Method for producing genome-edited plants using Nepovirus vectors

The Nepovirus vector with a CRISPR-Cas system and RNA silencing suppressors efficiently introduces and transmits mutations in plants without tissue culture, addressing limitations of existing methods by stabilizing Cas protein expression and enhancing editing efficiency.

JP7774862B2Active Publication Date: 2025-11-25NAT AGRI & FOOD RES ORG
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022101150
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-06-23
Publication Date
2025-11-25
Estimated Expiration
2042-06-23

AI Technical Summary

Technical Problem

Existing methods for genome editing in plants face limitations such as cumbersome procedures, time-consuming processes, culture-induced mutations, and limited applicability to certain plant species, particularly when using viral vectors, which struggle to introduce mutations into the shoot apical meristem and fail to transmit edits to progeny.

Method used

Utilizing a Nepovirus viral vector equipped with a CRISPR-Cas system, including a Cas protein and guide RNA, to introduce mutations into plants without tissue culture, enhanced by suppressing the expression of the RNA-dependent RNA polymerase 6 gene and incorporating viral RNA silencing suppressors like the 16K protein from Tobacco Rattle Virus.

Benefits of technology

Enables efficient genome editing in plants, with mutations introduced not only at the site of inoculation but throughout the plant, and transmitted to the next generation, overcoming previous limitations of viral vector stability and plant resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007774862000001
    Figure 0007774862000001
  • Figure 0007774862000002
    Figure 0007774862000002
  • Figure 0007774862000003
    Figure 0007774862000003
Patent Text Reader

Abstract

To provide a method capable of producing genome-edited plants without the need for tissue culture.SOLUTION: The discovery of this invention reveals that a Nepovirus virus vector, used as a virus vector to express Ca9 protein and guide RNA within a plant, enables the genome editing of plants without the need for tissue culture.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for producing a genome-edited plant using a Nepovirus virus vector equipped with a CRISPR-Cas system, and a kit used in said method. [Background technology]

[0002] Genome editing in plants is often performed by introducing genes expressing genome editing enzymes through tissue culture-mediated transformation. However, tissue culture has several technical limitations, including (i) cumbersome procedures, (ii) time-consuming procedures, (iii) the risk of culture-induced mutations, and, most importantly, (iv) limited applicable plant species / varieties. These limitations limit plant genome editing. Many attempts have been made worldwide to circumvent these issues. For example, the in-planta particle bombardment method has been developed as a technique for introducing mutations without tissue culture by physically introducing genome editing enzymes into the shoot apical meristem (Non-Patent Document 1). However, this method also has limitations, such as the limited range of plants it can be applied to.

[0003] In addition, attempts have been made to use viral vectors for the purpose of genome editing in plants without tissue culture (Non-Patent Document 2), but methods using viral vectors have the following problems: (i) the shoot apical meristem of plants generally has a mechanism for eliminating viruses, and (ii) the genome editing enzyme gene is easily dropped out of the viral vector genome due to its large size.

[0004] Some viruses are known to be exceptionally capable of invading the shoot apical meristem (Non-Patent Document 3). Therefore, to address the first problem, methods have been developed to utilize these viruses as vectors or to incorporate sequences that facilitate their entry into the shoot apical meristem into viral vectors. For example, methods have been reported for tobacco rattle virus (TRV; Non-Patent Documents 4-6), barley stripe mosaic virus (BSMV; Non-Patent Document 7), cotton leaf curl virus (CLCrV; Non-Patent Document 8), and tobacco ringspot virus (TRSV; Patent Document 1) to obtain genome-edited plants without tissue culture by inoculating a viral vector expressing guide RNA (sgRNA) into a transformed plant expressing Cas9. However, expressing the Cas9 protein using a viral vector is difficult. While successful experiments have been reported for potato virus X in inoculated leaves (Non-Patent Document 9) and for sonchus yellow net virus in the entire plant (Non-Patent Document 10), neither method successfully introduced mutations into the growing apex, and the mutations were not transmitted to progeny. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2020 / 234468 [Non-patent literature]

