Uses of CCL11
The targeted delivery of antigens via CCL11 and a T2 fragment enhances antigen presentation by DCs, achieving robust immune responses against pathogens and tumors, demonstrating improved disease prevention and treatment efficacy.
Patent Information
- Application Number
- JP2024533967
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2022-01-24
- Filing Date
- 2022-06-06
- Publication Date
- 2025-12-01
- Estimated Expiration
- 2042-06-06
AI Technical Summary
Current methods lack effective strategies to enhance antigen presentation by dendritic cells (DCs) for stronger immune responses against pathogens and tumors, necessitating the identification of additional DC cell surface molecules to mobilize robust immune responses.
The use of a T2 fragment and/or CCL11 for targeted antigen delivery, forming a fusion protein with antigens to enhance presentation by DCs, leveraging the chemotactic properties of CCL11 to recruit and activate DCs and eosinophils, and incorporating a linker and signal peptide for efficient expression and secretion.
The fusion protein significantly enhances antigen presentation and immune responses, inducing both cellular and humoral immunity, effectively inhibiting tumor growth and improving disease prevention and treatment outcomes.
Smart Images

Figure 0007777890000004 
Figure 0007777890000005 
Figure 0007777890000006
Abstract
Description
[Technical Field]
[0001] This application claims priority from China Patent Application No. 202210076816.7, entitled "Use of CCL5," filed with the State Intellectual Property Office of the People's Republic of China on January 24, 2022, the entire contents of which are incorporated herein by reference.
[0002] The present invention relates to the technical field of vaccine preparation, and in particular to an immune-enhancing delivery system formed by targeted delivery of antigens via CCL11. [Background technology]
[0003] The human body is constantly faced with attacks from external pathogenic microorganisms and carcinogenesis of its own normal cells. The immune system is the body's most powerful weapon against pathogenic microorganisms and its own tumor cells. The immune system's response involves three stages: recognition, reaction, and effect. Each stage is completed by the cooperation of the proteins, cells, tissues, and organs that make up the body's immune system. During the recognition stage of the overall response process, the immune system must distinguish between self-antigens and pathogens to avoid attacking itself. After recognition, the immune system enters the response stage against a specific pathogen. This stage involves the production of numerous proteins and specific cells. During the effect stage, these proteins and cells eliminate the pathogen and create immunological memory against it.
[0004] Pathogenic microorganisms, such as viruses, bacteria, fungi, and parasites, often cause large-scale epidemics. For example, SARS-CoV-2, which emerged at the end of 2019, spread worldwide. After invading the body, some pathogenic microorganisms induce transient illness without remaining dormant for long periods, while others remain dormant for long periods within the body's cells and tissues and cause disease. Therefore, preventive vaccines are needed to prevent the spread of pathogenic microorganisms, and therapeutic vaccines are also needed to treat and eliminate host cells that contain pathogenic microorganisms. Therefore, the immune system must generate both humoral and cellular immune responses. To achieve this, specific antigens of pathogenic microorganisms are injected into the human body to induce immune recognition. Furthermore, past experience has shown that the stronger the immune response, the better the preventive and therapeutic effects of vaccines.
[0005] CCL11, a member of the CC family of chemokines, is primarily expressed in the small intestine, heart, kidney, and pancreas. CCL11 expression is upregulated by proinflammatory cytokines such as TNFα and IL-4. CCL11 exerts its chemotactic function primarily through its receptor CCR3. Studies have shown that CCR3 is expressed on DCs and eosinophils. DCs are specialized antigen-presenting cells that primarily mediate antigen recognition. In addition to classical antibacterial effects, eosinophils can also mediate antitumor immune responses by enhancing specific T cell immune responses. Therefore, fusion of antigen molecules with CCL11 enhances the immunogenicity of antigens, initiates stronger immune responses, and provides an option for the preparation of more effective vaccines.
[0006] Dendritic cells (DCs) are professional antigen-presenting cells and a key component of the immune system. They circulate in the blood, are present throughout the body, and are primarily responsible for the engagement, processing, and presentation of antigens. They play a key role in the immune recognition phase. The degree of antigen recognition by DC cells determines the strength of the immune response.
[0007] Tumors are difficult for the immune system to recognize because they originate from self-tissue cells. However, compared with normal tissue cells, tumor cells typically highly express or mutate specific oncogenes to promote tumor cell proliferation and survival. These highly expressed or mutated gene products are usually weakly immunogenic, so they do not elicit a strong immune response to eliminate these tumor cells. Therefore, methods to mobilize the immune system to generate a strong immune response are key to eliminating tumors.
[0008] Tumor vaccines induce the function of effector T cells in patients by enhancing existing antitumor responses or activating naive T cells. Antigen-specific CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in the antitumor process. DC cells are the only professional antigen-presenting cells capable of activating naive CD8+ T cells. They internalize, process, and cross-present extracellular tumor antigens via MHC-I, which is crucial for the generation of effective CTLs. Therefore, conjugating DC cell surface molecules to deliver tumor antigens to DC cells is an effective tumor treatment strategy for inducing CD8+ T cell immune responses.
[0009] Currently, XCL-1 has been identified as a molecule that can enhance DC cell presentation, but there is an urgent need to investigate additional DC cell surface molecules that can promote presentation. Summary of the Invention [Problem to be solved by the invention]
[0010] The present invention has been made in view of the above circumstances, and aims to provide an immune-enhancing delivery system formed by targeted delivery of an antigen via a T2 fragment and / or CCL11. [Means for solving the problem]
[0011] The present invention provides the use of at least one of the following (I) to (VI) in improving the antigen presentation effect: T2 fragment (I) having the amino acid sequence shown in SEQ ID NO: 4; chemokine CCL11(II), (III) a fragment having 80% or more homology to (I) or (II) and having the same or similar function; A nucleic acid molecule (IV) encoding (I) or (II), A nucleic acid molecule (V) comprising one or more nucleotide substitutions, deletions or additions in the nucleotide sequence of the nucleic acid molecule (IV) and capable of encoding a functionally identical or similar protein; A nucleic acid molecule (VI) that is completely or partially complementary to (V).
