New markers for genetic recombination and their use
A Starmerella bombicola mutant strain with adenine auxotrophy, using a phosphoribosylglycine amidoformyltransferase-like protein as an endogenous selection marker, addresses the challenges of exogenous markers, enabling efficient glycolipid production and regulatory compliance.
Patent Information
- Application Number
- JP2025510357
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2024-05-22
- Filing Date
- 2024-10-24
- Publication Date
- 2025-11-10
- Estimated Expiration
- 2044-10-24
AI Technical Summary
Existing genetic recombination technologies for enhancing sophorolipid production in Starmerella bombicola face challenges due to the use of exogenous selection markers, which pose risks of horizontal gene transfer and regulatory compliance issues, necessitating the development of endogenous selection markers for self-cloning organisms.
Development of a Starmerella bombicola mutant strain with adenine auxotrophy by silencing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein, utilizing it as an endogenous selection marker for efficient genetic recombination and transformation.
Enables efficient transformation and production of glycolipids while ensuring the organisms are self-cloning or natural occurrences, compliant with environmental regulations and reducing the risk of horizontal gene transfer.
Smart Images

Figure 0007766844000002 
Figure 0007766844000001
Abstract
Description
[Technical Field]
[0001] The present invention relates to a novel marker for genetic recombination and its use. [Background technology]
[0002] Sophorolipids are glycolipids produced by microorganisms, primarily yeast, consisting of long-chain hydroxy fatty acids and sophorose. Sophorolipids are amphiphilic lipids with strong surface activity and excellent biodegradability, and in recent years have attracted attention for their use as biosurfactants. Because sophorolipids are produced by microorganisms and primarily comprise nonionic components, they have good skin affinity and are therefore used as penetration enhancers for cosmetics. Furthermore, because sophorolipids are highly biodegradable and effective even with small amounts, they are increasingly being used in cleaning agents such as dishwashing detergents.
[0003] To improve the productivity of sophorolipids using microorganisms, it is necessary to enhance the activity of the microorganisms. Genetic recombination technology is a major method for such activity enhancement. In the genetic recombination of microorganisms, selection markers such as drug resistance genes and auxotrophy-related genes are often used, and the desired genetically modified microorganisms are selected using the drug resistance or auxotrophy traits lost or acquired by these markers as indicators. However, genetically modified microorganisms into which foreign genes not originally present in the microorganism have been introduced carry concerns such as the risk of the introduced foreign genes being horizontally transmitted to other microorganisms, which could have a negative impact on the ecosystem.
[0004] On the other hand, the Enforcement Regulations of the Law Concerning the Sustainable Use of Biological Diversity through Regulations on the Use of Living Modified Organisms (Cartagena Protocol) stipulate that even organisms obtained using genetic engineering techniques are exempt from the scope of the law if they are self-cloning or natural occurrences, and thus self-cloning or natural occurrences are not included in genetically modified organisms. Therefore, even if genetic engineering techniques are used to improve the productivity of sophorolipids using microorganisms, it is desirable that the resulting microorganisms be self-cloning or natural occurrences.
[0005] Starmerella bombicola (formerly Candida bombicola), a nonpathogenic basidiomycete yeast, is a well-known sophorolipid-producing yeast. When modifying Starmerella bombicola, exogenous antibiotic resistance genes, such as hygromycin resistance and nourseothricin resistance, are often used as selection markers for recombinants. The only known selection marker derived from an endogenous gene (endogenous selection marker, self-marker) required for self-cloning is the ura3 gene (Non-Patent Document 1). Therefore, new endogenous selection markers (self-markers) are needed. Genes involved in the biosynthesis of amino acids and nucleic acids are generally considered as potential endogenous selection markers (self-markers), but establishing host strains with functionally defective genes that can be used for self-cloning is difficult.
[0006] (Non-Patent Document 1) Inge NA Van Bogaert et al., Yeast, 2007, 24: 201-208 Summary of the Invention
[0007] The present invention relates to the following 1) to 7). 1) A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is silenced or inactivated. 2) A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. 3) A method for transforming Starmerella bombicola, which comprises using the mutant strain described in 1) as a host. 4) A transformant obtained by the method described in 3). 5) A method for producing glycolipids, which comprises culturing the mutant strain described in 1) or the transformant described in 4). 6) An adenine-requiring selectable marker consisting of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto. 7) A vector or DNA fragment containing a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto. [Brief explanation of the drawings]
[0008] [Figure 1] Growth of a Starmerella bombicola mutant strain (T1 strain) having a mutation in the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 and the parent strain, Starmerella bombicola NBRC10243 strain, on (A) minimal agar + adenine medium and (B) minimal agar medium. Detailed Description of the Invention
[0009] If we can develop a new endogenous selection marker (self-marker) for genetic recombination that can be used in Starmerella bombicola and a genetic recombination technology using it, this could become a useful basic technology for producing substances such as glycolipids using Starmerella bombicola.
[0010] The present invention provides a novel marker for genetic recombination in Starmerella bombicola and a method for using the same.
[0011] The present inventors have succeeded in obtaining a mutant strain that exhibits adenine auxotrophy as a result of the introduction of a mutation into a specific gene by continuous subculture of a Starmerella bombicola type strain used in glycolipid production. Furthermore, the present inventors have found that it is possible to construct a Starmerella bombicola transformation system using the mutant strain as a host, and further that, by using the specific gene as an endogenous selection marker (self-marker), transformants can be efficiently selected based on the presence or absence of adenine auxotrophy.
[0012] The present invention provides a Starmerella bombicola mutant strain that exhibits adenine auxotrophy. By using the Starmerella bombicola mutant strain of the present invention as a host, efficient transformation of Starmerella bombicola can be performed using the presence or absence of adenine auxotrophy as an indicator.
[0013] All patents, non-patent documents, and other publications cited herein are hereby incorporated by reference in their entirety.
[0014] (1.Definition) Herein, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing analysis using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.
[0015] As used herein, "at least 90% identity" with respect to an amino acid sequence or a nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.
[0016] As used herein, "an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 20, preferably 1 to 10, more preferably 1 to 8, even more preferably 1 to 5, and even more preferably 1 to 3 amino acids have been deleted, substituted, added, or inserted. Furthermore, "a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 60, preferably 1 to 30, more preferably 1 to 24, even more preferably 1 to 15, and even more preferably 1 to 9 nucleotides have been deleted, substituted, added, or inserted. As used herein, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one or both ends of a sequence.
[0017] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.
[0018] As used herein, the term "operably linked" between a gene and a regulatory region such as a promoter means that the gene and regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operably linking" a gene to a regulatory region are well known to those skilled in the art.
[0019] As used herein, the term "native" when used with respect to a cellular function, property, or trait is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "exogenous" is used to indicate that the function, property, or trait is not inherently present in the cell but is introduced from outside. For example, an "exogenous" gene or polynucleotide is a gene or polynucleotide that is introduced into a cell from outside. An exogenous gene or polynucleotide may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene or polynucleotide).
[0020] As used herein, "adenine auxotrophy" refers to the requirement of adenine supplied from an external source for cell growth. Adenine-auxotrophic microbial strains are substantially unable to grow in adenine-free media, but can grow in adenine-containing media. For example, under the conditions shown in the Examples below, adenine-auxotrophic microbial strains cannot grow in adenine-free minimal solid media, but can grow in adenine-containing minimal solid media.
[0021] As used herein, "self-cloning" refers to organisms obtained using genetic engineering techniques in which the donor and host of the inserted DNA in the recombinant belong to the same species. Furthermore, as used herein, "natural occurrence" refers to organisms obtained using genetic engineering techniques in which the donor and host of the inserted DNA in the recombinant belong to different species, where genetic exchange between the two has been demonstrated in nature, and the donor and host of the inserted DNA in the recombinant belong to both species. Furthermore, as used herein, "mutation" refers to a change in genetic information caused by errors during DNA replication, DNA damage by chemicals, replication errors, DNA or chromosomal damage due to radiation, or gene disruption due to transposon transfer. Mutations that occur without human intervention are specifically referred to as "spontaneous mutations."
