- / - mice (CRTLow, CRTMedium, CRTHigh, and mixed populations); ○: BMDMs from NSG mice (CRTLow, CRTMedium, CRTHigh, and mixed populations). Error bars represent standard deviation (A and B). [Figure 5] TALEN-mediated CD47 knockout in SW620 cells. (A) and (B) Flow cytometry analysis of cell surface CD47 in SW620WT and SW620CD47KO cells. Cells were stained with phycoerythrin (PE)-conjugated anti-CD47 antibody (B6H12) or a PE-conjugated isotype control. Flow cytometry analysis is shown as a histogram (A) or contour plot (S). [Figure 6]Screening of TLR signaling for tumor cell PRCR by TLR agonists. (A) and (B) Phagocytosis assays showing treatment of macrophages with TLR agonists (poly(I:C) HMW, LPS, imiquimod) promoted tumor cell phagocytosis by SW620 cells (PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated, or CD47KO) as target cells and BMDM from RAG2- / -, γc- / - mice (A) or NSG mice (B). Dashed lines indicate twice the phagocytosis of control macrophage groups compared with each condition (SW620 + PBS, SW620 + Hu5F9-G4, or SW620CD47KO + PBS). (C) Representative flow cytometry images showing TLR agonists enhancing phagocytosis. Phagocytosis assay showing TLR agonists enhance phagocytosis of cancer cells by SW620 cells (PBS- or Hu5F9-G4-treated) as target cells and BMDM from NSG mice. Phagocytosis was examined by flow cytometry analysis. Macrophages were stained with PEcy7-conjugated anti-F4 / 80 antibody, and SW620 cells were labeled with GFP. Cells in the square in the upper right corner are F4 / 80+GFP+ cells and represent macrophages phagocytosing cancer cells. Treatment of macrophages with LPS significantly enhanced their phagocytic ability. Error bars represent standard deviation (A and B). [Figure 7] Phagocytosis of HL60, Raji, PC-3, and MDA-MB-231 cells is enhanced by TLR agonists. Phagocytosis assays show that TLR agonists enhanced phagocytosis of multiple human cancer cells by different hematopoietic (HL60 and Raji) and solid tumor (PC3 and MDA-MB-231) cells (PBS- or Hu5F9-G4-treated) as target cells and BMDM from NSG (HL60, Raji, and PC3) or RAG2- / -, γc- / - (MDA-MB-231) mice. HL60: promyelocytic leukemia; Raji: Burkitt lymphoma; PC3: prostate cancer; MDA-MB-231: breast cancer. Error bars represent standard deviation (A–D). [Figure 8]TLR agonists improve the efficacy of CD47-blocking antibodies to inhibit tumor growth in vivo. (A) Tumor growth was monitored by bioluminescence imaging. PC3 prostate cancer cells were implanted into NSG mice. Mice were treated with PBS, Hu5F9-G4, or Hu5F9-G4 + TLR agonist (poly(I:C) HMW + LPS) (n = 5 per group; one mouse in the PBS control group died at week 8 due to tumor progression). TLR agonists significantly enhanced the efficacy of Hu5F9-G4 to inhibit tumor growth. (B) Analysis of tumor specimens by flow cytometry. Tumor specimens from each group in the experiment described in (A) were collected and dissociated to obtain single-cell suspensions. Cells were analyzed by flow cytometry. Endothelial cells (CD31) and neutrophils (Gr-1) were excluded using anti-CD31 and anti-Gr-1 antibodies. Macrophages were labeled with anti-F4 / 80 antibody. a4 (GFP+F4 / 80-) represents tumor cells, a1 (GFP-F4 / 80+) represents macrophages, and a2 (GFP+F4 / 80+) represents macrophages that had phagocytosed tumor cells. Fewer tumor cells were observed in the Hu5F9-G4 group (40%) compared with the PBS group (56%), while tumor cells almost disappeared in the Hu5F9-G4 + TLR agonist group (1.06%). The Hu5F9-G4 group showed ongoing phagocytosis (a2) (39.3% vs. 2.18% in the PBS group), while the Hu5F9-G4 + TLR agonist group showed nearly complete tumor cell phagocytosis (94.7% by macrophages (a1 + a2) vs. 46.26% in the Hu5F9-G4 group and 23.8% in the PBS group). These results suggested that Hu5F9-G4 enhances the efficacy of Hu5F9-G4 in inducing PrCR of tumor cells in vivo. [Figure 9]Expression of Btk in the hematopoietic system. A schematic diagram showing Btk expression in the hematopoietic system, generated by Gene Expression Commons (5), is shown. Gene expression activity is labeled blue (low) or red (high). Btk is represented in all columns except for T cells and NK cells. HSC: hematopoietic stem cell; MPP: multipotent progenitor; GMLP: granulocyte / macrophage / lymphoid progenitor; pMEP / MEP: pro / megacytic erythroid progenitor; CMP: common myeloid progenitor; CLP: common lymphoid progenitor; Plt: platelet; Ery: erythrocyte; pGMP / GMP: pro / granulocyte-macrophage progenitor; MkP: megacytic-committed progenitor; pCFU-E: pro-CFU-E; Gra: granulocyte; Mono: monocyte; BLP: B lymphoid progenitor; iNK / mNK: intermediate / mature natural killer; BM: bone marrow; Spl: spleen. [Figure 10]Btk mediates PrCR by regulating cell surface exposure of CRT on macrophages. (A) Inhibition of basal levels of PrCR (resting macrophages) by Btk antagonism. Phagocytosis assay showing that Btk blockade inhibits tumor cell phagocytosis by resting macrophages (not stimulated by TLR signaling) using SW620 cells (control IgG-treated, anti-CD47 antibody (B6H12)-treated, or CD47KO) as target cells and BMDM from RAG2- / -, γc- / - mice. Macrophages and target cancer cells were co-cultured with or without the Btk blocker ibrutinib under the indicated conditions for 16 hours. Cells were examined by flow cytometry analysis. Remaining target cells were used to assess the efficacy of phagocytosis, with fewer remaining target cells representing more potent phagocytosis. Both Fc-dependent and Fc-independent phagocytosis induced by CD47 blockade (anti-CD47 antibody or CD47KO) were largely reversed by Btk antagonism. (B) Cell surface expression of CRT was examined by flow cytometry analysis. Macrophages (control, imiquimod, or imiquimod + ibrutinib) were analyzed with anti-CRT antibody. Imiquimod increased cell surface expression of CRT on macrophages, and this effect was reversed by ibrutinib. (C) Dose-response curves of CRT antagonism by CRT antibody or rabbit IgG (control) in blocking phagocytosis. Phagocytosis assays were performed using SW620 CD47KO cells as target cells and BMDMs from RAG2- / -, γc- / - mice. (D) Phagocytosis assay showing that CRT antibody or ibrutinib inhibits phagocytosis of cancer cells by SW620 cells (treated with control IgG or anti-CD47 antibody (B6H12)) and human PBMC-derived macrophages as target cells. **P<0.01 (t-test). (E) Phosphorylation of CRT by Btk. Immunoblot showing CRT phosphorylation in response to Btk activation. Myc-tagged CRT was expressed in J774 cells and immunoprecipitated with anti-myc antibody after imiquimod treatment. Phosphorylated CRT was detected with anti-phosphotyrosine antibody. Error bars represent standard deviation (A, C, and D). [Figure 11] Induction of cell surface CRT by Btk activation is specific to macrophages. (A) Immunoblot of Btk expression in macrophages and cancer cells. Btk was expressed in macrophages, but not in solid tumor cells. 620: SW620, 231: MDA-MB-231. (B-D) Cell surface expression of CRT with or without Btk activation in macrophages (B), colon cancer (SW620, C), and breast cancer (MDA-MB-231, D) cells examined by flow cytometry. Imi: Imiquimod. [Figure 12] Surface CRT expression on macrophages correlates with their phagocytic ability. (A) and (B) Macrophage subpopulations with differential cell surface CRT expression. FACS plots showing CRT expression on BMDM from RAG2- / -, γc- / - (A), or NSG (B) mice under control conditions or imiquimod treatment. CRTLow, CRTMedium, and CRTHigh populations were defined and labeled as regions a, b, and c. The phagocytic ability of different groups of untreated macrophages (volume—total population; CRTLow—cells in region a; CRTMedium—cells in region b; CRTHigh—cells in region c) is shown in Figure 4B. (C) The time effect of imiquimod (0, 1, 6, 16, and 24 hours of treatment) on cell surface expression of CRT on BMDM from NSG mice, examined with an anti-CRT antibody by flow cytometry analysis. (D) Mean fluorescence intensity values ​​of CRT at different time points after imiquimod treatment were normalized to 0 hr and log transformed (Log2). [Figure 13] Cell surface expression of CRT on M1 and M2 human macrophages. (A) and (B) Differentiation of M1 (A) and M2 (B) macrophages was examined with specific markers (CD80 for M1 and CD163 for M2). (C) and (D) FACS plots showing cell surface expression of CRT on M1 and M2 human macrophages. DETAILED DESCRIPTION OF THE INVENTION

[0015] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0016] When a range of values ​​is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, unless the context clearly dictates otherwise, as well as any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may each independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded value in the stated range. When the stated range includes one or both of those upper and lower limits, ranges excluding either or both of those included limits are also encompassed within the invention.

[0017] Methods recited herein may be carried out in any order of the recited events which is logically possible, as well as the recited order of events.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used to practice or test the present invention, the preferred methods and materials are described below.

[0019] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0020] It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless expressly stated otherwise. It is further noted that the claims may be drafted to exclude any element. Accordingly, this statement is intended to serve as a predicate for use of the exclusive terminology "solely" or "only" in connection with the recitation of claim elements or for use of a "negative" limitation.

