Jubrubergi lindner yeast and application thereof

Abstract

The invention relates to the technical field of microorganisms, and in particular relates to a Lingdner yeasts gedinieri and application thereof. The invention relates to a Judiniberg Lindnella yeast, which is preserved in Guangdong Microbial Culture Collection Center (CR) with the preservation number of GDMCC NO: 66538. The lindnella gedinieri CR provided by the invention is a special yeast strain which is resistant to high salt, high in wide-temperature adaptability, resistant to citric acid and high in yield. And obvious comprehensive advantages are shown in the fermentation conversion of the citrus peel residues. The strain can efficiently utilize a carbon source in pomace to vigorously grow, effectively tolerate natural inhibitors such as citric acid contained in the pomace, and shows high growth activity and excellent protein synthesis capability, so that citrus processing byproducts are efficiently converted into high-value single-cell protein feed, and the yield of the citrus processing byproducts is increased. And a reliable microbial tool is provided for resource utilization of agricultural wastes.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a strain of Starmerella bombicola and its application. BACKGROUND

[0002] At present, the protein feed resource is in short supply, and a large amount of agricultural by-products such as dregs and vinasse cannot be effectively utilized. Due to the limitation of technical bottleneck, most of the agricultural by-products have not been converted into high-value products. The traditional processing method not only leads to resource waste, but also causes environmental pollution. Therefore, it has become an important direction to realize clean production and ecological sustainable development by promoting the conversion of agricultural waste into feed resources through fermentation technology.

[0003] Among various conversion technologies, microbial fermentation is an effective means to improve the nutritional value of waste. As a kind of single-cell eukaryotic microorganism, yeast can significantly improve the nutritional value and palatability of feed due to its high protein content, balanced amino acid composition, and the ability to produce various vitamins and enzymes, and is widely used in single-cell protein production. It can effectively utilize various carbon sources, and is one of the ideal strains for processing fruit dregs and vinasse. However, such raw materials, especially fruit dregs and vinasse, will accumulate organic acids such as citric acid, acetic acid and lactic acid during processing and storage, resulting in low pH of the substrate. This acidic environment can seriously inhibit the growth, reproduction and metabolic activity of ordinary yeast, resulting in low activity of yeast in solid-state fermentation systems such as liquor dregs, and low yield of single-cell protein, which ultimately limits the efficient conversion of these wastes into high-protein feed. Therefore, breeding special acid-resistant yeast strains that can grow vigorously and efficiently synthesize cell proteins in such acidic environments has become a key technical link to realize the high-value utilization of fruit dregs, vinasse and other resources, and relevant research has urgent practical needs and application value. In particular, for the pickled orange peel or candied waste rich in salt produced in citrus processing, there is a lack of special strains that can adapt to high-acid and high-salt double-stress environments in the prior art.

[0004] In terms of technical development, research has begun to focus on the breeding and application of acid-tolerant yeast. For example, a Chinese patent with publication number CN117050893A discloses a method for constructing an acid-tolerant yeast strain with high lactic acid production through genetic modification; a patent with publication number CN118302514A relates to the construction of an acid-tolerant yeast engineering strain with high L-malic acid production. In addition, a patent with publication number CN112608854A also introduces a preparation method of a high-acid-tolerant yeast. These technical solutions demonstrate the application potential of yeast in acidic environments. However, the special nature of citrus pomace and distiller's grains and other raw materials lies in their high content of citric acid, and the citric acid content may further increase during fermentation, resulting in excessive acidity of the system. High concentrations of citric acid can significantly inhibit yeast cell activity and interfere with its normal energy metabolism. However, the existing disclosed acid-tolerant yeast technology is mostly optimized for other organic acids or specific product synthesis, and is not specifically designed for high citric acid tolerance. Therefore, when dealing with such raw materials, the fermentation efficiency is often poor. In summary, it is particularly necessary to breed a special yeast strain that can efficiently tolerate citric acid and adapt to possible salt stress in order to break through the current technical bottleneck and achieve efficient conversion of specific agricultural by-products, especially citrus processing waste.