[0022] (2. Starmerella bombicola mutant strain) The present inventors have continued subculturing a type strain of Starmerella bombicola used in glycolipid production, and have isolated a mutant strain exhibiting adenine auxotrophy due to the introduction of a mutation into the gene encoding the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2. The amino acid sequence shown in SEQ ID NO: 2 is an amino acid sequence based on a specific ORF discovered by the present inventors as a result of ORF analysis of Starmerella bombicola, for which ORF analysis had not previously been fully performed. As shown in the Examples below, a Starmerella bombicola mutant strain having a mutation in the gene encoding the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 can grow in adenine-containing media but cannot grow in adenine-free media. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is predicted to be involved in the adenine biosynthetic pathway in Starmerella bombicola. Furthermore, an NCBI CD search revealed that it contains the FMT_core_GART domain, suggesting that it is a polypeptide with phosphoribosylglycine amidoformyltransferase activity. Therefore, we named the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein. In adenine-nonrequiring Starmerella bombicola, suppression of the expression of the phosphoribosylglycine amidoformyltransferase-like protein or inactivation of the protein by reducing or eliminating its function results in adenine biosynthesis failure or inability to synthesize adenine, thereby conferring adenine auxotrophy to the strain. Conversely, if the expression of a phosphoribosylglycine amidoformyltransferase-like protein is suppressed or the function of the protein is reduced or eliminated, causing the protein to be inactivated and Starmerella bombicola to become adenine-requiring, then the adenine requirement of Starmerella bombicola can be relieved by normally expressing the protein.In other words, the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola is a protein that has the ability to relieve the adenine requirement of Starmerella bombicola, which is adenine-requiring. In other words, it is a protein that has the function of making adenine-requiring Starmerella bombicola non-requiring.
[0023] The present invention provides a Starmerella bombicola mutant strain (hereinafter referred to as the mutant strain of the present invention). In the mutant strain of the present invention, expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. The mutant strain of the present invention can be produced by suppressing or inactivating expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. The mutant strain of the present invention exhibits adenine auxotrophy due to suppression or inactivation of expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto.
[0024] Here, the "phosphoribosylglycine amidoformyltransferase-like protein" refers to a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2.
[0025] Furthermore, a "protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein" refers to a protein that has the same function as the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and includes homologs, orthologs, or variants thereof of the phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola. A protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2. Examples of amino acid sequences that are at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2.
[0026] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is suppressed compared to the strain before mutation (parent strain). In one embodiment, the mutant strain of the present invention can be a mutant strain in which the expression level of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and even more preferably 5% or less, compared to the parent strain. Even more preferably, the mutant strain of the present invention can be a mutant strain in which the expression level of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is reduced to an undetectable level (below the expression level of a negative control or background). The expression level of a protein or polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetry, fluorometry, Western blotting, ELISA, radioimmunoassay, etc.
[0027] Methods for suppressing or inactivating the expression of Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like proteins or proteins equivalent thereto include deleting or inactivating the genes encoding them, inactivating the mRNA transcribed from the genes encoding them, suppressing translation of the mRNA of the genes encoding them by RNA interference using siRNA, mutating the genes encoding them to reduce the activity of the protein, and inactivating the protein with inhibitors such as aptamers or antibodies. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto has been deleted or inactivated.
[0028] Here, the "gene encoding a phosphoribosylglycine amidoformyltransferase-like protein" refers to a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola, and is preferably a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1.
[0029] Furthermore, a "gene equivalent to the gene encoding a phosphoribosylglycine amidoformyltransferase-like protein" refers to a gene encoding a protein equivalent to the above-mentioned Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein, preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and more preferably a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2. Examples of nucleotide sequences at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1 include nucleotide sequences in which one or more nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence set forth in SEQ ID NO: 1.
[0030] Methods for deleting or inactivating Starmerella bombicola genes include introducing mutations (deletions, insertions, substitutions, or additions) into one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the nucleotide sequence, or deleting part or all of the nucleotide sequence. Alternatively, similar mutations or nucleotide sequence substitutions, insertions, or deletions may be performed in the target gene's regulatory region, such as the promoter region. For example, by introducing mutations into the promoter controlling the expression of the target gene or replacing it with a lower-expressing promoter, promoter activity can be reduced or eliminated, thereby reducing or eliminating mRNA transcription from the target gene, thereby inactivating the target gene.
[0031] Specific techniques for the above-mentioned mutagenesis, or substitution, insertion, or deletion of nucleotide sequences can be any method for genetic modification of microorganisms known in the art, including, but not limited to, ultraviolet irradiation, site-specific mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA cleaving enzymes (artificial DNA nucleases or programmable nucleases).
[0032] After the above-mentioned mutagenesis or substitution, insertion, or deletion of a nucleotide sequence, genetic analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene can be performed to select cells having the desired mutation, thereby obtaining the mutant strain of the present invention.
[0033] Alternatively, when the gene is deleted or inactivated by homologous recombination using SOE-PCR, a drug resistance marker gene can be incorporated into the gene deletion DNA fragment to replace the target gene DNA, and cells containing the deletion DNA fragment can be cultured on a drug-containing medium and grown colonies isolated to obtain a mutant strain in which the target gene has been deleted. Furthermore, the mutation can be confirmed by the above-described genetic analysis or evaluation of polypeptide expression levels. By following these procedures, the mutant strain of the present invention can be obtained in which a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto has been deleted or inactivated.
[0034] Alternatively, the mutant strain of the present invention in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated can be obtained by confirming the adenine requirement of the mutant strain prepared by the above procedure.
[0035] Furthermore, the mutant strain of the present invention may be a spontaneous mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein corresponding thereto is suppressed or inactivated due to a spontaneous mutation that has occurred without artificial mutagenesis. The spontaneous mutant strain can be obtained, for example, by subculturing a parent strain using a culture method known in the art that does not involve artificial mutagenesis, and then performing genetic analysis or evaluating the expression level of mRNA or polypeptide encoded by a target gene on cells that have characteristics different from those of normal cells that arise during the culture, and selecting cells having the desired mutation, or by confirming adenine requirement.
[0036] A preferred example of the mutant strain of the present invention is the Starmerella bombicola T1 strain (hereinafter simply referred to as the T1 strain). The T1 strain was deposited on March 7, 2024, at the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) (Accession No. NITE BP-04096). As shown in the Examples below, the T1 strain was generated by subcultivation using the Starmerella bombicola NBRC10243 strain as a parent strain. The T1 strain exhibits adenine auxotrophy as a result of a mutation in a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein. Because the T1 strain was generated by subcultivation without artificial mutation manipulation, it is considered to be a naturally occurring mutant strain.
[0037] (3. Transformation Method) The mutant strain of the present invention exhibits adenine auxotrophy due to suppression or inactivation of expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto. A gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto is involved in the adenine auxotrophy of Starmerella bombicola and can function as an auxotrophic (adenine) selectable marker (endogenous selectable marker, self-marker) derived from an endogenous gene of Starmerella bombicola. Therefore, the mutant strain of the present invention is useful as a host in a transformation method for Starmerella bombicola, particularly in a transformation method for Starmerella bombicola in which transformants are selected using the presence or absence of adenine auxotrophy as an indicator. Therefore, the present invention also provides a method for transforming Starmerella bombicola, comprising using the mutant strain of the present invention as a host.
[0038] In the transformation method of the present invention, the polynucleotide introduced into the host is not particularly limited and may be any polynucleotide. The polynucleotide may be derived from a microorganism of the same species as the host (i.e., Starmerella bombicola) or from a microorganism of a different species from the host. However, since the resulting transformant may be a self-cloning or natural occurrence, polynucleotides derived from a microorganism of the same species as the host or a microorganism of a different species from the host where genetic exchange between the two has been shown to occur in nature are preferred, and polynucleotides derived from a microorganism of the same species as the host are even more preferred. The polynucleotide may be isolated from nature, synthesized, or produced using genetic engineering techniques. The polypeptide may be in the form of single-stranded or double-stranded DNA, RNA, or artificial nucleic acid, or may be cDNA or intron-free chemically synthesized DNA. The polynucleotide may also be codon-optimized for the host species. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).
[0039] The polynucleotide can be introduced into a host by, for example, introducing a vector or a DNA fragment containing the polynucleotide into the host.