[0012] In the present invention, the T2 fragment consists of 31 amino acids, and its sequence is shown in SEQ ID NO: 4. Research has shown that the artificially modified T2 fragment has the effect of enhancing the human immune system.
[0013] In the present invention, the CCL11 is a chemokine CCL11 derived from humans or other animals, and may be a full-length sequence or a fragment having CCL11 activity. The present invention has found that CCL11 can deliver antigens to DC cells, thereby enhancing the presentation effect and enhancing the immune response.
[0014] The present invention also provides fusion proteins comprising CCL11 and an antigen, or comprising CCL11, an antigen and a T2 fragment.
[0015] In one embodiment of the present invention, the fusion protein comprises, in order from the N-terminus to the C-terminus, an IgE signal peptide, CCL11, a linker, an antigen, and a T2 fragment.
[0016] In the present invention, the antigen is derived from a virus, a pathogenic microorganism and / or a tumor.
[0017] In the present invention, the CCL11 is a humanized CCL11 sequence, and the antigen is HPV16 E6 protein and / or HPV16 E7 protein.
[0018] In some embodiments, the fusion protein comprises, in order from the N-terminus to the C-terminus, an IgE signal peptide, CCL11, a linker, HPV16 E6 protein, HPV16 E7 protein, and a T2 fragment.
[0019] In some embodiments, the amino acid sequence of the IgE signal peptide is set forth in SEQ ID NO:5.
[0020] The CCL11 amino acid sequence is shown in SEQ ID NO:3. The linker is (G5S)n, where n is 1 to 10. In an embodiment of the invention, the linker sequence is GGGGSGGGGGG. The amino acid sequence of the HPV16 E6 protein is shown in SEQ ID NO:1. The amino acid sequence of the HPV16 E7 protein is shown in SEQ ID NO:2. The amino acid sequence of the T2 fragment is shown in SEQ ID NO:4.
[0021] In some embodiments, the C-terminus of the fusion protein further comprises a flag tag sequence with the amino acid sequence DYKDDDDK, which serves as a tag for identifying protein expression and does not affect the immunological effect of the sequence.
[0022] The present invention also provides a nucleic acid encoding the fusion protein.
[0023] The nucleotide sequence encoding the fusion protein of the present invention is shown in SEQ ID NO:9.
[0024] The present invention also provides a nucleic acid fragment encoding the fusion protein of the present invention, comprising a 5'-UTR, a 3'-UTR, and a 3'-end PolyA, wherein the 5'-UTR is β-globin-2, the 3'-UTR is β-globin-2, and the 3'-end PolyA is 120 bp in length. The nucleic acid fragment has the structure 5'UTR-CCL11-E6E7-3'UTR-A(120).
[0025] The present invention further provides a transcription unit containing the coding sequence for the fusion protein.
[0026] The transcription unit includes a promoter and a nucleic acid encoding the fusion protein.
[0027] In some embodiments, the transcription unit further comprises a terminator.
[0028] In some specific embodiments, the promoter is a CMV or CMV / R promoter.
[0029] The present invention further provides an expression vector comprising a vector backbone and a nucleic acid encoding the fusion protein.
[0030] In the present invention, the vector backbone is a pVAX1-based vector or a pVR-based vector.
[0031] The present invention further provides a recombinant host for transforming or transfecting the recombinant vector.
[0032] The host cells of the recombinant host of the present invention are bacterial or mammalian cells.
[0033] The method for preparing the fusion protein of the present invention comprises culturing the recombinant host of the present invention to obtain a culture containing the fusion protein.
[0034] The present invention provides a delivery system for delivering antigenic substances, such as viruses, bacteria, fungi, and tumors, to CCR3-positive antigen-presenting cells. In this system, the chemokine CCL11 is fused to the corresponding antigen molecule, and a T2 tab is added to the end of the antigen molecule to further enhance immunogenicity. This system can be used in the form of a nucleic acid vector or a fusion protein for the prevention or treatment of diseases caused by the antigen.
[0035] The present invention provides the use of an antigen delivery system comprising the ligand CCL11, which binds to CCR3, in the preparation of a prophylactic or therapeutic vaccine.
[0036] The present invention provides the use of a fusion protein, a nucleic acid, an expression vector, a host, a fusion protein obtained by the preparation method, and / or a culture containing the fusion protein obtained by the preparation method in the preparation of a product for the prevention or treatment of a disease.
[0037] The present invention also provides products for the prevention and treatment of diseases, comprising the fusion protein, nucleic acid, expression vector, host, fusion protein obtained by the preparation method, and / or a culture containing the fusion protein obtained by the preparation method.
[0038] Furthermore, the present invention provides a method for preventing or treating a disease, which comprises administering the product for preventing or treating the disease.
[0039] In the present invention, the prevention and treatment includes prevention and / or treatment, specifically including increasing serum antibody levels, preventing tumor formation, inhibiting tumor growth, and improving the body's immune response capability against tumors.
[0040] In the present invention, the disease includes diseases caused by viruses and / or pathogenic microorganisms, or the disease is a tumor.
[0041] In the present invention, the products for preventing and treating the diseases include medicines and / or vaccines, which are DNA vaccines, recombinant protein vaccines, or mRNA vaccines.
