Compositions and methods for the treatment of primary ciliary dyskinesia

Abstract

To provide composition and methods for treatment of primary ciliary dyskinesia.SOLUTION: The present invention provides, among other things, methods and compositions for treating primary ciliary dyskinesia (PCD) based on mRNA therapy. The compositions used in treatment of PCD comprise an mRNA comprising a dynein axonemal heavy chain 5 (DNAH5) coding sequence, and are administered at effective doses and administration intervals such that at least one symptom or feature of PCD is reduced in intensity, severity or frequency or has a delayed onset. Here, mRNAs with optimized DNAH5 coding sequences are provided that can be administered without modifying the nucleotides of the mRNA to achieve a sustained in vivo function.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62 / 789,414, filed January 7, 2019, the contents of which are incorporated herein by reference in their entirety.

[0002] Incorporation by reference of sequence listing The contents of the text file named "MRT-2060WO_ST25.txt", created on January 6, 2020 and measuring 504KB, are incorporated herein by reference in their entirety. [Background technology]

[0003] Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder characterized by abnormal cilia and flagella found in the lining of the respiratory tract, reproductive system, and other organs and tissues. PCD occurs in approximately 1 in 16,000 people. Symptoms can begin as early as birth, with respiratory problems, and affected individuals experience frequent respiratory infections during infancy. Patients with PCD also experience year-round nasal congestion and a chronic cough. Chronic respiratory infections can lead to a condition called bronchiectasis, which damages the airways called bronchi, potentially causing life-threatening respiratory problems. Some patients with PCD also experience infertility, recurrent ear infections, and abnormal placement of organs in the chest and abdomen.

[0004] Mutations in the DNAH1 or DNAH5 genes account for approximately one-third of all cases of primary ciliary dyskinesia. The DNAH5 gene encodes dynein axoneme heavy chain 5, which forms the internal structure of cilia. Absence or abnormality of dynein axoneme heavy chain 5 results in defective cilia that cannot generate the force and movement necessary to expel fluid, bacteria, and particles from the lungs. Ciliary movement also helps establish the left-right axis during embryonic development and propel sperm cells toward the female egg cell.

[0005] Currently, there is no cure for PCD. The current standard of care includes aggressive measures to increase mucus clearance and antibiotic therapy for bacterial infections of the respiratory tract. Periodic immunizations are administered to prevent respiratory infections and other secondary complications. For some patients, lobectomy, lung transplantation, and sinus surgery are considered. Gene therapy has been investigated to address the urgent need for new, more effective treatments for PCD. However, traditional gene therapy remains challenging due to the large size of DNAH5. Summary of the Invention [Means for solving the problem]

[0006] The present invention provides, inter alia, methods and compositions for use in the treatment of primary ciliary dyskinesia (PCD). The present invention is based, in part, on the surprising discovery that DNAH5 mRNA, approximately 14 kb in length, can be successfully encapsulated in liposomes and effectively delivered to target tissues in vivo.

[0007] In some aspects, the present invention provides a method for delivering a 10 kb or larger mRNA encoding a protein or peptide in vivo, comprising administering a 10 kb or larger mRNA encoding the protein or peptide to a subject in need thereof. In some embodiments, the 10 kb or larger mRNA is encapsulated in a liposome. In some embodiments, the 10 kb or larger mRNA is 11 kb or larger in length. In some embodiments, the 10 kb or larger mRNA is 12 kb or larger in length. In some embodiments, the 10 kb or larger mRNA is 13 kb or larger in length. In some embodiments, the 10 kb or larger mRNA is 14 kb or larger in length.

[0008] In some aspects, the present invention provides a method for delivering human axonemal dynein heavy chain 5 (DNAH5) in vivo, comprising administering to a subject in need thereof mRNA encoding the human DNAH5 protein. In some embodiments, the DNAH5 mRNA is encapsulated in a liposome.

[0009] In some aspects, the present invention provides methods for treating primary ciliary dyskinesia (PCD), comprising administering to a subject in need of treatment mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) at an effective dose and at an interval such that at least one symptom or characteristic of PCD is reduced in intensity, severity, or frequency, or delayed in onset.

[0010] In some embodiments, the DNAH5 mRNA is encapsulated in a liposome.

[0011] In some embodiments, the liposomes comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

[0012] In some embodiments, the one or more cationic lipids are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, DLinSSDMA, KLin-K-DMA, The compound is selected from the group consisting of DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, ML7, and combinations thereof.

[0013] In some embodiments, the cationic lipid is ICE.

[0014] In some embodiments, one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)) or combinations thereof.In some embodiments, the non-cationic lipid is DOPE.