[0040] The vector containing the polynucleotide may be a vector capable of autonomous replication and propagation outside the chromosome, or may be a vector integrated into the chromosome. The type of vector is not particularly limited, and examples include plasmids, cosmids, phages, viruses, YACs, and BACs. Among these, plasmid vectors are preferred. Those skilled in the art can select an appropriate vector depending on the type of host. Plasmid vectors may be prepared according to the host, or commercially available products may be used.
[0041] Examples of DNA fragments containing the above polynucleotides include PCR-amplified DNA fragments and restriction enzyme-cleaved DNA fragments.
[0042] The vector or DNA fragment may further incorporate a selection marker such as an antibiotic resistance gene or an auxotrophy-related gene to select transformants into which the vector or DNA fragment has been appropriately introduced. Alternatively, the selection marker may be incorporated into the vector or DNA fragment as both a selection marker and a polynucleotide to be introduced into the host. The selection marker incorporated into the vector or DNA fragment is preferably a gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto, more preferably a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2, even more preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1 or a gene consisting of a nucleotide sequence at least 90% identical to the nucleotide sequence set forth in SEQ ID NO: 1, and even more preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1.
[0043] When the polynucleotide to be introduced into a host contains a gene, the vector or DNA fragment preferably further contains, in addition to the gene, a control region operably linked to the gene. The control region is a sequence for expressing the gene in the host into which the vector or DNA fragment has been introduced, and examples thereof include expression regulatory regions such as promoters and terminators, origins of replication, and secretion signal regions for secreting the expressed protein extracellularly. The type of control region is not particularly limited, and commonly used promoters and secretion signal sequences can be appropriately selected and used depending on the host into which the vector or DNA fragment is introduced. For example, suitable examples of control sequences include promoters and secretion signal sequences derived from Starmerella bombicola.
[0044] The polynucleotide contained in the vector or DNA fragment to be introduced into a host may be introduced into the host nucleus or into the host genome. Methods for introducing a polynucleotide into a genome include homologous recombination.
[0045] The vector or DNA fragment can be introduced into a host by any commonly used method, such as electroporation, particle gun method, lithium acetate method, or heat treatment.
[0046] Transformants into which a vector or DNA fragment of interest has been introduced can be selected using a selection marker. For example, if the selection marker is an antibiotic resistance gene, transformants into which a vector or DNA fragment of interest has been introduced can be selected by culturing cells in a medium supplemented with the antibiotic. Furthermore, for example, if the selection marker is an auxotrophy-related gene, the vector or DNA fragment can be introduced into a host with a specific auxotrophy, and then the presence or absence of the auxotrophy can be used as an indicator to select transformants into which a vector or DNA fragment of interest has been introduced. Alternatively, introduction of a vector or DNA fragment of interest can be confirmed by examining the DNA sequence of the transformant using PCR or other methods.
[0047] In a preferred embodiment, the transformation method of the present invention uses a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein from Starmerella bombicola or a gene equivalent thereto as a selection marker. This gene is involved in the adenine requirement of Starmerella bombicola. The mutant strain of the present invention used as a host in the transformation method of the present invention is adenine auxotrophic, but transformants into which this gene has been introduced are relieved of the adenine requirement and become adenine-nonauxotrophic, and can grow in adenine-free medium. Therefore, transformants into which the desired vector or DNA fragment has been introduced can be selected by culturing cells in adenine-free medium. Furthermore, because this gene functions as an endogenous selection marker (self-marker) for Starmerella bombicola, transformants obtained by the transformation method of the present invention using this gene as a selection marker can be considered self-cloning as long as the host is a mutant strain of the present invention, preferably the T1 strain, that does not contain a foreign gene, and the polynucleotide introduced into the host is derived from a microorganism of the same species as the host (i.e., Starmerella bombicola). Alternatively, the polynucleotide introduced into the host can be considered natural occurrence as long as the polynucleotide is derived from a microorganism of a different species from the host, where genetic exchange between the two has been shown to occur in nature. Therefore, in a more preferred embodiment, the transformation method of the present invention uses a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein gene or a gene corresponding thereto as a selection marker, a mutant strain of the present invention that does not contain a foreign gene as a host, and a polynucleotide introduced into the host is derived from a microorganism of the same species as the host or a microorganism of a different species from the host, where genetic exchange between the two has been shown to occur in nature, more preferably a microorganism of the same species as the host.
[0048] The gene encoding the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto as an endogenous selectable marker (self-marker) is preferably an isolated gene. Here, "isolated gene" refers to a gene that exists independently of the genomic DNA of the organism from which it originates, and includes genes separated from the genomic DNA of the organism from which it originates and genes synthesized by genetic engineering or chemical engineering. The gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto can be prepared from Starmerella bombicola harboring the gene by standard methods, either by extracting genomic DNA or by extracting RNA and synthesizing cDNA by reverse transcription. For example, the gene encoding the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein can be prepared from the Starmerella bombicola NBRC10243 strain. A gene corresponding to the gene encoding the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein can be prepared by modifying the gene encoding the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein using various known mutagenesis techniques. Alternatively, a gene encoding the Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto can be prepared by genetic engineering or chemical synthesis of a corresponding nucleotide sequence based on the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto.
[0049] According to the transformation method of the present invention, for example, a transformant in which the desired polynucleotide has been introduced into the mutant strain of the present invention can be obtained by introducing the desired polynucleotide to be introduced into the host and a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein of Starmerella bombicola or a gene corresponding thereto as a selection marker into the host mutant strain of the present invention, and selecting cells that are not adenine-requiring.
[0050] Alternatively, according to the transformation method of the present invention, for example, a gene encoding a Starmerella bombicola phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto can be introduced as a selection marker into the genome of a host mutant strain of the present invention so that a desired endogenous polynucleotide is deleted or inactivated in the host genome, and adenine-non-requiring cells can be selected to obtain a transformant in which the desired endogenous polynucleotide is deleted or inactivated in the genome of the mutant strain of the present invention. Here, the desired endogenous polynucleotide is not particularly limited as long as it is a polynucleotide contained in the genome of the host before transformation, and may be any polynucleotide.
[0051] (4. Method for producing glycolipids) Starmerella bombicola is known to produce glycolipids using hydrocarbon chains of various chain lengths, fatty acids, and the like as substrates. Therefore, by culturing the mutant strain of the present invention described in 2 above or the transformant obtained by the transformation method of the present invention described in 3 above (hereinafter referred to as the transformant of the present invention) with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, and the like of the desired chain length can be efficiently produced. Therefore, the present invention also provides a method for producing glycolipids, which comprises culturing the mutant strain of the present invention or the transformant of the present invention.
[0052] The glycolipid is not particularly limited as long as it can be produced by the mutant strain or transformant of the present invention, but preferably includes glycolipids containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain, more preferably includes glycolipids containing glucose, sophorose, cellobiose or an acetylated form thereof as the sugar or sugar chain, even more preferably includes sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid and cellobioselipid, even more preferably includes sophorolipid, Bola-type sophoroside, alkyl sophoroside, and even more preferably includes sophorolipid and Bola-type sophoroside.
[0053] The transformant used in the method for producing glycolipids of the present invention is not particularly limited as long as it is a transformant obtained by the transformation method of the present invention. For example, a transformant modified to improve the glycolipid-producing ability of Starmerella bombicola is preferably used. Examples of transformants modified to improve the glycolipid-producing ability of Starmerella bombicola include a transformant in which the expression of a polypeptide involved in suppressing the ability to produce a target glycolipid in Starmerella bombicola is suppressed or inactivated, a transformant in which the expression of a polypeptide involved in improving the ability to produce a target glycolipid in Starmerella bombicola is enhanced, and a transformant in which the expression of various enzymes required to produce a target glycolipid is enhanced.