[0021] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0022] definition Calreticulin is a multifunctional protein of 417 amino acids with a molecular weight of 48 kDa. 2+ It binds with ions and loses activity. 2+ It binds with low affinity but high capacity and can be released upon signaling. Calreticulin can be located in endoplasmic reticulum-associated storage compartments, where it binds to misfolded proteins and prevents their export to the Golgi apparatus. Calreticulin is also present in the nucleus, suggesting that it may have a role in transcriptional regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is nearly identical in amino acid sequence to the DNA-binding domain of the nuclear receptor superfamily. The gene name for calreticulin is CALR, and the human sequence is accessible on PubMed under protein accession number NP_004334 and nucleotide accession number NM_004343.

[0023] Anti-CD47 Agents. As used herein, the term "anti-CD47 agent" refers to any agent that reduces the binding of CD47 (e.g., on target cells) to SIRPα (e.g., phagocytes). Non-limiting examples of suitable anti-CD47 reagents include high-affinity SIRPα polypeptides, anti-SIRPα antibodies, soluble CD47 polypeptides, and SIRPα reagents, including, but not limited to, anti-CD47 antibodies, antibody fragments, peptides, small molecules, peptidomimetics, and the like. In some embodiments, suitable anti-CD47 agents (e.g., anti-CD47 antibodies, SIRPα reagents, etc.) specifically bind to CD47 to reduce binding of CD47 to SIRPα. In some embodiments, suitable anti-CD47 agents (e.g., anti-SIRPα antibodies, soluble CD47 polypeptides, etc.) specifically bind to SIRPα to reduce binding of CD47 to SIRPα. Suitable anti-CD47 agents that bind to SIRPα do not activate SIRPα (e.g., in phagocytes that express SIRPα).

[0024] The effectiveness of a suitable anti-CD47 agent can be assessed by assaying the agent. In a typical assay, target cells are cultured in the presence or absence of a candidate agent. Agents used in the present invention upregulate phagocytosis and subsequent T cell activation by at least 10% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 120%, at least 140%, at least 160%, at least 180%, or at least 200%) compared to the absence of the agent. Similarly, an in vitro assay of the level of tyrosine phosphorylation of SIRPα shows a decrease in phosphorylation by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%) compared to phosphorylation observed in the absence of the candidate agent.

[0025] In some embodiments, the anti-CD47 agent does not activate CD47 upon binding. When CD47 is activated, a process similar to apoptosis (i.e., programmed cell death) can occur (Manna and Frazier (2004) Cancer Research 64:1026-1036). Thus, in some embodiments, the anti-CD47 agent does not directly induce cell death in CD47-expressing cells.

[0026] SIRPα Reagents. SIRPα reagents typically contain a portion of SIRPα located between the signal sequence and the transmembrane domain sufficient to bind CD47 with appreciable affinity, or a fragment thereof that retains binding activity. Suitable SIRPα reagents reduce (e.g., block, prevent, etc.) the interaction between the native protein SIRPα and CD47. SIRPα reagents typically contain at least the d1 domain of SIRPα. In some embodiments, the SIRPα reagent is a fusion protein, e.g., fused in-frame with a second polypeptide. In some embodiments, the second polypeptide can increase the size of the fusion protein, e.g., so that the fusion protein is not rapidly cleared from the circulation. In some embodiments, the second polypeptide is part or all of an immunoglobulin Fc region. The Fc region aids in phagocytosis by providing an "eat me" signal, enhancing the blocking of the "don't eat me" signal provided by high-affinity SIRPα reagents. In other embodiments, the second polypeptide is any suitable polypeptide that is substantially similar to Fc, e.g., provides increased size, a multimerization domain, and / or additional binding or interaction with an Ig molecule.

[0027] In some embodiments, the subject anti-CD47 agents are "high-affinity SIRPα reagents" that induce SIRPα-derived polypeptides and analogs thereof. High-affinity SIRPα reagents are described in International Application No. PCT / US13 / 21937, which is specifically incorporated herein by reference. High-affinity SIRPα reagents are variants of naturally occurring SIRPα proteins. In some embodiments, the high-affinity SIRPα reagents are soluble, the polypeptides lack the SIRPα transmembrane domain, and contain at least one amino acid change compared to the sequence of wild-type SIRPα, where the amino acid change increases the affinity of the SIRPα polypeptide to bind to CD47 by, for example, decreasing the off-rate by at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 500-fold, or more.

[0028] High-affinity SIRPα reagents typically contain a sufficient portion of SIRPα located between the signal sequence and the transmembrane domain to bind CD47 with appreciable affinity, e.g., high affinity, or a fragment thereof that retains binding activity. High-affinity SIRPα reagents typically contain at least the d1 domain of SIRPα with modified amino acid residues to increase affinity. In some embodiments, the SIRPα variants of the present invention are fusion proteins, e.g., fused in-frame with a second polypeptide. In some embodiments, the second polypeptide can increase the size of the fusion protein, e.g., so that the fusion protein is not rapidly cleared from the circulation. In some embodiments, the second polypeptide is a portion or the entire Fc region of an immunoglobulin. The Fc region aids in phagocytosis by providing an "eat me" signal, enhancing the blocking of the "don't eat me" signal provided by high-affinity SIRPα reagents. In other embodiments, the second polypeptide is any suitable polypeptide that is substantially similar to an Fc, e.g., providing increased size, a multimerization domain, and / or additional binding or interaction with Ig molecules. The amino acid changes that provide increased affinity are localized to the d1 domain, and thus high-affinity SIRPα reagents comprise the d1 domain of human SIRPα having at least one amino acid change relative to the wild-type sequence in the d1 domain. Such high-affinity SIRPα reagents optionally include additional amino acid sequences, such as an antibody Fc sequence; a portion of the wild-type human SIRPα protein other than the d1 domain, including, but not limited to, residues 150-374 of the native protein or fragment thereof, typically adjacent to the d1 domain. High-affinity SIRPα reagents can be monomeric or multimeric, i.e., dimeric, trimeric, tetrameric, etc.

[0029] Anti-CD47 Antibodies. In some embodiments, the subject anti-CD47 agents are antibodies that specifically bind to CD47 (i.e., anti-CD47 antibodies) and reduce the interaction between CD47 on one cell (e.g., an infected cell) and SIRPα on another cell (e.g., a phagocyte). In some embodiments, suitable anti-CD47 antibodies do not activate CD47 upon binding. Non-limiting examples of suitable antibodies include clones B6H12, 5F9, 8B6, and C3 (e.g., as described in International Patent Publication No. WO 2011 / 143624, specifically incorporated herein by reference). Suitable anti-CD47 antibodies include fully human antibodies, humanized antibodies, or chimeric versions of such antibodies. Humanized antibodies (e.g., hu5F9-G4) are particularly useful for in vivo applications in humans due to their low antigenicity. Similarly, caninized, feline, and other antibodies are particularly useful for applications in dogs and cats, as well as in other species. Antibodies of interest include humanized antibodies, canine antibodies, feline antibodies, equine antibodies, bovine antibodies, porcine antibodies, and variants thereof.

[0030] Anti-SIRPα antibodies. In some embodiments, the subject anti-CD47 agent is an antibody that specifically binds to SIRPα (i.e., an anti-SIRPα antibody) and reduces the interaction between CD47 on one cell and SIRPα on another cell. A suitable anti-SIRPα antibody can bind to SIRPα without activating or stimulating SIRPα signaling, since activation of SIRPα inhibits phagocytosis. Alternatively, a suitable anti-SIRPα antibody promotes phagocytosis of target cells. Thus, a suitable anti-SIRPα antibody specifically binds to SIRPα (without sufficiently activating / stimulating the signaling response to inhibit phagocytosis) and blocks the interaction between SIRPα and CD47. Suitable anti-SIRPα antibodies include fully human antibodies, humanized antibodies, or chimeric versions of such antibodies. Similarly, caninized, feline, and other antibodies are particularly useful for canine and feline applications, as well as for other species, respectively. Antibodies of interest include humanized antibodies, or caninized, feline, equine, bovine, porcine, and other antibodies, and variants thereof.

[0031] Soluble CD47 polypeptides. In some embodiments, the subject anti-CD47 agents are soluble CD47 polypeptides that specifically bind to SIRPα and reduce the interaction between CD47 on one cell and SIRPα on another cell. Suitable soluble CD47 polypeptides can bind to SIRPα without activating or stimulating signaling by SIRPα. Suitable soluble CD47 polypeptides promote phagocytosis of target cells. Thus, suitable soluble CD47 polypeptides specifically bind to SIRPα without sufficiently activating / stimulating a signaling response to inhibit phagocytosis.

[0032] In some cases, a suitable soluble CD47 polypeptide may be a fusion protein (e.g., as structurally described in U.S. Patent Publication No. 2010 / 0239579, specifically incorporated herein by reference). However, only fusion proteins that do not activate / stimulate SIRPα are suitable for the methods disclosed herein. Suitable soluble CD47 polypeptides also include any peptide or peptide fragment containing a mutant or naturally occurring CD47 sequence (e.g., an extracellular domain sequence or extracellular domain mutant) that can specifically bind to SIRPα and inhibit the interaction between CD47 and SIRPα without stimulating the activity of SIRPα sufficient to inhibit phagocytosis.

[0033] In certain embodiments, soluble CD47 polypeptides comprise the extracellular domain of CD47 containing a signal peptide (SEQ ID NO: 2), such that the extracellular portion of CD47 is typically 142 amino acids in length and has the amino acid sequence set forth in SEQ ID NO: 3. Soluble CD47 polypeptides described herein further include CD47 extracellular domain variants that comprise at least 65%-75%, 75%-80%, 80%-85%, 85%-90%, or 95%-99% (or any percentage between 65%-100% not specifically recited) of the amino acid sequence and that maintain the ability to bind to SIRPα without stimulating SIRPα signaling.

[0034] In certain embodiments, the amino acid sequence of the signal peptide can be replaced with the amino acid sequence of a signal peptide from another polypeptide (e.g., an immunoglobulin or CTLA4). For example, unlike full-length CD47, which is a cell surface polypeptide that crosses the outer cell membrane, soluble CD47 polypeptides are secreted. Thus, a polynucleotide encoding a soluble CD47 polypeptide can include a nucleotide sequence encoding a signal peptide normally associated with a polypeptide secreted from a cell.