[0015] In some embodiments, the one or more PEG-modified lipids comprise a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having an alkyl chain C6-C20 in length.

[0016] In some embodiments, the cationic lipid comprises about 30-60% of the liposome by molar ratio.

[0017] In some embodiments, the cationic lipid comprises about 30%, 40%, 50%, or 60% of the liposome by molar ratio.

[0018] In some embodiments, the liposome comprises ICE, DOPE, and DMG-PEG2K.

[0019] In some embodiments, the liposomes have a size of about 80 nm to 200 nm, and optionally, the liposomes have a size of about 100 nm or less.

[0020] In some embodiments, the DNAH5 mRNA is codon-optimized.

[0021] In some embodiments, the DNAH5 mRNA comprises one or more modified nucleotides.

[0022] In some embodiments, the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.

[0023] In some embodiments, the mRNA is unmodified.

[0024] In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO:2 or SEQ ID NO:3.

[0025] In some embodiments, the mRNA comprises a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO:4 or SEQ ID NO:5.

[0026] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:6-31. In some embodiments, the mRNA comprises a coding sequence set forth in SEQ ID NOs:6-31.

[0027] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:6. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:6.

[0028] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:7. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:7.

[0029] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:8. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:8.

[0030] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:9. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:9.

[0031] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 10.

[0032] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:11. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:11.

[0033] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 12. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 12.

[0034] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 13.

[0035] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 14.

[0036] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 15. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 15.

[0037] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 16.

[0038] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 17. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 17.

[0039] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 18. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 18.

[0040] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 19.

[0041] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:20. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:20.

[0042] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:21. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:21.

[0043] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:22. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:22.

[0044] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:23. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:23.

[0045] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:24. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:24.

[0046] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:25. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:25.

[0047] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:26. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:26.

[0048] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:27. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:27.

[0049] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:28. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:28.

[0050] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:29. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:29.

[0051] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 30. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 30.

[0052] In some embodiments, the mRNA comprises a coding sequence at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises a coding sequence at least 70% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises a coding sequence at least 80% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises a coding sequence at least 90% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises a coding sequence at least 95% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises a coding sequence at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:31. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO:31.

[0053] In some embodiments, administration of the mRNA to the subject is by intratracheal, intranasal, intravenous, intramuscular, or subcutaneous delivery.

[0054] In some embodiments, administration of the mRNA to the subject is by intratracheal delivery.

[0055] In some embodiments, administration of the mRNA to the subject is by intranasal delivery.

[0056] In some embodiments, administration of the mRNA to the subject is by aerosol delivery.

[0057] In some embodiments, administration of the mRNA to the subject is by aerosol delivery.

[0058] In some embodiments, administration of the mRNA to the subject is by dry powder inhalation.

[0059] In some embodiments, the composition is administered once a week.

[0060] In some embodiments, the composition is administered once every two weeks.

[0061] In some embodiments, the composition is administered twice a month.

[0062] In some embodiments, the composition is administered once a month.

[0063] In some embodiments, administration of the mRNA results in detectable DNAH5 protein expression in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis.

[0064] In some embodiments, administration of the mRNA results in detectable DNAH5 protein expression in the lung.

[0065] In some embodiments, administration of the mRNA results in detectable DNAH5 protein expression in the lung epithelium.

[0066] In some aspects, the present invention provides a composition for use in treating primary ciliary dyskinesia (PCD), the composition comprising mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) encapsulated in a liposome, the liposome comprising one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

[0067] In some embodiments, the mRNA comprises a DNAH5 coding sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NO:6 through SEQ ID NO:31.

[0068] In some embodiments, the mRNA comprises a coding sequence at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO: 6. In some embodiments, the mRNA comprises a coding sequence at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO: 7.

[0069] In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 6. In some embodiments, the mRNA comprises the coding sequence set forth in SEQ ID NO: 7.

[0070] In some embodiments, the mRNA has a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO:2 or SEQ ID NO:3, and a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO:4 or SEQ ID NO:5.

[0071] In some embodiments, the mRNA has one or more modified nucleotides.

[0072] In some embodiments, the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.

[0073] In some embodiments, the mRNA is unmodified.

[0074] In some embodiments, the liposomes are 100 nm or less in diameter.

[0075] In some embodiments, the present invention provides a pharmaceutical composition comprising the above-described composition and a suitable excipient.