[0006] [Non-Patent Document 1] Hamada et al. (2018) Sci. Rep. 8(1) 14422 [Non-patent document 2] Kujur et al. (2021) Plant Cell Rep. 40, 931-934 [Non-patent document 3] Bradamante et al. (2021) Plant Cell 33(8), 2523-2537 [Non-patent document 4] Ellison et al. (2020) Nature Plants 6, 620-624 [Non-Patent Document 5] Aragones et al., Authorea. October 01, 2021 [Non-patent document 6] Nagalakshmi et al., bioRxiv 2022.01.20.477144 [Non-Patent Document 7] Li et al. (2021) Molecular Plant 14(11), 1787-1798 [Non-patent document 8] Lei et al. (2021) Plant Methods 17, 20 [Non-Patent Document 9] Ariga et al. Plant Cell Physiology (2020) 61(11), 1946-1953 [Non-Patent Document 10] Ma et al. Nature Plants (2020) 6, 773-779 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention has been made in view of these circumstances, and its purpose is to provide a method for producing genome-edited plants without tissue culture. [Means for solving the problem]

[0008] The present inventors conducted extensive research to solve the above-mentioned problem, despite the lack of knowledge regarding which plant viral vectors could stably express large proteins such as Cas9 proteins. As a result, they discovered that genome editing in plants can be performed without tissue culture by using a Nepovirus viral vector as a viral vector that expresses a CRISPR-Cas system containing a Cas protein and guide RNA in plants. In plants inoculated with a Nepovirus viral vector using this method, mutations were introduced into leaves distant from the inoculated leaf, despite the deletion of the Cas gene in the viral vector. This suggests that the introduction of mutations into the shoot apical meristem subsequently led to the development of tissues containing mutant cells, which spread throughout the plant. Furthermore, introduction of mutations was also observed in the next generation of plants from individuals inoculated with a Nepovirus viral vector.

[0009] Nepovirus viruses are known to be able to invade the shoot apical meristem (Non-Patent Document 3), and it has been reported that genome-edited plants were obtained by introducing a viral vector expressing a guide RNA into a transformed plant expressing a Cas protein (Patent Document 1). However, because the Cas gene is large and unstable in the viral vector genome, it is generally difficult to express a Cas protein in plants using a viral vector. Even with Nepovirus vectors, successful expression of a Cas protein has not been reported to date. While successful expression of Cas proteins in plants has been reported using potato virus X vectors and sonchus yellow net virus vectors, these examples are believed not to transmit mutations to progeny. Therefore, this present invention marks the first successful example in the world of expressing a Cas protein from a plant viral vector and editing the genomes of not only the current plant but also future plants.

[0010] Furthermore, the present inventors have found that suppressing the expression of the RNA-dependent RNA polymerase 6 gene, which is involved in viral resistance in host plants, and expressing various RNA silencing suppressors that inhibit viral resistance in host plants improves genome editing efficiency in plants using Nepovirus viral vectors. In particular, the most significant improvement in genome editing efficiency was observed when the 16K protein derived from Tobacco Rattle Virus was used as the RNA silencing suppressor. Previously, it was thought that other components of Tobacco Rattle Virus were required for the 16K protein to function in meristems (Martin-Hernandez and Baulcombe, JOURNAL OF VIROLOGY, Apr. 2008, 4064-4071). However, it is surprising that the 16K protein was able to function using only a Nepovirus viral vector, without the use of other components of Tobacco Rattle Virus.

[0011] The present invention has been made based on these findings and includes the following aspects.

[0012] (1) A method for producing a genome-edited plant, comprising introducing into a plant a Nepovirus virus vector carrying a nucleic acid encoding a Cas protein and a nucleic acid encoding a guide RNA.

[0013] (2) The method according to (1), wherein the Nepovirus virus vector further carries a nucleic acid encoding a viral RNA silencing suppressor.

[0014] (3) The method according to (2), wherein the viral RNA silencing suppressor is a 16K protein derived from tobacco rattle virus.

[0015] (4) The method according to any one of (1) to (3), wherein the plant into which the Nepovirus virus vector is introduced is a plant in which expression of the endogenous RNA-dependent RNA polymerase 6 gene is suppressed.

[0016] (5) The method according to any one of (1) to (4), wherein the Nepovirus virus vector is a tobacco ringspot virus vector.

[0017] (6) The method according to any one of (1) to (5), wherein the Cas protein is a Cas9 protein.