[0005] In addition, on the one hand, there are differences in the understanding of those skilled in the art; on the other hand, the inventors have studied a large number of literatures and patents when making the present application, but due to the limited space, all the details and contents are not listed in detail. However, this does not mean that the present application does not have these characteristics of the prior art, on the contrary, the present application already has all the characteristics of the prior art, and the applicant reserves the right to add relevant prior art in the background art. SUMMARY

[0006] The present application relates to the field of microbial technology, in particular to a strain of Starmerella bombicola and its application.

[0007] To solve the above technical problems, one of the purposes of the present application is to provide a strain of Starmerella bombicola, which is strain CR preserved in the Guangdong Microbial Culture Collection Center with the preservation number GDMCC NO: 66538.

[0008] One of the purposes of the present application is also to provide the use of the above-mentioned Starmerella bombicola in the preparation of a leavening agent, which is a citric acid substrate leavening agent.

[0009] According to a preferred embodiment, the leavening agent is a citric acid substrate leavening agent with a salinity not less than 1%. Preferably, the leavening agent is a citric acid substrate leavening agent with a salinity in the range of 1%-5%. More preferably, the leavening agent has a suitable temperature range of 25℃-45℃. The leavening agent is a citric acid substrate leavening agent with a salinity in the range of 0.25%-1.25%.

[0010] According to a preferred embodiment, the fermenting agent is used in citrus peel residue, vinasse or corn stalks with a salinity not lower than 1%.

[0011] Preferably, one of the purposes of the present application is also to provide a method for producing SCP by solid-state fermentation of the above-mentioned Zygosaccharomyces bailii in a substrate rich in citric acid. The activated culture and the expanded culture of Zygosaccharomyces bailii GDMCC 66538 are inoculated into different substrates under laboratory conditions, and after being cultured at 28-32℃ for a certain period of time, the SCP yield is significantly increased. The method for applying Zygosaccharomyces bailii CR to solid-state fermentation of agricultural waste achieves high-value utilization of waste, and is simple to operate, has little pollution, and has low investment.

[0012] One of the purposes of the present application is also to provide a microbial agent, and the active ingredient of the microbial agent is the above-mentioned Zygosaccharomyces bailii.

[0013] According to a preferred embodiment, the preparation of the microbial fermentation agent with bran as a filler: the Zygosaccharomyces bailii CR is cultured in YPD liquid medium at 30℃ and 180 rpm for 24 h to obtain a liquid fermentation agent; the liquid fermentation agent is mixed with sterilized bran at a ratio of 1:1 (mass / mass), and then placed in a constant temperature incubator at 40℃ for drying culture for 20-24 h, until the water content is 15-20%, which is a solid microbial fermentation agent.

[0014] According to a preferred embodiment, the microbial agent further comprises Aspergillus niger. Preferably, the Aspergillus niger and the Zygosaccharomyces bailii are mixed at an equal ratio and then inoculated in the fermentation substrate.

[0015] According to a preferred embodiment, the microbial agent is in a liquid or solid dosage form.

[0016] One of the purposes of the present application is also to provide a preparation method of the above-mentioned Zygosaccharomyces bailii, which comprises the following steps: inoculating the above-mentioned Zygosaccharomyces bailii in a culture medium and culturing at 25-35℃.

[0017] According to a preferred embodiment, the culture medium is YPD liquid medium. Preferably, the YPD medium: 20 g / L of tryptone, 10 g / L of yeast powder, 20 g / L of glucose, and 1% of aqueous Bengal red solution. The pH value of the YPD medium is 6.0.

[0018] The growth ability of the strain in the "ideal culture medium" of citric acid cannot be equivalent to the fermentation performance of the strain in the "adverse environment medium" of the wine lees or corn stalks and the like which are rich in components and inhibitors. The latter puts forward systematic requirements for the stress resistance, substrate utilization spectrum and ecological competition ability of the strain. The value of the strain of the present application is embodied in the high-efficiency conversion ability of the strain to the real waste.