[0076] In some aspects, the invention provides methods for delivery of mRNA encoding a protein or peptide in vivo, comprising administering to a subject in need thereof mRNA encoding the protein or peptide and having a 5'-untranslated region (5'-UTR) having a sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO:2, but is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 70% identical to SEQ ID NO:2, but is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 75% identical to SEQ ID NO:2, but is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence that is at least 80% identical to SEQ ID NO:2, but is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence at least 85% identical to SEQ ID NO:2 and which is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence at least 90% identical to SEQ ID NO:2 and which is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) having a sequence at least 95% identical to SEQ ID NO:2 and which is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) that is at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:2 and which is not SEQ ID NO:3. In some embodiments, the mRNA comprises a 5'-untranslated region (5'-UTR) set forth in SEQ ID NO:2. Other features, objects, and advantages of the present invention will become apparent in the following detailed description, drawings, and claims. It should be understood, however, that the following detailed description, drawings, and claims, while indicating embodiments of the present invention, are given by way of illustration only and not by way of limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A method for delivering human axonemal dynein heavy chain 5 (DNAH5) in vivo, comprising administering mRNA encoding the human DNAH5 protein to a subject in need thereof. (Item 2) A method for treating primary ciliary dyskinesia (PCD), comprising administering to a subject in need of treatment mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) at an effective dose and at an interval such that at least one symptom or characteristic of PCD is reduced in intensity, severity, or frequency, or its onset is delayed. (Item 3) 3. The method of claim 1, wherein the DNAH5 mRNA is encapsulated in a liposome. (Item 4) 4. The method of claim 3, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. (Item 5) The one or more cationic lipids may be cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, DLinSSDMA, KLin-K-DMA, DLin-K-X 5. The method of claim 4, wherein the compound is selected from the group consisting of TC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, ML7, and combinations thereof. (Item 6) 6. The method of claim 5, wherein the cationic lipid is ICE. (Item 7) 7. The method of any one of items 1 to 6, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), or a combination thereof. (Item 8) The one or more PEG-modified lipids are C6-C 20 8. The method of any one of items 4 to 7, comprising a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to a lipid having a long alkyl chain. (Item 9) 9. The method according to any one of items 1 to 8, wherein the cationic lipid constitutes about 30 to 60% of the liposome by molar ratio. (Item 10) 10. The method of claim 9, wherein the cationic lipid comprises about 30%, 40%, 50%, or 60% of the liposome by molar ratio. (Item 11) 11. The method according to any one of items 1 to 10, wherein the liposome comprises ICE, DOPE, and DMG-PEG2K. (Item 12) 12. The method of any one of items 3 to 11, wherein the liposomes have a diameter of about 80 nm to 200 nm, and optionally, the liposomes have a diameter of about 100 nm or less than 100 nm. (Item 13) 13. The method of any one of items 1 to 12, wherein the DNAH5 mRNA is codon-optimized. (Item 14) 14. The method of any one of items 1 to 13, wherein the DNAH5 mRNA comprises one or more modified nucleotides. (Item 15) 15. The method of claim 14, wherein the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine. (Item 16) 16. The method of any one of items 1 to 15, wherein the mRNA is unmodified. (Item 17) 17. The method according to any one of items 1 to 16, wherein the mRNA comprises a 5′-untranslated region (5′-UTR) having the sequence set forth in SEQ ID NO: 2 or 3. (Item 18) 18. The method according to any one of items 1 to 17, wherein the mRNA comprises a 3′-untranslated region (3′-UTR) having the sequence set forth in SEQ ID NO: 4 or 5. (Item 19) 19. The method of any one of items 1 to 18, wherein the mRNA comprises a coding sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 6 to 31. (Item 20) 20. The method according to any one of items 1 to 19, wherein the mRNA comprises a coding sequence that is at least 70% identical to SEQ ID NO: 6 to SEQ ID NO: 31. (Item 21) 21. The method according to any one of items 1 to 20, wherein the mRNA comprises a coding sequence that is at least 80% identical to SEQ ID NO: 6 to SEQ ID NO: 31. (Item 22) 22. The method according to any one of items 1 to 21, wherein the mRNA comprises a coding sequence that is at least 90% identical to SEQ ID NO: 6 to SEQ ID NO: 31. (Item 23) 23. The method of any one of items 1 to 22, wherein the mRNA comprises a coding sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 6 to SEQ ID NO: 31. (Item 24) 24. The method according to any one of items 1 to 23, wherein the mRNA comprises a coding sequence set forth in SEQ ID NO: 6 to SEQ ID NO: 31. (Item 25) 25. The method of any one of items 1 to 24, wherein the administration of the mRNA to the subject is by intratracheal, intranasal, intravenous, intramuscular, or subcutaneous delivery. (Item 26) 26. The method of any one of items 1 to 25, wherein the administration of the mRNA to the subject is carried out by intratracheal delivery. (Item 27) 27. The method of any one of items 1 to 26, wherein the administration of the mRNA to the subject is by intranasal delivery. (Item 28) 28. The method of any one of items 1 to 27, wherein the composition is administered once a day. (Item 29) 29. The method of any one of items 1 to 28, wherein the composition is administered once a week. (Item 30) 30. The method of any one of items 1 to 29, wherein the composition is administered once every two weeks. (Item 31) 31. The method of any one of items 1 to 30, wherein the composition is administered twice a month. (Item 32) 32. The method of any one of items 1 to 31, wherein the composition is administered once a month. (Item 33) 33. The method of any one of items 1 to 32, wherein administration of the mRNA results in detectable DNAH5 protein expression in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis. (Item 34) 34. The method of any one of items 1 to 33, wherein administration of the mRNA results in detectable DNAH5 protein expression in the lung. (Item 35) 35. The method of any one of items 1 to 34, wherein administration of the mRNA results in detectable DNAH5 protein expression in the lung epithelium. (Item 36) A composition for use in the treatment of primary ciliary dyskinesia (PCD), the composition comprising mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) encapsulated in a liposome, the liposome comprising one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. (Item 37) 37. The composition of item 36, wherein the mRNA comprises a coding sequence that is at least 70%, 75%, 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 6 to 31. (Item 38) 38. The composition of item 36 or 37, wherein the mRNA comprises a coding sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO:6 to SEQ ID NO:31. (Item 39) 39. The composition according to any one of Items 36 to 38, wherein the mRNA comprises a coding sequence set forth in SEQ ID NO: 6 to SEQ ID NO: 31. (Item 40) 30. The composition of any one of Items 36 to 39, wherein the mRNA has a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO: 2 and a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 5. (Item 41) 40. The composition of any one of items 36 to 39, wherein the mRNA has one or more modified nucleotides. (Item 42) 42. The composition of claim 41, wherein the modified nucleotide or nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine. (Item 43) 43. The composition of any one of items 36 to 42, wherein the mRNA is unmodified. (Item 44) 44. The composition according to any one of items 36 to 43, wherein the liposome has a diameter of 100 nm or less. (Item 45) One or more cationic lipids may be selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, DLinSSDMA, KLin-K-DMA, DLin-K-XTC2-DMA, and DLin-K-XTC2-DMA. 45. The composition of any one of items 36 to 44, wherein the hydroxybenzoate is selected from the group consisting of 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, ML7, and combinations thereof. (Item 46) 46. ​​The composition according to any one of items 36 to 45, wherein the cationic lipid is ICE. (Item 47) 47. The composition of any one of items 36 to 46, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), or a combination thereof. (Item 48) 48. The composition according to any one of items 36 to 47, wherein the non-cationic lipid is DOPE. (Item 49) The one or more PEG-modified lipids are C6-C 20 49. The composition of any one of items 36 to 48, comprising a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having a long alkyl chain. (Item 50) 50. A pharmaceutical composition comprising the composition according to any one of items 36 to 49 and suitable excipients.