[0042] In the present invention, said administration includes oral administration, injection and / or electroporation.
[0043] Related studies and numerous experiments have shown that fusing any CC family chemokine member with an antigen molecule does not enhance immunogenicity, but rather that only some CC family chemokine members can be fused with antigen molecules to improve the immunogenicity of the antigen, initiate stronger immune responses, and provide options for the production of more potent vaccines. For example, related studies have shown that 4-1BBL-S, 4-1BBL-Fc, CD80-Fc, etc., significantly enhance antigenic immunogenicity when fused with antigen molecules, while GM-CSF, mlL-23, IL-15SAG1, etc., have no effect on enhancing immunogenicity when fused with antigen molecules.
[0044] In the present invention, the chemotactic binding ability of CCL11 to surface receptors on immune cells such as DC cells is utilized to transport and cross-present various antigenic proteins to the DC cell surface, thereby improving the efficiency with which various antigenic proteins are taken up, processed, and presented by DC cells, thereby improving the effectiveness of preventing and treating related diseases. Experiments have confirmed that the T2 fragment in the present invention has a highly potent immune-enhancing effect, and during the process of promoting antigen presentation, it can further stimulate humoral and cellular immune responses, ultimately achieving the effect of inhibiting the growth of related tumors.
[0045] In order to more clearly describe the specific embodiments of the present invention or the technical solutions of the prior art, the following briefly introduces the drawings used to describe the specific embodiments or the prior art. The drawings in the following description are some embodiments of the present invention, and it is obvious that those skilled in the art can obtain other drawings based on these drawings. [Brief explanation of the drawings]
[0046] [Figure 1] FIG. 1 shows the results of analyzing the ability of CCL11 to chemotact DC cells and eosinophils. [Figure 2-1]Figure 2 shows vector maps of the nucleotide sequences encoding the fusion proteins, where A in Figure 2 shows the plasmid maps of pVR-CCL11-E6E7-T2, B in Figure 2 shows the plasmid maps of pVR-CCL11-E6E7, and C in Figure 2 shows the plasmid maps of pVR-E6E7. [Figure 2-2] Figure 2 shows vector maps of the nucleotide sequences encoding the fusion proteins, where A in Figure 2 shows the plasmid maps of pVR-CCL11-E6E7-T2, B in Figure 2 shows the plasmid maps of pVR-CCL11-E6E7, and C in Figure 2 shows the plasmid maps of pVR-E6E7. [Figure 3] Figure 3 shows the detection of the expression of three target genes, plasmids pVR-CCL11-E6E7-T2, pVR-CCL11-E6E7, and pVR-E6E7, and the detection of the expression of nucleotides encoding fusion proteins bearing a Flag tag using protein Western blot technology. [Figure 4] FIG. 4 shows the timeline of preventive immunization of mice with different fusion genes to measure specific T cell responses. [Figure 5] FIG. 5 shows the results of flow cytometry detection of specific T cell responses after immunization of mice with different fusion genes. [Figure 6] FIG. 6 shows the results of detecting specific antibody responses after immunizing mice with different fusion genes. [Figure 7] FIG. 7 shows the timeline of therapeutic immunization and vaccination of mice with different fusion gene, mRNA, and protein vaccines, respectively. [Figure 8] Figure 8 shows the volume of treated cell tumors in each group. DETAILED DESCRIPTION OF THE INVENTION
[0047] The present invention provides an immune-enhancing delivery system formed by targeted delivery of an antigen via CCL11. Those skilled in the art can realize this by appropriately modifying the process parameters while referring to the contents of this specification. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. While the methods and applications of the present invention have been described using preferred embodiments, it is clear that those skilled in the art can modify or make appropriate changes and combinations to implement and apply the technology of the present invention without departing from the content, spirit, and scope of the present invention.
[0048] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For definitions and terminology in the field, experts can specifically refer to Current Protocols in Molecular Biology (Ausubel). Amino acid residue abbreviations are based on the standard three-letter and / or one-letter codes used in the field to represent one of the 20 common L-amino acids.
[0049] The CCL11 of the present invention is an important chemokine in the human body that belongs to a member of the CC chemokine family and is expressed at high levels specifically in the human heart and kidney. Research in the present invention has shown that CCL11 can be used to deliver substances to professional antigen-presenting cells, particularly DCs and eosinophils, to enhance the presentation effect of DC cells and the recruitment effect of T cells.
[0050] The CCL11 of the present invention may be a humanized fragment, or may be a target fragment derived from other animals, such as mouse, rabbit, monkey, or pig. Furthermore, the CCL11 may be the complete CCL11, or a fragment or mutant having CCL11 activity, but this application is not limited to this. In the examples of the present application, humanized CCL11 was used as the experimental subject, and the improved antigen presentation effect of CCL11 was demonstrated. The amino acid sequence of the humanized CCL11 is SEQ ID NO: 3.
[0051] The T2 sequence in the fusion protein of the present invention is modified from a short C-terminal peptide of bacteriophage T4 fibrin (T4 phageheadfibritin) and is a sequence of foreign species origin. Because this sequence is completely absent in the human body, it does not cause the problem of killing other human proteins after immune enhancement. It has been reported that this sequence can promote the trimerization of certain proteins under certain conditions. In the present invention, T2 as an artificially modified polypeptide sequence has been found to have an immune-enhancing effect in the body. In the present invention, the T2 fragment consists of 31 amino acids, and its sequence is SEQ ID NO: 4.
[0052] The fusion protein of the present invention contains at least one antigen, but may contain, for example, one, two, three, four, five, six, seven, eight, nine, or ten or more antigens. In the present study, experiments were conducted on the effects of fusion with one or two antigens, and all showed good results.