[0035] In another embodiment, the soluble CD47 polypeptide comprises the extracellular domain of CD47 lacking the signal peptide. In an exemplary embodiment, the CD47 extracellular domain lacking the signal peptide has the amino acid sequence set forth in SEQ ID NO: 1 (124 amino acids). As described herein, the signal peptide is not exposed on the cell surface of secreted or transmembrane proteins because either the signal peptide is cleaved during protein translocation or the signal peptide remains anchored to the outer cell membrane (such peptides are also referred to as signal anchors). The signal peptide sequence of CD47 is believed to be cleaved in vivo from the precursor CD47 polypeptide.

[0036] In other embodiments, the soluble CD47 polypeptide comprises a CD47 extracellular domain variant. Such a soluble CD47 polypeptide maintains the ability to bind to SIRPα without stimulating SIRPα signaling. The CD47 extracellular domain variant may have an amino acid sequence that is at least 65%-75%, 75%-80%, 80-85%, 85%-90%, or 95%-99% identical to SEQ ID NO: 1 (including any percent identity between any one of the recited ranges).

[0037] Innate Immunity. The innate immune system is a primitive cellular response that provides cellular defense against pathogen antigens. Recognition of these antigens by the innate immune system can result in an inflammatory response characterized by the production of cytokines such as TNF, IL-1, IL-6, and IL-8, and gene activation of ICAM-1 and E-selectin, among others.

[0038] A wide variety of pathogens, including viruses, bacteria, and fungi, can constitutively express a set of specific mutation-resistant molecules called pathogen-associated molecular patterns (PAMPs). These microbial molecular markers can consist of proteins, carbohydrates, lipids, nucleic acids, and / or combinations thereof and can be located internally or externally. Examples include endotoxins such as lipopolysaccharides (LPS), single-stranded or double-stranded RNA, etc.

[0039] Typically, PAMP receptors (PRRs) are non-clonal, i.e., expressed in all cells of a given type and are not germline-encoded or dependent on immunological memory. Once bound, PRRs tend to cluster and recruit other extracellular and intracellular proteins into the complex, initiating signaling cascades that ultimately affect transcription. Furthermore, PRRs are involved in complement activation, coagulation, phagocytosis, inflammation, and apoptosis in response to pathogen detection. There are several types of PRRs, including complement, glucan, mannose, scavenger, and toll-like receptors, each with specific PAMP ligands, expression patterns, signaling pathways, and anti-pathogen responses.

[0040] Toll-like receptors are type I transmembrane (TM) PRRs that contain a variable number of extracellular N-terminal leucine-rich repeat (LRR) motifs, followed by a cysteine-rich region, a TM domain, and an intracellular Toll / IL-1R (TIR) ​​motif. The LRR domain is important for ligand binding and associated signal transduction and is a common feature of PRRs. The TIR domain is important in protein-protein interactions and is typically associated with innate immunity. The TIR domain further connects the larger IL-1R / TLR superfamily, which consists of three subgroups. The human TLR family consists of at least 10 members, TLR1-10. Each TLR is unique in its expression pattern and PAMP sensitivity.

[0041] Toll-like receptor 3 (TLR3) recognizes double-stranded RNA (dsRNA) and its mimics, molecular patterns associated with viral infection. It is located on chromosome 4q35, and its sequence encodes a putative 904-aa protein with 24 N-terminal LRRs and a calculated molecular mass of 97 kDa. TLR3 is most closely related to TLR5, TLR7, and TLR8, each with 26% overall aa sequence identity. TLR3 mRNA increases after exposure to Gram-negative bacteria and to a greater extent in response to Gram-positive bacteria.

[0042] TLR3 specifically recognizes double-stranded RNA (dsRNA) and triggers multiple intracellular events that contribute to innate antiviral immunity against many viral infections. The predicted 904-amino acid TLR3 protein contains a characteristic Toll motif, an extracellular leucine-rich repeat (LRR) domain, and a cytoplasmic interleukin-1 receptor-like region.

[0043] Exposure to double-stranded RNA (dsRNA) or polyinosinic-polycytidylic acid (poly(I:C)), a synthetic dsRNA analog, induces the production of interferon-α and -β and activates NFκB via signaling through TLR3. IRF3 is specifically induced by stimulation of TLR3 or TLR4, which mediates specific gene programs responsible for the innate antiviral response. TRIF is required for TLR3-dependent activation of NFκB. It functions as an adaptor protein that connects RIP1 and TLR3 to mediate TLR3-induced NFκB activation.

[0044] Toll-like receptor 4 is a protein encoded by the TLR4 gene in humans. It detects lipopolysaccharides from Gram-negative bacteria and is therefore important in activating the innate immune system. This receptor is most abundantly expressed in the placenta and in a subpopulation of myelomonocytic leukocytes. The human TLR4 gene is accessible in Genbank under NM_003266.3, and the protein is accessible in Genbank under NP_003257.1.

[0045] Activation of TLR4 leads to the downstream release of inflammatory regulators, including TNF-α and interleukin-1. Agonists include morphine, oxycodone, fentanyl, methadone, lipopolysaccharide (LPS), carbamazepine, oxcarbazepine, and others.

[0046] TLR agonists. TLR agonists activate TLRs, including, but not limited to, TLR3, TLR4, and RIG1. Examples of TLR agonists include pathogen-associated molecular patterns (PAMPs) and their mimetics. These microbial molecular markers can consist of proteins, carbohydrates, lipids, nucleic acids, and / or combinations thereof, and can be located internally or externally, as is well known in the art. Examples include LPS, zymosan, peptidoglycan, flagellin, synthetic TLR2 agonists Pam3cys, Pam3CSK4, MALP-2, imiquimod, CpG ODN, etc.

[0047] TLR3 agonists include double-stranded RNA, poly(I:C), poly(AU), etc., and such nucleic acids typically have a size of at least about 10 bp, at least about 20 bp, or at least about 50 bp, and can have a high molecular weight of about 1 to about 20 kb, usually about 50 to 100 kb. Alternative TLR3 agonists can be directly conjugated to proteins, such as antibodies or small molecules, that selectively bind to and activate TLR3. Other TLR3 agonists include retroviruses, such as retroviruses engineered to lack the ability to integrate into the genome.

[0048] A dose of agonist effective in the methods of the present invention is a dose that increases the expression of CRT on a phagocyte or cell population compared to the same population in the absence of the TLR agonist.

[0049] For example, for a TLR agonist of Poly I:C or an analog thereof, an effective amount can be at least about 10 ng / ml, at least about 50 ng / ml, at least about 100 ng / ml, at least about 250 ng / ml, or at least about 500 ng / ml. Doses of TLR agonists other than Poly I:C can be calculated based on providing equivalent activity to optimized Poly I:C.

[0050] TLR3, 4, 7 / 8, and 9 agonists are of particular interest as immunotherapeutic agents for treating cancer. These include, but are not limited to, 852A: a synthetic imidazoquinoline mimicking viral ssRNA, VTX-2337: a small molecule selective TLR8 agonist mimicking viral ssRNA, BCG: Bacillus Calmette-Guerin, Mycobacterium bovis, CpG ODN: CpG oligodeoxynucleotide, imiquimod: a synthetic imidazoquinoline mimicking viral ssRNA, LPS: lipopolysaccharide, MPL: monophosphoryl lipid A, poly I:C: polyriboinosinic-polyribocytidylic acid, poly ICLC: poly I:C-poly-l-lysine, and resiquimod: a synthetic imidazoquinoline mimicking viral ssRNA.

[0051] Imiquimod is a synthetic imidazoquinoline that targets TLR7. A newer imidazoquinoline TLR7 agonist, 852A, administered parenterally as monotherapy, has shown modest clinical efficacy in disease stabilization as monotherapy. Resiquimod is a human imidazoquinoline TLR7 / 8 agonist.

[0052] CpG is a single-stranded oligodeoxynucleotide (ODN) characterized by motifs containing cytosine and guanine. Based on their immunological effects, CpG ODNs are divided into three distinct classes: CpG-A, a potent stimulator of NK cells due to its influence on pDCs to produce IFNα; CpG-B, a moderate IFNα inducer and enhancer of antigen-specific immune responses (upregulating costimulatory molecules on pDCs and B cells, inducing Th1 cytokine production, and stimulating antigen presentation by pDCs); and CpG-C, which combines the stimulatory capabilities of both CpG-A and CpG-B. CpG7909 (PF-3512676, a CpG type B and TLR9 agonist) has been evaluated in several tumor types, including renal cell carcinoma, glioblastoma, melanoma, cutaneous T-cell lymphoma, and non-Hodgkin's lymphoma.

[0053] Polyriboinosinic-polyribocytidylic acid (poly I:C) is a synthetic analog of viral dsRNA that stimulates endosomal (TLR3) and / or cytosolic melanoma differentiation-associated gene 5 (MDA5), leading to further production of type I IFN.

[0054] Lipid A molecules that target the TLR4 complex include monophosphoryl lipid A (MPL), a lipid A derivative from Salmonella minnesota.

[0055] Bruton's tyrosine kinase (Btk) contains a PH domain that binds phosphatidylinositol (3,4,5)-trisphosphate (PIP3). PIP3 binding induces Btk to phosphorylate phospholipase C, which then hydrolyzes PIP2, a phosphatidylinositol, into two second messengers, inositol trisphosphate (IP3) and diacylglycerol (DAG), which then continue to regulate the activity of downstream proteins during B cell signaling. Mutations in the BTK gene are associated with the primary immunodeficiency disorder X-linked agammaglobulinemia (Bruton's agammaglobulinemia). XLA patients have a normal population of B cell precursors in the bone marrow, but these cells fail to develop and enter the circulation. Ibrutinib (PCI-32765) is a selective Bruton's tyrosine kinase inhibitor.