[0018] (7) A kit for producing a genome-edited plant, comprising a Nepovirus virus vector carrying a nucleic acid encoding a Cas protein and a nucleic acid encoding a guide RNA. [Effects of the Invention]

[0019] According to the present invention, by using a Nepovirus virus vector equipped with a CRISPR-Cas system, plant genome editing can be performed efficiently without tissue culture. Furthermore, genome editing can be performed not only at the site of inoculation of the virus vector but also throughout the entire plant. Furthermore, the edited genome can be propagated to the next generation of plants. [Brief explanation of the drawings]

[0020] [Figure 1] Figure 1 shows the results of genome editing in N. benthamiana plants inoculated with a tobacco ringspot virus vector expressing the Cas9 protein and guide RNA (targeting the PDS gene). The left image shows a schematic diagram of the inoculation of the vector into N. benthamiana plants. The upper right image shows an electrophoretic image of genome editing detected by CAPS in leaves above the leaves inoculated with the tobacco ringspot virus vector. The band indicated by the arrow indicates a band that was not cleaved by restriction enzymes due to the introduction of a mutation. The lower right image shows an electrophoretic image of the Cas9 gene on the tobacco ringspot virus vector detected by RT-PCR in leaves above the leaves inoculated with the tobacco ringspot virus vector. [Figure 2]Figure 2 shows the improvement of genome editing efficiency by suppressing the expression of the RNA-dependent RNA polymerase 6 (RDR6) gene. The top image shows an electrophoresis image showing the results of genome editing detected by the CAPS method. As a control, a vector not containing the RNA-dependent RNA polymerase 6 gene (ALSV-empty) was used. The bottom image shows a photograph of a leaf from a genome-edited plant. [Figure 3] Figure 3 shows the improvement of genome editing efficiency by introducing a viral RNA silencing suppressor (VSR). The top image shows a schematic diagram of the insertion of an RNA silencing suppressor into a tobacco ringspot virus vector, and the bottom image shows an electrophoresis image of genome editing detected by the CAPS method. [Figure 4] Figure 4 shows electrophoresis images showing the results of genome editing of the PDSa gene (top row) and the PDSb gene (bottom row) detected by the CAPS method in the next generation of Nicotiana benthamiana plants inoculated with a tobacco ringspot virus vector expressing Cas9 protein and guide RNA (targeting the PDS gene). DETAILED DESCRIPTION OF THE INVENTION

[0021] <Method for producing genome-edited plants> The present invention provides a method for producing a genome-edited plant, comprising introducing into a plant a Nepovirus virus vector carrying a nucleic acid encoding a Cas protein and a nucleic acid encoding a guide RNA.

[0022] (Cas protein and guide RNA) In the present invention, the CRISPR-Cas system carried in a Nepovirus virus vector includes, as components, at least a Cas protein and its guide RNA.

[0023] The "Cas protein" in the present invention may be a Cas protein of the class 2 system (e.g., a type II Cas protein such as Cas9, a type V Cas protein such as Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX) and Cas14, or a type VI Cas protein such as Cas13a (C2c2), Cas13b and Cas13c), or a Cas protein of the class 1 system (e.g., a type I Cas protein such as Cas3, or other type III or type IV Cas proteins), but is preferably a Cas protein of the class 2 system, more preferably a type II Cas protein, and particularly preferably a Cas9 protein.

[0024] The origin of the Cas protein is not particularly limited. Cas9 proteins of various origins can be used in the present invention, such as the Cas9 protein derived from Streptococcus pyogenes (SpCas9), the Cas9 protein derived from Francieda novicida (FnCas9), the Cas9 protein derived from Staphylococcus aureus (SaCas9), the Cas9 protein derived from Campylobacter jejuni (CjCas9), and the Cas9 protein derived from Neisseria meningitidis (NmCas9).

[0025] Typical amino acid and nucleotide sequences of Cas proteins are registered in public databases, such as GenBank (http: / / www.ncbi.nlm.nih.gov), and can be used in the present invention. For example, typical amino acid and nucleotide sequences of the Cas9 protein derived from Streptococcus pyogenes are listed in NCBI Reference Sequences NP_269215 and NC_002737, respectively.

[0026] The "Cas protein" in the present invention may be an artificial mutant, homolog, or partial peptide of a natural Cas protein, as long as it can form a complex with a guide RNA and edit the target plant genome.

[0027] An artificial mutant has an amino acid sequence in which one or more amino acids have been substituted, deleted, added, or inserted relative to the amino acid sequence of a reference native Cas protein. Here, "multiple" refers to, for example, 2 to 150, preferably 2 to 100, more preferably 2 to 50 (e.g., 2 to 30, 2 to 10, 2 to 5, 2 to 3, or 2).

[0028] Examples of mutations that can be introduced include those that partially or completely eliminate the nuclease activity of the Cas protein. A Cas protein mutant that partially eliminates nuclease activity is called an nCas protein, and a Cas protein mutant that completely eliminates nuclease activity is called a dCas protein.