[0077] The drawings are for purposes of illustration only and are not intended to be limiting. [Brief explanation of the drawings]

[0078] [Figure 1A] Figure 1A is a schematic diagram showing the dissection and use of various parts of the mouse trachea and lungs for quantitative PCR analysis (qPCR) and immunohistochemistry (IHC) analysis 24 h after mRNA administration. [Figure 1B] Figure 1B (left) and (right) are graphs showing qPCR data for hDNA5 mRNA in different regions of the respiratory system, as indicated. Figure 1B (left) shows data from Group 1 mice administered MRT-1 hDNA5 mRNA. Figure 1B (right) shows data from Group 2 mice administered MRT-1 hDNA5-GFP mRNA.

[0079] [Figure 2A] Figures 2A and 2B show a series of photomicrographs illustrating the results of IHC analysis of hDNA protein expression in the respiratory tract. Figure 2A shows representative IHC data of hDNA-5 protein staining in mice treated with MRT-1 hDNA5 mRNA compared to saline-treated controls (group 1, left), and IHC data of GFP protein staining in mice treated with MRT-1 hDNA5-GFP mRNA compared to saline-treated controls (group 2, right). [Figure 2B]FIG. 2B shows the detailed localization of each hDNA5 mRNA-derived protein in the epithelial tissue of the airways of mice from group 1 (upper panel) and group 2 (lower panel). DETAILED DESCRIPTION OF THE INVENTION

[0080] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of these terms and other terms are set forth throughout the specification. Publications and other reference materials referred to herein to describe the background of the invention and to provide further details regarding its practice are incorporated herein by reference.