[0056] Ibrutinib (1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)pyrazolo[3,4-d]pyrimidin-1-yl]piperidin-1-yl]prop-2-en-1-one) is a specific inhibitor of Btk. In the methods of the present invention, for example, in an oral dosage form, it can be administered at a dose of about 10 mg / day, about 50 mg / day, about 100 mg / day, about 250 mg / day, about 350 mg / day, about 420 mg / day, about 500 mg / day, about 600 mg / day, and up to about 1000 mg / day. Administration can be continued until unacceptable toxicity or disease progression.

[0057] Phagocytic Antigen Presenting Cells. The terms "phagocyte" and "phagocyte" are used interchangeably herein to refer to cells capable of phagocytosis, i.e., engulfing large particulate masses, e.g., about 0.1 μm to about 2 mm or about 1 mm in diameter, including up to the size of mammalian cells, e.g., tumor cells, in particular. Phagocytosis in this context is defined as the engulfment of cells, pathogens, and various particulates by surrounding them with the effector cell membrane.

[0058] There are several classes of phagocytes: macrophages, mononuclear cells (histiocytes and monocytes), polymorphonuclear leukocytes (neutrophils), and dendritic cells. Macrophages are of particular interest. Phagocytosis-associated cellular responses include immunomodulatory responses, such as the production and release of pro- and anti-inflammatory mediators, as well as cellular responses of a destructive nature, such as the respiratory burst and degranulation to release toxic and bactericidal molecules. Professional phagocytes can recognize a wide variety of phagocytic targets and ingest them at a higher rate than non-phagocytic cells.

[0059] Neutrophils and macrophages represent fully differentiated phagocytes. While neutrophils are fully differentiated away from the bone marrow, macrophages differentiate from circulating monocytes in extravascular tissues. Monocytes exhibit a lower phagocytic response than neutrophils and macrophages and must respond to activation and differentiation signals to achieve optimal phagocytic capacity. The process of monocyte-to-macrophage differentiation has been well characterized and can be performed in vitro or in vivo.

[0060] A "therapeutically effective amount" or "therapeutic dose" is an amount sufficient to produce a desired clinical result (i.e., therapeutic efficacy). For some purposes of the present invention, an effective amount of an anti-CD47 agent is an amount that increases phagocytosis by at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 100%, two-fold, three-fold or more.

[0061] For purposes of this invention, a therapeutically effective amount of an anti-CD47 agent is an amount sufficient to alleviate, ameliorate, stabilize, reverse, inhibit, delay, or slow the progression of a disease state (e.g., cancer or chronic infection) by increasing macrophage-mediated killing of target cells. Thus, a therapeutically effective amount of an anti-CD47 agent may reduce a target cell population via an in vivo immune response by at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 90%, or more, compared to the effect in the absence of administration of the phAPC reservoir.

[0062] Myelodysplastic Syndrome. Myelodysplastic syndrome (also known as MDS or myelodysplasia) is a hematological (i.e., blood-related) condition in which there is ineffective development (or "dysplasia") of blood cells. Patients with MDS may develop severe anemia and require blood transfusions. In some cases, the disease worsens, and patients develop cytopenias (low blood counts) caused by progressive bone marrow failure. The outlook for MDS depends on the type and severity.

[0063] Types of MDS that can be treated by the methods of the present invention include refractory anemia, refractory anemia with ringed sideroblasts, refractory anemia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with single lineage dysplasia, unclassifiable myelodysplastic syndrome, myelodysplastic syndrome with isolated del(5q) chromosomal abnormality, and chronic myelomonocytic leukemia (CMML).

[0064] Autoimmune hemolytic anemia (AIHA) is defined as the increased destruction of red blood cells due to the presence of anti-erythrocyte autoantibodies (AEA) and can be classified as either autoimmune, alloimmune, or drug-induced, depending on the antigen that triggers the immune response. While general hemolytic anemia is estimated to occur in approximately 4 cases per 1,000 people per year, the annual incidence of AIHA is estimated to be approximately 1-3 cases per 100,000 people per year. AIHA can be considered either a primary disease or secondary to other autoimmune diseases, lymphoid malignancies, infections, immunodeficiencies, or tumors in approximately 20-80% of cases, with lymphoid malignancies being the most common cause of secondary AIHA. AEA is classified as a cold or warm autoantibody, as it reacts optimally at temperatures below 30°C or between 35°C and 40°C, respectively. The majority of warm AEA are IgG, but occasionally IgA and / or IgM are also present, accounting for approximately 50-70% of AIHA cases. The binding of warm IgG AEA to red blood cells does not damage them per se. This is because red blood cell-bound IgG, in contrast to surface-bound IgM, is a poor activator of the classical complement pathway. Instead, surface-bound IgG is recognized by Fcγ receptors on cells of the monocyte-macrophage phagocyte system, usually preferentially in the spleen and liver, leading to the uptake and destruction of IgG-opsonized red blood cells. However, macrophage-mediated clearance of red blood cells in AIHA involves the activation of macrophage Fcγ and complement receptors (complement factors C3b and C3b). i This is likely mediated by the synergistic activity of IgG-opsonized red blood cells (which recognize complement) because red blood cells opsonized with very low levels of IgG are not eliminated in vivo in the absence of complement. Furthermore, low-level complement opsonization does not result in erythrophagocytosis in the absence of IgG, whereas low-level opsonization with both complement and IgG can induce effective erythrophagocytosis in vivo and in vitro.

[0065] Immune thrombocytopenic purpura (ITP) is an autoimmune disease characterized by low platelet counts due to antibody-mediated destruction of platelets by macrophages. ITP is classified as acute or chronic. Acute ITP has a rapid onset with typical petechiae and bruising, is often preceded by an infectious illness, primarily affects young children, and usually resolves spontaneously within 6 months. Chronic ITP is often more insidious than the acute form, is approximately 2–3 times more common in women than men, and is an adult-onset form.

[0066] Positive antiplatelet autoantibody tests are found in approximately 70-80% of adults with ITP and in children with chronic ITP. Platelet autoantibodies are IgG type and most often target platelet membrane glycoproteins, including GPIIb / IIIa, GPIb-IX, and GPIa-IIa. Platelets coated with IgG autoantibodies undergo accelerated clearance by macrophages via Fcγ receptor-mediated phagocytosis, preferably in the spleen and liver. Most patients have antibodies directed against several different platelet surface proteins. Adults diagnosed with ITP are usually initially treated with corticosteroids. Intravenous gamma globulin (IVIG) is another common method of ITP treatment, particularly in the treatment of internal bleeding. IVIG has well-known anti-inflammatory effects, usually attributed to the immunoglobulin G (IgG) Fc domain, which is thought to block pro-phagocytic Fc receptors on macrophages.

[0067] The term "antibody" or "antibody portion" is intended to include a molecular structure containing a polypeptide chain with a specific shape that fits and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. While antibodies utilized in the present invention can be polyclonal, monoclonal antibodies are preferred because they can be reproduced in cell culture or recombinantly and can be modified to reduce antigenicity.

[0068] The term "bispecific antibody" refers to a synthetic or recombinant antibody that recognizes multiple proteins. Examples include bispecific antibodies 2B1, 520C9xH22, mDX-H210, and MDX447. Bispecific antibodies directed against a combination of epitopes allow for the targeting and / or depletion of cell populations that express the combination of epitopes.

[0069] Polyclonal antibodies can be produced using standard protocols by injecting antigen compositions into production animals. See, for example, Harlow and Lane, *Antibodies: A Laboratory Manual*, Cold Spring Harbor Laboratory, 1988. When using the entire protein or larger portions of a protein, antibodies can be produced by vaccinating production animals with the protein and a suitable adjuvant (e.g., Freund's, complete Freund's, oil-in-water emulsion, etc.). When using smaller peptides, it is advantageous to conjugate the peptide with a larger molecule to create an immunostimulatory conjugate. Commonly used conjugated proteins commercially available for such use include bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH). Peptides derived from the complete sequence can be used to generate antibodies against specific epitopes. Alternatively, to generate antibodies against relatively short peptide portions of protein targets, superior immune responses can be elicited when polypeptides are conjugated to carrier proteins such as ovalbumin, BSA, or KLH.

[0070] Alternatively, for monoclonal antibodies, hybridomas can be formed by isolating stimulated immune cells, such as from the spleen of inoculated animals. These cells are then fused to immortalized cells, such as melanoma cells or transformed cells, which can replicate indefinitely in cell culture, thereby generating immortal immunoglobulin-secreting cell lines. Additionally, antibodies or antigen-binding fragments can be produced by genetic engineering. Humanized, chimeric, or xenohuman antibodies are preferred for use in the present invention, as they provoke less of an immune response when administered to humans.

[0071] Antibodies that have a reduced tendency to induce severe or adverse immune responses in humans (such as anaphylactic shock) and that further exhibit a reduced tendency to stimulate immune responses that would prevent repeated administration of the antibody therapeutic or imaging agent are preferred for use in the present invention. These antibodies are preferred for all routes of administration. Thus, humanized, chimeric, or xenohuman antibodies, which result in less of an immune response when administered to humans, are preferred for use in the present invention.

[0072] Chimeric antibodies can be generated by recombinant means by combining murine variable light and heavy chain regions (VK and VH) from murine (or other animal-derived) hybridoma clones with human constant light and heavy chain regions to generate antibodies with primarily human domains. The generation of such chimeric antibodies is well known in the art and can be performed by standard means (e.g., as described in U.S. Pat. No. 5,624,659, incorporated by reference in its entirety). Humanized antibodies are genetically engineered to contain more human-like immunoglobulin domains and incorporate only the complementarity-determining regions of an animal-derived antibody. This is achieved by carefully sequencing the hypervariable loops of the variable regions of a monoclonal antibody to match them to the structure of human antibody chains. While superficially complex, this method is robust in practice. See, e.g., U.S. Pat. No. 6,187,287. Alternatively, single-chain antibodies (Fv, as described below) can be generated from phage libraries containing human variable regions. See US Pat. No. 6,174,708, which is incorporated herein by reference in its entirety.