[0053] Antigens according to the present invention are derived from viral, bacterial, fungal, parasitic, and / or tumor proteins. In some embodiments, antigens are derived from viral capsid or nonstructural proteins, membrane proteins of pathogenic microorganisms, flagellin, or tumor surface antigens. Antigens may be complete fragments or antigenic determinants. Furthermore, antigens may contain only one antigenic determinant, or may comprise multiple antigenic determinants linked in tandem, or may comprise two or more repeats of one antigenic determinant linked in tandem.
[0054] In the present invention, the virus includes, but is not limited to, at least one of HPV virus, HCMV, EBV, HCV, HIV, HBV, VZV and / or coronavirus.
[0055] In the present invention, the tumor includes, but is not limited to, at least one of liver cancer, cervical cancer, ovarian cancer, lung cancer, head and neck cancer, prostate cancer, breast cancer, blood cancer, melanoma, nasopharyngeal cancer, and / or colon cancer.
[0056] In some embodiments, the antigen is the E2, E5, E6, and / or E7 protein or a variant epitope thereof of an HPV virus, including various HPV subtypes, such as HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, and / or HPV58.
[0057] In some embodiments, the antigen is LMP1, LMP2, EBNA1 of EB virus or a mutant epitope thereof.
[0058] In some embodiments, the antigen is an S protein, an N protein, an E protein, an M protein, or an epitope thereof of a coronavirus, wherein the coronavirus is SARS-CoV, MERS-CoV, and / or SARS-CoV-2.
[0059] In some embodiments, the antigen is a pan-cancer protein such as VEGFR2, Survivin, or FAP.
[0060] In some embodiments, the antigen is GPC3 protein and / or AFP protein of liver cancer.
[0061] In some embodiments, the antigen is PSA, PSMA, PSCA, PAP and / or STEAP1 for prostate cancer.
[0062] In some embodiments, the antigen is a dominant epitope of Her2 / neu and / or BCAR3 in breast cancer.
[0063] In some embodiments, the antigen is melanoma MAGE-A3, ISR2, NY-ESO-1, Melan A, gp100, tyrosinase, TRP1 and / or TRP2.
[0064] In some embodiments, the antigen is an immunoglobulin idiotype, an immunoglobulin κ-chain, and / or an immunoglobulin λ-chain of a hematological cancer.
[0065] In some embodiments, the antigen is AIM2, HT001, TAF1B, Micoryx and / or TGFβRII for colon cancer.
[0066] In some embodiments, the antigen is folate receptor-α for ovarian cancer.
[0067] In some embodiments, the antigens are various proto-oncogenes, anti-oncogenes, and / or tumor-specific antigens such as P53, IDH1 / 2, BAGE, GAGE1, GAGE2, CAG3, RAGE, CEA, CDK4, CASP-8, KRAS, bcr / abl, and / or MUC-1.
[0068] The present invention utilizes the chemotactic binding ability of CCL11 to surface receptors on immune cells, such as DC cells, to transport and cross-present antigenic proteins to the DC cell surface, thereby improving the efficiency with which various antigenic proteins are taken up, processed, and presented by DC cells, and also improving the effectiveness of preventing and treating related diseases. Experiments have demonstrated that CCL11 enhances the presentation efficiency of multiple antigens, including the HPV16 E6 or E7 proteins. In the examples of the present invention, it has been demonstrated that CCL11 improves the presentation efficiency of antigenic proteins, using the HPV16 E6 or E7 proteins as an example, and other proteins may also have good effects when fused with CCL11.
[0069] In the present invention, a linker is added between the fragments to ensure smooth folding of each functional fragment in the fusion protein without steric hindrance. Here, the linker between CCL11 and the HPV virus antigen protein is GGGGGSGGGGG. Different antigens can be linked by (G5S)n and / or AGA.
[0070] In the present invention, to improve the expression efficiency of the fusion protein, a signal peptide is added to the N-terminus of CCL11 to promote secretion of the fusion protein into the extracellular space. In some embodiments, the signal peptide is an IgE signal peptide. Specifically, the amino acid sequence is SEQ ID NO: 5.
[0071] In the present invention, a tag is added to the C-terminus of the fusion protein to facilitate purification of the fusion protein. The tag is selected from recombinant protein purification tags well known in the art. In some embodiments, the tag is DYKDDDDK.
[0072] In some specific examples, the fusion protein has a structure including, from the N-terminus to the C-terminus, an IgE signal peptide, a humanized CCL11 protein sequence, a linker sequence (GGGGGSGGGGG), an E6E7 protein sequence, a T2 protein sequence, and a flag tag sequence, in that order. Specifically, the amino acid sequence is, for example, SEQ ID NO: 15.
[0073] The nucleic acid encoding the protein of the present invention may be DNA, RNA, cDNA, or PNA. In an embodiment of the present invention, the nucleic acid is in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The nucleic acid may contain nucleotide sequences with different functions, for example, a coding region and a non-coding region such as a regulatory sequence (e.g., a promoter or transcription terminator). The nucleic acid may be linear or circular in topology. The nucleic acid may be, for example, part of a vector (e.g., an expression or cloning vector) or a fragment. The nucleic acid may be obtained directly from a natural source or may be prepared using recombinant, enzymatic, or chemical techniques. The RNA form may be mRNA obtained by gene transcription, etc.