[0029] In the SpCas9 protein, known mutations that cause the loss of its nuclease activity include, for example, a mutation of the 10th amino acid from the N-terminus (aspartic acid) to alanine (D10A: mutation within the RuvC domain), a mutation of the 840th amino acid from the N-terminus (histidine) to alanine (H840A: mutation within the HNH domain), a mutation of the 863rd amino acid from the N-terminus (asparagine) to alanine (N863A: mutation within the HNH domain), a mutation of the 762nd amino acid from the N-terminus (glutamic acid) to alanine (E762A: mutation within the RuvCII domain), and a mutation of the 986th amino acid from the N-terminus (aspartic acid) to alanine (D986A: mutation within the RuvCIII domain).

[0030] When using nCas or dCas proteins, plant genomes can be edited by fusing them with other effector proteins, utilizing the activity of the effector proteins. The "Cas protein" of the present invention encompasses such fusion proteins. Examples of activities of the fused effector proteins include, but are not limited to, deaminase activity (e.g., cytidine deaminase activity, adenosine deaminase activity), methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, photolyase activity, and glycosylase activity. Techniques for applying deaminase to CRISPR-Cas systems are known (Nishida K. et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems, Science, DOI: 10.1126 / science.aaf8729, (2016)), and such techniques can be applied to the present invention.

[0031] Mutations introduced into Cas proteins also include those that alter PAM recognition (Benjamin, P. et al., Nature 523, 481-485 (2015); Hirano, S. et al., Molecular Cell 61, 886-894 (2016)). By introducing such mutations, the number of bases in the PAM sequence recognized by the Cas protein can be reduced, expanding the genomic region that can be targeted by the CRISPR-Cas system.

[0032] The homologues of native Cas proteins used in the present invention typically have an amino acid sequence identity of 85% or more, preferably 90% or more, and more preferably 95% or more (e.g., 96% or more, 97% or more, 98% or more, or 99% or more) to the amino acid sequence of the native Cas protein. Sequence identity can be evaluated by the numerical value calculated using BLAST or the like (e.g., default, i.e., initial setting parameters).

[0033] The Cas protein used in the present invention may be added with a signal sequence such as a nuclear localization signal (NLS), a mitochondrial targeting signal, or a chloroplast targeting signal, depending on the purpose.

[0034] In the present invention, a "guide RNA" is an RNA that contains a base sequence that interacts with a Cas protein and a base sequence complementary to the base sequence of a target region. The form of the guide RNA varies depending on the type of CRISPR-Cas system, and includes forms that contain both crRNA and tracrRNA and forms that consist only of crRNA. The crRNA is selected to target a region adjacent to a PAM (proto-spacer adjacent motif) sequence.

[0035] In the case of a form containing both crRNA and tracrRNA, the crRNA contains a base sequence on the 3' end that can interact (hybridize) with the tracrRNA, while the tracrRNA contains a base sequence on the 5' end that can interact (hybridize) with a partial base sequence of the crRNA. The double-stranded RNA formed by the interaction of these base sequences interacts with the Cas protein. The guide RNA may be in the form of a single guide RNA (sgRNA) containing both the crRNA and tracrRNA, or in the form of a two-molecule guide RNA consisting of a combination of fragments of each.

[0036] When the CRISPR-Cas9 system is used, the targeting base sequence in the crRNA is usually a base sequence consisting of 12 to 50 bases, preferably 17 to 30 bases, and more preferably 17 to 25 bases.

[0037] (Nepovirus vector) In the present invention, a Nepovirus virus vector is used as a vector for carrying a nucleic acid encoding a Cas protein and a nucleic acid encoding a guide RNA.

[0038] Examples of "Nepovirus" from which vectors are derived include tobacco ringspot virus (TRSV), arabis mosaic virus (ArMV), blueberry latent spherical virus (BLSV), cherry leaf curl virus (CLRV), cycad necrotic dwarf virus (CNSV), grapevine fanleaf virus (GFLV), melon mild spot virus (MMMoV), mulberry ringspot virus (MRSV), tomato black ringspot virus (TBRV), and tomato ringspot virus (ToRSV), with tobacco ringspot virus (TRSV) being preferred.

[0039] The genome of Nepoviruses is a positive-sense single-stranded RNA with two segments: RNA-1 and RNA-2. RNA-1 encodes P1A (or X1 or X2, hereafter), Hel (helicase), VPg (genome-binding protein), Pro (protease), and Pol (polymerase), while RNA-2 encodes P2A (or X3 or X4, hereafter), MP (movement protein), and CP (coat protein). The proteins encoded by RNA-1 and RNA-2 are each translated into polyproteins and then degraded by proteases to yield functional proteins.

