RNA Plasmid Delivery Systems and Their Uses

The RNA plasmid delivery system addresses RNA instability and delivery inefficiencies by forming endogenous complexes in host tissues, ensuring safe and economical RNA delivery for targeted gene inhibition and disease treatment.

JP7784155B2Active Publication Date: 2025-12-11NANJING UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023560201
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-03-29
Filing Date
2022-03-29
Publication Date
2025-12-11
Estimated Expiration
2042-03-29

AI Technical Summary

Technical Problem

Current RNAi therapy faces challenges with the instability and degradation of RNA outside cells, lack of safe and efficient delivery systems, and high production costs of exosome-based delivery methods, which hinder its clinical application.

Method used

An RNA plasmid delivery system that endogenously forms a complex structure in host organ tissue, enriches, and targets specific tissues, using plasmids with RNA fragments, promoters, and targeting tags to deliver RNA fragments safely and efficiently.

Benefits of technology

The system provides stable RNA delivery, avoids immune response, and is cost-effective, enabling precise gene inhibition and disease treatment with versatile delivery of various RNA molecules.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007784155000006
    Figure 0007784155000006
  • Figure 0007784155000007
    Figure 0007784155000007
  • Figure 0007784155000008
    Figure 0007784155000008
Patent Text Reader

Abstract

Provided is an RNA plasmid delivery system and its use. The RNA plasmid delivery system includes a plasmid carrying an RNA fragment to be delivered, which is enriched in a host's organ tissue, can endogenously and spontaneously form exosomes containing the RNA fragment in the host's organ tissue, and can enter and bind to a target tissue to deliver the RNA fragment to the target tissue. The RNA delivery system is safe, reliable, has good drug development potential, and is highly versatile.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application relates to the field of biomedical technology, and in particular to RNA plasmid delivery systems and uses thereof. [Background technology]

[0002] Since its invention, RNA interference (RNAi) therapy has been considered a promising strategy for treating human diseases, but clinically it faces many challenges, and progress in this treatment has been much slower than expected.

[0003] It is believed that RNA cannot remain stable outside cells for long periods of time, and RNA is degraded and fragmented by RNases, which are abundant outside cells. Therefore, in order for RNAi therapy to be effective, it is necessary to find a way to keep RNA stable outside cells and target it to specific tissues.

[0004] Currently, there are many patents related to siRNA, focusing mainly on the following aspects: 1. Designing siRNA with medical effects; 2. Chemically modifying siRNA to increase siRNA stability in vivo and yield; 3. Improving the design of various artificial vectors (e.g., lipid nanoparticles, cationic polymers, and viruses) to improve the in vivo delivery efficiency of siRNA. Of these, there are many patents related to the third aspect, and the underlying reason for this is that researchers have recognized that there is a lack of appropriate siRNA delivery systems for safely, precisely, and efficiently delivering siRNA to target tissues, and that this problem has become a core limitation of RNAi therapy.

[0005] Chinese patent publication number CN108624590A discloses siRNA that can inhibit the expression of the DDR2 gene. Chinese patent publication number CN108624591A discloses siRNA that can silence the ARPC4 gene, and the siRNA is α-phosphorus-selenium modified. Chinese patent publication number CN108546702A discloses siRNA that targets the long non-coding RNA DDX11-AS1. Chinese patent publication number CN106177990A discloses siRNA precursors that can be used to treat various tumors. All of these patents design specific siRNAs to target certain diseases caused by genetic alterations.

[0006] Chinese patent publication number CN108250267A discloses a polypeptide and a polypeptide-siRNA-induced co-assembly, using the polypeptide as an siRNA vector. Chinese patent publication number CN108117585A discloses a polypeptide that delivers siRNA to target cells and promotes apoptosis in breast cancer cells, also using the polypeptide as an siRNA vector. Chinese patent publication number CN108096583A discloses a nanoparticle vector that can carry siRNA containing a chemotherapy drug and also has a breast cancer therapeutic effect. Although all of these patents are inventions related to siRNA vectors, their technical solutions share a common feature: both the vector and siRNA are pre-assembled ex vivo and then introduced into the host's body. In fact, most currently designed delivery technologies are similar to those described above. However, these artificially synthesized exogenous delivery systems have common problems: they are easily eliminated by the host's circulatory system, may cause immunogenic reactions, and are toxic to certain cell types and tissues.

[0007] The research team discovered that endogenous cells can selectively encapsulate miRNAs into exosomes, which then deliver the miRNAs to recipient cells. The secreted miRNAs can potently block target gene expression at relatively low concentrations. Exosomes are biocompatible with the host immune system and possess the innate ability to protect and deliver miRNA across biological barriers in vivo, making them a potential solution to overcoming the challenges associated with siRNA delivery. For example, Chinese patent publication number CN110699382A discloses a method for producing exosomes for siRNA delivery, which involves isolating exosomes from plasma and encapsulating siRNA in exosomes via electroporation.

[0008] However, these exosome isolation or production techniques require obtaining large amounts of exosomes through cell culture and an additional siRNA encapsulation step, which makes the clinical costs of large-scale application of this product prohibitively expensive for ordinary patients. Furthermore, the complex production and purification process of exosomes makes it nearly impossible to meet GMP standards.

[0009] To date, no drug using exosomes as an active ingredient has been approved by the CFDA, and the lack of consistency in exosome products is a central issue that has prevented such products from gaining pharmaceutical manufacturing approval. Solving this issue would be of great significance for advancing RNAi therapy.

[0010] Therefore, the development of a safe, precise, and efficient siRNA delivery system is essential to enhance the efficacy of RNAi treatment and promote RNAi therapy. Summary of the Invention [Problem to be solved by the invention]

[0011] In view of the above, the embodiments of the present application provide an RNA plasmid delivery system and its use to solve the technical deficiencies existing in the prior art. [Means for solving the problem]

[0012] One of the inventive features of the present application is to provide an RNA plasmid delivery system, which includes a plasmid carrying an RNA fragment to be delivered, which can be enriched in a host's organ tissue, endogenously and spontaneously form a complex structure containing the RNA fragment in the host's organ tissue, and the complex structure can enter and bind to a target tissue to deliver the RNA fragment to the target tissue. When the RNA fragment is delivered to the target tissue, it can inhibit the expression of the corresponding gene and inhibit the progression of a disease in the target tissue.

[0013] Optionally, the RNA fragments comprise one or more specific RNA sequences of medical significance, wherein the RNA sequences are siRNA, shRNA or miRNA sequences of medical significance.

[0014] Figures 39 to 41 show that plasmids constructed from multiple types of RNA fragments alone, any combination of two types, or any combination of three types all have the effects of enrichment, self-assembly, and disease treatment in vivo.

[0015] Optionally, the plasmid further comprises a promoter and a targeting tag capable of forming a targeting structure of the composite structure in a host organ tissue, and the composite structure can search for and bind to the target tissue via the targeting structure and deliver the RNA fragment to the target tissue.

[0016] Optionally, the plasmids comprise a combination of one or more of the following circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag, each of the plasmids comprising at least one RNA fragment and one targeting tag, wherein the RNA fragment and targeting tag are in the same circuit or different circuits.

[0017] Figures 42 to 49 show that all delivery systems constructed by arbitrarily combining two different types of RNA fragments and two different types of targeting tags have enrichment and therapeutic effects in vivo.

[0018] Optionally, the plasmid further comprises flanking sequences, compensatory sequences, and loop sequences that enable the circuit to fold into the correct structure and be expressed, the flanking sequences comprising a 5' flanking sequence and a 3' flanking sequence; The plasmid contains one or more combinations of the following circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensatory sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensatory sequence-3' flanking sequence.

[0019] The enrichment effect of promoter-siRNA and promoter-targeting tag-siRNA gene circuits and the detection results of the expression level of EGFR are shown in Figure 50.

[0020] Optionally, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc, or a sequence having greater than 80% homology thereto; the loop sequence is gttttggccactgactgac or a sequence having more than 80% homology thereto; the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having more than 80% homology thereto; The compensatory sequence is a reverse complementary sequence of the RNA fragment, in which any of bases 1 to 5 are deleted. The purpose of deleting bases 1 to 5 of the RNA reverse complementary sequence is to prevent the expression of this sequence.

[0021] Figures 51 to 53 show that constructing the 5' flanking sequence, loop sequence, 3' flanking sequence and homologous sequences of these three into a plasmid all has enrichment and therapeutic effects.

[0022] Preferably, the compensation sequence is a reverse complementary sequence of the RNA fragment, in which any one of 1 to 3 bases is deleted.

[0023] More preferably, the compensation sequence is a reverse complementary sequence of the RNA fragment, in which any one of 1 to 3 consecutive bases is deleted.

[0024] Most preferably, the compensatory sequence is the reverse complementary sequence of the RNA fragment, in which bases at positions 9 and / or 10 are deleted.

[0025] Optionally, when at least two types of circuits are present in the plasmid, adjacent circuits are linked by a sequence consisting of sequences 1 to 3 (sequence 1-sequence 2-sequence 3); Sequence 1 is CAGATC, Sequence 2 is a sequence consisting of 5 to 80 bases, and Sequence 3 is TGGATC. Preferably, Sequence 2 is a sequence consisting of 10 to 50 bases, and more preferably, Sequence 2 is a sequence consisting of 20 to 40 bases.

[0026] Optionally, when at least two circuits are present in the plasmid, adjacent circuits are linked by sequence 4 or a sequence having greater than 80% homology to sequence 4; Sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

[0027] Figure 55 shows that the delivery systems constructed with sequence 4 and its homologous sequences both have enrichment and therapeutic effects. Optionally, the plasmids consist of multiple types of plasmids with different structures, one of which contains a promoter and a targeting tag, and the other of which contains a promoter and an RNA sequence.

[0028] Optionally, said organ tissue is liver and said complex structures are exosomes.

[0029] Optionally, the targeting tag is selected from a targeting peptide or a targeting protein having a targeting function, and the targeting structure is located on the surface of the composite structure.

[0030] Optionally, the targeting peptide comprises an RVG targeting peptide, a GE11 targeting peptide, a PTP targeting peptide, a TCP-1 targeting peptide, an MSP targeting peptide; The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

[0031] Optionally, the length of the RNA to be delivered is 15 to 25 nucleotides (nt). For example, the length of the RNA sequence may be 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. Preferably, the length of the RNA sequence is 18 to 22 nucleotides.

[0032] Figure 54 shows that delivery systems (plasmids) constructed with RNA sequences of various lengths all have enrichment and therapeutic effects in vivo after intravenous injection.

[0033] Optionally, the RNA to be delivered is one or more selected from EGFR gene siRNA, KRAS gene siRNA, VEGFR gene siRNA, mTOR gene siRNA, TNF-α gene siRNA, integrin-α gene siRNA, B7 gene siRNA, TGF-β1 gene siRNA, H2-K gene siRNA, H2-D gene siRNA, H2-L gene siRNA, HLA gene siRNA, GDF15 gene siRNA, miRNA-21 antisense strand, miRNA-214 antisense strand, TNC gene siRNA, PTP1B gene siRNA, mHTT gene siRNA, Lrrk2 gene siRNA, α-synuclein gene siRNA, or RNA sequences having greater than 80% homology to the above sequences, or nucleic acid molecules encoding the above RNAs. Note that the RNA sequences in "nucleic acid molecules encoding the above RNA sequences" herein also include RNA sequences having greater than 80% homology to the respective RNAs.

[0034] Here, the siRNAs for each of the above genes are RNA sequences that have the function of inhibiting the expression of that gene. Since there are many RNA sequences that have the function of inhibiting the expression of each gene, it is not possible to list them all here, but only the following sequences, which have excellent effects, will be described as examples.

[0035] EGFR gene siRNA includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit EGFR gene expression, and sequences having more than 80% homology with the above sequences.

[0036] siRNA for the KRAS gene includes UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, UGUAUUUACAUAAUUACACAC, other sequences that inhibit KRAS gene expression, and sequences having more than 80% homology with the above sequences.

[0037] siRNA for the VEGFR gene includes AUUUGAAGAGUUGUAUUAGCC, UAAUAGACUGGUAACUUUCAU, ACAACUAUGUACAUAAUAGAC, UUUAAGACAAGCUUUUCUCCA, AACAAAAGGUUUUUCAUGGAC, other sequences that inhibit VEGFR gene expression, and sequences having more than 80% homology with the above sequences.

[0038] siRNA for the mTOR gene includes AGAUAGUUGGCAAAUCUGCCA, ACUAUUUCAUCCAUAUAAGGU, AAAAUGUUGUCAAAGAAGGGU, AAAAAUGUUGUCAAAGAAGGG, UGAUUUCUUCCAUUUCUUCUC, other sequences that inhibit mTOR gene expression, and sequences with more than 80% homology to the above sequences.

[0039] siRNA for the TNF-α gene includes AAAACAUAAUCAAAAGAAGGC, UAAAAAACAUAAUCAAAAGAA, AAUAAUAAAUAAUCACAAGUG, UUUUCACGGAAAACAUGUCUG, AAACAUAAUCAAAAGAAGGCA, other sequences that inhibit TNF-α gene expression, and sequences with more than 80% homology to the above sequences.

[0040] siRNA for the integrin-α gene includes AUAAUCAUCUCCAUUAAUGUC, AAACAAUUCCUUUUUAUCUU, AUUAAAACAGGAAACUUUGAG, AUAAUGAAGGAUAUACAACAG, UUCUUUAUUCAUAAAAGUCUC, other sequences that inhibit integrin-α gene expression, and sequences with more than 80% homology to the above sequences.

[0041] siRNA for the B7 gene includes UUUUCUUUGGGUAAUCUUCAG, AGAAAAAUUCCACUUUUUCUU, AUUUCAAAGUCAGAUAUACUA, ACAAAAAUUCCAUUUACUGAG, AUUAUUGAGUUAAGUAUUCCU, other sequences that inhibit B7 gene expression, and sequences with more than 80% homology to the above sequences.

[0042] siRNA for the TGF-β1 gene includes ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, UCUCAGACUCUGGGGCCUCAG, other sequences that inhibit TGF-β1 gene expression, and sequences having more than 80% homology with the above sequences.

[0043] siRNA for the H2-K gene includes AAAAACAAAUCAAUCAAACAA, UCAAAAAAACAAAUCAAUCAA, UAUGAGAAGACAUUGUCUGUC, AACAAUCAAGGUUACAUUCAA, ACAAAACCUCUAAGCAUUCUC, other sequences that inhibit H2-K gene expression, and sequences with more than 80% homology to the above sequences.