[0074] In the present invention, the DNA sequence for expressing the fusion protein is optimized, including, but not limited to, codon usage bias, removal of secondary structures that do not contribute to expression (such as hairpin structures), CpG dinucleotide content, mRNA secondary structure, splice site cryptisms, early polyadenylation sites, internal ribosome entry and binding sites, negative CpG islands, RNA instability regions, repeat sequences (such as direct repeats and inverted repeats), restriction sites that can affect cloning, and GC content modifications.
[0075] "Prevention" according to the present invention refers to the ability to reduce the risk of tumor development by administering the agent of the present invention before tumor development. "Treatment" according to the present invention refers to the ability to inhibit tumor growth, reduce tumor volume, or delay tumor growth by administering the agent of the present invention after tumor development. In the examples of the present invention, the effect of the fusion protein vaccine is demonstrated using tumor cells TC-1 transplanted into mice as the experimental subject.
[0076] The present invention also provides a transcription unit for a fusion protein. The transcription unit refers to a DNA sequence beginning with a promoter and ending with a terminator. A regulatory fragment may be further included on either side of or between the promoter and terminator. This regulatory fragment includes a promoter, enhancer, transcription termination signal, polyadenylation sequence, replication origin, nucleic acid restriction site, and homologous recombination site, such as a promoter enhancer or poly(A) signal, all operably linked to the nucleic acid sequence. The transcription unit provided by the present invention includes a CMV or CMV / R promoter, a CMV enhancer, and a nucleic acid fragment encoding the fusion protein.
[0077] A recombinant vector of the present invention is a recombinant nucleic acid vector, a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding gene in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotic cells include a promoter and optional operator sequence, a ribosome binding site, and possibly other sequences. Prokaryotes are known to use promoters, enhancers, terminators, and polyadenylation signals. Once transformed into an appropriate host, the vector can replicate and function independently of the host genome or, in some cases, can integrate into the genome. The terms "plasmid" and "vector" are sometimes used interchangeably herein, as plasmids are the most commonly used form of vector. However, the present invention is intended to encompass other forms of expression vectors that serve equivalent functions, including, but not limited to, plasmids, phage particles, viral vectors, and / or potential genomic inserts, as are known or will become known in the art. In specific embodiments, nucleic acids encoding the fusion proteins provided herein can be constructed into various eukaryotic expression vectors. For example, the vector backbone may be a pVAX1-based vector or a pVR-based vector (see Chinese Patent ZL202110624820.8).
[0078] The host cell of the present invention is a prokaryotic or eukaryotic host containing a nucleic acid vector and / or a target gene. The host cell is transformed or transfected with a vector constructed by recombinant DNA techniques. The host cell thus transformed is capable of replicating a protein-encoding vector or expressing the desired protein.
[0079] In an embodiment of the invention, the fusion protein is prepared by a method of inducing expression in a recombinant host, the culture being bacteria, cells and culture solution obtained from the culture, or an extract and / or purified product from the culture.
[0080] The products for preventing and treating diseases provided by the present invention include the fusion protein, nucleic acid, expression vector, host, fusion protein obtained by the preparation method, and / or culture containing the fusion protein obtained by the preparation method.The products for preventing and treating diseases provided by the present invention include pharmaceuticals and / or vaccines.The vaccines further contain pharmaceutically acceptable carriers, excipients, and / or adjuvants.The pharmaceuticals further contain pharmaceutically acceptable auxiliary substances.
[0081] "Prevention" according to the present invention refers to the administration of a product for the prevention and treatment of a disease according to the present invention before the onset of the disease, thereby reducing the risk of the disease. "Treatment" according to the present invention refers to the administration of a product for the prevention and treatment of a disease according to the present invention after the onset of the disease, thereby improving the disease, suppressing the onset of the disease, and restoring the patient's health. For example, the use of a product according to the present invention in the prevention and treatment of tumors can increase serum antibody levels, inhibit tumor growth, reduce tumor volume, or delay tumor growth. In the examples of the present invention, the efficacy of the fusion protein vaccine was demonstrated using TC-1 tumor cells transplanted into mice as the experimental subject, and favorable results were obtained.
[0082] The amino acid sequences of the fragments and the encoding nucleic acid fragments according to the examples of the present invention are shown in Table 1. [Table 1] Example
[0083] The present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are used only to illustrate the present invention and are not intended to limit the scope of the present invention. Unless specific conditions are specified in the examples, the examples may be carried out according to conventional conditions or conditions recommended by the manufacturer. Unless specified by the manufacturer, the reagents and instruments used may be conventional, commercially available products.
[0084] Example 1 After isolating DCs and eosinophils from mouse lymph nodes and peripheral blood, chemotaxis experiments were performed. The isolated cells were placed in the upper part of a chemotaxis chamber (carbonate membrane Transwell chamber: 5 μm, Costar, Cat. 3422). The cell addition volume was 1 × 10 cells based on the inventor's previous basic research. 6 The chemotaxis chamber was placed in the lower chamber containing 600 μL of medium containing the chemokine CCL11. At the same time, equal numbers of cells were added to establish a spontaneous migration control group and a CCL11 cytokine group. Three replicate wells were set up. E. coli-purified recombinant murine CCL11 protein was used as the chemokine CCL11. Based on the inventor's previous basic research, the optimal dose for chemotaxis efficiency was set at 100 ng / ml. After 4 hours, cells were collected from the lower chamber of the chemotaxis chamber, and the chemotactic activity of CCL11 toward various immune cells was analyzed by flow cytometry. The results showed that CCL11 effectively recruited various immune cells from the upper chamber to the lower chamber (P<0.001) (Figure 1).