[0054] In a preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 has been suppressed or inactivated by the transformation method of the present invention. The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 is a putative transcription factor protein, more preferably a putative transcription factor protein having two zinc finger C2H2-type DNA-binding domains. The presence or absence of zinc finger C2H2-type DNA-binding domains in a certain polypeptide can be confirmed by analyzing the amino acid sequence using, for example, NCBI CD search, although the method for analyzing the presence or absence of such domains is not limited thereto. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 has been deleted or inactivated, more preferably a transformant in which a gene encoding the nucleotide sequence shown in SEQ ID NO: 22 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 22 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 22 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 22 and consisting of the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 has been deleted or inactivated. Here, it has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 is encoded by the nucleotide sequence shown in SEQ ID NO: 22 in Starmerella bombicola, and that a Starmerella bombicola mutant strain in which the expression of this polypeptide is suppressed or inactivated has improved sophorolipid production ability compared to the parent strain (Patent Publication No. 6725506).A specific example of the transformant is the Starmerella bombicola T1Δseq1::ade strain shown in the Examples below. The T1Δseq1::ade strain is a self-cloning strain, as it was transformed using the T1 strain, which is considered to be a spontaneous mutant strain, as a host. The gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 present in the genome of the Starmerella bombicola NBRC10243 strain has been inserted in place of the gene consisting of the nucleotide sequence shown in SEQ ID NO: 22 present in the genome of the T1 strain.
[0055] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which FAO1 (fatty alcohol oxidase 1) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "FAO1" refers to Starmerella bombicola FAO1, a polypeptide having fatty alcohol oxidase activity, preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 35. Furthermore, "a protein equivalent to FAO1" refers to a protein having the same function as Starmerella bombicola FAO1, including homologs, orthologs, or variants thereof of Starmerella bombicola FAO1. A protein equivalent to FAO1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 35. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 35 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 35. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 35 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 34 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34 and consisting of the amino acid sequence shown in SEQ ID NO: 35 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 35 has been deleted or inactivated.It has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 34, and that a Starmerella bombicola mutant strain in which the expression of this polypeptide is suppressed or inactivated is capable of producing Bola-type sophorosides, alkylsophorosides, alkylglucosides, and Bola-type glucosides (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528). A specific example of the above transformant is the Starmerella bombicola T1Δfao1::ade strain shown in the Examples below. The T1Δfao1::ade strain was transformed using the T1 strain, which is thought to be a spontaneous mutant strain, as a host, and a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 present in the genome of Starmerella bombicola NBRC10243 strain was inserted in place of the fao1 gene consisting of the nucleotide sequence shown in SEQ ID NO: 34 present in the genome of the T1 strain, and therefore is thought to be a self-cloning strain.
[0056] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52M1 (CYP52M1 cytochrome P450 monooxygenase) or a protein corresponding thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "CYP52M1" refers to CYP52M1 from Starmerella bombicola, a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols, preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 37. Furthermore, "a protein corresponding to CYP52M1" refers to a protein having the same function as CYP52M1 from Starmerella bombicola, including homologs, orthologs, or variants thereof of CYP52M1 from Starmerella bombicola. The protein corresponding to CYP52M1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 37. An example of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 37 is an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 37. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 37 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 36 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 36 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 36 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 36 and consisting of the amino acid sequence shown in SEQ ID NO: 37 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 37 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 37 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 36. It has been reported that a Starmerella bombicola mutant strain in which the cyp52M1 gene and the fao1 gene are disrupted has good productivity of Bola-type sophoroside and suppresses the by-production of sophorolipid (WO 2020 / 104582).
[0057] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52N1 (CYP52N1 cytochrome P450 monooxygenase) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "CYP52N1" refers to CYP52N1 from Starmerella bombicola, which, like the above-mentioned CYP52M1, is a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 39. Furthermore, "a protein equivalent to CYP52N1" refers to a protein having the same function as CYP52N1 from Starmerella bombicola, and includes homologs, orthologs, and mutants of CYP52N1 from Starmerella bombicola. A protein corresponding to CYP52N1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 39 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 39.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 39 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 38 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 38 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 38 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 38 and consisting of the amino acid sequence shown in SEQ ID NO: 39 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 39 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39 is encoded by the nucleotide sequence shown in SEQ ID NO: 38 in Starmerella bombicola.
[0058] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52E3 (CYP52E3 cytochrome P450 monooxygenase) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "CYP52E3" refers to CYP52E3 from Starmerella bombicola, which, like the above-mentioned CYP52M1, is a polypeptide having hydroxylation activity at the ω- or ω-1-position of fatty acids or fatty alcohols (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 41. Furthermore, "a protein equivalent to CYP52E3" refers to a protein having the same function as CYP52E3 from Starmerella bombicola, including homologs, orthologs, and mutants thereof of CYP52E3 from Starmerella bombicola. A protein corresponding to CYP52E3 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 41. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 41 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 41.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 41 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 41 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 40 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 40 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 40 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 40 and consisting of the amino acid sequence shown in SEQ ID NO: 41 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 41 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 41 is encoded by the nucleotide sequence shown in SEQ ID NO: 40 in Starmerella bombicola.
[0059] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTB1 (UDP-glucosyltransferase B1) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "UGTB1" refers to UGTB1 from Starmerella bombicola, a polypeptide having glycosyltransferase activity on hydroxylated fatty acids using UDP-glucose as a donor, preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 43. Furthermore, "a protein equivalent to UGTB1" refers to a protein having the same function as UGTB1 from Starmerella bombicola, including homologs, orthologs, or variants thereof of UGTB1 from Starmerella bombicola. A protein equivalent to UGTB1 is preferably a polypeptide consisting of an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 43. Examples of amino acid sequences at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 43 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 43. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 43 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 42 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 42 and consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 43 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 is encoded by the nucleotide sequence shown in SEQ ID NO: 42 in Starmerella bombicola. It has been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene has been disrupted is capable of producing glucolipids (Sofie Lodens et al., Biotechnol Bioeng., 2020, 117(2): 453-465). It has also been reported that a Starmerella bombicola mutant strain in which the ugtB1 gene, fao1 gene, and cyp52M1 gene have been disrupted is capable of producing alkylglucosides and alkylsophorosides (WO 2021 / 229017).
[0060] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTA1 (UDP-glucosyltransferase A1) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "UGTA1" refers to UGTA1 from Starmerella bombicola, a polypeptide that, like the above-mentioned UGTB1, has the activity of transglycosylating hydroxylated fatty acids using UDP-glucose as a donor (Karen MJ Saerens et al., FEMS Yeast Res., 2015, 15(7): fov075), preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 45. Furthermore, "a protein equivalent to UGTA1" refers to a protein having the same function as UGTA1 from Starmerella bombicola, including homologs, orthologs, or variants thereof of UGTA1 from Starmerella bombicola. The protein equivalent to UGTA1 is preferably a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 45. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 45 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 45.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 45 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 44 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 44 and consisting of the amino acid sequence shown in SEQ ID NO: 45 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 45 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 is encoded by the nucleotide sequence shown in SEQ ID NO: 44 in Starmerella bombicola.
[0061] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of AT (acetyl transferase) or a protein corresponding thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "AT" refers to the AT of Starmerella bombicola, a polypeptide having the activity of acetylating the OH moiety of sugars, preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47. Furthermore, "a protein corresponding to AT" refers to a protein having the same function as the AT of Starmerella bombicola, including a homolog, ortholog, or variant thereof of the AT of Starmerella bombicola. The protein corresponding to AT is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 47. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 47 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 46 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 46 and consisting of the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 47 has been deleted or inactivated. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 is encoded by the nucleotide sequence shown in SEQ ID NO: 46 in Starmerella bombicola.It has been reported that a mutant of Starmerella bombicola in which the at gene is disrupted produces non-acetylated sophorolipids (Karen MJ Saerens et al., Biotechnol Bioeng., 2011, 108(12): 2923-2931).
[0062] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which the expression of SBLE (Starmerella bombicola lactone esterase) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "SBLE" refers to SBLE of Starmerella bombicola, a polypeptide having the lactonization activity of sophorolipids, preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49. Furthermore, "a protein equivalent to SBLE" refers to a protein having the same function as SBLE of Starmerella bombicola, including homologs, orthologs, or variants thereof of SBLE of Starmerella bombicola. A protein equivalent to SBLE is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 49. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 49 has been deleted or inactivated, more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 48 has been deleted or inactivated, and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 48 and consisting of the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 49 has been deleted or inactivated.The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 is encoded in Starmerella bombicola by the nucleotide sequence shown in SEQ ID NO: 48. It has been reported that the ratio of acid-type sophorolipids is increased in a Starmerella bombicola mutant strain in which the sble gene is disrupted (Katarzyna Ciesielska et al., Appl Microbiol Biotechnol., 2016, 100(22): 9529-9541). It has also been reported that a Starmerella bombicola mutant strain in which the sble gene and at gene are disrupted is capable of producing non-acetylated Bola-type sophorolipids (WO 2015 / 028278).