[0044] siRNA for the H2-D gene includes AAUCUCGGAGAGACAUUUCAG, AAUGUUGUGUAAAGAGAACUG, AACAUCAGACAAUGUUGUGUA, UGUUAACAAUCAAGGUCACUU, AACAAAAAAACCUCUAAGCAU, other sequences that inhibit H2-D gene expression, and sequences with more than 80% homology to the above sequences.

[0045] siRNA for the H2-L gene includes GAUCCGCUCCCAAUACUCCGG, AUCUGCGUGAUCCGCUCCCAA, UCGGAGAGACAUUUCAGAGCU, UCUCGGAGAGACAUUUCAGAG, AAUCUCGGAGAGACAUUUCAG, other sequences that inhibit H2-L gene expression, and sequences with more than 80% homology to the above sequences.

[0046] siRNA for HLA genes includes AUCUGGAUGGUGUGAGAACCG, UGUCACUGCUUGCAGCCUGAG, UCACAAAGGGAAGGGCAGGAA, UUGCAGAAACAAAGUCAGGGU, ACACGAACACAGACACAUGCA, other sequences that inhibit HLA gene expression, and sequences with more than 80% homology to the above sequences.

[0047] siRNA for the GDF15 gene includes UAUAAAUACAGCUGUUUGGGC, AGACUUAUAUAAAUACAGCUG, AAUUAAUAAUAAAUAACAGAC, AUCUGAGAGCCAUUCACCGUC, UGCAACUCCAGCUGGGGCCGU, other sequences that inhibit GDF15 gene expression, and sequences having more than 80% homology to the above sequences.

[0048] siRNA for the TNC gene includes UAUGAAAUGUAAAAAAAGGGA, AAUCAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, AGAAGUAAAAAACUAUUGCGA, other sequences that inhibit TNC gene expression, and sequences with greater than 80% homology to the above sequences.

[0049] siRNA for the PTP1B gene includes UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, UUUAUUAUUGUACUUUUUGAU, other sequences that inhibit PTP1B gene expression, and sequences with more than 80% homology to the above sequences.

[0050] siRNA for the mHTT gene includes UAUGUUUUCACAUAUUGUCAG, AUUUAGUAGCCAACUAUAGAA, AUGUUUUUCAAUAAAUGUGCC, UAUGAAUAGCAUUCUUAUCUG, UAUUUGUUCCUCUUAAUACAA, other sequences that inhibit mHTT gene expression, and sequences with more than 80% homology to the above sequences.

[0051] siRNA for the Lrrk2 gene includes AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, UUUGAUAACAGUAUUUUUCUG, other sequences that inhibit Lrrk2 gene expression, and sequences with more than 80% homology to the above sequences.

[0052] siRNA for the α-synuclein gene includes AUAUAUUAACAAAUUUCACAA, AAGUAUUAUAUAUUAACAA, AUAACUUUAUAUUUUUGUCCU, UAACUAAAAAAUUAUUUCGAG, UCGAAUAUUAUUUAUUGUCAG, other sequences that inhibit α-synuclein gene expression, and sequences with greater than 80% homology to the above sequences.

[0053] The above-mentioned "sequence having a homology of more than 80%" may also mean a homology of 85%, 88%, 90%, 95%, 98%, etc.

[0054] Optionally, the RNA fragment comprises a main RNA sequence and a modified RNA sequence in which the main RNA sequence is ribose-modified. That is, the RNA fragment may consist of only at least one main RNA sequence, only at least one modified RNA sequence, or both the main RNA sequence and the modified RNA sequence.

[0055] In the present invention, the isolated nucleic acid further includes its variants and derivatives. Those skilled in the art can modify the nucleic acid using common methods. Modification methods include, but are not limited to, methylation, hydrocarbyl, glycosyl (e.g., 2-methoxy-glycosyl, hydrocarbyl-glycosyl, sugar ring, etc.), nucleic acid modification, peptide segment modification, lipid modification, halogen modification, and nucleic acid modification (e.g., "TT" modification). In one embodiment of the present invention, the modification is an internucleotide bond selected from, for example, phosphorothioate, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamido ester, carboxymethyl ester, and combinations thereof. In one embodiment of the present invention, the modification is a nucleotide modification selected from, for example, peptide nucleic acid (PNA), long-chain nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives, and combinations thereof. Preferably, the modification is a 2'-fluoropyrimidine modification, which replaces the 2'-OH of a pyrimidine nucleotide on RNA with 2'-F, which can make the RNA less recognizable by RNA enzymes in vivo, thereby increasing the stability of the RNA fragment when delivered in vivo.

[0056] Optionally, the delivery system is for use in a mammal, including a human.

[0057] Another inventive feature of the present application is to provide a use of the RNA delivery system according to any one of the above in medicine.

[0058] Optionally, the method of administration of the drug includes oral administration, inhalation administration, subcutaneous injection administration, intramuscular injection administration, intravenous injection administration, with intravenous injection being preferred.

[0059] Optionally, the drug is a drug for treating cancer, pulmonary fibrosis, colitis, obesity, obesity-related cardiovascular disease, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0060] Optionally, the drug comprises the above-mentioned plasmid, specifically, the plasmid here refers to a plasmid carrying an RNA fragment or carrying an RNA fragment and a targeting tag, which can enter the host body, enrich in the liver, and self-assemble to form a complex exosome, which can deliver the RNA fragment to the target tissue, express the RNA fragment in the target tissue, inhibit the expression of the corresponding gene, and achieve the purpose of treating the disease.

[0061] The dosage form of the drug may be a tablet, capsule, powder, granule, pill, suppository, ointment, solution, suspension, lotion, gel, paste, etc. [Effects of the Invention]

[0062] The technical effects of the present invention are as follows: The RNA delivery system of the present application uses a plasmid as a vector and a mature injectable agent. Its safety and reliability have been thoroughly verified, making it highly suitable for drug discovery. The final effective RNA sequence is delivered packaged in endogenous exosomes, eliminating the need for any immune response and eliminating the need to verify the safety of the exosomes. This delivery system is highly versatile and can deliver a variety of small RNA molecules. Furthermore, the production of plasmids is cheaper and more economical than the production of substances such as exosomes, proteins, and polypeptides. After self-assembly in vivo, the RNA delivery system of the present application can tightly bind and enrich with AGO2 to form a complex structure (exosome), which not only prevents premature degradation and maintains stability during circulation, but also facilitates uptake by recipient cells, release into the cytoplasm, and escape from lysosomes, requiring a low dose. When used in drugs, the RNA delivery system of the present application provides a drug delivery platform, which can provide a foundation for the research and development of more RNA-based drugs, and can bring about a significant promotional effect on the research, development, and use of RNA-based drugs. [Brief explanation of the drawings]

[0063] [Figure 1] FIG. 1 is a comparative diagram of plasmid distribution and metabolic status in mice according to an embodiment of the present application. [Figure 2] FIG. 1 is a comparative diagram of protein expression levels in mice according to one embodiment of the present application. [Figure 3] FIG. 1 is a comparative diagram of relevant siRNA levels in mice according to one embodiment of the present invention. [Figure 4] FIG. 1 is a comparison diagram of absolute siRNA levels in each mouse tissue according to one embodiment of the present invention. [Figure 5] FIG. 1 is a comparison of the effect of plasmid dose on siRNA levels in mice, according to one example of the present application. [Figure 6] FIG. 1 is a comparison of the metabolic status of precursors and mature forms in the liver of mice after plasmid injection, according to one embodiment of the present application. [Figure 7] FIG. 1 is a comparison of siRNA kinetics and distribution in various mouse tissues, according to one embodiment of the present invention. [Figure 8] FIG. 1 is a comparison of the effects of various promoters on siRNA, according to one embodiment of the present invention. [Figure 9] FIG. 1 is a comparison of eGFP fluorescence intensity in various mouse tissues, according to one embodiment of the present invention. [Figure 10] FIG. 1 is a comparative diagram of mouse alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, creatinine content, thymus weight, spleen weight, and peripheral blood cell percentage according to one embodiment of the present application. [Figure 11] FIG. 1 is a graph comparing the therapeutic effects of mouse EGFR mutant lung cancer tumors according to one example of the present application. [Figure 12] 1A and 1B are HE staining images, immunohistochemical staining images, and staining statistics of a mouse according to an embodiment of the present invention. [Figure 13] FIG. 1 is a comparative diagram of the therapeutic effects of mouse KRAS mutant lung cancer tumors according to one embodiment of the present application. [Figure 14] 1A and 1B are HE staining images, immunohistochemical staining images, and staining statistics of a mouse according to an embodiment of the present invention. [Figure 15] FIG. 1 is a comparison of mouse kidney cancer tumor images according to an example of the present application. [Figure 16] FIG. 1 is a comparative diagram of mouse kidney cancer tumor progression according to one example of the present application. [Figure 17] FIG. 1 is a comparative diagram of the progression of colitis in mice according to one embodiment of the present invention. [Figure 18] FIG. 1 is a comparative diagram of HE staining of mouse colon according to one embodiment of the present invention. [Figure 19] FIG. 1 is a comparative diagram of the progression of colitis in mice according to one embodiment of the present invention. [Figure 20] FIG. 1 is a comparative diagram of HE staining of mouse colon according to one embodiment of the present invention. [Figure 21]FIG. 1 is a comparative diagram of hydroxyproline content in mice according to an embodiment of the present invention. [Figure 22] FIG. 1 is a fluorescent staining image of a mouse lung according to one embodiment of the present application. [Figure 23] FIG. 1 is a Masson trichrome stained image of a mouse lung according to one embodiment of the present invention. [Figure 24] FIG. 1 is a HE stained image of a mouse lung according to one embodiment of the present invention. [Figure 25] FIG. 1 is a comparative diagram of some protein and mRNA levels in mice according to one embodiment of the present invention. [Figure 26] FIG. 1 is a comparative diagram of siRNA-associated expression in mice according to one embodiment of the present invention. [Figure 27] FIG. 1 is a comparison diagram of treatment status of mouse glioblastoma according to one example of the present application. [Figure 28] FIG. 1 is a comparative diagram of mouse brain immunohistochemical staining according to one example of the present application. [Figure 29] 1 is a fluorescent microscope image of the hypothalamus and liver of a mouse according to one embodiment of the present invention. [Figure 30] FIG. 1 is a comparison diagram of the treatment status of obesity in mice according to an embodiment of the present invention. [Figure 31] FIG. 1 is a comparison diagram of treatment status of obesity-related fatty liver in mice according to an embodiment of the present invention. [Figure 32] FIG. 1 is a comparison of the treatment status of Huntington's disease in mice according to an embodiment of the present invention. [Figure 33] FIG. 1 is a comparison diagram of siRNA and protein in the liver, cortex, and striatum of a mouse according to one embodiment of the present invention. [Figure 34] FIG. 1 is a comparative diagram of treatment status of Huntington's disease in mice according to one embodiment of the present application. [Figure 35] FIG. 1 is a comparison of mHTT protein and toxic aggregates in the striatum and cortex of mice according to one embodiment of the present invention. [Figure 36] FIG. 1 is a comparative diagram of treatment status of Parkinson's disease in transgenic mice according to one embodiment of the present application. [Figure 37] FIG. 1 shows the change in siRNA concentration in whole blood of cynomolgus monkeys according to one embodiment of the present invention. [Figure 38] FIG. 1 is a circuit construction and characterization diagram according to one embodiment of the present invention. [Figure 39] Figure 1 shows the enrichment effect in plasma of a plasmid containing six different types of RNA, the detection of siRNA in exosomes, and the corresponding gene expression levels according to one example of the present application. In the figure, A shows the enrichment effect of the plasmid in plasma and the detection of siRNA in exosomes, B and C show the protein expression levels and mRNA expression levels of EGFR, and D and E show the protein expression levels and mRNA expression levels of TNC. [Figure 40] FIG. 1 shows the enrichment effect in plasma of a plasmid containing an RNA fragment consisting of any two types of RNA sequences out of six different types of RNA, the detection of siRNA in exosomes, and the corresponding gene expression levels, according to one example of the present application. In the figure, A shows the enrichment effect of the plasmid in plasma and the detection results of siRNA in exosomes, B shows the protein expression levels of EGFR and TNC, and C shows the mRNA expression levels of EGFR and TNC. [Figure 41] 1 shows the enrichment effect in plasma of a plasmid containing RNA fragments consisting of any three RNA sequences out of six different RNAs, the detection of siRNA in exosomes, and the corresponding gene expression levels, according to one embodiment of the present application. In the figure, A shows the enrichment effect of the plasmid in plasma and the detection results of siRNA in exosomes, B shows the protein expression levels of EGFR and TNC, and C shows the mRNA expression levels of EGFR and TNC. [Figure 42]FIG. 1 shows the enrichment effect in the pancreas, brain, plasma, and exosomes when a genetic circuit contains two different types of RNA fragments and two different types of targeting tags according to one embodiment of the present application. In the figure, A and B are the enrichment effect when the RNA fragment is siREGFR and the targeting tag is PTP, C and D are the enrichment effect when the RNA fragment is siRTNC and the targeting tag is PTP, E and F are the enrichment effect when the RNA fragment is siREGFR and the targeting tag is RVG, and G and H are the enrichment effect when the RNA fragment is siRTNC and the targeting tag is RVG. [Figure 43] FIG. 1 shows the expression levels of EGFR and TNC detected in the pancreas and brain when a genetic circuit contains two different types of RNA fragments and two different types of targeting tags according to one embodiment of the present application. In the figure, A and B are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR and the targeting tag is PTP, C and D are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR and the targeting tag is RVG, E and F are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siRTNC and the targeting tag is PTP, and G and H are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siRTNC and the targeting tag is RVG. [Figure 44] According to one embodiment of the present application, the enrichment effect in the pancreas, brain, plasma, and exosomes when a genetic circuit simultaneously contains two types of RNA fragments and two different types of targeting tags is shown. In the figure, A and B are the enrichment effect when the RNA fragments are siREGFR+TNC and the targeting tag is PTP, and C and D are the enrichment effect when the RNA fragments are siREGFR+TNC and the targeting tag is RVG. [Figure 45]1 shows the expression levels of EGFR and TNC detected in the pancreas and brain when a genetic circuit simultaneously contains two types of RNA fragments and two different types of targeting tags according to one embodiment of the present application. In the figure, A and B are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR+TNC and the targeting tag is PTP, C and D are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR+TNC and the targeting tag is RVG, E and F are the protein expression levels and mRNA expression levels of TNC when the RNA fragment is siREGFR+TNC and the targeting tag is PTP, and G and H are the protein expression levels and mRNA expression levels of TNC when the RNA fragment is siREGFR+TNC and the targeting tag is RVG. [Figure 46] According to one embodiment of the present application, the enrichment effect in the pancreas, brain, plasma, and exosomes when a genetic circuit contains two different types of RNA fragments and two types of targeting tags simultaneously is shown. In the figure, A and B are the enrichment effect when the RNA fragment is siREGFR and the targeting tag is PTP-RVG, and C and D are the enrichment effect when the RNA fragment is siRTNC and the targeting tag is PTP-RVG. [Figure 47] According to one embodiment of the present application, the expression levels of EGFR and TNC detected in the pancreas and brain when a genetic circuit contains two different types of RNA fragments and two types of targeting tags simultaneously. In the figure, A and B are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR and the targeting tag is PTP-RVG, and C and D are the protein expression levels and mRNA expression levels of TNC when the RNA fragment is siRTNC and the targeting tag is PTP-RVG. [Figure 48]FIG. 1 shows the enrichment effect in the pancreas, brain, plasma, and exosomes when a genetic circuit according to one embodiment of the present application simultaneously contains two types of RNA fragments and two types of targeting tags. In the figure, A shows the enrichment effect in the pancreas and brain when the RNA fragment is siREGFR+TNC and the targeting tag is PTP-RVG, and B shows the enrichment effect in the plasma and exosomes when the RNA fragment is siREGFR+TNC and the targeting tag is PTP-RVG. [Figure 49] This shows the expression levels of EGFR and TNC detected in the pancreas and brain when a genetic circuit simultaneously contains two types of RNA fragments and two types of targeting tags according to one embodiment of the present application. In the figure, A and B are the protein expression levels and mRNA expression levels of EGFR when the RNA fragment is siREGFR+TNC and the targeting tag is PTP-RVG, and C and D are the protein expression levels and mRNA expression levels of TNC when the RNA fragment is siREGFR+TNC and the targeting tag is PTP-RVG. [Figure 50] 1 shows the enrichment effect in plasma and brain of two types of gene circuits, Albumin-siREGFR and Albumin-RVG-siREGFR, and the expression level of EGFR, according to one embodiment of the present invention. In the figure, A is the enrichment effect in plasma of the two types of gene circuits, B is the enrichment effect in brain of the two types of gene circuits, and C is the protein expression level and mRNA expression level of EGFR obtained by detecting the two types of gene circuits. [Figure 51] FIG. 1 shows the enrichment and therapeutic effects in the lungs of a delivery system having 5' flanking sequences with greater than 80% homology, according to one embodiment of the present application. In the figure, A shows the enrichment effect in the lungs of two 5' flanking sequences with greater than 80% homology, when RVG-linked and non-RVG-linked, respectively; B shows the protein expression level of EGFR of two 5' flanking sequences with greater than 80% homology, when RVG-linked and non-RVG-linked, respectively; and C shows the mRNA expression level of EGFR of two 5' flanking sequences with greater than 80% homology, when RVG-linked and non-RVG-linked, respectively. [Figure 52] FIG. 1 shows the enrichment and therapeutic effects in the lungs of a delivery system having loop sequences with greater than 80% homology, according to one embodiment of the present application. In the figure, A shows the enrichment effect in the lungs of two loop sequences with greater than 80% homology when RVG-linked and non-RVG-linked, respectively; B shows the protein expression level of EGFR of two loop sequences with greater than 80% homology when RVG-linked and non-RVG-linked, respectively; and C shows the mRNA expression level of EGFR of two loop sequences with greater than 80% homology when RVG-linked and non-RVG-linked, respectively. [Figure 53] FIG. 1 shows the enrichment and therapeutic effects in the lungs of a delivery system with 3' flanking sequences that share more than 80% homology, according to one embodiment of the present application. In the figure, A shows the enrichment effect in the lungs of two 3' flanking sequences with more than 80% homology when linked to RVG and not linked to RVG, respectively; B shows the protein expression level of EGFR with two 3' flanking sequences with more than 80% homology when linked to RVG and not linked to RVG, respectively; and C shows the mRNA expression level of EGFR with two 3' flanking sequences with more than 80% homology when linked to RVG and not linked to RVG, respectively. [Figure 54] FIG. 1 shows the results of detecting EGFR expression levels after intravenous injection of a delivery system containing three types of RNA sequences of different lengths according to one embodiment of the present application. In the figure, A shows the results of detecting EGFR protein expression levels, and B shows the results of detecting EGFR mRNA expression levels. [Figure 55] This shows the results of detecting EGFR siRNA content (enrichment) in lung tissue 9 hours after intravenous injection of a delivery system containing sequence 4 and two sequences 4-1 and 4-2 that have more than 80% homology to sequence 4, according to one example of the present application. In the figure, A is the detection result for sequence 4, B is the detection result for sequence 4-1, and C is the detection result for sequence 4-2. MODE FOR CARRYING OUT THE INVENTION