[0085] Example 2 Antigen design scheme for fusion gene or protein vaccines and construction and production of mammalian expression plasmids Construction of pVR-CCL11-E6E7-T2 plasmid: The fusion protein CCL11-E6E7-T2 was constructed from the E6 and E7 proteins of human papillomavirus subtype HPV16, humanized CCL11 protein, and the T2 polypeptide sequence. The N-terminus of the fusion protein CCL11-E6E7-T2 was linked to an IgE signal peptide with the amino acid sequence MDWTWILFLVAAATRVHS, and the C-terminus was linked to a Flag tag consisting of eight amino acids DYKDDDDK.
[0086] The finally obtained fusion protein contains, from the N-terminus to the C-terminus, the IgE signal peptide, the humanized CCL11 protein sequence, the linker sequence (GGGGGSGGGGG), the E6 protein sequence, the E7 protein sequence, the T2 protein sequence, and the Flag tag sequence, in that order.
[0087] The amino acid sequence of the fusion protein was codon-optimized for expression in animal cells, and the resulting fusion gene sequence was set forth in SEQ ID NO: 8. After gene synthesis of the fusion gene sequence, the entire sequence was inserted into the corresponding polyclonal region of the pVR plasmid vector to enable expression of the fusion protein with the correct codon translation sequence. As shown in Figure 2A, the final plasmid constructed was designated pVR-CCL11-E6E7-T2.
[0088] Construction of plasmid pVR-CCL11-E6E7: Similarly, the fusion gene finally constructed contained, from the N-terminus to the C-terminus, the IgE signal peptide, the humanized CCL11 protein sequence, the linker sequence (GGGGGSGGGGG), the E6E7 protein sequence, and the flag tag sequence, in that order.
[0089] The amino acid sequence of the fusion protein was codon-optimized for expression in animal cells, and the resulting fusion gene sequence was set forth as SEQ ID NO: 10. After gene synthesis of the fusion gene sequence, the entire sequence was inserted into the corresponding polyclonal region of the pVR plasmid vector to enable expression of the fusion protein with the correct codon translation sequence. As shown in Figure 2B, the final plasmid constructed was designated pVR-CCL11-E6E7.
[0090] Construction of pVR-E6E7 plasmid: An IgE signal peptide having the amino acid sequence MDWTWILFLVAAATRVHS was linked to the E6 and E7 protein sequences of human papillomavirus subtype HPV16, followed by a flag tag consisting of eight amino acids DYKDDDDK.
[0091] As shown in Figure 2C, the finally obtained fusion protein contained, from the N-terminus to the C-terminus, the IgE signal peptide, the E6E7 protein sequence, and the flag tag sequence, in that order.
[0092] The amino acid sequence of the fusion protein was codon-optimized for expression in animal cells, and the resulting fusion gene sequence was set forth in SEQ ID NO: 11. After gene synthesis of the fusion gene sequence, the entire sequence was inserted into the corresponding polyclonal region of the pVR plasmid vector to enable expression of the fusion protein with the correct codon translation sequence. The final plasmid constructed was designated pVR-E6E7 plasmid.
[0093] Specifically, the plasmid patterns constructed in the experiments described in this example were pVR-CCL11-Antigen-T2, pVR-CCL11-Antigen, and its control plasmid pVR-Antigen. In the experiments in this example, the E6E7 fusion protein of HPV16 subtype was used as the antigen.
[0094] Example 3 In vitro cell transfection experiment of the constructed plasmid (Example 2 used a vector constructed with HPV16 E6 and E7 proteins as antigens, but transfection of vectors containing other antigens was carried out using a similar procedure.)
[0095] 24 hours before transfection, 1 × 10 6HEK293T cells were seeded in a 6-well cell culture plate. Transfection experiments were initiated when the cell density reached 80% or higher. Prior to transfection, cell culture medium and serum-free Opti-MEM medium were preheated in a 37°C water bath. For transfection, 3 μg of control vector, pVR-CCL11-E6E7-T2 expression vector, pVR-CCL11-E6E7 expression vector, pVR-E6E7 expression vector, and 12 μL of PEI transfection reagent were added sequentially to 200 μL of serum-free Opti-MEM, mixed uniformly, and then incubated at room temperature for 10 minutes. Fresh medium was then added to the transfected cells and gently shaken. The cells were then returned to the cell culture incubator and cultured for 6 hours, after which the medium was replaced. 48 hours after transfection, the cells were harvested and the expression effect of the E6E7 fusion gene plasmid in HEK293T cells was detected by Western blotting.
[0096] The collected cells were added to 60 μL of lysis buffer containing 0.5% NP40 containing PMSF or a cocktail of protease inhibitors. The cells were thoroughly resuspended and lysed by rotating at 4°C for 30 minutes. The lysates were centrifuged at 12,000 rpm for 10 minutes at 4°C, after which the supernatant was collected in a new 1.5 mL EP tube and the precipitate discarded. After adding 5x SDS-PAGE protein loading buffer according to the actual sample volume and mixing uniformly, the samples were heated in an air bath at 100°C for 10 minutes. Western blotting was then performed immediately, and the proteins were detected using a Flag tag antibody (Sigma, F3165). The results are shown in Figure 3. The control vector (Vector) showed no protein expression, while the size and location of the expressed proteins in pVR-CCL11-E6E7-T2 and pVR-CCL11-E6E7 were significantly higher than those in pVR-E6E7. This indicated that the experimental plasmids pVR-CCL11-E6E7-T2 and pVR-CCL11-E6E7 and the control plasmid pVR-E6E7 could all be expressed smoothly and normally in mammalian cells.
[0097] Example 4 To investigate the effects of the CCL11 chemokine and T2 polypeptide on cell-specific T cell responses induced by fusion gene vaccines. (The example used was a vaccine whose antigens were HPV16 E6 and E7 proteins, but the same procedure was used to induce T cell responses using vaccines containing other antigens.)