[0019] One of the purposes of the present application is also to provide a processing method of high-salt citrus processing by-products, which inoculates the above-mentioned Zygosaccharomyces bailii with OD 600 The above-mentioned Zygosaccharomyces bailii with OD

[0020] According to a preferred embodiment, the substrate comprises a carbon source, wherein the substrate containing citrus peel residue takes bran and urea as the carbon source; the substrate containing wine lees or corn stalks takes bran as the carbon source.

[0021] The principle of the application of Zygosaccharomyces bailii CR to solid-state fermentation of agricultural waste is that the strain maintains cell growth and accumulates protein by utilizing sugars, acids, alcohols and lignocellulose in the substrate, thereby realizing protein feed production. The Zygosaccharomyces bailii CR in the present application has strong citric acid tolerance, and thus still maintains strong fermentation ability to substrates rich in citric acid such as citrus residue and wine lees, thereby realizing increase of protein content.

[0022] The technical scheme has the beneficial effects that: The Zygosaccharomyces bailii CR has strong growth activity, and can reach maximum activity in 24 h, and the protein content is 54.77%. The Zygosaccharomyces bailii CR can grow between pH 3.0-7.0, and has strong tolerance to citric acid (0.25%-1.5%) in particular. Meanwhile, the strain has strong tolerance to salinity (2%-5%) and temperature (25-45 DEG C), and has no obvious decrease in growth activity at citric acid concentration of 1.0%, salinity of 5% and temperature of 40 DEG C.

[0023] The provided Zeytinsebilinea CR of the application is a special yeast strain with high salt tolerance, strong temperature adaptability, citric acid tolerance and high yield. It has significant comprehensive advantages in the fermentation and conversion of citrus peel residues. The strain can efficiently utilize the carbon source in the residues for vigorous growth and effectively tolerate natural inhibitors such as citric acid contained therein, showing high growth activity and excellent protein synthesis capacity. Only a single strain can be used for SCP production by fermentation, which is convenient for packaging and transportation and easy to form commercialization, thereby efficiently converting citrus processing by-products into high-value single-cell protein feed and providing a reliable microbial tool for resource utilization of agricultural waste.

[0024] On the basis of the above efficient conversion, the excellent salt tolerance and broad-spectrum temperature adaptability of the strain bring more prominent process characteristics and economy in practical application. For high-salinity orange peel waste generated in the processing of citrus pickling and candying, the high salt tolerance of the strain enables it to directly ferment with these waste as the substrate, eliminating the high-cost desalination pretreatment link and realizing true 'waste treatment with waste'. At the same time, the high-salt environment naturally inhibits most bacterial contamination, so that the fermentation process can be carried out under open or semi-open conditions, significantly reducing the dependence on aseptic operation and expensive sterilization equipment. The wide temperature adaptation range enables the fermentation process to be carried out stably at natural ambient temperature without relying on a precise temperature control system, greatly reducing energy consumption and enhancing the adaptability and stability of the process under different climate conditions and seasons. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Figure 1 is a diagram for identification of Zeytinsebilinea CR, wherein a is a line drawing of bacterial colony, b is a strain morphology diagram under scanning electron microscope, and c is a phylogenetic tree. DETAILED DESCRIPTION

[0026] In the description of the application, the terms are used only for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. In the description of the application, the meaning of "a plurality of" is two or more, unless otherwise explicitly specified.

[0027] Unless otherwise specified, the test methods used in the following examples are conventional methods; the materials, reagents or instruments used are commercially available reagents and materials; and the specific conditions not specified in the examples are carried out according to conventional conditions or the conditions recommended by the manufacturer. Meanwhile, the source of the raw materials used in the application is not limited, and the raw materials used in the application are ordinary commercially available products in the technical field, unless otherwise specified.

[0028] Salinity: the ratio of the weight of dissolved salt in water to the weight of water, in this application, the formula of solution salinity is adding sodium chloride, respectively 2% (20 g / L) -5% (50 g / L).

[0029] The Zeytinsebilinea naganishii CR is collected from pickled vegetable water in Xindu Town, Xindu District, Sichuan Province.