[0073] In addition to whole immunoglobulins (or recombinant forms thereof), immunoglobulin fragments containing epitope-binding sites (e.g., Fab', F(ab')2, or other fragments) are useful as antibody portions of the present invention. Such antibody fragments can be generated from whole immunoglobulins by ficin, pepsin, papain, or other protease cleavage. "Fragments," or minimal immunoglobulins, can be engineered using recombinant immunoglobulin technology. For example, "Fv" immunoglobulins for use in the present invention can be generated by linking the variable light chain region to the variable heavy chain region via a peptide linker (e.g., polyglycine or another sequence that does not form an α-helical or β-sheet motif).

[0074] The Fv fragment contains the variable heavy chain domain (V H ) and variable light chain domain (V L) heterodimers. The heterodimers of heavy and light chain domains that occur throughout IgG are connected, for example, by disulfide bonds. V connected by a peptide linker H and V L Certain recombinant Fvs are generally stable; see, e.g., Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988) and Bird et al., Science 242:423-426 (1988), both of which are incorporated herein by reference in their entireties. These are single-chain Fvs that have been found to retain selectivity and affinity, demonstrating their utility in tumor imaging and for generating recombinant antitoxins for tumor therapy. Any of these minimal antibodies can be used in the present invention, and those that are humanized to avoid HAMA reactions are preferred for use in embodiments of the present invention.

[0075] Additionally, derivatized immunoglobulins with additional chemical linkers, detectable moieties such as fluorochromes, enzymes, radioisotopes, substrates, chemiluminescent moieties, or specific binding moieties such as streptavidin, avidin, biotin, etc., can be used in the methods and compositions of the invention. For convenience, the terms "antibody" or "antibody portion" are used throughout to refer generally to molecules that specifically bind to an epitope of a target protein, although the terms encompass all immunoglobulins, derivatives, fragments, recombinant or genetically engineered immunoglobulins, and modified immunoglobulins, as described above.

[0076] Candidate binding agents can be tested for activity by any suitable standard means. As a first screen, antibodies can be tested for binding to the target antigen used to generate them. As a second screen, candidate agents can be tested for binding to appropriate cells, e.g., cancer cells, hematopoietic cells, etc. In these screens, candidate antibodies can be labeled for detection (e.g., with a fluorescer or another fluorescent moiety, or with an enzyme such as horseradish peroxidase). After selective binding to the target, candidate agents can be tested for appropriate activity in an in vivo model (i.e., the ability to reduce tumor cell proliferation and / or aid in visualizing tumor cells).

[0077] By "manipulating phagocytosis" is meant upregulating or downregulating phagocytosis by at least about 10%, or up to 20%, or 50%, or 70%, or 80%, or up to about 90% compared to the level of phagocytosis observed in the absence of the intervention. Thus, with respect to reducing phagocytosis of circulating hematopoietic cells, particularly in the context of transplantation, "manipulating phagocytosis" means downregulating phagocytosis by at least about 10%, or up to 20%, or 50%, or 70%, or 80%, or up to about 90% compared to the level of phagocytosis observed in the absence of the intervention.

[0078] The terms "phagocyte" and "phagocyte" are used interchangeably herein to refer to cells capable of phagocytosis. There are three main categories of phagocytes: macrophages, mononuclear cells (histiocytes and monocytes), polymorphonuclear leukocytes (neutrophils), and dendritic cells.

[0079] The term "biological sample" encompasses various types of samples obtained from an organism and can be used in diagnostic or monitoring assays. The term includes blood and other liquid samples of biological origin, as well as solid tissue samples, such as biopsy specimens or tissue cultures or cells derived therefrom and their progeny. The term encompasses samples that have been manipulated in any way after procurement, such as by treatment with reagents, solubilization, or enrichment for particular components. The term encompasses clinical samples, and also includes cells from cell culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples.

[0080] The terms "cancer," "neoplasm," and "tumor" are used interchangeably herein to refer to cells that exhibit autonomous, unregulated growth, resulting in an abnormal growth phenotype characterized by a significant loss of control over cell proliferation. Cells of interest for detection, analysis, or treatment in this application include precancerous (e.g., benign), malignant, premetastatic, metastatic, and non-metastatic cells. Cancer of virtually all tissues is known. The phrase "cancer burden" refers to the amount of cancer cells or cancer volume in a subject. Thus, "reducing cancer burden" refers to reducing the number of cancer cells or cancer volume in a subject. As used herein, the term "cancer cell" refers to a cancer cell or any cell derived from a cancer cell, e.g., a clone of a cancer cell. Many types of cancer are known to those skilled in the art, including solid tumors (e.g., carcinoma, sarcoma, glioblastoma, melanoma, lymphoma, myeloma, etc.) and circulating cancers (e.g., leukemia). Examples of cancer include, but are not limited to, ovarian cancer, breast cancer, colon cancer, lung cancer, prostate cancer, hepatocellular carcinoma, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urinary tract cancer, thyroid cancer, kidney cancer, carcinoma, melanoma, head and neck cancer, and brain cancer.

[0081] The "pathology" of cancer includes any phenomenon that compromises the health of the patient, including, but not limited to, abnormal or uncontrolled cell growth, metastasis, interference with the normal function of neighboring cells, release of abnormal levels of cytokines or other secretions, suppressed or exacerbated inflammatory or immune responses, tumor, premalignant, malignant, invasion of surrounding or distant tissues or organs (e.g., lymph nodes), etc.

[0082] As used herein, "cancer recurrence" and "tumor recurrence" and grammatical variations thereof refer to the further growth of neoplasms or cancer cells after a cancer diagnosis. In particular, recurrence can occur when further cancer cell proliferation occurs in cancerous tissue. "Tumor progression" similarly occurs when tumor cells spread into local or distant tissues and organs, and thus tumor progression includes tumor metastasis. "Tumor invasion" occurs when tumor growth spreads locally and compromises the function of associated tissues by compressing, destroying, or interfering with normal organ function.

[0083] As used herein, the term "metastasis" refers to the growth of a cancer tumor in an organ or body part that is not directly connected to the organ of the original cancer tumor. Metastasis, of course, includes micrometastasis, which is the presence of undetectable amounts of cancer cells in an organ or body part that is not directly connected to the organ of the original cancer tumor. Metastasis can also be defined as several steps in a process (e.g., the detachment and migration of cancer cells from the original tumor site and / or the infiltration of cancer cells into other parts of the body).

[0084] The terms "treatment," "treating," "treating," and the like are used herein to generally refer to obtaining a desired pharmacological and / or physiological effect. The effect can be preventative, in that it completely or partially prevents a disease or its symptoms, and / or therapeutic, in that it partially or completely stabilizes or cures the disease and / or adverse effects caused by the disease. As used herein, "treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes (a) preventing the disease or condition from occurring in a subject who may be susceptible to, but has not yet been diagnosed as having, the disease or condition; (b) inhibiting a symptom of the disease, i.e., halting its development; or (c) alleviating a symptom of the disease, i.e., causing regression of the disease or condition.

[0085] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired.

[0086] As used herein, "host cell" means a microorganism, or eukaryotic cell or cell line cultured as a unicellular entity, that can be or has been used as a recipient of a recombinant vector or other transfer polynucleotide, and includes the progeny of the original transfected cell. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.

[0087] "Therapeutic target" means a gene or gene product, the activity of which, upon modulation (e.g., by modulation of expression, biological activity, etc.), can provide for modulation of the cancer phenotype. As used throughout, "modulation" is meant to refer to an increase or decrease in the indicated phenomenon (e.g., modulation of biological activity means an increase in biological activity or a decrease in biological activity).

[0088] "Reducing the growth of cancer cells" includes, but is not limited to, reducing the proliferation of cancer cells and reducing the incidence of non-cancerous cells becoming cancerous cells. Whether a reduction in the growth of cancer cells has been achieved can be determined by [ 3 The degree of progression can be readily determined using any well-known assay, including, but not limited to, [H]-thymidine incorporation, counting cell number over a period of time, detecting and / or measuring markers associated with cancer, and the like.

[0089] Whether a substance, or a particular amount of a substance, is effective in treating cancer is assessed using any of a variety of well-known cancer diagnostic assays, including, but not limited to, biopsy, contrast x-ray, CAT scan, and detection of tumor markers associated with cancer in an individual's blood. The substance can be administered systemically or locally, usually systemically.

[0090] In certain embodiments, bispecific antibodies may be used, such as bispecific antibodies in which one antigen-binding region targets CTR and the other antigen-binding region targets a cancer cell marker, such as CD47, EGFR, HER2, CD96, CD97, CD99, PTHR2, HAVCR2, etc.

[0091] For administration, the active agent is mixed with a non-toxic, pharmaceutically acceptable carrier material prior to administration. This is typically an aqueous solution, normal saline or phosphate-buffered saline (PBS), Ringer's solution, lactate-Ringer's solution, or any physiologically acceptable isotonic solution for administration by the selected means. Preferably, the solution is sterile, pyrogen-free, and manufactured and packaged under current FDA-approved Good Manufacturing Processes (GMP). When formulating pharmaceutical compositions for intravascular, intrathecal, intracerebrospinal fluid, direct intratumoral injection, or other routes of administration, clinicians of ordinary skill are familiar with appropriate ranges for pH, tonicity, and additives or preservatives. In addition to additives for adjusting pH or tonicity, antibody therapeutic agents and antibody contrast agents may be stabilized against aggregation and polymerization with amino acids and nonionic surfactants, polysorbates, and polyethylene glycol. Optionally, additional stabilizers can include various physiologically acceptable carbohydrates and salts. Polyvinylpyrrolidone can also be added in addition to amino acids. Suitable therapeutic immunoglobulin solutions stabilized for storage and administration to humans are described in U.S. Patent No. 5,945,098, which is incorporated herein by reference in its entirety. Other agents, such as human serum albumin (HSA), can be added to the therapeutic or diagnostic imaging composition to stabilize the antibody conjugate.