[0040] The Nepovirus virus vector of the present invention may be in the form of DNA encoding the viral genomic RNA, the viral genomic RNA, or a viral particle containing the viral genomic RNA.

[0041] When the Nepovirus virus vector of the present invention is in the form of DNA encoding the viral genomic RNA, the nucleic acid encoding the Cas protein and the nucleic acid encoding the guide RNA are both carried in the form of DNA in the Nepovirus virus vector. In this case, the DNA encoding the viral genomic RNA may be inserted into an expression vector that ensures expression in plant cells. In the expression vector, the DNA encoding the viral genomic RNA is preferably operably linked to one or more regulatory elements. Here, "operably linked" means that the DNA encoding the viral genomic RNA is linked in an expressible manner. "Regulatory elements" include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals (polyadenylation signals, polyU sequences, etc.)).

[0042] When the Nepovirus viral vector is in the form of viral genomic RNA or viral particles containing viral genomic RNA, the nucleic acid encoding the Cas protein and the nucleic acid encoding the guide RNA are both carried in the form of RNA in the Nepovirus viral vector. Viral genomic RNA can be prepared by in vitro transcription from a vector into which DNA encoding the viral genomic RNA has been inserted, and viral particles containing viral genomic RNA can be prepared by introducing a vector into which DNA encoding the viral genomic RNA has been inserted or viral RNA into host cells, growing the viral particles in the host cells, and recovering them.

[0043] In Nepovirus viral vectors, the RNA encoding the Cas protein may be located either on the 5' side of the P1A gene of RNA1, between the genes, or on the 3' side of the Pol gene, or on the 5' side of the P2A gene of RNA2, between the genes, or on the 3' side of the CP gene, but is preferably located between the MP gene and CP gene of RNA2.

[0044] In Nepovirus vectors, the guide RNA is located either 5' to the P1A gene or 3' to the Pol gene, or 5' to the P2A gene or 3' to the CP gene of RNA2, but is preferably located 3' to the CP gene of RNA2.

[0045] The Nepovirus virus vector of the present invention can be introduced into plants by methods known to those skilled in the art, such as the particle gun method, electroporation, plasma method, Agrobacterium method, and friction inoculation, depending on its form.

[0046] (Viral RNA silencing suppressors) In a preferred embodiment of the present invention, the Nepovirus vector contains a nucleic acid encoding a viral RNA silencing suppressor in addition to a nucleic acid encoding a CRISPR-Cas system. Expression of the viral RNA silencing suppressor suppresses plant resistance to Nepovirus and improves plant genome editing efficiency.

[0047] In the present invention, a "viral RNA silencing suppressor" refers to a viral protein that has the function of suppressing RNA silencing, which is involved in viral resistance in animals and plants. Examples of viral RNA silencing suppressors include the 16K protein derived from tobacco rattle virus, the B2 protein derived from flock house virus, the p6 protein derived from rice yellow leaf virus, the 2b protein derived from cucumber mosaic virus, and the p25 protein derived from potato virus X, with the 16K protein derived from tobacco rattle virus being particularly preferred.

[0048] When the Nepovirus viral vector of the present invention is in the form of DNA encoding viral genomic RNA, the nucleic acid encoding the viral RNA silencing suppressor is carried in the form of DNA in the Nepovirus viral vector, whereas when the Nepovirus viral vector is in the form of viral genomic RNA or a viral particle containing viral genomic RNA, the nucleic acid encoding the viral RNA silencing suppressor is carried in the form of RNA in the Nepovirus viral vector.

[0049] In Nepovirus viral vectors, the RNA encoding the viral RNA silencing suppressor may be located 5' to the P1A gene of RNA1, between the genes, or 3' to the Pol gene, or 5' to the P2A gene of RNA2, between the genes, or 3' to the CP gene, but is preferably located 5' to the P1A gene of RNA1. When located 5' to the P1A gene, the RNA encoding the viral RNA silencing suppressor is preferably linked to the P1A gene via the 2A sequence.