[0063] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which expression of MDR1 (multidrug resistance protein 1) or a protein equivalent thereto is enhanced by the transformation method of the present invention. Here, "MDR1" refers to MDR1 of Starmerella bombicola, a transporter polypeptide responsible for intracellular and extracellular transport of sophorolipids, and is preferably a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 51. Furthermore, "a protein equivalent to MDR1" refers to a protein having the same function as MDR1 of Starmerella bombicola and includes homologs, orthologs, or variants thereof of MDR1 of Starmerella bombicola. The protein equivalent to MDR1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 51. Examples of amino acid sequences having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 51 include amino acid sequences in which one or several amino acids are deleted, substituted, added, or inserted relative to the amino acid sequence set forth in SEQ ID NO: 51. The transformant is preferably a transformant in which expression has been enhanced of a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 51, more preferably a transformant in which expression has been enhanced of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 50, and even more preferably a transformant in which expression has been enhanced of a gene consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 50, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 51. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 is encoded by the nucleotide sequence shown in SEQ ID NO: 50 in Starmerella bombicola.It has been reported that the productivity of sophorolipids and Bola-type sophorolipids is significantly reduced in Starmerella bombicola mutants in which the mdr1 gene is disrupted (Silke Claus et al., BMC Genomics, 2022, 23(1): 22).
[0064] In another preferred embodiment, the transformant used in the glycolipid production method of the present invention is a transformant in which the expression of MFE-2 (multifunctional enzyme type 2) or a protein equivalent thereto has been suppressed or inactivated by the transformation method of the present invention. Here, "MFE-2" refers to Starmerella bombicola MFE-2, a polypeptide involved in the beta-oxidation degradation of fatty acids. Furthermore, "proteins equivalent to MFE-2" refer to proteins that have the same function as Starmerella bombicola MFE2 and include homologs, orthologs, or mutants of Starmerella bombicola MFE2. It has been reported that a Starmerella bombicola mutant strain in which the mfe-2 gene is disrupted produces sophorolipids with a medium-chain fatty acid backbone (Inge N.A. Van Bogaert et al., FEMS Yeast Res., 2009, 9(4): 610-617).
[0065] In the method for producing glycolipids of the present invention, the mutant strain of the present invention or the transformant of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, fats and oils, alkanes, alkenes, alkynes, alcohols, etc. Glycolipids can be produced by recovering them from the medium after the culture and purifying them as necessary.
[0066] The medium used for the above-mentioned culture can be a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins. The medium may be either a synthetic medium or a natural medium.
[0067] The carbon and nitrogen sources contained in the medium may be of any type that can be utilized by the mutant or transformant being cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used alone or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.
[0068] Examples of the inorganic salts include phosphates, magnesium salts, calcium salts, iron salts, manganese salts, etc. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones containing these, casamino acids, yeast extract, soy protein hydrolysates, etc. When using an auxotrophic mutant or transformant that requires amino acids or the like for growth, the required nutrients may be supplemented.
[0069] Preferred examples of substrates that can be contained in the medium include C12-22 fatty acids and their alkyl esters, triacylglycerols containing C12-22 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols containing C12-18 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. More preferred examples include C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, and C12 to C18 alcohols.
[0070] More specific examples of the substrate include, but are not limited to, the C12-22 fatty acids, which may be saturated or unsaturated, and may be straight-chain or branched, such as lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the alkyl esters of the C12-22 fatty acids include alkyl esters of the above-listed fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and the fats and oils containing the C12-22 fatty acids or alkyl esters thereof include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.
[0071] The C12-22 alkanes may be straight-chain or branched, and examples thereof include dodecane, tridecane, tetradecane, pentadecane, hexadecane, heptadecane, octadecane, nonadecane, icosane, henicosane, and docosane; the C12-22 alkenes may be straight-chain or branched, and examples thereof include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecene, and 1-hexadecene. , 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-heneicosene, 1-docosene, etc.; the C12-22 alkynes may be linear or branched, and examples thereof include 1-dodecyne, 1-tridecyne, 1-tetradecyne, 1-pentadecyne, 1-hexadecyne, 1-heptadecyne, 1-octadecyne, 1-nonadecyne, 1-icosine, 1-heneicosine, 1-docosine, etc.
[0072] The C12-22 alcohol may be a saturated or unsaturated alcohol, and may be a straight-chain or branched-chain alcohol, and examples thereof include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitoleyl alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.
[0073] The substrates listed above can be used alone or in combination of two or more. Preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, or fats and oils containing them, or alkanes, alkenes, alkynes, or alcohols with a chain length of C12 to C18 are used. More preferably, fatty acids with a chain length of C12 to C18 or their alkyl esters, or alcohols with a chain length of C12 to C18 are used. Even more preferably, fatty acids with a chain length of C16 to C18 or their alkyl esters, or alcohols with a chain length of C16 to C18 are used. Even more preferably, C18 fatty acids or their alkyl esters, or C18 alcohols are used. Even more preferably, oleic acid or its alkyl esters, or oleyl alcohol are used. Rapeseed oil, whose main component is triacylglycerols containing a large amount of oleic acid as a constituent fatty acid, is also preferably used.
[0074] The content of the above-mentioned substrate that can be contained in the medium (at the time of adding the substrate) is preferably 0.1 mass / volume% or more, more preferably 0.5 mass / volume% or more, even more preferably 1 mass / volume% or more, even more preferably 2 mass / volume% or more, even more preferably 3 mass / volume% or more, and even more preferably 5 mass / volume% or more in terms of the amount of glycolipid produced, and is preferably 40 mass / volume% or less, more preferably 30 mass / volume% or less, even more preferably 25 mass / volume% or less, even more preferably 20 mass / volume% or less, even more preferably 15 mass / volume% or less, and even more preferably 10 mass / volume% or less in terms of glycolipid production efficiency. Alternatively, preferably, the amount is 0.1 to 40 mass / volume%, 0.1 to 30 mass / volume%, 0.1 to 25 mass / volume%, 0.1 to 20 mass / volume%, 0.1 to 15 mass / volume%, 0.1 to 10 mass / volume%, 0.5 to 40 mass / volume%, 0.5 to 30 mass / volume%, 0.5 to 25 mass / volume%, 0.5 to 20 mass / volume%, 0.5 to 15 mass / volume%, 0.5 to 10 mass / volume%, 1 to 40 mass / volume%, 1 to 30 mass / volume%, 1 to 25 mass / volume%, 1 to 20 mass / volume%, 1 to 15 mass / volume%. %, 1 to 10 mass / volume%, 2 to 40 mass / volume%, 2 to 30 mass / volume%, 2 to 25 mass / volume%, 2 to 20 mass / volume%, 2 to 15 mass / volume%, 2 to 10 mass / volume%, 3 to 40 mass / volume%, 3 to 30 mass / volume%, 3 to 25 mass / volume%, 3 to 20 mass / volume%, 3 to 15 mass / volume%, 3 to 10 mass / volume%, 5 to 40 mass / volume%, 5 to 30 mass / volume%, 5 to 25 mass / volume%, 5 to 20 mass / volume%, 5 to 15 mass / volume%, or 5 to 10 mass / volume%. In this specification, volume refers to the volume at 25°C and 1 atmosphere.
[0075] The culture conditions may be any conditions that allow the mutant strain or transformant of the present invention to produce glycolipids by fermentation. Culturing is preferably carried out under aerobic conditions, and common methods such as aeration and agitation culture or shaking culture can be used. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the medium (at 30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.