[0092] The compositions of the present invention can be administered using any medically appropriate procedure, for example, by intravascular (intravenous, intraarterial, intracapillary) administration, intracerebrospinal fluid, intracavity, subcutaneous injection, or direct injection into a tumor. For the diagnostic imaging compositions of the present invention, administration via intravascular injection is preferred for preoperative visualization of tumors.

[0093] The effective amount of an active agent given to a particular patient depends on a variety of factors, some of which vary between patients. A competent clinician can determine the effective amount to administer to a patient to slow the growth and promote the death of tumor cells, or the effective amount of a diagnostic imaging composition to administer to a patient for the treatment of myelodysplastic syndrome. The dosage will depend on the tumor treatment, the route of administration, the nature of the therapy, the tumor's sensitivity to the therapy, etc. The available LD for a drug 50 Using animal data and other information, clinicians can determine the maximum safe dosage for an individual, depending on the route of administration. For example, a dosage administered intravenously may exceed a dosage administered intrathecally, given the larger body volume into which the therapeutic composition is administered. Similarly, compositions that are rapidly cleared from the body can be administered at high doses or in repeated doses to maintain therapeutic concentrations. Diagnostic imaging moieties are typically less toxic than cytotoxic moieties and, in some embodiments, can be administered at higher doses. Using routine techniques, a competent clinician can optimize the dosage of a particular therapeutic composition during routine clinical trials.

[0094] A typical dosage is 0.001 to 100 milligrams per kilogram of the subject's body weight. The agent can be administered to the subject in a series of multiple doses. For therapeutic compositions, regular periodic administration (e.g., every 2-3 days) may sometimes be necessary or desirable to reduce toxicity. For therapeutic compositions utilized in repeated administration regimens, agents that do not induce HAMA or other immune responses are preferred.

[0095] How to use Methods for cancer treatment are provided. An activator of TLR signaling or a BTK agonist is provided in combination with CD47 blockade, resulting in increased cancer cell elimination compared to cell elimination in the presence of either agent as monotherapy. In some embodiments, a cell population containing macrophages is contacted in vitro or ex vivo with a dose of a TLR agonist or a BTK agonist effective to increase CRT on the cell surface of macrophages by at least about 25%, at least about 50%, or at least about 75%, and may increase expression by two-fold, three-fold, five-fold, or more compared to unstimulated cells. The level of phagocytosis of cells treated in this manner may be at least about 25%, at least about 50%, or at least about 75%, and may increase phagocytosis by two-fold, three-fold, five-fold, or more compared to unstimulated cells. In the presence of an agent that blocks the interaction of CD47 and SIRPα, the incremental increase in phagocytosis of cells treated with an effective amount of a TLR agonist or a BTK agonist can be at least about 25%, at least about 50%, at least about 75%, and can increase phagocytosis by 2-fold, 3-fold, 5-fold or more compared to cells treated with a TLR agonist in the absence of CD47 blockade.

[0096] For in vivo treatment, the TLR agonist or BTK agonist can be administered in an effective amount and for a period of time sufficient to increase PrCr in the recipient, e.g., as determined by phagocytosis of tumor cells by phagocytes. The TLR agonist or BTK agonist can be co-administered or simultaneously administered with an effective amount of an agent that blocks the interaction between CD47 and SIPα. The TLR agonist or BTK agonist can be co-administered or simultaneously administered with an agent that specifically targets cancer cells, e.g., an antibody directed against a tumor-selective target.

[0097] Phagocytic cells treated ex vivo with a TLR agonist or a BTK agonist can be administered to an individual for cancer treatment, with the cells administered systemically or locally, for example, to the tumor site. The cells can be co-administered with or simultaneously administered with an effective amount of an agent that blocks the interaction between CD47 and SIPα. The cells can be contacted with tumor cells or tumor cell antigens ex vivo prior to administration. The cells can be co-administered with or simultaneously administered with an agent that specifically targets cancer cells, such as an antibody directed against a tumor-selective target.

[0098] The phagocytic ability of phagocytes, e.g., macrophages, can be determined by measuring the expression of CRT on the cell surface, with an increase in CRT corresponding to an increase in phagocytic ability. In some embodiments, calreticulin expression on the macrophage cell surface is measured by, but not limited to, contacting the cells with a CRT-specific antibody and measuring the amount of bound antibody, for example, by flow cytometry, ELISA, immunohistochemistry, etc., as known in the art. In some such embodiments, the measuring step is performed after treating the cells with a TLR agonist ex vivo. In some embodiments, the measurement is compared to a default level or control cells not treated with a TLR agonist. In some embodiments, cells with a default level of CRT are administered to an individual for cancer treatment, where the cells are administered systemically or locally, e.g., to a tumor site.

[0099] In another embodiment of the present invention, a BTK inhibitor, including but not limited to ibrutinib, is provided in a therapeutic dose to an individual suffering from excessive or unwanted PrCR, including, but not limited to, myelodysplastic syndrome (MDS), autoimmune hemolytic anemia (AIHA), immune thrombocytopenic purpura (ITP), and the like. The administered amount of the BTK inhibitor is sufficient to reduce CRT expression on phagocytes, e.g., by at least about 25%, at least about 50%, or at least about 75%, resulting in a two-fold, three-fold, five-fold, or greater reduction in expression compared to unstimulated cells. The level of phagocytosis of cells treated in this manner can be reduced by at least about 25%, at least about 50%, or at least about 75%, resulting in a two-fold, three-fold, five-fold, or greater reduction in phagocytosis compared to unstimulated cells.

[0100] Example 1 Macrophages eat cancer cells, using their own calreticulin as a guide, TLRs, and BTK. Macrophage-mediated programmed cell elimination (PrCR) is an important mechanism for eliminating diseased and damaged cells prior to programmed cell death. Induction of PrCR by "eat me" signals on tumor cells is counteracted by "don't eat me" signals, such as CD47, which binds macrophage signal-regulatory protein α (SIRPα) to inhibit phagocytosis. Blockade of CD47 on tumor cells leads to phagocytosis by macrophages. Here, we demonstrate that activation of the toll-like receptor (TLR) signaling pathway in macrophages synergizes with blockade of CD47 on tumor cells to enhance PrCR. Bruton's tyrosine kinase (Btk) mediates TLR signaling in macrophages. Calreticulin, previously shown to be an "eat me" signal on cancer cells, is activated in macrophages through secretion and cell surface exposure by TLRs and Btk, targeting cancer cells for phagocytosis even if the cancer cells themselves do not express calreticulin.

[0101] Programmed cell elimination (PrCR) is a macrophage-mediated immune surveillance process in which target cells are recognized and phagocytosed. PrCR is known as a key step in programmed cell death for the elimination of apoptotic cells. However, when apoptosis is blocked (by forced expression of bcl2), PrCR occurs on viable neutrophils, just as PrCR eliminates dying wild-type neutrophils. Recently, the role of PrCR in eliminating viable tumor cells has been elucidated. Several studies have demonstrated the important function of CD47 as an antiphagocytic "don't eat me" signal that governs PrCR. During cancer progression, tumor cells upregulate CD47 to protect them from PrCR. Blockade of the interaction between CD47 on target cells and its receptor, signal-regulatory protein α (SIRPα) on macrophages, efficiently induces PrCR in cancer cells, but not in many normal cells, both in vitro and in vivo (Figure 1A). When CD47 is blocked, cancer cells, but not normal cells, are phagocytosed because pro-phagocytic "eat me" signals such as calreticulin (CRT) are commonly expressed in many leukemias, lymphomas, and solid tumors (Figure 1A).

[0102] Calreticulin is normally an endoplasmic reticulum (ER) protein with an ER-retained KDEL sequence; however, in many cases of cell damage due to cytotoxic drugs or inflammation, it can be released to the cell surface and recognized by macrophage LRP1 / CD91 during phagocytosis of apoptotic cells. Bruton's tyrosine kinase (Btk) belongs to the Tec non-receptor protein tyrosine kinase family and plays an important role in regulating the innate immune response. Abnormalities in Btk expression lead to immunodeficiencies, including X-linked hypo- or agammaglobulinemia, possibly due to a block in B cell development, and are likely also associated with defective and inefficient elimination of B lineage cells. However, to date, little is known about the molecular mechanisms by which macrophages recognize and phagocytose live cancer cells. Here, we show that macrophages express calreticulin and that toll-like receptor (TLR) signaling via Btk leads to its migration to the cell surface, which can be used to mediate PrCR of appropriate tumor cells.

[0103] We performed phagocytosis assays by co-culturing mouse bone marrow-derived macrophages (BMDMs) with target human cancer cells to test the efficacy of PrCR under different conditions. To induce phagocytosis, we blocked CD47 on a human colon cancer cell line (SW620) by treating tumor cells with a CD47-blocking antibody or by directly knocking it out. Phagocytosis was significantly increased by knocking out the self-protective signal CD47 (SW620), resulting from an imbalance of the "eat me" over the "don't eat me" pathway (Figure 1A). CD47KO , Figure 5A-B). SW620 by anti-CD47 antibody WT Cell treatment was SW620 CD47KO The anti-CD47 antibody induced phagocytosis of SW620 cancer cells by blocking both CD47-SIRPα interactions (Fc-independent) and by an Fc-dependent mechanism, inducing a more potent phagocytosis that was reversed by Fc receptor blockade to the same level as the SW620 cancer cells (Figure 1A).