[0030] The YPD culture medium: 20 g / L of tryptone, 10 g / L of yeast powder, 20 g / L of glucose, 1% of aqueous solution of Bengal red, and 20 g / L of agar is added to the solid culture medium.

[0031] The macroscopic colony morphological characteristics of the strain are as follows: regular round shape, milky white and semi-transparent, smooth surface, wet and sticky, uniform texture, easy to pick up. The cell size is stable, the cell diameter is 4.0-5.0 μm, the width is 2 μm, and the shape is smooth oval. Its reproduction mode is typical multi-edge budding reproduction. According to the above morphological characteristics, it can be identified that the strain belongs to yeast.

[0032] Through 18S rDNA identification, the NCBI database is compared, the strain sequences with higher homology and different species are compared, cut and used to construct a phylogenetic tree, and the strain is identified as Zeytinsebilinea naganishii.

[0033] The sequence of 18S rDNA (SEQ ID NO. 1) of the Zeytinsebilinea naganishii CR is as follows: TCCTCCGCCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAGCTTAGAAAGGTTGTTCAGCCGAGCTCTGCCTGGAAGTCTGTCTGGAAAATAACGAGTTGGTAGAACCTAATACATTATTTCGGCCCAGAGGATTTCTAGGGGGAGCTCTGCCTAGAGTATTTCAAGTTAACACAGAGTATCACTCAATACCAAGTCCCCTAGAGGATCTTGAGAGAGAAATGACGCTCAAACAGGCATGCTCTCTGGAATGCCAGAGAGCGCAATATGCGTTCAAAGATTCGATGATTCACGAAAACCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGTTGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTAAAATTCAAATTGACTAGTTTCTAGAGAAAATAAATTTCTGTGTTTAAAACCTTTGGCAGAGCCAAAGCAAAAGAAGCAAAATACACTGTGTATTGGTTGGAGCCGCGCTAGAAGCGCAGGCCCAGGTTCTCTAATGATCCTTCCGCAGGTTCACCTACGG.

[0034] The amplification primer of 18S rDNA of Saccharomyces cerevisiae CEN.A4 is as follows: The upstream primer F (SEQ ID NO. 2) is ITS1 (5'-TCCGTAGGTGAACCTGCGG-3'); The downstream primer R (SEQ ID NO. 3) is ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0035] The PCR amplification system (25 μL) is as follows: 10×PCR Buffer 2.5 μL, dNTP Mixture 2 μL, ITS1 and ITS4 primers (10 μM) 1 μL each, Taq DNA polymerase 0.2 μL, template DNA 1 μL, and ddH2O up to 25 μL.

[0036] The PCR amplification procedure is as follows: pre-denaturation at 94℃ for 5 min, followed by 39 cycles of denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 45 s, final extension at 72℃ for 10 min, and preservation at 4℃.

[0037] Jadinia ceberiina CR Cyberlindnera jadinii Strain preservation information: Jadinia ceberiina CR has been preserved in Guangdong Microbial Culture Collection Center (address: 5th floor, No. 59, Guangdong Academy of Microbiology, 100 Middle Martyrs Road, Guangzhou, Guangdong Province, 510070), on June 18, 2025, and the preservation number is GDMCC No. 66538.

[0038] Example 1 This example relates to the use of Jadinia ceberiina CR for solid-state fermentation of citrus peel residue to produce SCP. The fermentation substrate is actual citrus peel residue.

[0039] 1. Preparation of culture medium and inoculum Seed culture medium of Jadinia ceberiina CR: 20 g / L of tryptone, 10 g / L of yeast powder, 20 g / L of glucose, 1000 mL of water, pH 6.5-7, sterilized at 121℃ for 30 min. Preparation of inoculum: 2 loops of strain were picked up with an inoculation loop in the seed culture medium, and cultured at 30℃ for 24 h on a constant temperature shaker at 180 rpm. The OD 600 After adjusting to 1.0, the inoculum of Jadinia ceberiina CR was prepared.