[0050] (plant) In the present invention, the "plant" into which a Nepovirus vector is introduced is not particularly limited, as long as it is a plant that can serve as a host for a Nepovirus virus. Examples of such plants include Solanaceae plants (e.g., Nicotiana plants such as tobacco, Solanaceae plants such as eggplant, Petunia plants such as petunia, and Capsicum plants such as bell pepper), Leguminosae plants (e.g., Glycine soja (soybean) and Lupinus plants such as lupine), Ericaceae plants (e.g., Vaccinium mykiss (blueberry)), Rosaceae plants (e.g., Malus plants such as apple, Fragaria plants such as blackberry, Prunus plants such as sweet cherry, and Prunus plants such as peach), plants), Vitaceae (e.g., Vitis such as grapes), Cornaceae (e.g., Cornus such as dogwood), Oleaceae (e.g., Fraxinus such as ash, Olive such as olive), Iridaceae (e.g., Gladiolus such as gladiolus, Iris such as iris), Ranunculaceae (e.g., Anemone such as anemone), Lamiaceae (e.g., Mentha such as mint), Amaryllidaceae (e.g., daffodil, Narcissus plants such as papaya), Carapaceae (e.g., Papaya plants such as papaya), Geraniaceae (e.g., Pelargonium plants such as geranium), Salicaceae (e.g., Sambucus plants such as elderberry), Cucurbitaceae (e.g., Cucumis plants such as melon), Brassicaceae (e.g., Arabis plants such as Arabis), Moraceae (e.g., Morus plants such as mulberry), Euphorbiaceae (e.g., Potassium plants such as cassava), Crassulaceae ( Examples include Aeonium plants such as Aeonium, Apiaceae plants (e.g., Arracacha plants such as Arracacha), Asteraceae plants (e.g., Artichoke plants such as Artichoke, and Chicory plants such as Chicory), Amaranthaceae plants (e.g., Beetroot plants such as Sugar beet), Ribesaceae plants (e.g., Ribes plants such as Black currant), Malvaceae plants (e.g., Cacao plants such as Cacao, and Hibiscus plants such as Hibiscus), and Cycadaceae plants (e.g., Cycad plants such as Cycads).

[0051] (Suppression of RNA-dependent RNA polymerase 6 gene expression) In a preferred embodiment of the present invention, the expression of an endogenous RNA-dependent RNA polymerase 6 gene is suppressed in a plant into which a Nepovirus vector is introduced.

[0052] The "RNA-dependent RNA polymerase 6" in the present invention is known to be a protein involved in RNA silencing, which induces virus resistance in plants. By suppressing the expression of the RNA-dependent RNA polymerase 6 gene, plant resistance to Nepoviruses can be suppressed and the efficiency of plant genome editing can be improved.

[0053] Here, "suppression of gene expression" includes both suppression of gene transcription and suppression of translation into protein. Furthermore, "suppression of expression" includes not only complete cessation of expression but also reduction of expression.

[0054] To suppress the expression of the RNA-dependent RNA polymerase 6 gene, dsRNA (double-stranded RNA) complementary to the transcription product of the gene can be used. Introducing dsRNA with a sequence identical or similar to that of a target gene into cells can induce a phenomenon known as RNAi (RNA interference). In fact, an RNAi hairpin construct (RDR6i) that suppresses the expression of the RNA-dependent RNA polymerase 6 gene has been reported (Schwach et al., Plant Physiology (2005) 138(4), 1842-1852). Antisense RNA or RNA with ribozyme activity can also be used to suppress the expression of the RNA-dependent RNA polymerase 6 gene.

[0055] In the present invention, the RNA-dependent RNA polymerase 6 gene or its expression control region may be edited using a genome editing system (CRISPR-Cas, TALEN, ZFN, etc.) targeting the RNA-dependent RNA polymerase 6 gene to suppress the expression of a functional protein or the transcription of the gene.

[0056] (Plant genome editing) "Genome editing" in the present invention includes editing of the nuclear genome as well as the mitochondrial genome and chloroplast genome.

[0057] In the present invention, "editing the genome" includes deletion, insertion, substitution, or modification of bases in a DNA strand at a target site in the genome. It also includes regulation of DNA (gene) transcription at the target site. The manner of genome editing may vary depending on the activity of the Cas protein or the activity of other effector proteins fused to the Cas protein in the CRISPR-Cas system.

[0058] According to the present invention, genome editing can be performed not only on the plant part into which a Nepovirus virus vector has been introduced, but also throughout the entire plant. In this example, it was confirmed that continued cultivation of a plant into which a Nepovirus virus vector has been introduced increases the proportion of genome-edited cells in its axillary shoots. Therefore, by propagating such axillary shoots by cuttings or the like, it is possible to obtain genome-edited individuals without seed propagation. Furthermore, by obtaining seeds from the axillary shoots, it is possible to significantly improve the heritability of the edited genome in the next generation of individuals.