[0081] Alkyl: As used herein, "alkyl" refers to the radical of a straight-chain or branched saturated hydrocarbon group having 1 to 15 carbon atoms ("Ci_i5 alkyl"). In some embodiments, the alkyl group has 1 to 3 carbon atoms ("Ci_3 alkyl"). Examples of Ci_3 alkyl groups include methyl (Ci), ethyl (C2), n-propyl (C3), and isopropyl (C3). In some embodiments, the alkyl group has 8 to 12 carbon atoms ("Cg_i2 alkyl"). Examples of Cg_i2 alkyl groups include, but are not limited to, n-octyl (C8), n-nonyl (C9), n-decyl (C10), n-undecyl (C11), n-dodecyl (C12), and the like. The prefix "n-" (straight-chain) refers to an unbranched alkyl group. For example, n-C8 alkyl refers to (CH2)7CH3, n-C10 alkyl refers to (CH2)9CH3, and so on.

[0082] Amino acid: As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure HN-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid, in some embodiments, an amino acid is a D-amino acid, and in some embodiments, an amino acid is an L-amino acid. A "standard amino acid" refers to any of the 20 standard L-amino acids commonly found in naturally occurring peptides. A "non-standard amino acid" refers to any amino acid other than the standard amino acids, whether prepared synthetically or obtained from a natural source. As used herein, a "synthetic amino acid" encompasses chemically modified amino acids, including, but not limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including the carboxy- and / or amino-terminal amino acids in a peptide, can be modified by methylation, amidation, acetylation, protecting groups, and / or substitutions with other chemical groups that can alter the circulating half-life of the peptide without adversely affecting its activity. An amino acid can participate in a disulfide bond. An amino acid may include one or more post-translational modifications, e.g., association with one or more chemicals (e.g., a methyl group, a hydrochloride group, an acetyl group, a phosphate group, a formyl moiety, an isoprenoid group, a sulfate group, a polyethylene glycol moiety, a lipid moiety, a carbohydrate moiety, a biotin moiety, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and can refer to a free amino acid and / or an amino acid residue of a peptide. Whether the term refers to a free amino acid or a residue of a peptide will be clear from the context in which it is used.

[0083] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0084] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction of (greater than or less than) the stated reference value, unless otherwise stated or clear from the context (except when such number exceeds 100% of possible values). Typically, the term "approximately" or "about" refers to a range of values ​​that is within 10%, or more typically within 1%, of the stated reference value.

[0085] Biologically active: As used herein, the phrase "biologically active" refers to the characteristic of any agent that has activity in a biological system, particularly in an organism. For example, an agent that, when administered to an organism, has a biological effect on that organism is considered to be biologically active.

[0086] Codon optimized: As used herein, this term refers to a nucleic acid in which one or more nucleotides present in a naturally occurring nucleic acid sequence (also referred to as a "wild-type" sequence) have been replaced with alternative nucleotides to optimize protein expression without changing the amino acid sequence of the polypeptide encoded by the naturally occurring nucleic acid sequence. For example, the codon AAA may be modified to become AAG without changing the identity of the encoded amino acid (lysine). In some embodiments, the nucleic acids of the invention are codon optimized to increase protein expression of the protein encoded by the nucleic acid. For purposes of this application, the nucleobases thymidine (T) and uracil (U) are used interchangeably in the narration of mRNA sequences.

[0087] Delivery: As used herein, the term "delivery" encompasses both local delivery and systemic delivery. For example, the delivery of mRNA encompasses the situation where mRNA is delivered to a target tissue, its encoded protein is expressed, and is retained in the target tissue (also referred to as "local distribution" or "local delivery"); the situation where mRNA is delivered to a target tissue, its encoded protein is expressed, and is secreted into the patient's circulatory system (e.g., serum), and is distributed throughout the body and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0088] Dosing interval: As used herein, the dosing interval in the context of a method for treating a disease refers to the frequency with which a therapeutic composition, such as an mRNA composition, is administered to a subject (mammal) in need thereof at an effective dose of mRNA so that one or more symptoms associated with the disease are reduced or one or more biomarkers associated with the disease are reduced for at least the duration of the dosing interval. Dosing frequency and dosing interval can be used interchangeably in this disclosure.

[0089] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of the polypeptides or fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production," and grammatical equivalents, are used interchangeably.

[0090] Effective dose: As used herein, an effective dose is a dose of mRNA in a pharmaceutical composition that, when administered to a subject in need thereof, according to the methods of the present invention, is effective to produce the desired result in the mammalian subject, e.g., a reduction in symptoms associated with a disease.