[0040] Citrus peel residue culture medium: 98% carbon source (citrus peel residue: bran = 8:2 by weight) (w / w), 2.0% urea (w / w), pH 5.0, sterilized at 115℃ for 30 min.

[0041] 2. Solid-state fermentation to produce SCP The inoculum was inoculated into 800 g of citrus peel residue culture medium at a ratio of 10% (v / w) in a shallow tray, and fermented at a moisture content of 70% and 30℃ for 8 d. After fermentation, the changes in nutritional components before and after fermentation of citrus peel residue were determined, and the results are shown in Table 1.

[0042] Table 1 shows the effect of solid-state fermentation of Jadinia ceberiina CR strain on citrus peel residue to produce SCP.

[0043] Table 1

[0044] As shown in the above table, Jadinia ceberiina CR has good fermentation effect when applied to solid-state fermentation of citrus peel residue to produce SCP. The contents of crude protein, crude fiber and crude fat in the sample before fermentation were 14.24%, 12.59% and 2.66%, respectively, and those in the sample after fermentation were 36.77%, 10.80% and 3.10%, respectively, indicating a significant improvement in nutritional value.

[0045] Example 2 This example relates to the use of the Candida sheatae CR for the production of SCP by solid state fermentation of distiller's grains, with the fermentation substrate being actual distiller's grains.

[0046] (1) Preparation of culture medium and inoculum The seed culture medium of the Candida sheatae CR was prepared by mixing 20 g / L of tryptone, 10 g / L of yeast extract, 20 g / L of glucose, and 1000 mL of water, with the pH being adjusted to 6.5-7, and sterilizing at 121°C for 30 min. The inoculum was prepared by picking 2 loops of the strain with an inoculating loop and culturing in the seed culture medium at 30°C and 180 rpm for 24 h, after which the OD 600 After adjusting to 1.0, the inoculum of the Candida sheatae CR was prepared.

[0047] Distiller's grain culture medium: 98% carbon source (by weight, distiller's grains: bran = 8:2) (w / w), 2.0% ammonium sulfate (w / w), pH 5.0, sterilized at 115°C for 30 min.

[0048] (2) SCP production by solid state fermentation The inoculum was inoculated into 800 g of the distiller's grain culture medium at a ratio of 15% (v / w) and fermented in a shallow tray at a moisture content of 70% and 30°C for 4 d. After the fermentation was completed, the sample was taken to determine the changes in the nutritional components before and after the fermentation of the distiller's grains, and the results are shown in Table 2.

[0049] Table 2: SCP production effect of the Candida sheatae CR strain by solid state fermentation of distiller's grains Table 2

[0050] As can be seen from the above table, the Candida sheatae CR has good fermentation effect when applied to the production of SCP by solid state fermentation of distiller's grains. The crude protein and crude fiber of the sample before the fermentation were 15.44% and 31.26%, respectively, and those of the sample after the fermentation were 25.66% and 28.46%, respectively, and the nutritional value was obviously improved.

[0051] Example 3 This example relates to the production of SCP by solid state fermentation of corn stalks using a mixed culture of the Candida sheatae and Aspergillus niger (accession number 6650).

[0052] (1) Preparation of culture medium and inoculum The seed culture medium of the Candida sheatae CR was prepared by mixing 20 g / L of tryptone, 10 g / L of yeast extract, 20 g / L of glucose, and 1000 mL of water, with the pH being adjusted to 6.5-7, and sterilizing at 121°C for 30 min.

[0053] Inoculum preparation: 2 loops of strain were picked up in seed medium with a inoculating loop, and cultured at 180 rpm, 30°C for 24 h. The OD 600 After adjusting to 1.0, prepare 50 mL of Jidinseibelingna yeast CR inoculum.

[0054] Aspergillus niger seed medium: peeled potato 200 g, glucose 20 g, agar 16 g, peptone 3 g, pH 7.0, sterilized at 121°C for 20 min.