[0064] Hereinafter, specific embodiments of the present invention will be described with reference to the drawings.

[0065] First, technical terms, test methods, etc. related to the present invention will be explained.

[0066] Hematoxylin-eosin staining, abbreviated as HE staining, is one of the most basic and widely used techniques in histology and pathology teaching and scientific research.

[0067] Hematoxylin stain is basic and can stain basophilic structures of tissue (e.g., ribosomes, ribonucleic acids in the cell nucleus and cytoplasm) blue-purple, while iosin is an acidic dye and can stain acidophilic structures of tissue (e.g., Lewy bodies, alcohol bodies, and intracellular and intercellular proteins, including most of the cytoplasm) pink, allowing the overall morphology of cell tissue to be clearly seen.

[0068] The specific steps of HE staining include fixation and sectioning of the sample tissue, dewaxing of the tissue sample, hydration of the tissue sample, hematoxylin staining of the tissue section, differentiation and anti-blue treatment, iosin staining and dehydration of the tissue section, air-drying and sealing of the tissue sample section, and observation and photography under a microscope.

[0069] In Masson staining, collagen fibers appear blue (stained with aniline blue) or green (stained with brilliant green), and muscle fibers appear red (stained with acid magenta and Ponceau), depending on the size of the anionic dye molecules and the tissue's permeability. When fixed tissues were stained sequentially or mixed with a series of anionic water-soluble dyes, it was found that red blood cells stained with the smallest anionic dyes, muscle fibers and cytoplasm stained with medium-sized anionic dyes, and collagen fibers stained with large anionic dyes. This indicates that red blood cells are the least permeable to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers are the most permeable. Types I and III collagen appear green (GBM, TBM, mesangial matrix, and renal interstitium appear green), while ferrohevin, renal tubule cytoplasm, and red blood cells appear red.

[0070] The specific steps of Masson staining include the following:

[0071] The tissue is fixed in Bouin's solution, rinsed overnight in running water, and then dehydrated and embedded in the usual way. The sections are dewaxed in water (dewaxed in xylene for 10 min three times, then absorbed with absorbent paper; dewaxed in 100% ethanol for 5 min twice, then absorbed with absorbent paper; dewaxed in 95% ethanol for 5 min twice, then absorbed with absorbent paper; run water for 2 min, then absorb with absorbent paper). Stain with Weiger's iron hematoxylin for 5-10 min. Rinse briefly in running water, differentiate in 0.5% hydrochloric acid alcohol for 15 s, rinse for 3 min in running water, stain with Ponceau acid fuchsin solution for 8 min, rinse briefly in distilled water, treat with 1% phosphomolybdic acid solution for approximately 5 min, restain for 5 min in aniline Burrow solution or brilliant green solution, and treat with 1% glacial acetic acid for 1 min. Dehydrate in 95% ethanol for 5 minutes twice, then absorb the liquid with absorbent paper. Dehydrate in 100% ethanol for 5 minutes twice, then absorb the liquid with absorbent paper. Clear in xylene for 5 minutes twice, then absorb the liquid with absorbent paper. Seal with neutral rubber.

[0072] Western blotting involves transferring proteins to a membrane and detecting them using antibodies. For known expressed proteins, the corresponding antibodies can be used as primary antibodies, and for expression products of novel genes, antibodies to the fusion moiety can be used.

[0073] Western blotting uses polyacrylamide gel electrophoresis, with proteins as the target protein, antibodies as the "probe," and labeled secondary antibodies as the "coloring agent." Protein samples separated by PAGE are transferred to a solid support (e.g., cellulose nitrate film) that can noncovalently adsorb proteins and preserve the polypeptide types and biological activity separated by electrophoresis. The proteins or polypeptides on the solid support act as antigens, undergoing immunoreaction with corresponding antibodies, followed by reaction with enzyme- or isotope-labeled secondary antibodies. Substrate color development or autoradiographic development allows the detection of protein components expressed by specific target genes separated by electrophoresis. The process primarily involves protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling, and development.

[0074] Immunohistochemistry, also known as immunocytochemistry, utilizes the principle of antigen-antibody reaction, i.e., the specific binding of antigens and antibodies. It uses a chemical reaction to develop color with a coloring agent (fluorescein, enzymes, metal ions, isotopes) that labels the antibody, thereby identifying antigens (polypeptides and proteins) within tissue cells and conducting research into their localization, qualification, and relative quantification.

[0075] The major steps of immunohistochemistry include immersion of sections, overnight drying, xylene dewaxing, dewaxing in gradient alcohol (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3 min each time), double distillation, removal of catalase by adding 3% hydrogen peroxide, washing with water, antigen retrieval, blocking with 5% BSA for 1 h, primary antibody dilution, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer, color development, washing with water, hematoxylin staining, dehydration in gradient ethanol, and sealing with neutral rubber.

[0076] The siRNA levels, protein content, and mRNA content of the present invention are all detected by injecting the RNA delivery system into mice to construct an in vitro mouse stem cell model. mRNA and siRNA expression levels in cells and tissues are detected using qRT-PCR. Absolute quantification of siRNA is determined by creating a calibration curve using a standard. The expression level of each siRNA or mRNA relative to the internal reference can be expressed as 2-ΔCT, where ΔCT = C sample - C internal reference. When amplifying siRNA, the internal reference gene is U6 snRNA (in tissues) or miR-16 (in serum and exosomes), and when amplifying mRNA, the internal reference gene is GAPDH or 18s RNA. Western blotting experiments are used to detect protein expression levels in cells and tissues, and protein quantitative analysis is performed using ImageJ software.

[0077] In the present invention, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art unless otherwise specified, and all reagents, materials and operational steps used herein are reagents, materials and conventional steps commonly used in the art. Example 1

[0078] This example provides an RNA plasmid delivery system comprising a plasmid carrying an RNA fragment to be delivered, which is enriched in a host organ tissue, can endogenously and spontaneously form a complex structure containing the RNA fragment within the host organ tissue, and the complex structure can enter and bind to a target tissue, thereby delivering the RNA fragment to the target tissue.

[0079] In this embodiment, the plasmid further comprises a promoter and a targeting tag. The plasmid comprises one or more combinations of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-RNA sequence-targeting tag circuit, each of the plasmids comprising at least one RNA fragment and one targeting tag, the RNA fragment and the targeting tag being in the same circuit or different circuits. In other words, the plasmid may comprise only a promoter-RNA sequence-targeting tag, or may comprise a combination of a promoter-RNA sequence and a promoter-targeting tag, or a combination of a promoter-targeting tag and a promoter-RNA sequence-targeting tag.

[0080] 42 to 49 show the detection results when two different types of RNA fragments and two different types of targeting tags were arbitrarily combined. Specifically, RNA fragment 1 was siR EGFR and RNA fragment 2 is siR TNC where targeting tag 1 is PTP and targeting tag 2 is RVG. After randomly combining RNA fragments and targeting tags, the enrichment effect of EGFR siRNA and TNC siRNA in the pancreas, brain, plasma, and exosomes, as well as the expression levels of EGFR and TNC siRNA, were detected.

[0081] Furthermore, the plasmid may further comprise flanking sequences, compensating sequences, and loop sequences that enable the circuit to be folded into the correct structure and expressed, the flanking sequences including a 5' flanking sequence and a 3' flanking sequence, and the plasmid may comprise any one or more combinations of the following circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

[0082] In Figure 50, Albumin is the promoter, RVG is the targeting tag, and siR EGFR Albumin-siR is an RNA fragment that targets the EGFR protein. Without the RNA fragment, the genetic circuitry would not function. EGFR and Albumin-RVG-siR EGFR The enrichment effect of these two gene circuits in plasma and brain, as well as the expression level of EGFR, were detected.

[0083] Here, the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having more than 80% homology thereto, including a sequence having 85%, 90%, 92%, 95%, 98%, or 99% homology thereto.

[0084] The loop sequence is preferably gttttggccactgactgac or a sequence having more than 80% homology thereto, including sequences having 85%, 90%, 92%, 95%, 98%, 99% homology thereto.

[0085] The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having more than 80% homology thereto, including a sequence having 85%, 90%, 92%, 95%, 98%, or 99% homology thereto.

[0086] The compensation sequence is a reverse complementary sequence of the RNA fragment, in which any of bases 1 to 5 are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of this RNA sequence, in which any of bases 1 to 5 are deleted.

[0087] Preferably, the compensation sequence is a reverse complementary sequence of the RNA fragment, in which any one of bases 1 to 3 is deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of this RNA sequence, in which any one of bases 1 to 3 is deleted.

[0088] More preferably, the compensation sequence is a reverse complementary sequence of the RNA fragment, in which any 1 to 3 consecutive bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be a reverse complementary sequence of this RNA sequence, in which any 1 to 3 consecutive bases are deleted.

[0089] Most preferably, the compensatory sequence is a reverse complementary sequence of the RNA fragment, with bases at positions 9 and / or 10 deleted. When the RNA fragment contains only one RNA sequence, the compensatory sequence may be a reverse complementary sequence of this RNA sequence, with bases at positions 9 and / or 10 deleted. Deletion of bases at positions 9 and 10 is most effective.

[0090] Furthermore, the above flanking sequences, compensatory sequences, and loop sequences were not selected arbitrarily, but were determined based on extensive theoretical research and testing. Therefore, the cooperation of the above specific flanking sequences, compensatory sequences, and loop sequences can maximize the expression rate of RNA fragments.