[0059] Although the Nepovirus virus vector of the present invention can be used to edit the genome of a plant without tissue culture, as described above, it goes without saying that it is also possible to edit the genome of a plant via tissue culture. In this case, the Nepovirus virus vector of the present invention is introduced into plant cells, and a plant can be regenerated from the plant cells. Methods established in the art can be used to regenerate plant tissues by tissue culture to obtain individuals (e.g., Transformation Protocols [Plant Edition], edited by Yutaka Tabei, Kagaku Dojin, pp. 340-347 (2012)).

[0060] <Kit for producing genome-edited plants> The present invention provides a kit for producing a genome-edited plant.

[0061] The kit of the present invention includes a Nepovirus virus vector carrying a nucleic acid encoding a Cas protein and a nucleic acid encoding a guide RNA. As described above, the Nepovirus virus vector may further include a nucleic acid encoding a viral RNA silencing suppressor.

[0062] The kit of the present invention may further include one or more additional components. Examples of the additional components include a molecule for inhibiting expression of the RNA-dependent RNA polymerase 6 gene. Other additional components include a target reagent (e.g., a Nepovirus virus vector not containing a CRISPR-Cas system).

[0063] The kits of the present invention may further include instructions for use. [Example]

[0064] A. Materials and Methods (1)Plants Nicotiana benthamiana was grown at 25°C under a 16-hour light / 8-hour dark cycle.

[0065] (2) Viruses and partial sequences used TRSV RNA1 (SEQ ID NO: 1, 2) TRSV RNA2-Cas9(NbPDS) (SEQ ID NOs: 3 and 4) TRSV RNA1-Tobacco rattle virus 16K (SEQ ID NO: 5, 6) Flock House virus B2 (SEQ ID NO: 7, 8) Rice yellow leaf virus P6 (SEQ ID NOs: 9, 10) Cucumber mosaic virus 2b (SEQ ID NO: 11, 12) Potato virus X p25 (SEQ ID NO: 13, 14) ALSV RNA1 (SEQ ID NOs: 15, 16) ALSV RNA2-NbRDR6 (SEQ ID NO: 17, 18).

[0066] (3) Virus vectors for agroinfection (TRSV, ALSV) The CaMV 35S promoter and nopaline synthase gene terminator were introduced into pPZP2028 (Endo et al. (2015) Plant Cell Physiol. 56:116-125), and each viral cDNA was cloned between them.

[0067] (4) Virus inoculation Agrobacterium carrying each viral cDNA plasmid and Agrobacterium carrying a plasmid expressing the Tomato bushy stunt virus p19 gene were co-inoculated according to the method of Ariga et al. (Ariga et al. Plant Cell Physiology (2020) 61 (11), 1946-1953). The tobacco ringspot virus vector (TRSV) was inoculated into the fifth to eighth true leaves of Nicotiana benthamiana approximately four weeks after sowing. RDR6 gene expression was suppressed by inoculating the first to third true leaves with the ALSV vector approximately 18 days after sowing.

[0068] (5) Genomic DNA extraction and CAPS analysis of Nicotiana benthamiana DNA was extracted using the DNeasy Plant Mini kit (QIAGEN) or the Kaneka Easy DNA Extraction Kit Version 2 (Kaneka). CAPS analysis was performed by PCR-amplified DNA using primers (forward primer: TTAGGTTCACAAGTGGGACAATCTTC / SEQ ID NO: 19, reverse primer: CAGCATCACACTTTCGCATTCAAAAC / SEQ ID NO: 20) and cleaving the amplified DNA with the restriction enzyme NcoI.

[0069] B. Results (1) Genome editing in Nicotiana benthamiana using a TRSV vector expressing the CRIPR-Cas9 system A combination of a TRSV vector for agroinfection expressing "TRSV RNA1" and a TRSV vector for agroinfection expressing "TRSV RNA2-Cas9(NbPDS)" was inoculated into Nicotiana benthamiana using the Agrobacterium method (Figure 1). As a result, a mutation in the PDS gene was detected in leaves above the inoculated leaf (top right), but a short band indicating loss of the Cas9 gene was detected in leaves eight or more leaves above the inoculated leaf (bottom right). It is thought that the introduction of a mutation in the PDS gene in the shoot apical meristem of Nicotiana benthamiana causes tissues containing mutant cells to continue to arise.

[0070] Furthermore, it was found that continued cultivation of the inoculated plants resulted in the concentration of mutations in the axillary buds, and individuals exhibiting a phenotype similar to branch mutation appeared. By using such individuals, it is possible to select axillary buds consisting almost entirely of mutant cells.