[0055] Inoculum preparation: pick up the appropriate amount of strain with a inoculating loop to coat a flask containing 50 mL of Aspergillus niger seed medium, and culture at 30°C in a constant temperature incubator for 72 h. After the Aspergillus niger covers the slope, wash it with 150 mL of sterile water several times to adjust the strain spore count to 1.0×10 6 cfu / mL, and prepare Aspergillus niger inoculum.

[0056] Corn stalk medium: 99% carbon source (corn stalk: bran = 8:2 by weight) (w / w), 1.0% urea (w / w), pH 5.0, sterilized at 115°C for 30 min.

[0057] (2) SCP production by solid-state fermentation Four groups were set up, respectively: Combination 1: corn stalk medium without adding any strain; combination 2: inoculated with 100 mL of Aspergillus niger with a concentration of 1.0×10 6 cfu / mL; combination 3: inoculated with 100 mL of Jidinseibelingna yeast CR with an OD 600 of 1.0; combination 4: inoculated with mixed bacteria, mixed with 50 mL of Aspergillus niger with a concentration of 1.0×10 6 cfu / mL and 50 mL of Jidinseibelingna yeast CR with an OD 600 of 1.0.

[0058] Inoculate 5% (v / w) of Jidinseibelingna yeast CR inoculum and 5% of Aspergillus niger inoculum into a tray containing 400 g of corn stalk medium, and ferment at a moisture content of 70% and 30°C for 4 d. After fermentation, sample and measure the changes in nutritional components before and after corn stalk fermentation, and the results are shown in Table 3.

[0059] Table 3 is the SCP production effect of mixed strain of Jidinseibelingna yeast and Aspergillus niger by corn stalk solid-state fermentation.

[0060] Table 3

[0061] From the above table, it can be seen that the application of mixed bacteria of Jadin Cyberlindnera CR and Aspergillus niger to corn straw solid state fermentation for producing SCP has good fermentation effect. The crude protein, crude fiber and amino acids of the sample before fermentation are 13.86%, 34.18% and 2.99 respectively, and those of the sample after fermentation are 18.68%, 29.15% and 4.79% respectively, and the nutritional value is obviously improved.

[0062] Example 4 This example relates to the application of Jadin Cyperlindnera CR to liquid fermentation for producing SCP in high-salinity medium and wide-temperature range.

[0063] (1) Preparation of culture medium and inoculum The seed culture medium of Jadin Cyperlindnera CR was prepared by sterilizing 20 g / L of tryptone, 10 g / L of yeast powder, 20 g / L of glucose, 1000 mL of water and adjusting pH to 6.5-7 at 121℃ for 30 min. 600 After adjusting to 1.0, the inoculum of Jadin Cyperlindnera CR was prepared.

[0064] The liquid expansion culture medium was prepared by sterilizing 10 g / L of yeast powder, 20 g / L of glucose and 20 g / L of tryptone, 1000 mL of water and adjusting pH to 6.5-7 at 121℃ for 30 min.

[0065] (2) Liquid fermentation for producing SCP The inoculated strain was inoculated into 200 mL of liquid expansion culture medium at a proportion of 3% by volume, and 2.0%, 3.0%, 4.0% and 5.0% of sodium chloride solution was added respectively. After 96 h of culture at 30℃ and 180 rpm, the SCP yield was determined, and the results are shown in Table 4.

[0066] The inoculated strain was inoculated into 200 mL of liquid expansion culture medium at a proportion of 3%, and was cultured at 25℃, 30℃, 35℃, 40℃ and 45℃ respectively at 180 rpm for 96 h. Then the SCP yield was determined, and the results are shown in Table 5.

[0067] Table 4 shows the effect of liquid fermentation for producing SCP by Jadin Cyperlindnera CR strain.

[0068] Table 4

[0069] Table 4 shows the effect of liquid fermentation for producing SCP by Jadin Cyperlindnera CR strain.