[0091] Figures 51 to 53 respectively show the enrichment effect and therapeutic effect in the lungs after constructing two types of 5' flanking sequences, loop sequences, and 3' flanking sequences with more than 80% homology into a delivery system (plasmid). Specifically, Figure 51 shows the enrichment effect and therapeutic effect in the lungs of a plasmid whose 5' flanking sequence has more than 80% homology, Figure 52 shows the enrichment effect and therapeutic effect in the lungs of a plasmid whose loop sequence has more than 80% homology, and Figure 53 shows the enrichment effect and therapeutic effect in the lungs of a plasmid whose 3' flanking sequence has more than 80% homology.

[0092] Details of each of the above sequences are shown in Table 1 below. [Table 1]

[0093] When a plasmid carries two or more circuits, adjacent circuits may be linked by sequence 1-sequence 2-sequence 3, where sequence 1 is preferably CAGATC, sequence 2 may be a sequence consisting of 5 to 80 bases, for example, a sequence consisting of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 bases, preferably a sequence consisting of 10 to 50 bases, more preferably a sequence consisting of 20 to 40 bases, and sequence 3 is preferably TGGATC.

[0094] Details of Sequence 2 are shown in Table 2 below. [Table 2]

[0095] More preferably, when the plasmid carries two or more circuits, adjacent circuits are linked by sequence 4 or a sequence having greater than 80% homology to sequence 4, where sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

[0096] FIG. 55 shows the results of detecting EGFR siRNA content in lung tissue 9 hours after intravenous injection of delivery systems constructed from Sequence 4 and Sequences 4-1 and 4-2, which have more than 80% homology to Sequence 4.

[0097] Details of Sequence 4 are shown in Table 3 below. [Table 3]

[0098] The RNA fragments contain one or more specific RNA sequences of medical significance, the RNA sequences being expressible in a target receptor, and the compensatory sequences being non-expressible in a target receptor. The RNA sequences may be siRNA sequences, shRNA sequences, or miRNA sequences, and are preferably siRNA sequences.

[0099] The length of a single RNA sequence may be 15 to 25 nucleotides (nt), preferably 18 to 22 nt, for example, 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. This sequence length range is not randomly selected but determined through repeated testing. Extensive testing has demonstrated that RNA sequences shorter than 18 nt, particularly shorter than 15 nt, are largely ineffective and have no effect. However, RNA sequences longer than 22 nt, particularly longer than 25 nt, not only significantly increase the cost of the circuit, but also result in no superior efficacy compared to RNA sequences 18 to 22 nt, resulting in poor economic efficiency. Therefore, RNA sequences 15 to 25 nt, particularly 18 to 22 nt, offer the most cost-effective solution.

[0100] RNA sequences of various lengths are shown in Table 4 below. [Table 4]

[0101] Figure 54 shows the detection of EGFR expression levels after intravenous injection of delivery systems (plasmids) constructed with RNA sequences of various lengths. Among them, the plasmids with RNA sequences of 18, 20, and 22 lengths, respectively, were CMV-siR E (18), CMV-siR E (20), CMV-siR E This corresponds to (22).

[0102] The RNA sequence is any one or more selected from EGFR gene siRNA, KRAS gene siRNA, VEGFR gene siRNA, mTOR gene siRNA, TNF-α gene siRNA, integrin-α gene siRNA, B7 gene siRNA, TGF-β1 gene siRNA, H2-K gene siRNA, H2-D gene siRNA, H2-L gene siRNA, HLA gene siRNA, GDF15 gene siRNA, miRNA-21 antisense strand, miRNA-214 antisense strand, TNC gene siRNA, PTP1B gene siRNA, mHTT gene siRNA, Lrrk2 gene siRNA, α-synuclein gene siRNA, RNA sequences having more than 80% homology to the above sequences, or nucleic acid molecules encoding the above RNAs.

[0103] The siRNAs and antisense strands of miRNAs for the above-mentioned genes can inhibit the expression or mutation of these genes or miRNAs, thereby achieving the effect of inhibiting diseases. These diseases include, but are not limited to, cancer, pulmonary fibrosis, colitis, obesity, obesity-related cardiovascular disease, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, graft-versus-host disease, and related diseases. Here, "related diseases" refers to related diseases, complications, sequelae, etc. that occur during the onset or progression of one or more of the above diseases, or other diseases that have a certain correlation with the above diseases. Here, cancers include, but are not limited to, gastric cancer, kidney cancer, lung cancer, liver cancer, brain cancer, blood cancer, intestinal cancer, skin cancer, lymphatic cancer, breast cancer, bladder cancer, esophageal cancer, head and neck squamous cell carcinoma, hemangioma, glioma, and melanoma.

[0104] The number of RNA sequences in the RNA fragment may be 1, 2, or more. For example, when treating glioblastoma, EGFR gene siRNA and TNC gene siRNA can be used in combination in the same plasmid vector, and when treating enteritis, TNF-α gene siRNA, integrin-α gene siRNA, and B7 gene siRNA can be used in combination.

[0105] In an example where "siRNA1" and "siRNA2" are used together in the same plasmid vector, the functional structural region of this plasmid vector can be expressed as (promoter-siRNA1)-linking sequence-(promoter-siRNA2)-linking sequence-(promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linking sequence-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linking sequence-(promoter-targeting tag-siRNA2), etc.

[0106] More specifically, the functional structural region of this plasmid vector is (5'-promoter-5'-flanking sequence-siRNA1-loop sequence-compensating sequence-3'-flanking sequence)-linking sequence (5'-promoter-5'-flanking sequence-siRNA2-loop sequence-compensating sequence-3'-flanking sequence)-linking sequence (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5'-flanking sequence-siRNA1-loop sequence-compensating sequence-3'-flanking sequence)-linking sequence (5'-promoter-targeting tag). The linked sequence may be expressed as (5'-promoter-targeting tag-5' flanking sequence-siRNA2-loop sequence-compensating sequence-3' flanking sequence), (5'-promoter-5' flanking sequence-siRNA1-loop sequence-compensating sequence-3' flanking sequence)-linked sequence (5'-promoter-targeting tag-5' flanking sequence-siRNA2-loop sequence-compensating sequence-3' flanking sequence), (5'-promoter-targeting tag-5' flanking sequence-siRNA1-siRNA2-loop sequence-compensating sequence-3' flanking sequence), etc. Similar analogies can be used in other cases, and therefore will not be described in detail here. The linked sequence may also be expressed as "Sequence 1-Sequence 2-Sequence 3" or "Sequence 4," with a single parenthesis representing a complete circuit.

[0107] Preferably, the RNA may be obtained by ribose modification of the RNA sequence (siRNA, shRNA, or miRNA) therein, preferably 2'-fluoropyrimidine modification. 2'-fluoropyrimidine modification involves replacing the 2'-OH of the pyrimidine nucleotide in the siRNA, shRNA, or miRNA with 2'-F, which can make the siRNA, shRNA, or miRNA less recognizable by RNA enzymes in the human body, thereby increasing the stability of the RNA delivered in the body.

[0108] Specifically, the liver engulfs exogenous plasmids, and up to 99% of exogenous plasmids enter the liver. Therefore, when plasmids are used as vectors, specific design is not required, and exogenous plasmids can be enriched in liver tissue. The exogenous plasmids are then opened, releasing RNA molecules (siRNA, shRNA, or miRNA). The liver tissue then spontaneously encapsulates the RNA molecules into exosomes (self-assembly), and these exosomes become the RNA delivery mechanism.

[0109] Preferably, to give this RNA delivery mechanism (exosomes) the ability of "precise targeting," a targeting tag is designed into the plasmid injected into the body, and this targeting tag is also incorporated into the exosomes by liver tissue. In particular, by selecting a specific targeting tag, the targeting tag will be inserted into the surface of the exosome, thereby forming a targeting structure that can target the exosomes. This will greatly improve the accuracy of the RNA delivery mechanism described in this invention, and on the one hand, can greatly reduce the amount of exogenous plasmid that needs to be introduced, and on the other hand, can greatly improve the potential drug delivery efficiency.

[0110] The targeting tag can be a targeting peptide, targeting protein, or antibody with targeting function. Selecting a targeting tag is a creative and laborious process. On the one hand, it is necessary to select an available targeting tag according to the target tissue, and on the other hand, it is necessary to ensure that the targeting tag is stably displayed on the surface of exosomes to achieve targeting function. Currently, selected targeting peptides include, but are not limited to, RVG targeting peptide (nucleotide sequence shown in SEQ ID No. 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No. 2), PTP targeting peptide (nucleotide sequence shown in SEQ ID No. 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No. 4), and MSP targeting peptide (nucleotide sequence shown in SEQ ID No. 5). Targeting proteins include, but are not limited to, RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), and MSP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 10).

[0111] Among these, the RVG targeting peptide, RVG-LAMP2B fusion protein, can precisely target brain tissue; the GE11 targeting peptide, GE11-LAMP2B fusion protein, can precisely target EGFR-high-expressing organ tissues, such as EGFR-mutated lung cancer tissue; the PTP targeting peptide, PTP-LAMP2B fusion protein, can precisely target plectin-1, a protein specifically expressed in the pancreas, particularly in human and mouse pancreatic cancer tissue; the TCP-1 targeting peptide, TCP-1-LAMP2B fusion protein, can precisely target the colon; and the MSP targeting peptide, MSP-LAMP2B fusion protein, can precisely target muscle tissue.

[0112] In practical applications, targeting tags can be flexibly combined with various different RNA fragments, and different targeting tags can be combined with different RNA fragments to achieve various functions. For example, RVG targeting peptides and RVG-LAMP2B fusion proteins can be combined with EGFR gene siRNA, TNC gene siRNA, or a combination of both to treat glioblastoma, PTP1B gene siRNA to treat obesity, mHTT gene siRNA to treat Huntington's chorea, and LRRK2 gene siRNA to treat Parkinson's disease. GE11 targeting peptides and GE11-LAMP2B fusion proteins can be combined with EGFR gene siRNA to treat diseases such as lung cancer caused by high expression or mutation of the EGFR gene. TCP-1 targeting peptides and TCP-1-LAMP2B fusion proteins can be combined with TNF-α gene siRNA, integrin-α gene siRNA, B7 gene siRNA, or any combination of these three to treat colitis or colon cancer.

[0113] In addition, in order to achieve the goal of precise delivery, various integration forms of plasmid vectors were experimented, and the following another optimized form was obtained: the plasmid vector may also be composed of various plasmids with different structures, one of which contains a promoter and a targeting tag, and the other plasmid contains a promoter and an RNA fragment. That is, the targeting tag and the RNA fragment are integrated into different plasmid vectors, and the two types of plasmid vectors are injected into the body. In this case, the targeting effect is equivalent to that achieved by incorporating the same targeting tag and RNA fragment into a single plasmid vector.

[0114] More preferably, when two different types of plasmid vectors are injected into a host, the plasmid vector incorporating an RNA sequence may be injected first, and then the plasmid vector containing a targeting tag may be injected 1 to 2 hours later, thereby achieving a better targeting effect.

[0115] Any of the above delivery systems may be used in mammals, including humans.

[0116] To verify the feasibility of the delivery system, the following tests were performed.

[0117] First, as shown in Figure 38a, we rationally designed the infrastructure of a core circuit (genetic circuit) to allow for the flexible combination of different functional modules. The core circuit consists of a promoter and an siRNA expression module, which produces and assembles siRNAs into exosomes as a payload. Other combinable components (plug-ins) can be integrated into the core circuit framework to achieve plug-and-play functionality. For example, two combinable components can be combined to optimize siRNA activity. One modifies the membrane-anchoring protein of the exon to achieve tissue selectivity, while the other co-expresses a second siRNA to simultaneously inhibit two molecular targets.

[0118] For the core circuit construct, we designed a scheme to encode an optimized siRNA expression scaffold under the control of a promoter to maximize guide strand expression while minimizing undesired passenger strand expression (Figure 38a). Epidermal growth factor receptor (EGFR), a frequently mutated and highly expressed oncogene in many human tumors (e.g., lung cancer and glioblastoma), was selected as the siRNA target. Human embryonic kidney 293T cells (HEK293T) and mouse hepatoma cells (Hep1-6) were selected as chassis cells for in vitro siRNA assembly. To optimize siRNA production efficiency, we compared two design schemes: one using a CMV promoter to express miRNA precursors (pre-miRNAs) and replacing the miRNA sequence with siRNA, and the other using a U6 promoter to express short hairpin RNAs (shRNAs). First, we investigated the structure of a series of miRNA precursors and selected pre-miR-155 as the optimal scaffold for producing siRNA. Next, as shown in Figure 38b, we synthesized EGFR siRNA (CMV-siR E ) and U6-directed EGFR shRNA (U6-siRE We compared the siRNA production efficiency of CMV-directed pre-miRNAs encoding EGFR siRNA. Although the two schemes have similar efficiencies in driving the transcription of the EGFR siRNA guide strand, as shown in Figure 38b, the pre-miRNA method produced fewer or no passenger strands compared to the shRNA method (the passenger strands are likely degraded during the biogenesis of the mature guide strand). Therefore, to avoid off-target effects, we selected and designed a CMV-driven pre-miRNA.

[0119] Next, we investigated whether the core circuit can induce siRNA to autonomously incorporate into exosomes. E HEK293T cells were transfected with the gene and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the exosomes secreted by each group were similar in number and size distribution, with peak values ​​between 128 and 131 nm. Transmission electron microscopy (TEM) demonstrated that the purified exosomes exhibited typical round vesicle morphology and accurate size. Furthermore, enrichment of specific exon markers (CD63, TSG101, and CD9) was detected only in purified exosomes, not in the cell culture medium. These results indicate that circuit transfection does not affect the size, structure, or quantity of exosomes produced by HEK293T cells. Finally, CMV-siR E Large amounts of EGFR siRNA were detected in exosomes derived from HEK293T and Hepa1-6 cells transfected with the circuit, as shown in Figure 38c. When these exosomes were incubated with mouse Lewis lung carcinoma (LLC) cells, they caused a dose-dependent decrease in EGFR expression, as shown in Figures 38d and 38e, suggesting that exosomal siRNA has biological functions.