[0104] To understand the molecular mechanism of PrCR, we performed a screening study to identify signaling pathways that regulate the phagocytic ability of macrophages. TLR signaling plays an important role in innate immune responses against pathogens, and TLR agonists have been proposed as potential immunotherapeutic drugs to suppress cancer. However, the role of TLR signaling in PrCR on live cancer cells remains unexplored. Therefore, we pretreated BMDMs with various TLR agonists and analyzed their phagocytic ability against cancer cells. We found that activation of multiple TLRs significantly enhanced phagocytosis of cancer cells (Figure 1B). We then focused on the TLR agonists that were most effective in enhancing phagocytosis and evaluated their effects in a broader range of macrophages and tumor cells. We showed that treatment of macrophages with TLR3, 4, and 7 agonists (i.e., polyinosinic-polycytidylic acid-high molecular weight (poly(I:C)HMW), lipopolysaccharide (LPS), and imiquimod) dramatically enhanced the phagocytosis of multiple hematopoietic and solid tumor cells (Figures 6A-C and 7A-D). Subsequent evaluation of mice lacking T, B, and NK cells showed that these TLR agonists significantly improved the efficacy of CD47-blocking antibodies to inhibit tumor growth in vivo (Figures 8A-B).

[0105] To further understand the mechanism by which activation of TLR signaling in macrophages promoted tumor cell phagocytosis, we treated macrophages by mixing TLR agonists with various inhibitors targeting key molecules that positively (MAPK, Btk) or negatively (PI3K, caspase-1) regulate TLR signaling. Blockers of MAPK, PI3K, and caspase-1 showed no effect on cancer cell phagocytosis. In contrast, ibrutinib, a specific blocker of Bruton's tyrosine kinase (Btk), a tyrosine kinase expressed in the hematopoietic system (Figure 9), significantly attenuated TLR agonist-induced phagocytosis (Figure 2A). Treatment of macrophages with poly(I:C) HMW, LPS, or imiquimod stimulated Btk phosphorylation, an effect that was counteracted by ibrutinib, resulting in basal Btk phosphorylation (Figure 2B). Basal phagocytosis of cancer cells, in particular, is regulated by the Btk pathway, and ibrutinib exhibited inhibitory effects on both Fc-dependent and Fc-independent phagocytosis (Figure 10A). In summary, Btk is a key effector through which TLRs mediate tumor cell phagocytosis. Interestingly, stimulation and inhibition of Btk exhibited temporally differential effects on phagocytosis. Maximal phagocytic capacity of macrophages was achieved by 16 hours of Btk activation (Figure 2C). In contrast, blockade of Btk exhibited a rapid effect, reaching maximum inhibition within 1 hour (Figure 2D).

[0106] Upon activation, Btk phosphorylates transcription factors such as TFII-I and STAT5A in the nucleus and PLCγ2 in the plasma membrane. Recent studies have identified CRT as a substrate phosphorylated by Btk when TLR7 is activated upon recognition of apoptotic cells. Phosphorylation of CRT by Btk in macrophages is important for CRT migration to the cell surface, where it functions as a bridging molecule for the CRT / CD91 / C1q complex, which initiates phagocytosis of apoptotic cells. To investigate whether CRT is a critical downstream effector of the TLR-Btk pathway mediating PrCR in tumor cells, we next examined the expression and function of CRT in macrophages. We found that CRT is expressed on the surface of macrophages and that its cell surface exposure is regulated by the activation status of Btk (Figures 3A-B, 10B). CRT antibody significantly inhibited phagocytosis of SW620 cells by mouse BMDM- or human peripheral blood mononuclear cell (PBMC)-derived macrophages (Figure 3C and Figures 10C-D), whereas overexpression of CRT in the mouse monocyte / macrophage cell line J774 led to enhanced phagocytosis (Figure 3D). Furthermore, we confirmed the phosphorylation of CRT upon Btk activation, which reached a maximum level 30 min after imiquimod treatment of macrophages (Figure 10E). These results suggest that CRT is an essential component regulated by the TLR-Btk pathway to mediate phagocytosis of live cancer cells.

[0107] We further analyzed the role of CRT in mediating PrCR in cancer cells. Previous studies have demonstrated cell surface expression of CRT on apoptotic cells and multiple viable human cancer cells (Figure 11B-D). Therefore, we tested whether CRT plays an important role in mediating cancer cell phagocytosis on macrophages and target tumor cells (Figure 4A). Interestingly, blocking CRT on macrophages reduced phagocytosis, whereas blocking CRT on cancer cells had no effect, suggesting a specific role for CRT on macrophages to mediate phagocytosis (Figure 4A). Importantly, cell surface expression of CRT was enhanced by TLR agonists on macrophages, but not on target cancer cells, which lack Btk (Figure 11A-D), indicating a different mechanism for regulating CRT exposure. Next, we examined macrophage subpopulations with different levels of cell surface CRT and found that macrophages with higher surface CRT exhibited stronger phagocytic ability (Figure 4B and Figures 12A-B). Quantitative analysis of a panel of macrophages, including subpopulations with different surface CRT expression and macrophages at different time points after imiquimod treatment, revealed a significant correlation between CRT expression on macrophages and tumor cell phagocytosis (Figure 4C and Figures 12C-D). Moreover, both M1 and M2 human macrophages derived from peripheral blood expressed CRT on their surface, with the M1 subset expressing somewhat higher levels of CRT (Figure 13). Taken together, these findings indicate that CRT is an important effector in macrophage-mediated surveillance of tumor cells and that upregulating CRT on macrophages can result in enhanced PrCR of cancer cells.

[0108] Recent advances in cancer immunology have highlighted the ability of cancer cells to evade immune surveillance as one of the fundamental hallmarks of cancer. While lymphocytes (T cells, B cells, and NK cells) are thought to mediate much of the anti-cancer immune surveillance, we have demonstrated that blocking CD47 on tumor cells leads to in vivo immune recognition, macrophage phagocytosis of tumor cells, and tumor elimination in lymphocyte-deficient mice, demonstrating that phagocytosis is crucial for cancer cell surveillance. Tumor cell phagocytosis mediated by anti-CD47 blockade can result in cross-presentation of tumor antigens to CD8+ T cells, and thus CD47 blockade can result in both innate immune system macrophage surveillance and stimulation of adaptive immune system T cell cytotoxicity.

[0109] Here, we demonstrate that cell-surface CRT on macrophages is regulated by the TLR-Btk pathway, which triggers phosphorylation of endoplasmic reticulum CRT; its cleavage from ER storage signals subsequent secretion, where it can bind to macrophage CD91. In addition to demonstrating this mechanism for apoptotic cell removal, we show that this mechanism of secretion is important for mediating PrCR of live cancer cells. CRT on macrophages may function in detecting target cells through trans-interactions as a yet unidentified specific receptor on target cancer cells; thus, blocking surface CRT inhibits PrCR. Furthermore, CD47 mutant mice do not phagocytose autologous erythrocytes or hematopoietic stem cells (HSCs), but when transferred to wild-type, congenic, normal, or irradiated mice, this suggests the possibility that other "eat me" signals are used, or that CRT can modify target cells that do not express the calreticulin gene. Although neither cell type expresses CRT in microarrays, these cells are rapidly phagocytosed.

[0110] We demonstrate that multiple TLR agonists can stimulate macrophages to enhance PrCR on solid tumor cells, consistent with reports that TLR4 agonists, LPS, and IFNγ receptors are required to activate macrophages and phagocytose acute myeloid leukemia cells after disrupting the CD47-SIRPα interaction. These studies suggest that TLR signaling can interact with anti-CD47 blockade to enhance tumor cell phagocytosis, but also target them for phagocytosis. The potential for TLR signaling on normal cells must be tested in several systems before the clinical potential of such synergy can be determined. Further studies of the interactions between macrophages and target cancer cells will advance our understanding of the principles of cancer cell immune evasion.

[0111] Materials and Methods Mice: BALB / c, RAG2 - / - , γc - / - , BALB / c and NOD.Cg-Prkdc scid II2rg tm1WjI / SzJ(NSG) mice were housed in a pathogen-free facility at the Institute for Stem Cell Biology and Regenerative Medicine at Stanford University. All animal procedures were approved by the Administrative Panel on Laboratory Animal Care at Stanford University.

[0112] Cell culture. The cell lines SW620 (colon cancer), HL60 (leukemia), Raji (lymphoma), MDA-MB-231 (breast cancer), PC3 (prostate cancer), and human carcinoma derived from mouse macrophage / monocyte cell line J774 were obtained from ATCC and routinely cultured in DMEM medium supplemented with 10% fetal bovine serum (SW620, MDA-MB-231, J774), IMDM medium supplemented with 20% fetal bovine serum (HL60), F-12K medium supplemented with 10% fetal bovine serum (PC-3), or RPMI-1640 medium supplemented with 10% fetal bovine serum (Raji). Tumor cells were transduced with lentivirus, which was generated by the pCDH-CMV-MCS-EF1 lentiviral vector expressing a luciferase-eGFP fusion protein, and sorted by flow cytometry with a BD FACSAriaII cell sorter for GFP+ cells as described above.

[0113] CD47 knockout using TALENs. TALENs were designed and constructed as described. The human CD47 genomic locus (NC_000003.12) was scanned for putative TALEN binding pairs. Exon 2 was ultimately selected for targeting, and the TALEN pairs TGTCGTCATTCCATGCTTTG and TATACTTCAGTAGTGTTTTG were cloned into the pTALEN backbone, respectively. SW620 cells were transfected with the CD47-TALEN constructs using lipofectamine 2000. Three days after transfection, cells were stained with anti-CD47 or isotype antibodies. CD47 cells were sorted by flow cytometry using a BD FACSAria II cell sorter.

[0114] Flow cytometry analysis. Flow cytometry analysis was performed using a BD LSRFortessa. For staining, 2.5 x 10 5 ~10 6Cells were incubated with the indicated antibodies (1:50–1:200) in FACS buffer (PBS with 2% fetal bovine serum) for 30 minutes on ice. Then, cells were washed with FACS buffer and subjected to FACS analysis. For macrophage staining, cells were first treated with an Fc receptor blocker or a high concentration of isotype IgG control (5–10x the concentration of the indicated antibody) to block nonspecific binding of antibodies resulting from interaction between the Fc domain on macrophages and Fc receptors.