[0076] In the above-mentioned culture, the mutant strain of the present invention or the transformant of the present invention may be cultured under conditions in which the cells grow, thereby producing glycolipids by fermentation, or the mutant strain of the present invention or the transformant of the present invention may be cultured in a resting cell state, i.e., in a state in which growth and proliferation have stopped, thereby producing glycolipids by fermentation.
[0077] The method for recovering glycolipids from the culture medium after cultivation is not particularly limited, and may be performed according to a known recovery method. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in combination as appropriate.
[0078] The following compositions, manufacturing methods, uses, and methods are further disclosed herein as exemplary embodiments of the present invention, but the present invention is not limited to these embodiments.
[0079] [1] A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. [2] The mutant strain described in [1], wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. [3] The mutant strain according to [1] or [2], in which a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto is deleted or inactivated. [4] The mutant strain described in [3], wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the phosphoribosylglycine amidoformyltransferase-like protein gene is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1. [5] The mutant strain according to any one of [1] to [4], which is adenine auxotrophic. [6] The mutant strain according to any one of [1] to [5], which is Starmerella bombicola T1 strain (accession number NITE BP-04096).
[0080] [7] A method for producing a Starmerella bombicola mutant, which comprises suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola. [8] The method described in [7], wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2. [9] The method described in [7] or [8], which comprises deleting or inactivating a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto.
[10] The method described in [9], wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.
[11] The method according to any one of [7] to
[10] , which is a method for producing an adenine-requiring Starmerella bombicola mutant.
[0081]
[12] A method for transforming Starmerella bombicola, comprising using the mutant strain according to any one of [1] to [6] as a host.
[13] The method described in
[12] , further comprising introducing a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto into the host as an adenine-requiring selection marker.
[14] The method described in
[13] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.
[15] The method according to any one of
[12] to
[14] , further comprising selecting a transformant using the presence or absence of adenine auxotrophy as an indicator.
[16] The method according to any one of
[12] to
[15] , wherein the mutant strain is a mutant strain that does not contain a foreign gene, preferably Starmerella bombicola T1 strain, and a polynucleotide derived from a microorganism of the same species as the host or a microorganism of a different species from the host, where gene exchange between the host and the different species has been shown to occur in nature, preferably a polynucleotide derived from a microorganism of the same species as the host, is introduced into the host.
[17] The method according to any one of
[12] to
[16] , wherein a transformant capable of growing in an adenine-free medium is selected.
[0082]
[18] A transformant obtained by the method according to any one of
[12] to
[17] .
[19] A transformant described in
[18] , in which expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 is suppressed or inactivated.
[20] A transformant described in
[18] or
[19] , in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 22 or a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 22 is deleted or inactivated.
[21] The transformant according to any one of
[18] to
[20] , wherein FAO1 or a protein corresponding thereto is expression-repressed or inactivated.
[22] The transformant described in
[21] , wherein the FAO1 is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 35, and the protein corresponding to the FAO1 is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 35.
[23] The transformant according to any one of
[18] to
[22] , in which the fao1 gene or a gene corresponding thereto is deleted or inactivated.
[24] A transformant described in
[23] , wherein the fao1 gene is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 34, and the gene corresponding to the fao1 gene is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 34.
[0083]
[25] A method for producing a glycolipid, comprising culturing the mutant strain according to any one of [1] to [6] or the transformant according to any one of
[18] to
[24] .
[26] The method described in
[25] , wherein the glycolipid is selected from sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids, and cellobiose lipids, preferably sophorolipids, Bola-type sophorosides, and alkyl sophorosides.
[27] The method according to
[25] or
[26] , wherein the culture medium contains the following substrates: at least one substrate selected from the group consisting of C12 to C22 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C22 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C22 fatty acids or alkyl esters thereof, C12 to C22 alkanes, C12 to C22 alkenes, C12 to C22 alkynes, and C12 to C22 alcohols; At least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, oils and fats containing C12 to C18 fatty acids or alkyl esters thereof, C12 to C18 alkanes, C12 to C18 alkenes, C12 to C18 alkynes, and C12 to C18 alcohols; or At least one substrate selected from the group consisting of C12-C18 fatty acids and alkyl esters thereof, and C12-C18 alcohols.
[28] The content of the substrate in the medium is preferably 0.1% by mass / volume or more, more preferably 0.5% by mass / volume or more, even more preferably 1% by mass / volume or more, still more preferably 2% by mass / volume or more, still more preferably 3% by mass / volume or more, still more preferably 5% by mass / volume or more, and preferably 40% by mass / volume or less, more preferably 30% by mass / volume or less, even more preferably 25% by mass / volume or less, still more preferably 20% by mass / volume or less, still more preferably 15% by mass / volume or less, still more preferably 10% by mass / volume or less, or preferably 0.1 to 40% by mass / volume, 0.1 to 30% by mass / volume, 0.1 to 25% by mass / volume, 0.1 to 20% by mass / volume, 0.1 to 15% by mass / volume, 0.1 to 10% by mass / volume, 0.5 to 40% by mass / volume, Volume%, 0.5-30 mass / volume%, 0.5-25 mass / volume%, 0.5-20 mass / volume%, 0.5-15 mass / volume%, 0.5-10 mass / volume%, 1-40 mass / volume%, 1-30 mass / volume%, 1-25 mass / volume%, 1-20 mass / volume%, 1-15 mass / volume%, 1-10 mass / volume%, 2-40 mass / volume%, 2-30 mass / volume%, 2-25 mass / volume%, 2-20 mass / vol%, 2 to 15 mass / vol%, 2 to 10 mass / vol%, 3 to 40 mass / vol%, 3 to 30 mass / vol%, 3 to 25 mass / vol%, 3 to 20 mass / vol%, 3 to 15 mass / vol%, 3 to 10 mass / vol%, 5 to 40 mass / vol%, 5 to 30 mass / vol%, 5 to 25 mass / vol%, 5 to 20 mass / vol%, 5 to 15 mass / vol%, or 5 to 10 mass / vol%.
[29] The method according to any one of
[25] to
[28] , further comprising recovering glycolipids from the culture medium after the culture.
[0084]
[30] An adenine-requiring selectable marker consisting of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto, preferably an isolated gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or an isolated gene equivalent thereto.
[31] An adenine-requiring selectable marker described in
[30] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.
[32] Use of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene equivalent thereto, preferably an isolated gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or an isolated gene equivalent thereto, as an adenine-requiring selection marker.
[33] The use described in
[32] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1.
[34] A vector or DNA fragment containing a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene corresponding thereto.
[35] A vector or DNA fragment described in
[34] , wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1. [Example]
[0085] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.
[0086] Example 1: Obtaining a Starmerella bombicola mutant (1) Acquisition of T1 shares Semi-continuous culture for glycolipid production was performed using the Starmerella bombicola strain NBRC10243 (ATCC22214) as the reference strain. A loopful of NBRC10243 glycerol stock was inoculated onto YPD agar medium (1% glucose, 1% yeast extract, 1% tryptone, 1.5% agar) and cultured statically at 30°C. The resulting bacteria were then inoculated into a Sakaguchi flask containing 75 mL of YPD medium (1% glucose, 1% yeast extract, 1% tryptone) and cultured at 30°C with shaking at 120 rpm for 42 hours. 24 mL of the seed culture was added to 1.2 L of glycolipid production medium 1 (0.1% urea, 2% yeast extract, 10% ethyl palmitate, and 10% glucose) and cultured in a 2 L jar fermenter at 30°C with stirring. After this, aeration, agitation, and temperature control were stopped, and the mixture was left to stand for 1 hour. The glycolipid layer was then removed. 120 g of ethyl palmitate and 120 g of glucose were added to the remaining aqueous layer, and sterile water was added to bring the volume to 1.2 L. Aeration, agitation, and control at 30°C were then resumed. The above procedure was repeated for 15 days, and the culture was diluted appropriately. Single colonies were isolated on YPD agar medium. The isolated colonies were then cultured again on glycolipid production medium 1 and evaluated. Colonies exhibiting characteristics different from normal colonies during culture were designated as Starmerella bombicola T1 strain. The T1 strain is a spontaneous mutant strain, and analysis of the genome of the T1 strain confirmed that a mutation had been introduced into the gene set forth in SEQ ID NO:1.