[0091] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0092] Half-life: As used herein, the term "half-life" is the time required for a quantity, such as a nucleic acid or protein concentration or activity, to fall to half of its initially measured value over a period of time.

[0093] Improve, increase, or decrease: As used herein, "improve," "increase," or "decrease," or grammatical equivalents, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual before initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated and who is approximately the same age as the subject being treated.

[0094] In vitro: As used herein, the term "in vitro" refers to events that take place not within a multicellular organism but in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc.

[0095] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term can be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0096] Isolated: As used herein, the term "isolated" refers to substances and / or entities that are (1) separated from at least some of the components with which they were associated when originally produced (whether in nature and / or in an experimental setting) and / or (2) artificially produced, prepared, and / or manufactured. Isolated substances and / or entities can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were originally associated. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of percent purity of isolated substances and / or entities should not include excipients (e.g., buffers, solvents, water, etc.).

[0097] Local distribution or local delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires an mRNA-encoded protein (e.g., an enzyme) that is translated and expressed intracellularly or that is secreted only to avoid it entering the patient's circulatory system.

[0098] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polyribonucleotide that encodes at least one polypeptide. mRNA can contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, and optionally purified, in vitro transcribed, or chemically synthesized. mRNA sequences are presented in a 5' to 3' direction unless otherwise indicated. Typically, mRNA of the present invention is synthesized from unmodified adenosine, guanosine, cytidine, and uridine nucleotides. Such mRNA is referred to herein as mRNA with unmodified nucleotides, or "unmodified mRNA" for short. Typically, this means that the mRNA of the invention does not comprise any of the following nucleoside analogues: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine. mRNA suitable for practicing the claimed invention generally does not contain nucleosides containing chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0099] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, nucleic acids are compounds and / or substances that are or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA, as well as single-stranded and / or double-stranded DNA and / or cDNA.

[0100] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0101] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, inflammatory irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0102] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. provide a detailed description of pharmaceutically acceptable salts in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include amino salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed by other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lanthanide, and lanthanide. Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N(C1-4 alkyl) salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.Further pharmaceutically acceptable salts include non-toxic ammonium cations, quaternary ammonium cations, and amine cations, formed where appropriate using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharmaceutically acceptable salts include salts formed from the quaternization of amines using suitable electrophiles, for example, alkyl halides, to form quaternized alkylated amino salts.

[0103] Systemic distribution or delivery: As used herein, the terms "systemic distribution," "systemic delivery," or grammatical equivalents refer to a delivery or distribution mechanism or approach that affects the entire body or the entire organism. Typically, systemic distribution or delivery is achieved via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery."

[0104] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, a subject is a human. A subject can be a patient. It refers to a person who sees a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be suffering from or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0105] Substantially: As used herein, the term "substantially" refers to the qualitative state of exhibiting all or nearly all extent or degree of a desired characteristic or property. Those skilled in the biological arts understand that biological and chemical phenomena rarely, if ever, go to completion and / or reach completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0106] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes tissue that exhibits pathology, symptoms, or characteristics associated with the disease.

[0107] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of, and / or the disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. Those skilled in the art will appreciate that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.

[0108] Treating: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not exhibit signs of disease and / or who exhibit only early signs of disease, for the purpose of reducing the risk of developing conditions associated with the disease.

[0109] Various aspects of the present invention are described in detail in the following sections. The use of sections is not meant to limit the present invention. Each section can be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0110] Primary ciliary dyskinesia (PCD) Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder characterized by abnormal cilia and flagella found in the lining of the respiratory tract, reproductive system, and other organs and tissues. Mutations in the DNAH5 gene, which encodes the dynein axoneme heavy chain 5 protein that forms the inner structure of cilia, cause PCD. More than 80 mutations in the DNAH5 gene have been identified in patients with PCD.

[0111] Mutations in the DNAH5 gene result in the absence or abnormality of dynein axonemal heavy chain 5, which is required for the proper function of cilia. Without a normal version of dynein axonemal heavy chain 5, defective cilia cannot generate the force and movement necessary to clear fluid, bacteria, and particles from the lungs, establish the left-right axis during embryonic development, and propel sperm cells forward. PCD can lead to chronic respiratory infections, bronchiectasis, year-round nasal congestion, abnormal placement of chest and abdominal organs, and infertility.