[0120] To design the targeting tag for the circuit, we inserted a sequence encoding a targeting tag fused to the N-terminus of Lamp2b protein (a typical exosomal membrane protein) downstream of the CMV promoter (Figure 38a). This tag anchors to the surface of exosomes via Lamp2b, thereby directing the delivery of the composite exosomes to the desired tissue. Specifically, we selected the RVG peptide as a target for the central nervous system (CNS) and introduced exosomes into the brain (RVG has been shown to help exosomes cross the blood-brain barrier and enter neurons). We first evaluated the promoter's efficiency in initiating the expression of the RVG-Lamp2b fusion protein. Tests demonstrated that the CMV promoter was effective in promoting the production of RVG-Lamp2b mRNA and the marker protein eGFP in HEK293T cells, whereas the U6 promoter was ineffective. This demonstrated the superiority of the CMV promoter in linking each component of the circuit. Next, we used immunoprecipitation to verify that the targeting tag was correctly expressed on the exosome surface. Due to a temporary shortage of anti-RVG antibodies, we temporarily used a Flag tag instead of RVG. As shown in Figure 38f, after transfection of HEK293T and Hepa1-6 cells with the CMV-guided Flag-Lamp2b circuit, we successfully immunoprecipitated intact exosomes using anti-Flag beads, demonstrating the accurate positioning of the targeting tag. To design an additional siRNA expression moiety, we used tenascin-C (TNC), a major oncogene associated with many cancers, particularly glioblastoma, as a second siRNA target. The TNC-siRNA was also embedded in a pre-miR-155 scaffold and inserted downstream of the EGFR-siRNA, as shown in Figure 38. As shown in Figure 38g, a single (CMV siR) E or CMV siR T ) transcription or tandem (CMV siR E) Little difference was detected between EGFR and TNC siRNA, regardless of transcription. In any case, these results suggest that both siRNA and targeting tags play their respective roles in the circuit.

[0121] Next, we investigated whether the circuits could self-assemble into exosomes. We used CMV-guided circuits encoding EGFR and TNC siRNAs and RVG-tagged (CMV-RVG-siR) circuits. E HEK293T cells were transfected with exosomes containing the complex core circuit. The results showed that exosomes derived from the cell culture medium exhibited typical morphology and size distribution, indicating that modification with the complex core circuit did not alter the physical properties of exosomes. Furthermore, EGFR and TNC-siRNAs and a targeting tag (CMV-Flag-siRNA) were transfected with the complex core circuit. E We constructed a complete circuit containing the EGFR-TNC siRNA and successfully immunoprecipitated it using exosomes produced from transfected HEK293T and hep1-6 cells. As shown in Figure 38h, both EGFR and TNC siRNA were abundant in the immunoprecipitated exosomes.

[0122] Furthermore, AGO2 is widely expressed in vivo and is a core component of the RNA-induced silencing complex. It possesses endoribonuclease activity, promotes siRNA maturation, and regulates its biosynthesis and function, thereby inhibiting target gene expression.

[0123] Because siRNA processing is dependent on Argonaute 2 (AGO2), and proper incorporation of siRNA into AGO2 is expected to enhance siRNA targeting, we performed another immunoprecipitation experiment to evaluate the association between AGO2 and siRNA in exosomes. The test demonstrated that EGFR and TNC siRNAs could be easily detected in exosomes precipitated with an AGO2 antibody (anti-AGO2), demonstrating that our design ensures siRNA loading into the RNA-induced silencing complex (RISC) and that AGO2 promotes efficient transport of bound siRNA into exosomes. Finally, to examine whether the assembled siRNAs are functional in vitro, we used CMV-RVG-siRNA. E+T Exosomes derived from HEK293T cells transfected with the circuit were incubated with U87MG glioblastoma cells. As shown in Figures 38i and 38j, a dose-dependent reduction in EGFR and TNC expression was observed in U87MG cells. Furthermore, the RVG tag on the surface of the exosomes did not affect the silencing efficacy of EGFR and TNC siRNA targets. These results established the circuit as an organic assembly of multiple combinable moieties, and the clever combination of these moieties enabled the self-assembly and release of RNA.

[0124] To understand the distribution of the plasmid in the body, a mouse plating assay was performed. As shown in Figure 1A, mice were injected with the plasmid and then sampled at time points (1 h, 3 h, 6 h, 9 h, 12 h, 24 h, 72 h, 168 h, and 720 h). Spectinomycin-extracted plasmid was used for transformation, and the number of clones in the liver, plasma, lung, brain, kidney, and spleen was measured. As shown in Figures 1B, 1C, and 1D, the plasmid was most abundant in the liver, peaking approximately 3 h after injection. By 12 h after injection, the plasmid had essentially been metabolized.

[0125] CMV eGFP siR co-expressed eGFP protein and EGFR siRNA EThe circuit was intravenously injected into C57BL / 6J mice. As shown in Figure 2, eGFP fluorescence in the mouse liver gradually increased over time, peaked at approximately 12 hours, and decreased to background levels by 48 hours. No obvious eGFP signal was observed in other tissues.

[0126] Control plasmid (CMV-scrR), EGFR siRNA expression plasmid (CMV-siR E ) into mice to create an in vitro model of mouse hepatocytes, and CMV-scrR and CMV-siR were injected into the mice. E As shown in Figure 3A, the siRNA levels in exosomes of hepatocytes from mice injected with CMV-siR were detected. E We found that siRNA expression was present in the exosomes of hepatocytes from mice injected with the drug.

[0127] Generally, binding to Ago2 protein is considered to be a necessary condition for siRNA function, i.e., siRNA in exosomes can bind to Ago2 protein. Therefore, we performed Ago2 immunoprecipitation experiments and the results are shown in Figure 3B and Figure 3C. Here, Input represents a sample detected by direct exosome cleavage without immunoprecipitation, and represents a positive control.

[0128] Figure 4 shows the distribution of mature siRNA in various tissues after intravenous injection of the plasmid into mice. Figure 4A shows that the EGFR-siRNA levels in plasma, exosomes, and exosome-free plasma changed in a time-dependent manner. Figure 4B shows that the accumulation of mouse EGFR-siRNA in the liver, lung, pancreas, spleen, and kidney was time-dependent.

[0129] Control plasmid (CMV-scrR), 0.05 mg / kg CMV-siR E Plasmid, 0.5 mg / kg CMV-siR E Plasmid, 5 mg / kg CMV-siR EThe plasmids were injected into mice, and the resulting tissues were then isolated from the liver, spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, and CD4 + As a result of detecting the absolute siRNA (EGFR siRNA) level in cells, as shown in Figure 5A, there was no siRNA expression in the tissues of mice injected with the control plasmid, but there was no CMV-siRNA expression. E In the plasmid-injected mice, the siRNA expression levels in each tissue and CMV-siR E As shown in Figure 5B, the siRNA expression level and CMV-siR were positively correlated by fluorescence in situ hybridization (FISH). E The plasmid concentration showed a positive correlation, confirming that the distribution of EGFR siRNA in tissues is dose-dependent.

[0130] Once inside the body, the plasmid expresses a precursor, which is then processed into the mature form (siRNA). We therefore investigated the metabolism of the precursor and mature form (siRNA) in the liver of mice after plasmid injection, and the results are shown in Figure 6. Six hours after plasmid injection, the expression levels of the precursor and mature form (siRNA) in the liver of the mice reached their peak, 36 hours after plasmid injection, and the metabolism of the mature form (siRNA) in the liver of the mice was complete, and 48 hours after plasmid injection, the metabolism of the precursor in the liver of the mice was complete.

[0131] After injecting exogenous siRNA into the common bile duct of mice, the absolute siRNA levels in exosome-free plasma, exosomes, and plasma were detected, respectively. The results are shown in Figure 7A. After injecting exogenous siRNA into the common bile duct of mice, the absolute siRNA levels in the spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, and CD4 + The levels of siRNA in the cells were detected, respectively, and the results are shown in Figure 7B. The two figures reflect that the kinetics of siRNA in different tissues are almost the same, but there are significant differences in the distribution of siRNA in different tissues.

[0132] siRNA with an albumin ALB promoter, siRNA with a CMV promoter, and promoterless siRNA were each intravenously injected into mice, and the absolute siRNA levels in the mice were detected 0, 3, 6, 9, 12, 24, 36, and 48 hours after injection. The results are shown in Figure 8. The levels of siRNA with a CMV promoter were highest in the mice, indicating that the CMV promoter is the most effective.

[0133] The inhibition of eGFP levels in mice by the self-assembled eGFP siRNA was observed by a fluorescence assay as follows: eGFP transgenic mice were injected with PBS or 5 mg / kg CMV-siR. G or CMV-RVG-siR G The plasmid was injected intravenously, and the mice were sacrificed 24 hours after treatment. The eGFP fluorescence levels were detected in frozen sections. Figure 9A shows a representative fluorescence microscopy image, where green indicates a positive eGFP signal and blue indicates DAPI-stained cell nuclei. The scale is 100 μm. CMV-RVG-siR G The plasmid showed a more pronounced inhibitory effect on mouse eGFP. eGFP transgenic mice were treated with PBS, CMV-scrR, or CMV-siR. E The plasmid was intravenously injected, and the mice were sacrificed 24 hours after treatment. The eGFP fluorescence level was detected in frozen sections. Figure 9B shows the results of PBS, CMV-siR, and E , CMV-RVG-siR E This is a bar graph comparing the fluorescence intensity in the heart, lungs, kidneys, pancreas, brain, and skeletal muscle of mice injected with , and it was found that the contrast in fluorescence intensity in the liver, spleen, lungs, and kidneys of the mice was even more obvious.

[0134] PBS, CMV-scrR, CMV-siR EThe alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were measured for the mice injected with PBS, CMV-scrR, and CMV-siR, respectively. The results are shown in Figure 10. Figures 10A to 10F show the results for PBS, CMV-scrR, and CMV-siR, respectively. E 10A and 10B are comparative graphs of alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, and creatinine contents of mice injected with 10A and 10B, respectively; FIG. 10G is a comparative graph of the liver, lung, spleen, and kidney tissues of mice; FIG. 10H-I are comparative graphs of the thymus and spleen tissues of mice; and FIG. 10J is a comparative graph of the percentage in peripheral blood cells of mice.

[0135] As a result, PBS, CMV-scrR, and CMV-siR E In mice injected with CMV-siR, the contents of ALT, AST, etc., as well as the weights of the thymus and spleen and the percentage of peripheral blood cells were almost unchanged. E Mice injected with α-glucan also had less tissue damage in the liver, lungs, spleen, and kidneys than mice injected with PBS.

[0136] Therefore, the RNA delivery system of this embodiment uses a plasmid as a vector and a mature injectable agent. Its safety and reliability have been thoroughly verified, making it highly suitable for drug discovery. The final effective RNA sequence is delivered packaged in endogenous exosomes, eliminating the need for any immune response and eliminating the need to verify the safety of the exosomes. This delivery system is highly versatile and can deliver a variety of small RNA molecules. Furthermore, the production of plasmids is less expensive and more economical than the production of substances such as exosomes, proteins, and polypeptides. After self-assembly in vivo, the RNA delivery system of this embodiment can tightly bind and enrich with AGO2 to form a complex structure (exosome), which not only prevents premature degradation and maintains stability during circulation, but also facilitates uptake by recipient cells, release into the cytoplasm, and escape from lysosomes, requiring a low dose. Example 2

[0137] Based on Example 1, this example provides a drug, which comprises a plasmid carrying an RNA fragment to be delivered, which can be enriched in a host's organ tissue, endogenously and spontaneously form a complex structure containing the RNA fragment in the host's organ tissue, and the complex structure can enter and bind to a target tissue, thereby delivering the RNA fragment to the target tissue.

[0138] Optionally, the RNA fragments comprise one or more specific RNA sequences of medical significance, wherein the RNA sequences are siRNA, shRNA or miRNA sequences of medical significance.

[0139] In Figures 39 to 41, the six types of RNA are siR E (Target gene is EGFR), siR T (Target gene is TNC), shR E (Target gene is EGFR), shR T(target gene TNC), miR-7 (target gene EGFR), and miR-133b (target gene EGFR). Figure 39 shows the enrichment effect in plasma of the six different RNA plasmids provided, the detection of siRNA in exosomes, and the corresponding gene expression levels. Figure 40 shows the enrichment effect in plasma of four groups of plasmids consisting of any two of the six RNA sequences provided above, the detection of siRNA in exosomes, and the corresponding gene expression levels. Figure 41 shows the enrichment effect in plasma of three groups of plasmids consisting of any three of the six RNA sequences provided above, the detection of siRNA in exosomes, and the corresponding gene expression levels.

[0140] Details of the RNA sequences are shown in Table 5 below. [Table 5]

[0141] Optionally, the plasmid further comprises a promoter and a targeting tag capable of forming a targeting structure of the composite structure within a host organ tissue, the targeting structure being located on the surface of the composite structure, and the composite structure being able to search for and bind to the target tissue via the targeting structure and deliver the RNA fragment to the target tissue.

[0142] The above-mentioned plasmids, RNA fragments, targeting tags, etc. in this example can all be explained with reference to Example 1, and therefore will not be explained in detail here.

[0143] The drug can be administered to the human body by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection, and then delivered to the target tissue by the RNA delivery system described in Example 1 to exert its therapeutic effect.

[0144] The drug may be a drug for treating cancer, pulmonary fibrosis, colitis, obesity, obesity-related cardiovascular disease, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0145] The drug of this embodiment may further comprise a pharmaceutically acceptable carrier, including, but not limited to, a diluent, a buffer, an emulsifier, an encapsulating agent, an excipient, a filler, a binder, a spray, a transdermal absorption agent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent, an adjuvant, a desiccant, an adsorbent carrier, and the like.

[0146] The dosage form of the drug according to this embodiment may be a tablet, capsule, powder, granule, pill, suppository, ointment, solution, suspension, lotion, gel, paste, etc.

[0147] The drug of this embodiment uses a plasmid as a vector and a mature injectable agent. Its safety and reliability have been thoroughly verified, making it highly suitable for drug discovery. The final effective RNA sequence is delivered packaged in endogenous exosomes, eliminating any immune response and eliminating the need to verify the safety of the exosomes. This drug can deliver a variety of small RNA molecules, making it highly versatile. Furthermore, the production of plasmids is cheaper and more economical than the production of substances such as exosomes, proteins, and polypeptides. After self-assembly in vivo, the drug of this embodiment can tightly bind and enrich with AGO2 to form a complex structure (exosomes), which not only prevents premature degradation and maintains stability during circulation, but also facilitates uptake by recipient cells, release into the cytoplasm, and escape from lysosomes, requiring a low dose. Example 3

[0148] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a lung cancer treatment drug.