[0098] After confirming that the fusion gene could be successfully expressed in mammalian cells, the pVR-CCL11-E6E7-T2, pVR-CCL11-E6E7, and pVR-E6E7 plasmids were extracted and electrotransfected into mice using the TERESA in vivo gene transfer system. The amount of plasmid was 25 μg. There were four groups, including a negative control PBS group, with five mice in each group. Mice were immunized according to the immunization strategy shown in the timeline in Figure 4. On day 14, blood was collected from each group and added to heparinized PBS solution. All samples were centrifuged at 3000 rpm for 5 minutes. The supernatant was discarded, and the remaining precipitate was dispersed by shaking. 1 mL of red blood cell lysis solution was added and lysed at room temperature for 1 minute. All samples were then centrifuged at 1200 rpm for 6 minutes. The supernatant was discarded, and the samples were washed once with 700 μL of PBS. They were then centrifuged twice at 1200 rpm for 6 minutes. After discarding the supernatant, 300 μL of deactivated 10% FBS 1640 medium was added, resuspended, and precipitated. 1 μL of E7 protein tetramer (E7-tetramer) was added and stained for 1 hour. Flow staining for CD8-FITC and E7-tetramer-PE was performed. The flow staining results are shown in Figure 5. Compared with the same dose groups, the CCL11-E6E7-T2 group had significantly higher numbers of E7-specific T cells than the E6E7 group. Compared with the same dose groups, the CCL11-E6E7-T2 group had significantly higher numbers of E7-specific T cells than the CCL11-E6E7 group. Compared with the same dose groups, the CCL11-E6E7 group had significantly higher numbers of E7-specific T cells than the E6E7 group. This suggests that the chemokine CCL11 effectively induces binding between antigen molecules and specific immune cells at the N-terminus of the antigen protein. Therefore, the cross-presentation effect of antigen molecules was significantly improved, and CCL11 was finally able to induce stronger specific immune responses to antigen molecules. Furthermore, the T2 polypeptide, at the C-terminus of the antigen protein, could effectively reinforce the immunopotency of antigen molecules in cellular immunity, significantly increasing the number of specific T cells produced and playing a crucial role as an immune enhancer.
[0099] Example 5 To investigate the effects of the CCL11 chemokine and T2 polypeptide on the humoral immune response induced by a fusion gene vaccine (a vaccine whose antigen is the HPV16 E6 and E7 proteins was used as an example, but T cell responses were induced by vaccines containing other antigens using similar procedures).
[0100] Next, we evaluated whether CCL11 could enhance humoral immune responses. Plasmids pVR-CCL11-E6E7-T2, pVR-CCL11-E6E7, and pVR-E6E7 were extracted, and mice were electrotransfected with the immunization plasmids using the TERESA in vivo gene transfer system. The amount of plasmid was 25 μg. Four groups, including a negative control PBS group, each had five mice. Mice were immunized according to the immunization strategy outlined in the timeline in Figure 4. On day 21, blood was collected from each group without anticoagulant. All samples were centrifuged at 3000 rpm for 20 minutes. The supernatant was then collected. One day prior, laboratory-purified E6E7 fusion protein was diluted in PBS and coated onto ELISA plates containing 10 μg of protein at 200 μL per well. The plates were left overnight at 4°C. The next day, the plates were washed and blocked with blocking solution at room temperature for 2 hours. The collected mouse serum was diluted 1:100 and 100 μL was added to each well. The plates were incubated overnight at 4°C. On the third day, the staining was performed by ELISA. The results are shown in Figure 6. Compared with the same dose groups, all CCL11-E6E7-T2 groups had significantly higher numbers of E7-specific antibodies than the E6E7 group. Compared with the same dose groups, all CCL11-E6E7-T2 groups had significantly higher numbers of E7-specific antibodies than the CCL11-E6E7 group. Compared with the same dose groups, all CCL11-E6E7 groups had significantly higher numbers of E7-specific antibodies than the E6E7 group. This indicates that the chemokine CCL11 can effectively induce binding between antigen molecules and specific immune cells at the N-terminus of the antigen protein. As a result, the cross-presentation of antigen molecules was significantly improved, ultimately enabling CCL11 to induce stronger specific immune responses to antigen molecules. Furthermore, the T2 polypeptide, at the C-terminus of the antigen protein, could effectively reinforce the immune potency of antigen molecules in cellular immunity, significantly increasing the production of specific antibodies and playing a crucial role as an immune enhancer.
[0101] Example 6 A study on the therapeutic effect of a fusion gene vaccine against mouse TC-1 allograft tumors (a fusion gene vaccine with HPV16 E6 and E7 proteins as antigens was used as an example, but similar procedures were used to demonstrate the tumor intervention effect of vaccines containing other antigens).
[0102] Vaccines such as CCL11-E6E7-T2 demonstrated excellent efficacy in cellular and humoral immune experiments. We further investigated their therapeutic efficacy against TC-1 tumor xenografts after immunization with the fusion gene. In addition to the DNA vaccine format, we also synthesized an mRNA vaccine format of CCL11-E6E7-T2 and coated it onto nanoparticles. The specific process is as follows: 5'UTR-CCL11-E6E7-3'UTR-A(120) was introduced into the cloning vector pGEM-3Zf(+) (Promega), and an in vitro transcription and expression system was constructed. This was named pGEM-CCL11-E6E7. The in vitro transcription system contained the following UTR sequences: 5-UTR (β-globin-2) agagcggccgctttttcagcaagattaagcccagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacacc 3-UTR (2β-globin) agctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc agctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc
[0103] The recombinant plasmid was linearized using the single enzyme digestion reaction system shown in the table below. The reaction conditions were 37°C and 3 hours. [Table 2]
[0104] In vitro transcription reaction: 1.T7-Flash Scribe TM In vitro transcription was performed using a transcription kit (Cell script). During the preparation of the in vitro transcription system, UTP was replaced with N1-methylpseudouridine-5'-triphosphate (Trilink Biotech). The reaction system is shown in the table below. The reaction conditions were 35°C for 30 minutes after the first stage reaction was completed, and 35°C for 15 minutes after the first stage reaction. [Table 3]
[0105] ScriptCap TM mRNA capping was performed using the Cap 1 capping system (Cell script).