[0087] (2) Confirmation of mutations in the T1 strain PCR was performed using primers (SEQ ID NO: 3: ATGTCGATAGTTGTGCTGATTTCG, SEQ ID NO: 4: CTAGATGCCCTTGTGAATGCGTG) and a single colony from each strain as a template to confirm the presence or absence of amplification of the nucleotide sequence shown in SEQ ID NO: 1. As a control, PCR was performed using primers (SEQ ID NO: 6: ATGCAGGACGATCAGTACGCTTTG, SEQ ID NO: 7: TTAGGGACAGCGGCGGTGGAC) designed to amplify the nucleotide sequence of the actin gene shown in SEQ ID NO: 5. As a result, amplification of the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 5 was confirmed in the NBRC10243 strain, whereas amplification of the nucleotide sequence shown in SEQ ID NO: 5 was confirmed in the T1 strain, but not the nucleotide sequence shown in SEQ ID NO: 1. These results indicate that the T1 strain has a deletion or mutation of the sequence shown in SEQ ID NO: 1.
[0088] (3) Confirmation of adenine requirement of T1 strain The NBRC10243 and T1 strains were inoculated into minimal agar medium (0.7% wt / vol yeast nitrogen base (amino acid-free), 2% wt / vol glucose, 1.5% wt / vol agar) and minimal agar + adenine medium (0.03% wt / vol adenine sulfate, 0.7% wt / vol yeast nitrogen base (amino acid-free), 2% wt / vol glucose, 1.5% wt / vol agar), and static culture was performed at 30°C. Growth of the NBRC10243 strain was observed in both media, whereas growth of the T1 strain was observed in minimal agar + adenine medium but not in minimal agar medium (Figure 1). Therefore, it was confirmed that the T1 strain is adenine auxotrophic.
[0089] Example 2 Preparation of transformants and production of glycolipids 1 (1) Genomic DNA extraction from the NBRC10243 strain Genomic DNA was extracted and purified from the NBRC10243 strain using GenTorukun (for yeast) High Recovery (Takara Bio) according to the attached protocol.
[0090] (2) Amplification of a genomic DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for all PCR reactions performed hereinafter. A DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 8: CCTCTTACCAATTGAACTATGGAAATTAATGAAGAATTGGGCTG and SEQ ID NO: 9: TCGGACAACAATTCATCTGCAGACATAGCCGAAATTCTACTGTGAG) with the genomic DNA of the NBRC10243 strain as a template.
[0091] (3) Amplification of genomic DNA fragments 1 kbp upstream and 1 kbp downstream of the seq1 gene Similarly, using the genomic DNA of the NBRC10243 strain as a template, a 1-kbp DNA fragment upstream of the seq1 gene was amplified using primers (SEQ ID NO: 10: GCCAAGCTTGCATGCTCCAATTTCTAAGGCGCAAGCGACGCTTCTAG and SEQ ID NO: 11: TCAATTGGTAAGAGGGAACGCGTAG), and a 1-kbp DNA fragment downstream of the seq1 gene was amplified using primers (SEQ ID NO: 12: TGAATTGTTGTCCGAATGCTCTGC and SEQ ID NO: 13: AGAGTCGACCTGCAGCCCAACGCCTTGACAAGCTTTCCAAATAGAG).
[0092] (4) Amplification of vector fragments A vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template and primers (SEQ ID NO: 14: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 15: CTGCAGGTCGACTCTAGAGGATCCCCG).
[0093] (5) Preparation of template plasmid pbJK8 for the introduced DNA fragment The four PCR products described in (2), (3), and (4) were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) to separate DNA fragments, which were then ligated using the In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene Co., Ltd.), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 16: CTCTTCGCTATTACGCCAGC and SEQ ID NO: 17: CACTTTATGCTTCCGGCTCG). Transformants carrying the plasmids for which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), and plasmid pbJK8 was obtained, which contains a DNA fragment containing 1 kbp upstream of the seq1 gene and the nucleotide sequence shown in sequence number 1, and a DNA fragment containing 1 kbp downstream of the seq1 gene linked together.
[0094] (6) Preparation of DNA fragment for introduction Using the plasmid pbJK8 as a template and primers (SEQ ID NO: 18: TCCAATTTCTAAGGCGCAAGCGAC and SEQ ID NO: 19: CCCAACGCCTTGACAAGCTTTCC), a DNA fragment containing 1 kbp upstream of the seq1 gene, a DNA sequence containing SEQ ID NO: 1, and 1 kbp downstream of the seq1 gene was amplified. The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragments were sequenced, and it was confirmed that all of the DNA fragments were composed of gene sequences present in the genome of the NBRC10243 strain.
[0095] (7) Insertion of DNA fragment into T1 strain and generation of T1Δseq1::ade strain The T1 strain was transformed by electroporation (Nepa Gene) with the DNA fragment obtained in (6), which contained a 1 kbp upstream region of the seq1 gene, a DNA sequence containing SEQ ID NO: 1, and a 1 kbp downstream region of the seq1 gene. The transformed cell sap was plated on minimal agar medium and incubated at 30°C for 3 days. PCR was performed using the resulting colonies as templates with primers (SEQ ID NO: 20: CATGATTGAGTGACGTACGATG and SEQ ID NO: 21: CACAGTTCCATACAAGCCAG), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment had been integrated into the genome, this strain was designated Starmerella bombicola T1Δseq1::ade. This strain contains a DNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1 inserted into the genome, replacing the seq1 gene. It has been reported that deletion or inactivation of the seq1 gene (SEQ ID NO: 22) improves sophorolipid productivity compared to the parent strain (Japanese Patent No. 6725506).
[0096] (8) Confirmation of adenine requirement of the T1Δseq1::ade strain The T1Δseq1::ade strain obtained in (7) and the host strain T1 were inoculated onto minimal agar medium and subjected to static culture at 30°C. As a result, growth of the T1 strain on minimal agar medium was not observed, whereas growth of the obtained T1Δseq1::ade strain was observed, confirming that the adenine requirement was relieved by the insertion of the nucleotide sequence shown in SEQ ID NO: 1. The above results indicate that the adenine auxotrophy of the T1 strain is due to the introduction of a mutation into the gene set forth in SEQ ID NO: 1, and that the gene set forth in SEQ ID NO: 1 is the gene involved in adenine auxotrophy.
[0097] (9) Confirmation of glycolipid productivity of the T1Δseq1::ade strain The host strain T1 and the T1Δseq1::ade strain obtained in (8) were inoculated into glycolipid production medium 2 (0.1% urea, 2% yeast extract, 5% oleic acid, and 12.5% glucose) and cultured with shaking at 30°C. After 72 hours of culture, 5 mL of culture medium was collected, 4 mL of hexane was added, and the mixture was stirred and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the hexane fraction in the supernatant was removed. 6 mL of ethyl acetate was then added to the remaining solution and stirred and mixed for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire ethyl acetate fraction was collected. The collected ethyl acetate fraction was evaporated by blowing nitrogen gas to precipitate the dissolved sophorolipid. The weight of the precipitated sophorolipid was measured, and the sophorolipid concentration in the culture medium was calculated. The results are shown in Table 1. It was confirmed that sophorolipids were produced in each strain.
[0098] [Table 1]
[0099] Example 3 Preparation of transformants and production of glycolipids 2 (1) Amplification of a genomic DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for all PCR reactions performed hereinafter. A DNA fragment containing the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 24: TCCGGAATTGACACAACTATGGAAATTAATGAAGAATTGGGCTG and SEQ ID NO: 25: TAAATCTAGATATCTGCAGACATAGCCGAAATTCTACTGTGAG) with the genomic DNA of the NBRC10243 strain as a template.
[0100] (2) Amplification of genomic DNA fragments 1 kbp upstream and 1 kbp downstream of the fao1 gene Similarly, using the genomic DNA of the NBRC10243 strain as a template, a 1-kbp DNA fragment upstream of the fao1 gene was amplified with primers (SEQ ID NO: 26: GCCAAGCTTGCATGCGAAGGGGCTCTCCGAAGTACATCACTG and SEQ ID NO: 27: TGTGTCAATTCCGGAAAAACGACAGAAAAGTG), and a 1-kbp DNA fragment downstream of the fao1 gene was amplified with primers (SEQ ID NO: 28: TATCATCTAGATTTATATCACAAGTCACTATTTAC and SEQ ID NO: 29: AGAGTCGACCTGCAGCTCAATGAACTGAGACAGCAGCTTGTCAC).