[0149] Here, a specific explanation will be given based on the following experiment.

[0150] As shown in Figure 11A, mice were selected and injected with mouse lung cancer cells (LLC cells) into the body of the mice, followed by PBS buffer / CMV-scrR / gefitinib / CMV-siR. E Mice were treated with injections of the compound every two days, and survival analysis and tumor evaluation were performed on the mice. Treatment began on day 30 and ended on day 44.

[0151] As shown in Figure 11B, the horizontal axis represents time and the vertical axis represents survival rate. E The mice injected with the drug had the highest survival rate.

[0152] As shown in Figure 11C, PBS buffer / CMV-scrR / gefitinib / CMV-siR E 3D modeling of mouse lung tissue based on CT images was performed before and after treatment of mice injected with CMV-siR. E The mice injected with the drug showed a significant reduction in tumor growth.

[0153] As shown in Figure 11D, this figure shows the PBS buffer / CMV-scrR / gefitinib / CMV-siR E Tumor volume (mm ) of mice injected with α-glucan before and after treatment 3 ) and CMV-siR E In contrast, mice injected with PBS buffer / CMV-scrR / gefitinib showed no reduction in tumor volume, and even showed an increase, although to varying degrees.

[0154] As shown in Figure 11E, this figure shows the results of the treatment with normal mice, PBS buffer / CMV-scrR / gefitinib / CMV-si RE 1 shows a comparison of Western blots of mice injected with PBS buffer / CMV-scrR / gefitinib, which showed that the EGFR gene content was significantly higher in mice injected with PBS buffer / CMV-scrR / gefitinib.

[0155] As shown in Figure 11F, this figure shows normal mice, PBS buffer / CMV-scrR / gefitinib / CMV-siR E 1 shows a comparison of EGFR miRNA levels in mice injected with PBS buffer / CMV-scrR / gefitinib, which revealed that the EGFR miRNA levels were higher in mice injected with PBS buffer / CMV-scrR / gefitinib.

[0156] From the above, CMV-siR E has a significant therapeutic effect on EGFR-mutated lung cancer tumors.

[0157] PBS buffer / CMV-scrR / gefitinib / CMV-siR E HE staining and immunohistochemistry were performed on each of the mice injected with PBS buffer / CMV-scrR / gefitinib. As shown in Figures 12A and 12B, EGFR was more highly expressed in the mice injected with PBS buffer / CMV-scrR / gefitinib. The stained areas of EGFR and PCNA in the mice were statistically analyzed, and as shown in Figures 12C and 12D, CMV-scrR was more highly expressed in the mice injected with PBS buffer / CMV-scrR / gefitinib. E In mice injected with EGFR-1, the stained areas of both EGFR and PCNA were the smallest, indicating that the treatment effect on EGFR-mutated lung cancer tumors was the best.

[0158] As shown in Figure 13A, KRAS G12D p53 - / - Mice were selected and treated with PBS buffer / CMV-scrR / gefitinib / CMV-siR from day 50 to day 64 after Adv-Cre inhalation. E Mice were treated with injections every two days, and survival analysis and tumor evaluation were performed on the mice.

[0159] As shown in Figure 13B, the horizontal axis represents the time after infection and the vertical axis represents the survival rate. K Mice injected with the drug showed a higher survival rate.

[0160] As shown in Figure 13C, CMV-scrR / CMV-siR K3D modeling of mouse lung tissue based on CT images before and after treatment of mice injected with CMV-siR revealed that the K It was found that injecting the compound significantly inhibited the growth of lung cancer tumors.

[0161] As shown in Figure 13D, this figure shows that CMV-scrR / CMV-siR K The figure shows the comparison of tumor numbers before and after treatment in mice injected with CMV-siR. K The mice injected with the drug showed significantly less tumor growth.

[0162] As shown in Figure 13E, this figure shows that CMV-scrR / CMV-siR K The number of tumors (mm) before and after treatment in mice injected with 3 ) and CMV-siR K In mice injected with , the tumor volume increased slowly, whereas in mice injected with CMV-scrR, the tumor volume increased significantly.

[0163] As shown in Figure 13F, this figure shows that CMV-scrR / CMV-siR K 1 shows a comparison of Western blots of mice injected with CMV-scrR and mice injected with CMV-scrR, showing that the KRAS gene content was significantly higher in mice injected with CMV-scrR.

[0164] As shown in Figure 13G, this figure shows the CMV-scrR / CMV-siR K 1 shows a comparison of the associated KRAS mRNA levels in mice injected with CMV-scrR and mice injected with CMV-scrR. The mice injected with CMV-scrR showed higher levels of the associated KRAS mRNA.

[0165] From the above, CMV-siR K has a remarkable therapeutic effect on KRAS-mutated lung cancer tumors.

[0166] CMV-scrR / CMV-siR KHE staining and immunohistochemistry were performed on the mice injected with CMV-scrR. As shown in Figures 14A, 14D, and 14E, the mice injected with CMV-scrR showed higher expression of KRAS, p-AKT, and p-ERK, and higher staining rates. Western blot analysis was also used to detect the expression levels of related proteins in the mice. As shown in Figures 14B and 14C, the mice injected with CMV-scrR showed higher expression of related proteins. This was also due to the CMV-siR. K These results suggest that IL-16 has a significant inhibitory effect on KRAS-mutated lung cancer tumors. Example 4

[0167] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a renal cancer treatment drug.

[0168] Here, the following experiment will be used to explain this in detail.

[0169] Different mice were injected with PBS buffer / control plasmid / VEGFR siRNA plasmid / mTOR siRNA plasmid / MIX siRNA plasmid (VEGFR siRNA and mTOR siRNA combined) / sunitinib / everolimus, respectively, and the progression of mouse kidney cancer tumors was observed. The results are shown in Figures 15 and 16. Mice injected with MIX siRNA plasmid showed the most significant inhibition of kidney cancer progression, while mice injected with PBS buffer / control plasmid showed rapid kidney cancer progression.

[0170] From the above, the combined use of VEGFR siRNA and mTOR siRNA has a significant therapeutic effect on renal cancer tumors. Example 5

[0171] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a drug for treating colitis. In this example, the effect of the RNA delivery system in treating colitis is specifically described through the following two tests.

[0172] In the first study, three test groups and three control groups were set up. The test groups were the anti-TNF-α (0.5) group, the anti-TNF-α (5) group, and the anti-TNF-α (20) group, respectively. The control groups were the mock group, the scr-RNA group, and the IFX group, respectively.

[0173] Among these, the anti-TNF-α (0.5) group, the anti-TNF-α (5) group, and the anti-TNF-α (20) group were each treated with a TNF-α siRNA system (CMV-siR) using a plasmid. TNF-α ) and 0.5 μL, 5 μL, and 20 μL of CMV-siR TNF-α The solution was injected into the tail vein of the mouse.

[0174] The mock group was a negative control group, and the scr-RNA group and IFX group were mice that were injected with scr-RNA plasmid and IFX (infliximab) via the tail vein, respectively.

[0175] Next, we established a DSS-induced chronic colitis model, and during this time, mice were weighed and recorded daily. As shown in Figure 17A, the scr-RNA group showed the most rapid weight loss, while the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups showed slower weight loss. The higher the dose of TNF-α siRNA solution, the slower the weight loss. This suggests that the plasmid-encapsulated TNF-α siRNA system can alleviate weight loss in mice with colitis.

[0176] After completing the model construction, we monitored the in vivo expression of the plasmid system in live animals and then sacrificed the mice to examine their colons. As shown in Figure 17B, the scr-RNA group had the shortest colon length, while the anti-TNF-α (0.5), anti-TNF-α (5), and anti-TNF-α (20) groups had relatively long colons. The higher the TNF-α siRNA injection dose, the longer the colon length of the mice. This suggests that the plasmid-encapsulated TNF-α siRNA system can improve, to varying degrees, the shortening of colon length caused by chronic inflammation.

[0177] The disease activity index of the mice was evaluated. As shown in Figure 17C, the disease activity index of the mice in the scr-RNA injection group, anti-TNF-α (0.5) group, and anti-TNF-α (5) group was high, while the disease activity index of the mice in the anti-TNF-α (20) group and IFX group was low.

[0178] TNF-α mRNA was detected in the mouse colon, and as shown in Figure 17D, this CMV-siR TNF-α The system was found to be able to reduce the expression and secretion of TNF-α in the colon. The results of detecting TNF-α in the mouse colon, as shown in Figure 17E, showed that this AAV system was able to produce a certain amount of TNF-α. The results of detecting the pro-inflammatory factors IL-6, IL-12p70, IL-17A, and IL-23 in the colon, as shown in Figure 17F, showed that the secretion of inflammatory factors in the high-dose group was generally lower than that in the control group.

[0179] Colon sections from the mice were stained with HE staining, and pathological scoring and statistical analysis were performed. As shown in Figures 18A and 18B, the anti-TNF-α(0.5), anti-TNF-α(5), and anti-TNF-α(20) groups, especially the anti-TNF-α(20) group, showed higher colonic mucosal integrity, shallower immune cell infiltration, and significantly reduced colonic crypt abscesses and colonic congestion and bleeding compared to the control group.

[0180] These studies demonstrated that the plasmid-based treatment with the TNF-α siRNA system was more effective than, or at least as effective as, IFX in ameliorating the development of colitis.

[0181] In the second study, four test groups and three control groups were set up. The test groups were the anti-TNF-α group, the anti-integrin-α group, the anti-B7 group, and the anti-mix group, respectively. The control groups were the mock group, the PBS group, and the scr-RNA group, respectively.

[0182] The anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group each contained a TNF-α siRNA system (CMV-siR) using a plasmid. TNF-α ), integrin-α siRNA system (CMV-siR integrin-α ), B7 siRNA system (CMV-siR B7 ), mix siRNA (CMV-siR mix , i.e., CMV-siR TNF-α+integrin-α+B7 ) The system was encapsulated and injected into mice via the tail vein in 20 μL, and the expression of this system in vivo was monitored in living small animals. As a result, it was found that the system was stably expressed in the body, particularly in the liver.

[0183] The mock group was a negative control group, and the scr-RNA group and PBS group were injected with scr-RNA plasmid and PBS solution (phosphate buffered saline), respectively, via the tail vein of mice.

[0184] Next, we started to establish a DSS-induced chronic colitis model, during which mice were weighed and recorded daily. As shown in Figure 19A, the weight gain of mice in the anti-mix group was the most moderate, i.e., the CMV-siR packaged in the plasmid TNF-α+integrin-α+B7The system significantly reduced weight loss in mice with chronic colitis, and the mice in the anti-TNF-α, anti-integrin-α, and anti-B7 groups also showed significantly faster weight recovery during the inflammation relief period than the scr-RNA and PBS groups.

[0185] After the model construction was completed, the in vivo expression of the plasmid system was monitored through live small animals, and then the mice were sacrificed and the colons were observed. As shown in Figure 19B, it was found that in the four test groups, the redness of the mouse colon was alleviated to varying degrees, and the shortening of the colon length due to chronic inflammation was also improved to varying degrees.

[0186] The disease activity index of the mice was evaluated. As shown in Figure 19C, the disease activity index of the mice in the scr-RNA and PBS groups was high, while the disease activity index of the mice in the anti-TNF-α group, anti-integrin-α group, anti-B7 group, and anti-mix group decreased in that order.

[0187] TNF-α mRNA, integrin mRNA, and B7 mRNA were detected in the plasma, liver, and colon of mice. As shown in Figures 19D to 19F, this system produced a constant amount of RNA that was stably expressed in the plasma, liver, and colon, and also significantly reduced the expression of TNF-α, integrin, and B7 mRNA in the colon.

[0188] HE staining of mouse colon sections showed that, as shown in Figure 20, the integrity of the colonic mucosa was higher in the four test groups, especially in the anti-mix group, and the degree of immune cell infiltration was shallower. Colonic crypt abscesses and colonic congestion and bleeding were also significantly reduced compared to the control group.

[0189] From the above studies, it was found that CMV-siR packaged in a hepatotropic plasmid TNF-α+integrin-α+B7The circuit enabled long-term expression of TNF-α mRNA, B7 mRNA, and integrin mRNA and silencing of multiple target genes, and also significantly reduced the severity of colonic inflammation, showing great potential for drug discovery and clinical research value. Example 6

[0190] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a drug for treating pulmonary fibrosis. In this example, the use of the RNA delivery system in the treatment of pulmonary fibrosis is specifically illustrated by the following test.

[0191] In this example, eight test groups and three control groups were established. The test groups were the anti-miR-21 (1 mg / kg) group, the anti-miR-21 (5 mg / kg) group, the anti-miR-21 (10 mg / kg) group, the TGF-β1 siRNA (1 mg / kg) group, the TGF-β1 siRNA (5 mg / kg) group, the TGF-β1 siRNA (10 mg / kg) group, the anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group, and the pirfenidone (300 mg / kg) group. The control groups were the normal group, the PBS group, and the scrRNA group, respectively.

[0192] In the Anti-miR-21 (1 mg / kg), Anti-miR-21 (5 mg / kg), and Anti-miR-21 (10 mg / kg) groups, 1 mg / kg, 5 mg / kg, and 10 mg / kg miR-21 siRNA plasmids were injected into mice with pulmonary fibrosis via the tail vein, respectively. In the TGF-β1 siRNA (1 mg / kg), TGF-β1 siRNA (5 mg / kg), and TGF-β1 siRNA (10 mg / kg) groups, 1 mg / kg, 5 mg / kg, and 10 mg / kg TGF-β1 siRNA plasmids were injected into mice with pulmonary fibrosis via the tail vein, respectively. In the Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group, 10 mg / kg Anti-miR-21 and TGF-β1 siRNA were injected into mice with pulmonary fibrosis via the tail vein. The siRNA plasmid was injected into mice with pulmonary fibrosis via the tail vein. In the pirfenidone (300 mg / kg) group, pirfenidone 300 mg / kg was injected into mice with pulmonary fibrosis via the tail vein. The normal group served as the normal control group. In the PBS group and scrRNA group, PBS solution and the control plasmid were injected into mice with pulmonary fibrosis via the tail vein, respectively.