[0070] Table 5

[0071] As shown in Table 4, the SCP yield of the Jadin C. reinhardtii CR inoculated in different salinity mediums showed an upward trend between salinity 2.0%-4.0%, and the highest SCP yield increase rate was 66.4% compared with the control strain. As shown in Table 5, the SCP yield of the Jadin C. reinhardtii CR fermented under different temperature conditions showed no significant decrease between temperature 30℃-40℃, and the highest SCP yield increase rate was 69.4% compared with the control strain. The strain had strong tolerance to salinity (2%-5%) and temperature (25℃-45℃). More specifically, the growth activity of the strain showed no significant decrease at salinity 5% and temperature 40℃.

[0072] Example 5 This example relates to the SCP production by liquid fermentation of Jadin C. reinhardtii in a liquid medium rich in citric acid.

[0073] (1) Preparation of culture medium and inoculum Seed culture medium of Jadin C. reinhardtii CR: 20 g / L of tryptone, 10 g / L of yeast powder, 20 g / L of glucose, 1000 mL of water, pH 6.5-7, sterilized at 121℃ for 30 min.

[0074] Preparation of inoculum: 2 loops of strain were picked up with inoculation loop in the seed culture medium, and cultured at 180 rpm and 30℃ for 24 h in a constant temperature shaker. The OD 600 After adjusting to 1.0, the inoculum of Jadin C. reinhardtii CR was prepared.

[0075] Liquid expansion culture medium: 10 g / L of yeast powder, 20 g / L of glucose, 20 g / L of tryptone, 1000 mL of water, pH 6.5-7, sterilized at 121℃ for 30 min.

[0076] (2) SCP production by liquid fermentation The inoculated strain was inoculated into 200 mL of liquid expansion culture medium at a proportion of 3%, and 0.25%, 0.5%, 0.75%, 1.00%, 1.25% and 1.50% of citric acid were added, respectively. After 96 h of culture at 30℃ and 180 rpm, the SCP yield was determined, and the results are shown in Table 6.

[0077] Table 6 shows the SCP production effect of Jadin C. reinhardtii strain by liquid fermentation.

[0078] Table 6

[0079] From Table 6, it can be seen that when the Candida zeylanoides was inoculated in the medium with different concentrations of citric acid, the SCP yield showed an upward trend between the citric acid concentration of 0.25% and 1.25%; compared with the control strain, the highest SCP yield increase rate was 77.47%.

[0080] It should be noted that the above specific embodiments are exemplary, and those skilled in the art can think of various solutions under the inspiration of the disclosure of the present application, and these solutions also belong to the disclosed range of the present application and fall within the protection scope of the present application. Those skilled in the art should understand that the specification and drawings of the present application are illustrative and do not constitute a limitation on the claims. The protection scope of the present application is defined by the claims and their equivalents.

Claims

1. A strain of *Gerdinium sacchariformis*, characterized in that, The strain CR of *G. selaginella leucis* is preserved at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCC NO: 66538.

2. The use of the *G. sacchariformis* as described in claim 1 in the preparation of a starter culture, characterized in that... The fermenting agent is a citric acid substrate fermenting agent.

3. The use according to claim 2, characterized in that, The fermenting agent is a citric acid substrate fermenting agent with a salinity of not less than 1%.

4. The use according to claim 3, characterized in that, The fermentation agent is used in citrus peel residue, distiller's grains, or corn stalks with a salinity of not less than 1%.

5. A microbial inoculant, characterized in that, Its active ingredient is the *Jedingsberlindnerella vaginalis* as described in claim 1.

6. The microbial agent according to claim 5, characterized in that, The microbial agent also contains Aspergillus niger.

7. A method for preparing *Giardia lamblia* according to claim 1, characterized in that, The *Jedin Seberlindnerella vaginalis* as described in claim 1 was inoculated into a culture medium and cultured at 25°C-35°C.

8. The preparation method according to claim 7, characterized in that, The culture medium is YPD liquid culture medium.

9. A method for processing a high-salt citrus processing by-product, characterized in that, OD 600 The *J. seldom seen in claim 1* is inoculated into a substrate containing citrus peel residue, distiller's grains, or corn stalks for fermentation culture.

10. The processing method according to claim 9, characterized in that, The matrix contains wheat bran and urea.

Images