[0115] Macrophage preparation. Human peripheral blood-derived macrophages were generated as described above. Monocytes were enriched from human peripheral blood and differentiated into macrophages by culture in IMDM supplemented with 10% human serum for 7–10 days. To generate M1 human macrophages, monocytes were treated with recombinant human GM-CSF (5 ng / mL) in RPMI 1640 medium supplemented with 5% FBS and 1% glutamax for a total of 7 days. M1 polarization was achieved by further treatment with IFN-γ (20 ng / mL) for 1 hour on day 5, followed by LPS (100 ng / mL) treatment on days 6–7. To generate M2 human macrophages, monocytes were treated with recombinant human M-CSF (25 ng / mL) in RPMI 1640 medium supplemented with 5% FBS and 1% glutamax for a total of 7 days. M2 polarization was achieved by further treatment with IL-4 (20 ng / mL) and IL-13 (20 ng / mL) on days 5 and 6. Differentiation of M1 and M2 macrophages was assessed by the expression of specific surface markers CD80 (M1) and CD163 (M2).

[0116] Anti-CD47 (BD Biosciences), anti-calreticulin (Enzo Life Sciences, Abeam, and MBL International), anti-F4 / 80 (Biolegend), anti-CD31 (BD Biosciences), and anti-Gr-1 (Biolegend) antibodies were used for FACS analysis. Antibodies were phycoerythrin (PE), PEcy-7, APC, or Brilliant Violet 421 (BV421) conjugated, or fluorophore-conjugated secondary antibodies were used. Sytox Blue was used to exclude dead cells.

[0117] Phagocytosis assay. A FACS-based phagocytosis assay was performed to assess the phagocytic capacity of macrophages. Macrophages were harvested after 6–8 days of differentiation and were cultured at 1–5 × 10 per well / tube. 4 The cells were sorted into FACS tubes or low-adhesion 96-well plates. Target cells were added and mixed with macrophages and incubated for 2 hours at 37°C under the indicated conditions (antibody / drug treatment). For CD47 blockade, anti-CD47 (B6H12, BD Biosciences) or humanized anti-CD47 (Hu5F9-G4, provided by the CD47 Disease Team at Stanford University) antibodies were used. The cells were then incubated with PEcy7-conjugated anti-mouse F4 / 80 antibody to stain the macrophages. After incubation, the cells were washed with FACS buffer and resuspended in FACS buffer containing Sytox blue to identify dead cells. The phagocytic index was determined by FACS analysis; macrophages that phagocytosed target cells were F4 / 80+ and GFP+. The phagocytic index was calculated by dividing the number of F4 / 80+GFP+ cells by the number of F4 / 80+ cells. In each experiment, the phagocytic index was normalized to the maximum index.

[0118] Alternatively, macrophages and target cells were mixed and co-cultured in 24-well plates for 16 to 24 hours under the indicated conditions. Cells were harvested from the plate using TrypLE and stained for macrophages by incubation with PEcy7-conjugated anti-mouse F4 / 80 antibody. After incubation, cells were washed with FACS buffer and resuspended in FACS buffer containing Sytox blue and unstained standard cells (293T cells were used as standard cells). The cells then underwent FACS analysis. The remaining target cells were normalized to the standard cells (the number of standard cells was known and equal in each sample) to assess the percentage of cells phagocytosed by macrophages during incubation.

[0119] In experiments to test the phagocytic ability of macrophages with differential cell surface expression of CRT, cells were stained with anti-F4 / 80 and anti-calreticulin antibodies, or isotype controls conjugated to the same colors, after phagocytosis assays. F4 / 80+ cells (macrophages) were gated, and among them, CRT High , CRT Medium or CRT Low Cells were analyzed separately for phagocytic index.

[0120] Overexpression of CRT. Replication-incompetent lentivirus was used to overexpress calreticulin in J774 cells. CRT cDNA was cloned into the pCDH-MCS-IRS-Puro lentiviral vector, with a signal peptide followed by a myc tag. Lentiviral vectors expressing myc-tagged CRT were transiently transfected into 293T cells, psPAX2, and pMD2.G at a ratio of 4:3:1. Forty-eight hours after transfection, supernatants were collected and added to J774 cells. Cells were treated with puromycin (2 μg / ml) for 48 hours, and selected cells were used for phagocytosis assays. CRT overexpression was confirmed by Western blotting with an anti-myc antibody.

[0121] Cell surface biotinylation. Mouse bone marrow-derived macrophages were seeded on day 6 and treated with imiquimod or ibrutinib for 16 hours before the biotinylation assay. Cells were incubated with NHS-SS-biotin (0.5 mg / ml) in PBS (pH 8.0) for 1 hour, then rinsed with quench buffer (20 mM Tris-HCl, 120 mM NaCl, pH 7.4), 100 mM glycine in PBS, and PBS. Cells were lysed in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, supplemented with protease inhibitor cocktail and phosphatase inhibitor cocktail). Cell lysates were incubated with neutravidin agarose resin for 4 hours at 4°C, and the resin was washed with lysis buffer. Biotin-labeled proteins were eluted with lysis buffer containing 2% SDS and 100 mM DTT and subjected to SDS-PAGE and immunoblotting. The intracellular protein GAPDH was used as a negative control to confirm that only cell surface proteins were labeled by NHS-SS-biotin.

[0122] Immunoprecipitation. Calreticulin was immunoprecipitated from J774 cells expressing myc-CRT. J774 cells were plated 12 hours prior to immunoprecipitation. Cells were treated with imiquimod (1 μg / ml) at the indicated time points and washed on ice with pre-chilled PBS containing phosphatase inhibitors. Cells were then lysed in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, supplemented with protease inhibitor cocktail and phosphatase inhibitor cocktail) at 4°C. Cell lysates were incubated with GammaBind Plus Sepharose for 1 hour for preclearance and with anti-myc antibody for 4 hours at 4°C. GammaBind Sepharose was added to the cell lysates and incubated for 1 hour at 4°C. Beads were washed with lysis buffer. Proteins were eluted with lysis buffer containing 2% SDS and 100 mM DTT and subjected to SDS-PAGE and immunoblotting. To detect phosphorylated CRT, blots were incubated with biotin-labeled pT66 anti-pTyrosine antibody and HRP-conjugated streptavidin.

[0123] Tumor implantation and treatment. PC3 cells (human prostate cancer) were housed in F-12K medium with 25% matrix Matrigel and subcutaneously implanted into the backs of NSG mice for 6-10 weeks. Two weeks after implantation, mice were treated with PBS or Hu5F9-G4 antibody by intraperitoneal injection until tumors grew to 100 mm. 3 Seven weeks after the transplantation, the tumors were treated with PBS or TLR agonists (20 μg of poly(I:C) HMW and 20 μg of LPS) by intratumoral injection.

[0124] Bioluminescence imaging was performed to monitor tumor growth as described above. Briefly, D-luciferin (firefly) potassium salt was dissolved in PBS to a final concentration of 16.6 mg / ml. Mice were intraperitoneally injected with luciferin solution (0.139 g luciferin / kg body weight), imaged, and analyzed using Living Image 4.0 software.

[0125] Tumor dissociation and FACS analysis. Tumor specimens were collected from mice, minced into pieces smaller than 1 mm in diameter, and dissociated in Medium 199 with TM enzyme and DNAase at 37°C until a single-cell suspension was obtained. Cells were treated with ACK lysis buffer to lyse red blood cells, washed twice with HBSS, filtered through a 70 μm cell strainer, and subjected to flow cytometry analysis. Cells were stained with anti-CD31 antibody, anti-Gr1 antibody, and Sytox blue to exclude endothelial cells, neutrophils, and dead cells, and with anti-F4 / 80 antibody to exclude macrophages.

[0126] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 106,050, filed January 21, 2015, which is incorporated herein by reference in its entirety.

Claims

1. 1. A pharmaceutical composition for use in a method for increasing phagocytosis of cancer cells, comprising a TLR agonist and an anti-CD47 antibody, The method includes contacting a population of phagocytes with (i) an effective dose of a TLR agonist selected from a TLR3, TLR4, or TLR9 agonist that is at least as active as 10 ng / ml of poly I:C to increase calreticulin expression on the surface of the phagocytes by 2-fold or more compared to unstimulated cells, and (ii) an effective amount of the anti-CD47 antibody; programmed cell elimination of cancer cells by said phagocytes is increased by at least 25% compared to cells treated with a TLR agonist in the absence of CD47 blockade; (a) the contacting is performed in vivo; or (b) the contacting is performed ex vivo, and the phagocytes are contacted with the TLR agonist and the anti-CD47 antibody prior to introduction into the subject; Pharmaceutical compositions.

2. The pharmaceutical composition of claim 1 , wherein the TLR agonist activates Btk.

3. 2. The pharmaceutical composition of claim 1, wherein the TLR agonist comprises a CpG containing oligonucleotide, wherein the CpG oligonucleotide is a single-stranded oligodeoxynucleotide characterized by a cytosine and guanine containing motif.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the expression of calreticulin on the surface of the phagocyte is measured before the introduction.

5. The pharmaceutical composition according to any one of claims 1 to 3, wherein the phagocyte is a macrophage.

6. The pharmaceutical composition according to any one of claims 1 to 3, wherein the anti-CD47 antibody is a fully human antibody, a humanized antibody, or a chimeric antibody.

7. The pharmaceutical composition of claim 6, wherein the anti-CD47 antibody is hu5F9-G4.

8. The anti-CD47 antibody comprises an antibody fragment, and the antibody fragment includes a Fab' fragment, an F(ab') fragment, and an F(ab') fragment. ２ The pharmaceutical composition according to any one of claims 1 to 3, which is a fragment or an Fv fragment.

9. 4. The pharmaceutical composition of claim 1, wherein the cancer is selected from (a) solid tumors, including carcinoma, sarcoma, glioblastoma, melanoma, lymphoma, and myeloma, and (b) circulating cancers, including leukemia.

Images