[0193] The hydroxyproline content was measured for each group of mice, and the results are shown in Figure 21. Hydroxyproline is a collagen-based component, and its content reflects the degree of pulmonary fibrosis. Figure 21 shows that the hydroxyproline content was relatively low in the anti-miR-21 (5 mg / kg) group, anti-miR-21 (10 mg / kg) group, TGF-β1 siRNA (10 mg / kg) group, and anti-miR-21 + TGF-β1 siRNA (10 mg / kg) group, indicating that pulmonary fibrosis was inhibited.

[0194] The lungs of mice from each group were fluorescently stained. As shown in Figure 22, the green areas represent type I collagen (Collagen I), the red areas represent α-SMA, and the blue areas represent DAPI. Mice in the PBS and scrRNA groups had high levels of type I collagen and α-SMA, while mice in the test groups had low levels of both. In particular, the Anti-miR-21 (5 mg / kg), Anti-miR-21 (10 mg / kg), and Anti-miR-21 + TGF-β1 siRNA (10 mg / kg) groups showed almost no expression of type I collagen or α-SMA.

[0195] The lungs of mice from each group were stained with Masson's trichrome, and the results are shown in Figure 23. Mice in the PBS and scrRNA groups showed significant destruction of the alveolar space and formation of pulmonary interstitial collagen, while these phenomena were significantly reduced in the test group.

[0196] The lungs of mice from each group were stained with H&E, and the results are shown in Figure 24. Mice in the PBS and scrRNA groups showed enlarged alveolar spaces, infiltration of inflammatory cells, and damage to the alveolar structure, while the lung tissues of the experimental group were found to be normal.

[0197] Western blot analysis of TGF-β1 protein and TGF-β1 mRNA levels in mice treated with normal, PBS, scrRNA, TGF-β1 siRNA (1 mg / kg), TGF-β1 siRNA (5 mg / kg), TGF-β1 siRNA (10 mg / kg), and pirfenidone (300 mg / kg) mice revealed that the TGF-β1 siRNA (10 mg / kg) group had the lowest TGF-β1 protein and TGF-β1 mRNA levels, as shown in Figures 25A-C. This suggests that TGF-β1 can be delivered to the lungs and exert its function after tail vein injection of the corresponding siRNA expression plasmid.

[0198] The relative miR-21 levels were measured in the normal, PBS, scrRNA, anti-miR-21 (1 mg / kg), anti-miR-21 (5 mg / kg), and anti-miR-21 (10 mg / kg) groups, respectively. As shown in Figure 25D, the anti-miR-21 (10 mg / kg) group showed the highest relative miR-21 levels. This suggests that the antisense strand of miR-21 can be delivered to the lungs and exert its function after tail vein injection of the corresponding antisense strand expression plasmid.

[0199] From the above studies, it was found that CMV-siR packaged in a hepatotropic plasmid miR-21 , CMV-siR TGF-β1 , CMV-siR miR-21+TGF-β1 The circuit can significantly alleviate the severity of pulmonary fibrosis, and is highly promising in terms of potential for drug discovery and clinical research value. Example 7

[0200] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a therapeutic drug for glioblastoma. In this example, the use of the RNA delivery system in the treatment of glioblastoma is specifically explained by the following two tests.

[0201] In the first study, five test groups and three control groups were established. E group, CMV-siR T group, CMV-RVG-siR E+T group, CMV-siR E+T group, CMV-Flag-siR E+T The control groups are the PBS group, the CMV-scrR group, and the CMV-Flag-scrR group, respectively. The specific test process is shown in Figure 26A.

[0202] The CD63 protein expression level and siRNA expression level of mice in each group were detected. As shown in Figures 26B to 26D, CMV-RVG-siR E+TThese results suggest that siRNA can be delivered to the brain by intravenous injection of the circuit.

[0203] In the second study, two test groups and two control groups were established. The test groups were CMV-RVG-siR E group, CMV-RVG-siR E+T The control groups were the PBS group and the CMV-scrR group, respectively.

[0204] For the specific test, as shown in Figure 27A, mice were selected and injected with glioblastoma cells (U-87 MG-Luc cells) into the body of the mice. From day 7 to day 21, the mice were treated with PBS buffer / CMV-scrR / CMV-RVG-siR. E / CMV-RVG-siR E+T Mice were treated with 5 mg / kg of PEG every two days, and survival analysis and tumor evaluation were performed. BLI in vivo imaging was performed on the mice on days 7, 14, 28, and 35, respectively.

[0205] As shown in Figure 27B, this figure is a comparison of BLI in vivo imaging detection of mice at days 7, 14, 28, and 35, and CMV-RVG-siR E+T Mice in this group were found to have the most pronounced glioblastoma-inhibiting effect.

[0206] As shown in Figure 27C, this figure shows a comparison of the survival rates of mice in each group, and E+T Mice in this group were found to have the longest survival time.

[0207] As shown in Figure 27D, this figure compares the fluorescence intensity of mice in each group, obtained by luciferase bioimaging. The vertical axis represents the intensity of the lucifer fluorescence signal. Because the implanted tumors had already been artificially integrated with this gene, this figure can show the progression of the tumors. While tumor progression was rapid in the control group, tumor growth was significantly inhibited in the test group.

[0208] As shown in Figure 27E, this figure is a comparison of the relative siRNAs of each group of mice, and CMV-RVG-siR E Mice in the EGFR group had higher levels of EGFR siRNA and CMV-RVG-siR E+T Mice in this group were found to have high levels of both EGFR siRNA and TNC siRNA.

[0209] As shown in Figure 27F, this figure is a Western blot comparison of the mice in each group, including the PBS group, CMV-scrR group, and CMV-RVG-siR group. E Mice in this group were found to have higher EGFR and TNC gene contents.

[0210] Based on the above test data, CMV-RVG-siR E+T They suggested that intravenous injection of the plasmid could deliver siRNA to the brain and inhibit glioblastoma growth.

[0211] Immunohistochemical staining was performed on the brains of mice from each group, and the staining rates of EGFR, TNC, and PCNA were statistically analyzed for each field of view. The results are shown in Figure 28. E+T The mice in the group had the lowest brain EGFR, TNC, and PCNA contents, and the CMV-RVG-siR E The mice in the CMV-RVG-siR group had lower levels of EGFR and PCNA in the brain. E Injection of the plasmid CMV-RVG-siR inhibits the expression of EGFR and PCNA in the brain. E+T It was found that plasmid injection could inhibit the expression of EGFR, TNC, and PCNA in the brain. Example 8

[0212] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a drug for treating obesity. In this example, the use of the RNA delivery system in the treatment of obesity is specifically explained by the following two tests.

[0213] In the first study, two test groups and one control group were established. The test groups were CMV-siR P group, CMV-RVG-siR P group, and the control group was the CMV-scrR group, where "P" represents PTP1B.

[0214] CMV-siR P group, CMV-RVG-siR P In the CMV-scrR group, 5 mg / kg of CMV-siR was administered. P Plasmid, CMV-RVG-siR P The plasmid and CMV-scrR plasmid were injected into mice, and fluorescent microscopic images of the hypothalamus and liver of mice from each group were taken, respectively. As shown in Figure 29, the results showed that PTP1B siRNA could be delivered to the hypothalamus.

[0215] In the second study, two test groups and two control groups were established. The test groups were administered CMV-siR P group, CMV-RVG-siR P The control groups were the PBS group and the CMV-scrR group, respectively.

[0216] For the specific test, C57BL / 6 mice were selected as shown in Figure 30A. After 12 weeks, PBS buffer / CMV-scrR / CMV-siR P / CMV-RVG-siR P The mice were injected with 100 mg of 10 ...

[0217] As shown in Figure 30B, this figure shows the comparison of the body weight of mice in each group, and the CMV-RVG-siR P In the group, the weight of the mice was found to be the most stable.

[0218] As shown in Figure 30C, this figure shows the comparison of epididymal fat pad weights of mice in each group, and the CMV-RVG-siR P In the group, the mice were found to have the lightest epididymal fat pad weight.

[0219] Using metabolic cages, the oxygen consumption, respiratory exchange rate, activity, and calorie production of mice receiving various treatments were continuously monitored for 72 hours. The average values ​​were then plotted and statistically analyzed. The results are shown in Figures 30D to 30G. As a result, CMV-RVG-siR P The plasmid effectively increased the oxygen consumption of the mice, which means that the mice in this group were in a high-energy metabolic state compared to the mice in the other groups. Normal mice primarily rely on glucose as their energy source, while CMV-RVG-siR P The plasmid reduced the respiratory exchange rate of the mice, meaning that the mice in this group were more likely to use protein as their energy source than the mice in the other groups. P The activity of mice injected with the plasmid was significantly increased. P Mice in the group had significantly increased thermogenesis.

[0220] As shown in Figure 30H, this figure compares the initial weight curves of mice in each group. P The mice were found to have the lightest body weight in the group.

[0221] As shown in Figure 30I, this figure compares the initial food intake curves of mice in each group. P It was found that the mice in the group had the lowest food intake.

[0222] As shown in Figure 30J, this figure compares the serum leptin content of mice in each group. P In the group, the mice were found to have the lowest serum leptin content.

[0223] As shown in Figure 30K, this figure shows a comparison of Western blots of mice from each group. P Among the groups, mice were found to have the lowest content of PTP1B protein.

[0224] As shown in Figure 30L, this figure compares the blood glucose change curves of mice in each group. P The mice in the group were found to have the lowest blood sugar levels.

[0225] As shown in Figure 30M, this figure compares the basal glucose change curves of mice in each group. P In the group, the mice were found to have the lowest basal glucose content.

[0226] From the above studies, CMV-RVG-siR P Intravenous injection of the plasmid can reduce obesity in obese model mice.

[0227] The serum total cholesterol (TC), triglyceride (TG), and low-density lipoprotein (LDL) levels of mice in each group were measured. As shown in Figure 31A, the CMV-RVG-siR P In the group, mice were found to have the lowest TC, TG, and LDL.

[0228] The body length of the mice in each group was measured, and as shown in Figure 31B, it was found that the body lengths of the mice in the four groups were almost the same.

[0229] The HFD food intake of mice in each group was statistically analyzed, and as shown in Figure 31C, it was found that the HFD food intake of mice in the four groups was almost the same.

[0230] Liver tissue samples were collected from mice in each group after treatment and compared with normal controls. As shown in Figure 31D, the liver tissue pathology sections of mice in the PBS and CMV-scrR groups showed obvious pathological features of fatty liver, while the CMV-siR group showed no pathological features of fatty liver. P The mice in this group were found to have less fatty liver.

[0231] From the above studies, CMV-RVG-siR PThese results suggest that intravenous injection of the plasmid can reduce fatty liver in obese mice. Example 9

[0232] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a drug for treating Huntington's disease. In this example, the use of the RNA delivery system in the treatment of Huntington's disease is specifically described through the following five tests.

[0233] In the first study, two test groups and two control groups were established. The test groups were CMV-siR mHTT group, CMV-RVG-siR mHTT The control groups were the PBS group and the CMV-scrR group, respectively.

[0234] The experimental flow is shown in Figure 32A. mHTT group, CMV-RVG-siR mHTT Mice with Huntington's disease were treated with CMV-siR in each of the three groups: PBS, CMV-scrR, and CMV-siR. mHTT Plasmid, CMV-RVG-siR mHTT After intravenous injection of the plasmid, PBS solution, and CMV-scrR plasmid, plasma exosomes were isolated, labeled with PKH26 dye, and then co-cultured with cells to observe the cellular uptake of exosomes.

[0235] As shown in Figure 32B, this figure compares the siRNA levels in exosomes in the plasma of mice in each group, and it was found that the siRNA levels in exosomes in the plasma of mice in the two test groups were high.

[0236] Plasma exosomes extracted from each group of mice after injection of the plasmid / solution were labeled with PKH26, co-cultured with cells, and photographed using a confocal microscope. The results, as shown in Figure 32C, demonstrated that exosomes encapsulating siRNA entered cells.

[0237] Plasma exosomes were extracted from mice in each group and co-cultured with cells. The changes in HTT protein and mRNA levels in the mice in each group were then detected. As shown in Figures 32D to 32F, CMV-siR mHTT and CMV-RVG-siR mHTT However, we showed that it can reduce HTT protein levels, suggesting that siRNA incorporated into the exome can still exert its gene silencing function.

[0238] After co-culturing the extracted mouse plasma exosomes with cells, the accumulation of HTT protein in each group of mice was observed and statistically analyzed. As shown in Figures 32G-32H, CMV-siR mHTT and CMV-RVG-siR mHTT showed that it can reduce the aggregation of pathological HTT protein in a Huntington's HTT aggregation cell model, suggesting that siRNA incorporated into exosomes can still exert its gene silencing function and can effectively reduce the aggregation of mutant proteins.

[0239] The absolute siRNA expression levels in the liver, plasma, cortex and striatum of mice from each group were detected and statistically analyzed. As shown in Figure 33A, this figure shows the comparison of the absolute siRNA levels in the liver of mice from each group, and the CMV-siR mHTT group, CMV-RVG-siR mHTT The absolute siRNA levels in mice were found to be relatively high in the CMV-siR group. As shown in Figure 33B, this figure shows a comparison of the absolute siRNA levels in the plasma of mice in each group. mHTT group, CMV-RVG-siR mHTT The absolute siRNA levels in the mice injected with CMV-RVG-siRmHTT were found to be relatively higher in the control group. As shown in Figure 33C, which compares the absolute siRNA levels in the cortex and striatum of mice from each group, the mice injected with CMV-RVG-siRmHTT had higher absolute siRNA levels.

[0240] As shown in Figure 33D, this figure shows in situ hybridization images of liver, cortex, and striatum tissues of mice from each group, and CMV-siR mHTT group, CMV-RVG-siR mHTT In the group, significant fluorescence was observed in the liver tissue sections of mice, CMV-RVG-siR mHTT In the treated group, clear fluorescence was observed in the cortex and striatum tissue sections of mice, suggesting that RVG guides exosomal siRNA to cross the blood-brain barrier and exert its function.

[0241] In the second study, two test groups and two control groups were established. The test groups were CMV-siR GFP group, CMV-RVG-siR GFP The control groups were the PBS group and the CMV-scrR group, respectively. GFP group, CMV-RVG-siR GFP GFP transgenic mice in the PBS, CMV-scrR, and CMV-scrR groups were treated with CMV-siR. GFP Plasmid, CMV-RVG-siR GFP Plasmid, PBS solution, and CMV-scrR plasmid were injected intravenously.