[0112] The polyribonucleotides of the present disclosure can be used, for example, to treat subjects having or at risk of having primary ciliary dyskinesia or any other condition associated with a defect or dysfunction in a gene whose function is related to the maintenance and function of cilia. Non-limiting examples of genes associated with primary ciliary dyskinesia include armadillo repeat containing 4 (ARMC4), chromosome 21 open reading frame 59 (C21orf59), coiled-coil domain containing 103 (CCDC103), coiled-coil domain containing 114 (CCDC114), coiled-coil domain containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40), coiled-coil domain containing 65 (CCDC65), cyclin O (CCNO), dynein assembly factor 1 (DNAAF1), dynein assembly factor 2 (DNAAF2), dynein assembly factor 3 (DNAAF3), dynein assembly factor 5 (DNAAF5), dynein axoneme heavy chain 11 (DNAHl), and dynein axoneme heavy chain 12 (DHA). l), dynein axonemal heavy chain 5 (DNAH5), dynein axonemal heavy chain 6 (DNAH6), dynein axonemal heavy chain 8 (DNAH8), dynein axonemal intermediate chain 2 (DNAI2), dynein axonemal light chain 1 (DNALl), dynein regulatory complex subunit 1 (DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), growth arrest specific 8 (GAS8), axonemal central paired apparatus protein (HYDIN), leucine-rich repeat containing 6 (LRRC6), M These include E / M23 family member 8 (NME8), orofacial digital syndrome 1 (OFD1), retinitis pigmentosa GTPase regulator (RPGR), radial spokehead 1 homolog (Chlamydomonas) (RSPH1), radial spokehead 4 homolog A (Chlamydomonas) (RSPH4A), radial spokehead 9 homolog (Chlamydomonas) (RSPH9), sperm-associated antigen l (SPAGl), and zinc finger MY D type-containing 10 (ZMYND10).

[0113] Dynein axonemal heavy chain 5 (DNAH5) gene and protein sequence. In some embodiments, the present invention provides methods and compositions for delivering to a subject an mRNA encoding DNAH5 for the treatment of PCD. Suitable DNAH5 mRNA encodes any full-length, fragment, or portion of DNAH5 protein that can substitute for the activity of a native DNAH5 protein and / or reduce the intensity, severity, and / or frequency of one or more symptoms associated with PCD.

[0114] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding the human DNAH5 protein. The native human DNAH5 mRNA coding sequence and its corresponding amino acid sequence are shown in Table 1:

[0115] The native human DNAH5 mRNA coding sequence and its corresponding amino acid sequence are shown in Table 1: [Table 1-1] [Table 1-2]

[0116] In some embodiments, a suitable mRNA sequence is that of wild-type human DNAH5 mRNA. In some embodiments, a suitable therapeutic candidate mRNA is a codon-optimized hDNAH5 sequence capable of encoding the DNAH5 amino acid sequence shown in Table 1 as SEQ ID NO: 1, or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In some embodiments, an mRNA according to the invention encodes a DNAH5 protein having an amino acid sequence identical to SEQ ID NO: 1.

[0117] Codon optimization Increasing research has shown that mRNA contains multiple layers of information that overlap with the amino acid code. Traditionally, codon optimization has been used to remove rare codons that are thought to be rate-limiting for protein expression. While fast-growing bacteria and yeast both exhibit strong codon bias in highly expressed genes, higher eukaryotes exhibit much less codon bias, making it more difficult to identify potentially rate-limiting codons. In addition, it has been found that codon bias itself does not necessarily result in high expression; other features are required.

[0118] For example, rare codons are involved in slowing translation and creating pause sites that may be necessary for proper protein folding. Therefore, changes in codon usage can provide a mechanism for fine-tuning the temporal pattern of elongation, thereby increasing the time available for proteins to undergo their correct folding. Codon optimization can interfere with this fine-tuning mechanism, resulting in less efficient protein translation or increased amounts of misfolded protein. Similarly, codon optimization can disrupt the normal patterns of cognate and wobble tRNA usage, thereby affecting protein structure and function. This is because wobble-dependent slowing of elongation may also be selected as a mechanism for achieving proper protein folding.

[0119] Despite these obstacles, the inventors arrived at a codon-optimized hDNAH5 sequence that improved DNAH5 protein expression by at least threefold compared to the coding sequence of the wild-type gene. Increased expression was observed not only in mammalian cell culture but also in vivo in a mouse model. The observed improvement in expression of the codon-optimized DNAH5 coding sequence is expected to improve and make mRNA replacement therapy for patients suffering from PCD more cost-effective, as it will eliminate the need for modified nucleotides for mRNA preparation and allow treatment with reduced doses and / or extended dosing intervals.