[0071] (2) Effect of RNA-dependent RNA polymerase 6 (RDR6) gene silencing on genome editing efficiency To suppress the expression of the RNA-dependent RNA polymerase 6 gene by virus-induced gene silencing, we used the Agrobacterium method to inoculate N. benthamiana plants pre-inoculated with a combination of an agroinfection vector for ALSV expression of "ALSV RNA2-NbRDR6" and an agroinfection vector for ALSV expression of "ALSV RNA1," and a control (N. benthamiana pre-inoculated with ALSV-empty) with a combination of an agroinfection vector for TRSV expression of "TRSV RNA1" and an agroinfection vector for TRSV RNA2-Cas9(NbPDS) and examined the presence or absence of mutations in the 10 upper leaves (Fig. 2).

[0072] As a result, when the expression of the RNA-dependent RNA polymerase 6 gene was suppressed, the efficiency of introducing mutations into the PDS gene increased compared to the control (top). Furthermore, in plants where the expression of the RDR6 gene was suppressed, whitening of the leaf surface due to the disruption of the target PDS gene was rarely observed (bottom).

[0073] (3) Effect of RNA silencing suppressor (VSR) expression on genome editing efficiency A combination of agroinfection TRSV vectors expressing "TRSV RNA1-each RNA silencing suppressor" and "TRSV RNA2-Cas9 (NbPDS)" was inoculated into Nicotiana benthamiana using the Agrobacterium method, and the presence or absence of mutations in the 10 upper leaves was examined (Figure 3, top). As a result, expression of the RNA silencing suppressors increased the overall efficiency of mutation introduction into the PDS gene, but the highest efficiency of mutation introduction was achieved when the 16K protein derived from tobacco rattle virus (TRV) was expressed (Figure 3, bottom).

[0074] (4) Confirmation of mutations in the next generation For the next-generation individuals obtained from the individuals obtained in (2) above, mutations introduced into the two target genes (NbPDSa and NbPDS1b) present due to amphidiploidy were detected using the CAPS method (Figure 4). As a result, mutations were detected in some individuals, and when confirmed by Sanger sequencing, 42% (8 / 19) of individuals had mutations in one of the genes, and 26% (5 / 19) had mutations in both genes. [Industrial Applicability]

[0075] As described above, the present invention enables plant genome editing without tissue culture, which makes it possible to easily and efficiently produce a wide range of plants with various traits depending on the type of gene to be genome-edited.

Claims

1. A method for producing a genome-edited plant, comprising introducing into a plant a tobacco ringspot virus vector carrying a nucleic acid encoding a Cas protein of a class 2 system and a nucleic acid encoding a guide RNA; The plant is a plant that is a host for tobacco ringspot virus, a nucleic acid encoding a Cas protein of a class 2 system is located on the 5' side of the P2A gene, between the P2A gene and the MP gene, between the MP gene and the CP gene, or on the 3' side of the CP gene in RNA2 of a tobacco ringspot virus vector, thereby allowing a polyprotein containing the Cas protein, P2A, MP, and CP to be expressed in the plant; The method, wherein the nucleic acid encoding the guide RNA is located 3' to the coding region for the polyprotein in RNA2 of the tobacco ringspot virus vector.

2. The method described in claim 1, wherein the tobacco ringspot virus vector further carries a nucleic acid encoding a viral RNA silencing suppressor.

3. 3. The method of claim 2, wherein the viral RNA silencing suppressor is the 16K protein from tobacco rattle virus.

4. The method described in claim 1, wherein the plant into which the tobacco ringspot virus vector is introduced is a plant in which the expression of the endogenous RNA-dependent RNA polymerase 6 gene is suppressed.

5. A method described in any one of claims 1 to 4, wherein the Cas protein of the class 2 system is a Cas9 protein.

6. A kit for producing a genome-edited plant, comprising a tobacco ringspot virus vector carrying a nucleic acid encoding a Cas protein of a class 2 system and a nucleic acid encoding a guide RNA; The plant is a plant that is a host for tobacco ringspot virus, a nucleic acid encoding a Cas protein of a class 2 system is located on the 5' side of the P2A gene, between the P2A gene and the MP gene, between the MP gene and the CP gene, or on the 3' side of the CP gene in RNA2 of a tobacco ringspot virus vector, thereby allowing a polyprotein containing the Cas protein, P2A, MP, and CP to be expressed in the plant; A kit, wherein the nucleic acid encoding the guide RNA is located 3' to the coding region of the polyprotein in RNA2 of the tobacco ringspot virus vector.

Citation Information

Patent Citations

  • RNA viral RNA molecule for gene editing

    WO2020234468A1