[0101] (3) Amplification of vector fragments A vector DNA fragment was amplified using pHSG298 (Takara Bio) as a template and primers (SEQ ID NO: 14: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 15: CTGCAGGTCGACTCTAGAGGATCCCCG).
[0102] (4) Preparation of template plasmid pbJK8-2 for the introduced DNA fragment The four PCR products described in (1), (2), and (3) were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) to separate DNA fragments, which were then ligated using the In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α (Nippon Gene Co., Ltd.), and the cell suspension was plated on LB agar medium containing kanamycin and incubated overnight at 37°C. Colony PCR was performed using the resulting colonies as templates and Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 16: CTCTTCGCTATTACGCCAGC and SEQ ID NO: 17: CACTTTATGCTTCCGGCTCG). Transformants carrying the plasmids for which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. The plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK8-2, which contains a DNA fragment containing 1 kbp upstream of the fao1 gene, SEQ ID NO: 1, and a DNA fragment containing 1 kbp downstream of the fao1 gene linked together.
[0103] (5) Preparation of DNA fragment for introduction Using plasmid pbJK8-2 as a template and primers (SEQ ID NO: 30: GAAGGGCTCTCCGAAGTACATCACTG and SEQ ID NO: 31: CTCAATGAACTGAGACAGCAGCTTGTCAC), a DNA fragment containing 1 kbp upstream of the fao1 gene, a DNA sequence containing SEQ ID NO: 1, and 1 kbp downstream of the fao1 gene was amplified. The resulting PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The resulting DNA fragment was sequenced, and it was confirmed that the entire DNA fragment was composed of gene sequences present in the genome of the NBRC10243 strain.
[0104] (6) Insertion of the DNA fragment into the T1 strain and generation of the T1Δfao1::ade strain The T1 strain was transformed by electroporation (Nepa Gene) with the DNA fragment obtained in (5), which contained a 1-kb upstream region of the fao1 gene, a DNA sequence containing SEQ ID NO: 1, and a 1-kb downstream region of the fao1 gene. The transformed cell sap was plated on minimal agar medium and incubated at 30°C for 3 days. PCR was performed using the resulting colonies as templates with primers (SEQ ID NO: 32: CTAAGGCCAGTACAAGAGATC and SEQ ID NO: 33: CTAAAGCTCGAATTAATAGAGACACG), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment had been integrated into the genome, this strain was designated Starmerella bombicola T1Δfao1::ade. This strain contains a DNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1 inserted into the genome, replacing the fao1 gene. Furthermore, it has been reported that when the fao1 gene (SEQ ID NO: 34) is deleted or inactivated, Bola-type sophorosides and alkyl polyglycosides are mainly produced when alcohols are used as substrates (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528, etc.).
[0105] (7) Confirmation of adenine requirement of the T1Δfao1::ade strain The T1Δfao1::ade strain obtained in (6) and the host strain T1 were inoculated onto minimal agar medium and subjected to static culture at 30°C. As a result, growth of the T1 strain on minimal agar medium was not observed, whereas growth of the obtained T1Δfao1::ade strain was observed, confirming that the adenine requirement had been relieved by the insertion of the nucleotide sequence shown in SEQ ID NO: 1.
[0106] (8) Confirmation of glycolipid productivity of the T1Δfao1::ade strain The T1Δfao1::ade strain obtained in (7) was inoculated into glycolipid production medium 3 (0.5% w / v trisodium citrate dihydrate, 0.4% w / v yeast extract, 0.15% w / v ammonium chloride, 0.07% w / v magnesium sulfate heptahydrate, 0.05% w / v sodium chloride, 0.027% w / v calcium chloride dihydrate, 0.1% w / v potassium dihydrogen phosphate, 0.016% w / v dipotassium dihydrogen phosphate, and 15% w / v glucose) and cultured with shaking at 30°C. After one day of culture, 2.6% w / v oleyl alcohol was added as a substrate. After four days of culture, 3 mL of the culture medium was collected, 3 mL of hexane was added, and the mixture was stirred and mixed for 5 seconds. The mixture was centrifuged at 3000 rpm and 25°C for 5 minutes, and the hexane fraction from the supernatant was removed. Next, 3 mL of butanol was added to the remaining solution, and the mixture was stirred and mixed for 5 seconds. After 5 minutes of centrifugation at 3000 rpm and 25°C, the entire butanol fraction was recovered. An additional 3 mL of butanol was added to the remaining solution, and the same procedure was repeated to recover the entire butanol fraction. The recovered butanol fraction was volatilized by blowing nitrogen gas over it, and the weight of the dissolved precipitate was measured and defined as the Bola-type sophoroside concentration in the culture medium. The T1Δfao1::ade strain was confirmed to produce 37.7 g / L of Bola-type sophoroside.
Claims
1. A Starmerella bombicola mutant strain in which the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated, wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:
2.
2. A mutant strain as described in claim 1, in which a gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene encoding a protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is deleted or inactivated.
3. A mutant strain described in claim 2, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene encoding the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:
1.
4. The mutant strain according to claim 1, which is adenine auxotrophic.
5. The mutant strain according to claim 1, which is Starmerella bombicola T1 strain (accession number NITE BP-04096).
6. A method for producing a Starmerella bombicola mutant, comprising suppressing or inactivating the expression of a phosphoribosylglycine amidoformyltransferase-like protein or a protein equivalent thereto in Starmerella bombicola, wherein the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein equivalent to the phosphoribosylglycine amidoformyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:
2.
7. The method described in claim 6, comprising deleting or inactivating a gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene encoding a protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein.
8. The method described in claim 7, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene encoding the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:
1.
9. The method according to claim 6, which is for producing an adenine-requiring Starmerella bombicola mutant.
10. A method for transforming Starmerella bombicola, comprising using the mutant strain according to any one of claims 1 to 5 as a host.
11. The method described in claim 10, further comprising introducing a gene encoding the phosphoribosylglycine amidoformyltransferase-like protein or a gene encoding a protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein into the host as an adenine-requiring selection marker.
12. The method described in claim 11, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene encoding the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:
1.
13. The method according to claim 11, further comprising selecting a transformant using the presence or absence of adenine auxotrophy as an indicator.
14. A transformant obtained by the method according to claim 10.
15. The transformant described in claim 14, in which expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 23 is suppressed or inactivated.
16. 15. The transformant according to claim 14, wherein expression of FAO1 or a protein corresponding thereto is suppressed or inactivated.
17. 16. The transformant according to claim 15, wherein expression of FAO1 or a protein corresponding thereto is suppressed or inactivated.
18. A method for producing glycolipids, comprising culturing the mutant strain according to any one of claims 1 to 5.
19. A method for producing a glycolipid, comprising culturing the transformant according to claim 14.
20. A method for producing a glycolipid, comprising culturing the transformant according to claim 15.
21. A method for producing a glycolipid, comprising culturing the transformant according to claim 16.
22. A method for producing a glycolipid, comprising culturing the transformant according to claim 17.
23. The method of claim 18, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids, and cellobioselipids.
24. 20. The method of claim 19, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids, and cellobioselipids.
25. The method of claim 20, wherein the glycolipid is selected from the group consisting of sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids, and cellobioselipids.
26. Use of a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene encoding a protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein as an adenine-requiring selection marker, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene encoding the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:
1.
27. A vector or DNA fragment comprising a gene encoding a phosphoribosylglycine amidoformyltransferase-like protein or a gene encoding a protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein, wherein the gene encoding the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene encoding the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a polypeptide having the ability to relieve adenine requirement of Starmerella bombicola which has become adenine-requiring due to inactivation of the phosphoribosylglycine amidoformyltransferase-like protein or the protein corresponding to the phosphoribosylglycine amidoformyltransferase-like protein.
Citation Information
Patent Citations
Method for producing glycolipid
WO2014061459A1
Mutant strain having high sophorolipid productivity
WO2017014176A1