[0106] Cap-mRNA purification MEGAclear TM Purification was performed using a kit purification (Invitrogen).
[0107] Preparation of liposomal nanoparticles LNP-Man DOTAP ((2,3-dioleoyl-propyl)trimethylammonium chloride), DOPE (dioleoylphosphatidylethanolamine), and DSPE-PEG2000 (distearoylphosphatidylethanolamine-polyethylene glycol 2000) were purchased from Shanghai Advanced Vehicle Technology Co., Ltd. DSPE-PEG2000-Man was purchased from Xi'an Haoran Biotechnology Co., Ltd.
[0108] The nanoparticles were prepared by rotary evaporation. The specific operation process for preparing LNP-Man is as follows:
[0109] 1) DOTAP:DOPE:DSPE-PEG2000-Man in a molar ratio of 50:50:1 were sequentially added to a round-bottom flask, and 6 mL of chloroform was added until the solid was completely dissolved. 2) Sonication was carried out in a water bath for 30 minutes. 3) The round-bottom flask was placed on a rotary evaporator so that the dissolved material was submerged under the water surface. Rotation was carried out at 100 rpm for 15 minutes. 4) The round-bottom flask was removed and placed in a hood, and 8 mL of HEPES buffer was added to dissolve the film adhering to the inner wall of the bottle. 5) Sonication was carried out in a water bath for 30 minutes. 6) The sonicated solution was filtered three times through a 0.22 μm filter membrane to obtain the desired liposomal nanoparticles LNP-Man.
[0110] Preparation of LNPs / mRNA The prepared cationic liposomal nanomaterial LNP-Man and mRNA were mixed at a set N / P = 10:1 (molar ratio), and the required volumes of LNPs and mRNA were calculated. Prior to mixing, an equal volume of 10 mM EPEES buffer was added to the LNPs and mRNA, respectively. The LNPs / mRNA mixture was vortexed for 1 minute and then allowed to stand at room temperature for 30 minutes. Concurrently, CCL11-E6E7-T2 protein was also purified as a vaccine control. Mice were inoculated with tumors and administered plasmid treatment immunizations according to the timeline shown in Figure 7. Each immunization dose was 25 μg. After inoculation, mice were immunized twice, on days 4 and 11, respectively. Subsequently, tumors were measured using the same method, and tumor volumes were recorded. The tumor growth curve shown in Figure 8 was generated. As a result, the three groups containing pVR-CCL11-E6E7-T2 plasmid, CCL11-E6E7-T2-mRNA, and CCL11-E6E7-T2 protein showed faster tumor growth inhibition than the pVR-E6E7 plasmid group, and in the three groups containing pVR-CCL11-E6E7-T2 plasmid, CCL11-E6E7-T2-mRNA, and CCL11-E6E7-T2 protein, the transplanted tumors completely disappeared around day 17 after tumor inoculation, achieving a complete tumor treatment effect.
[0111] It should be noted that the above embodiments do not limit the present invention, but are merely used to explain the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, it should be understood that those skilled in the art may further modify the technical solutions described in the above embodiments, or replace some or all of the technical features with equivalents, and such modifications or replacements do not cause the essence of the corresponding technical solutions to depart from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A fusion protein comprising, from the N-terminus to the C-terminus, an IgE signal peptide, CCL11, a linker, an antigen, and a T2 fragment, in that order, wherein the amino acid sequence of the T2 fragment is SEQ ID NO:
4.
2. the antigen is derived from a virus, a pathogen and / or a tumor; the virus is selected from the group consisting of HPV, EBV, HCV, HIV, HBV, VZV, coronavirus, and combinations thereof; 2. The fusion protein of claim 1, wherein the tumor is selected from the group consisting of liver cancer, cervical cancer, ovarian cancer, lung cancer, head and neck cancer, prostate cancer, breast cancer, blood cancer, ovarian cancer, colon cancer, and combinations thereof.
3. The fusion protein described in claim 1, wherein the antigen is an HPV protein.
4. The fusion protein described in claim 3, wherein the antigen is E6 and / or E7 of HPV16.
5. A nucleic acid encoding the fusion protein according to any one of claims 1 to 4.
6. A nucleic acid fragment comprising the nucleic acid of claim 5, a 5'-UTR, a 3'-UTR, and a 3'-terminal PolyA.
7. An expression vector comprising a vector backbone and the nucleic acid of claim 5.
8. A host comprising the expression vector of claim 7, wherein the expression vector has been introduced into the host by transformation or transfection.
9. A method for preparing the fusion protein according to any one of claims 1 to 4, which comprises culturing the host according to claim 8 to obtain a culture containing the fusion protein.
10. A pharmaceutical for preventing or treating a disease, comprising the fusion protein according to any one of claims 1 to 4.
Citation Information
Patent Citations
Vaccine with interleukin-33 as adjuvant
JP2016538246A
Vaccines for recurrent respiratory papillomatosis and methods of using the same
WO2021231925A1
APC targeting units for immunotherapy
WO2022013277A1