[0242] As shown in Figures 33E and 33F, these are tissue sections of the liver, cortex, and striatum of mice from each group, and CMV-siR was detected in the liver. GFP / CMV-RVG-siR GFP In GFP transgenic mice injected with CMV-RVG-siR, the GFP fluorescence level was reduced and the CMV-RVG-siR was expressed in the corticostriatal tissue. GFP We found that GFP fluorescence levels were reduced in mice injected with RVG, suggesting that RVG guides exosomal siRNA to cross the blood-brain barrier and exert its function.

[0243] In the third study, two test groups and one control group were established. The test groups were administered CMV-siR mHTT group, CMV-RVG-siR mHTT group, and the control group was the CMV-scrR group.

[0244] For the test, 8-week-old N17182Q mice were selected, as shown in Figure 34A, and each mouse was injected with CMV-siR. mHTT group, CMV-RVG-siR mHTT CMV-siR was administered to mice with Huntington's disease in the CMV-scrR and CMV-siR groups. mHTT Plasmid, CMV-RVG-siR mHTT Plasmids, CMV-scrR plasmids, were injected via the tail vein, and rotation tests were performed on days 0 and 14. Mice were sacrificed and analyzed after 14 days.

[0245] As shown in Figure 34B, this figure shows the results of the wild-type mice, the CMV-scrR group, the CMV-RVG-siR group, and the CMV-RVG-siR group. mHTT This is a comparison of the latency period of mice in the CMV-scrR group and the CMV-RVG-siR group. mHTT The groups were matched in terms of the latency period of the mice, and on day 14, the CMV-scrR group showed the shortest latency period of the mice.

[0246] As shown in Figures 34C and 34D, Figure 34C shows the CMV-scrR group, CMV-RVG-siR mHTT Figure 34D shows the western bolt images of the striatum of mice in the CMV-scrR group, CMV-RVG-siR group, and mHTT Figure 1 shows a comparison of the relative mHTT mRNA levels in the striatum of mice in the CMV-scrR group. It was found that the content of N171-mHTT protein in the striatum of mice in the CMV-scrR group was high, and the relative mHTT mRNA levels were also high.

[0247] The fourth study had one test group and one control group, and the test group was CMV-RVG-siR mHTT group, and the control group was the CMV-scrR group.

[0248] For the test, 3-month-old BACHD mice were selected and transfected with CMV-RVG-siR, as shown in Figure 34E. mHTT CMV-RVG-siR was administered to mice with Huntington's disease in the CMV-scrR and CMV-RVG groups. mHTTThe mice were intravenously injected with the CMV-scrR plasmid and the CMV-scrR plasmid, respectively, and sacrificed 14 days later for analysis.

[0249] As shown in Figure 34F, Figure 34F shows the CMV-scrR group, the CMV-RVG-siR group, mHTT Western bolt view of the cortex and striatum of mice in the CMV-RVG-siR group. mHTT In this group, it was found that the contents of both mutant HTT and endogenous HTT in the mouse cortex and striatum were low.

[0250] As shown in Figure 34G, Figure 34G shows the CMV-scrR group, CMV-RVG-siR mHTT The relative mHTT protein levels in the cortex and striatum of mice from the CMV-RVG-siR group were compared. mHTT In both groups, mice were found to have low relative mHTT protein levels.

[0251] As shown in Figure 34H and Figure 35I, Figure 34H shows the CMV-scrR group, CMV-RVG-siR mHTT Figure 35I shows the immunofluorescence images of mice in the CMV-scrR group, CMV-RVG-siR group, and mHTT This figure shows the relative mHTT mRNA levels in the mouse cortex and striatum. mHTT In both groups, mice were found to have low relative mHTT mRNA levels.

[0252] From the above studies, MV-RVG-siR mHTT Intravenous injection of the plasmid contributed to the inhibition of mHTT in the striatum and cortex, leading to improved motor performance and alleviation of neuropathology in HD mice.

[0253] The fifth study had one test group and one control group. The test group was CMV-RVG-siR mHTT group, and the control group was the CMV-scrR group.

[0254] For the test, 6-week-old YAC128 mice were selected, as shown in Figure 35A, and CMV-RVG-siR mHTT CMV-RVG-siR was administered to mice with Huntington's disease in the CMV-scrR and CMV-RVG groups. mHTT Plasmids and CMV-scrR plasmids were intravenously injected, and rotation tests were performed on day 0, week 4, and week 8 of the study, after which the mice were sacrificed and analyzed.

[0255] As shown in Figure 35B, this figure shows that wild-type mice, CMV-RVG-siR mHTT This is a comparison of the latency period of mice in the CMV-RVG-siR group and the CMV-scrR group. mHTT The mice in the CMV-scrR group and the CMV-scrR group showed consistent decreased latency periods, and at weeks 4 and 8, the mice in the CMV-scrR group showed the shortest decreased latency periods.

[0256] As shown in Figure 35C, this figure shows that CMV-RVG-siR mHTT Figure 1 shows western bolt images of the cortex and striatum of mice in the CMV-scrR group and the CMV-RVG-siR group. mHTT In this group, the cortex of mice had low levels of both mutant HTT and endogenous HTT, while the striatum had low levels of mutant HTT and high levels of endogenous HTT.

[0257] As shown in Figures 35D and 35E, both figures show CMV-RVG-siR mHTT The relative mHTT mRNA levels and relative mHTT protein levels in the cortex and striatum of mice in the CMV-RVG-siR and CMV-scrR groups are shown in Fig. 1. mHTT In this group, mice were found to have low relative mHTT mRNA levels and low relative mHTT protein levels.

[0258] As shown in Figure 35F, this figure shows that CMV-RVG-siR mHTTImmunofluorescence images of the cortex and striatum of mice in the CMV-scrR group and the CMV-RVG-siR group. mHTT In the group, the expression of NeuN and EM48 in mice was found to be lower than that in the CMV-scrR group.

[0259] From the above studies, MV-RVG-siR mHTT Intravenous injection of the plasmid contributed to the reduction of mHTT protein and toxic aggregates in the striatum and cortex, suggesting that it ameliorated behavioral deficits and striatal and cortical neuropathology. Example 10

[0260] Based on Example 1 or 2, this example provides the use of the RNA delivery system in a drug, which is a Parkinson's disease treatment drug. In this example, the use of the RNA delivery system in Parkinson's disease treatment is specifically explained by the following test.

[0261] In this study, LRRK2R1441G transgenic mice were selected and tested at 3 months of age. The study included an LPS-intervention group and an LPS-non-intervention group. In the LPS-intervention group, CMV-scrR / CMV-RVG-siR was administered 7 days after LPS treatment. LRRK2 Treatment was performed.

[0262] As shown in Figures 36A and 36B, Figure 36A shows CMV-scrR / CMV-RVG-siR LRRK2 36A is a western bolt image of an LRRK2R1441G transgenic mouse injected with CMV-scrR / CMV-RVG-siR; and FIG. 36B is a western bolt image of an LRRK2R1441G transgenic mouse injected with CMV-scrR / CMV-RVG-siR. LRRK2 Figure 1 shows a protein grayscale analysis of LRRK2R1441G transgenic mice injected with CMV-RVG-si RLRRK2 In mice injected with CMV-RVG-siRLRRK2, the levels of LRRK2 and S935 proteins were found to be reduced, suggesting that CMV-RVG-siRLRRK2 releases siRNA in the liver, and when the siRNA is incorporated into exosomes, it crosses the blood-brain barrier and reduces the expression of deep brain proteins.

[0263] As shown in Figure 36C, this figure shows that CMV-scrR / CMV-RVG-siR LRRK2 Immunofluorescence images of TH+ neurons in the substantia nigra of LRRK2R1441G transgenic mice injected with CMV-RVG-siR. LRRK2 In mice injected with CMV-RVG-siR, loss of TH neurons was prevented, and LRRK2 These results suggest that siRNA is released in the liver, and when incorporated into exosomes, it can cross the blood-brain barrier and enter deep into the brain to exert its function.

[0264] As shown in Figure 36D, this figure shows that CMV-scrR / CMV-RVG-siR LRRK2 Immunofluorescence diagram of microglial activation levels in LRRK2R1441G transgenic mice injected with CMV-RVG-siR. LRRK2 In mice injected with CMV-RVG-siR, microglial activation was inhibited, and LRRK2 These results suggest that siRNA is released in the liver, and when incorporated into exosomes, it can cross the blood-brain barrier and enter deep into the brain to exert its function.

[0265] From the above studies, CMV-RVG-siR LRRK2 Intravenous injection of the plasmid suggested that it contributes to the inhibition of LRRK2 in dopaminergic neurons and attenuates the neuropathological development in Parkinsonian PD mice. Example 11

[0266] To further explore this important issue and elucidate the pharmacokinetics and efficacy of self-assembled siRNA in vivo, we performed a more detailed study in cynomolgus monkeys (Macaca fascicularis), a well-known non-human primate model used in safety evaluation studies. Four ethically approved adult rhesus monkeys were administered 5 mg / kg of CMV-siR. E The plasmid was injected intravenously, and blood samples were taken before and at different time points after injection. After one month, these rhesus monkeys received 5 mg / kg of CMV-siR daily. EThe plasmid was injected intravenously a total of five times, and blood samples were taken at different time points before injection or after the last injection.

[0267] As shown in Figure 37, Figure 37A shows the change in the siRNA concentration in the whole blood of cynomolgus monkeys after a single injection, and Figure 37B shows the change in the siRNA concentration in the whole blood of cynomolgus monkeys after multiple injections. It was found that the siRNA concentration in cynomolgus monkeys after a single injection peaked 6 hours after intravenous injection and then decreased, while the siRNA concentration in cynomolgus monkeys after multiple injections peaked 3 hours after intravenous injection and then decreased, indicating that the rate of decrease in the siRNA concentration in cynomolgus monkeys after multiple injections was slower.

[0268] From the above experiments, CMV-siR E The plasmid was found to be safe and effective in primates such as cynomolgus monkeys, suggesting that it has promising future applications.

[0269] In this specification, terms such as "upper", "lower", "front", "rear", "left", "right", etc. are used only to describe the relative positional relationships between related parts and do not limit the absolute positions of these related parts.

[0270] In this specification, terms such as "first" and "second" are used to distinguish one from another, and do not indicate importance, order, or the premise of each other's existence.

[0271] In this specification, terms such as "equal" and "same" are not strictly limited in the mathematical and / or geometric sense, but rather include errors that can be understood by a person skilled in the art and that may occur due to manufacturing or use.

[0272] Unless otherwise stated, the numerical ranges herein include the entire range within its two endpoints as well as any sub-ranges subsumed therein.

[0273] Although preferred specific embodiments and examples of the present application have been described in detail above with reference to the drawings, the present application is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of knowledge possessed by a person skilled in the art without departing from the concept of the present application.

Claims

1. The method comprises: providing a plasmid carrying an RNA fragment to be delivered, the plasmid being capable of being enriched in a host's organ tissue, endogenously and spontaneously forming a complex structure containing the RNA fragment in the host's organ tissue, the complex structure searching for a target tissue via a targeting structure located on its surface, entering and binding to the target tissue, and delivering the RNA fragment to the target tissue; the RNA fragments comprise one or more specific RNA sequences of medical significance, the RNA sequences being siRNA, shRNA or miRNA sequences of medical significance; The plasmid further comprises a promoter, a targeting tag capable of forming a targeting structure of the composite structure in a host organ tissue, and a 5' flanking sequence, a 3' flanking sequence, a compensating sequence, and a loop sequence capable of folding the circuit into a correct structure and expressing it, and the plasmid may comprise one circuit of 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, or a combination of multiple circuits selected from 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, and 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence; the organ tissue is a liver, and the complex structure is an exosome; the targeting tag is selected from an RVG-LAMP2B fusion protein, a GE11-LAMP2B fusion protein, a PTP-LAMP2B fusion protein, a TCP-1-LAMP2B fusion protein, and an MSP-LAMP2B fusion protein; the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having 90% or more homology thereto; the loop sequence is gttttggccactgactgac or a sequence having 90% or more homology thereto; the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence having 90% or more homology thereto; The RNA plasmid delivery system is characterized in that the compensatory sequence is a reverse complementary sequence of the RNA fragment, in which any one of bases 1 to 5 is deleted.

2. When at least two types of circuits are present in the plasmid, adjacent circuits are linked by a sequence consisting of sequences 1 to 3; 2. The RNA plasmid delivery system according to claim 1, wherein sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5 to 80 bases, and sequence 3 is TGGATC.

3. When there are at least two types of circuits in the plasmid, adjacent circuits are linked by sequence 4 or a sequence having 90% or more homology to sequence 4; 3. The RNA plasmid delivery system of claim 2, wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

4. The RNA plasmid delivery system of claim 1, wherein the RNA sequence is 15 to 25 nucleotides in length.

5. 5. The RNA plasmid delivery system according to claim 4, wherein the RNA sequence is one or more selected from EGFR gene siRNA, KRAS gene siRNA, VEGFR gene siRNA, mTOR gene siRNA, TNF-α gene siRNA, integrin-α gene siRNA, B7 gene siRNA, TGF-β1 gene siRNA, H2-K gene siRNA, H2-D gene siRNA, H2-L gene siRNA, HLA gene siRNA, GDF15 gene siRNA, miRNA-21 antisense strand, miRNA-214 antisense strand, TNC gene siRNA, PTP1B gene siRNA, mHTT gene siRNA, Lrrk2 gene siRNA, α-synuclein gene siRNA, RNA sequences having 90% or more homology to the above sequences, or nucleic acid molecules encoding the above RNAs.

6. 2. The RNA plasmid delivery system of claim 1, wherein the delivery system is for use in mammals, including humans.

7. Use of the RNA plasmid delivery system according to any one of claims 1 to 6 in the manufacture of a drug.

8. 8. The use according to claim 7, wherein the method of administration of the drug includes oral administration, inhalation administration, subcutaneous injection administration, intramuscular injection administration, or intravenous injection administration.

9. 8. The use according to claim 7, wherein the drug is a drug for treating cancer, pulmonary fibrosis, colitis, obesity, obesity-induced cardiovascular disease, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

Citation Information

Patent Citations

  • siRNA inhibiting EGFR expression as well as precursors and application of siRNA

    CN109971756A

  • Compositions for the delivery of genetic material

    JP2012524052A

  • Method for expressing, secreting and transferring functional micrornas / sirnas and application thereof

    US20160017321A1