[0120] Example of a codon-optimized DNAH5 mRNA sequence The following sequences list selected exemplary codon-optimized DNAH5 mRNA sequences.

[0121] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:6.

[0122] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:7.

[0123] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:8.

[0124] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:9.

[0125] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:10.

[0126] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:11.

[0127] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:12.

[0128] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:13.

[0129] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:14.

[0130] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:15.

[0131] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:16.

[0132] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:17.

[0133] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:18.

[0134] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:19.

[0135] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:20.

[0136] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:21.

[0137] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:22.

[0138] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:23.

[0139] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:24.

[0140] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:25.

[0141] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:26.

[0142] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:27.

[0143] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:28.

[0144] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:29.

[0145] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:30.

[0146] In some embodiments, a suitable mRNA may be a codon-optimized sequence such as that shown in SEQ ID NO:31.

[0147] In some embodiments, a suitable mRNA sequence may be an mRNA sequence of a homolog or analog of the human DNAH5 protein. For example, a homolog or analog of the human DNAH5 protein may be a modified human DNAH5 protein that contains one or more amino acid substitutions, deletions, and / or insertions compared to the wild-type or naturally occurring human DNAH5 protein while substantially retaining the activity of the DNAH5 protein. In some embodiments, an mRNA suitable for the present invention encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 1. In some embodiments, an mRNA suitable for the present invention encodes a protein that is substantially identical to the human DNAH5 protein. In some embodiments, an mRNA suitable for the present invention encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1. Typically, an mRNA according to the present invention encodes a DNAH5 protein having an amino acid sequence identical to SEQ ID NO: 1.

[0148] In some embodiments, mRNA suitable for the present invention encodes a fragment or portion of the human DNAH5 protein, in which case the fragment or portion of the protein still maintains DNAH5 activity similar to the wild-type protein.

[0149] In some embodiments, a suitable mRNA encodes a fusion protein comprising a full-length, fragment, or portion of the DNAH5 protein fused to another protein (e.g., an N-terminal or C-terminal fusion). In some embodiments, the protein fused to the mRNA encoding the full-length, fragment, or portion of the DNAH5 protein encodes a signal sequence or a cellular targeting sequence.

[0150] In some embodiments, mRNA suitable for the present invention comprises a nucleotide sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31. More typically, mRNA according to the present invention comprises a nucleotide sequence at least 95% identical to SEQ ID NO:6. Preferably, mRNA according to the present invention comprises a nucleotide sequence at least 99% identical to SEQ ID NO:7. For example, mRNA according to the present invention comprises the nucleotide sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0151] The messenger RNA of the present invention can be synthesized according to any of various known methods.For example, the mRNA of the present invention can be synthesized through in vitro transcription (IVT).Briefly, IVT is typically carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor.The exact conditions vary depending on the specific application.

[0152] In some embodiments, to prepare mRNA according to the present invention, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence of the desired mRNA and a termination signal.

[0153] Typically, the mRNA of the present invention is synthesized as unmodified mRNA. Thus, the mRNA of the present invention is synthesized from naturally occurring nucleotides containing purines (adenine (A), guanine (G)) or pyrimidines (cytosine (C), uracil (U)).

[0154] Typically, mRNA synthesis involves the addition of a "cap" onto the N-terminus (5') and a "tail" onto the C-terminus (3'). The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation.

[0155] Thus, in some embodiments, an mRNA (e.g., an mRNA encoding DNAH5) includes a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase to create a 5'5'5 triphosphate linkage; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0156] In some embodiments, an mRNA (e.g., an mRNA encoding DNAH5) comprises a 3' poly(A) tail structure. The poly-A tail on the 3' end of the mRNA typically comprises about 10 to 800 adenosine nucleotides (e.g., about 300 to 500 adenosine nucleotides, about 300 to 800 adenosine nucleotides, about 10 to 500 adenosine nucleotides, about 10 to 300 adenosine nucleotides, about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). Typically, the poly-A tail in an mRNA according to the present invention is about 300 to about 800 adenosine nucleotides in length. More commonly, the poly-A tail is about 300 adenosine nucleotides in length. In some embodiments, the poly(A) tail structure comprises at least 85%, 90%, 95%, or 100% adenosines.

[0157] In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly-C tail on the 3' end of the mRNA typically comprises about 10 to 200 cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). The poly-C tail can be added to or can replace the poly-A tail.

[0158] In some embodiments, the mRNA further comprises a 5' untranslated region (5' UTR) comprising a nucleotide sequence and positioned between the 5' cap structure and the coding sequence, and / or a 3' untranslated region (3' UTR) comprising a nucleotide sequence and positioned between the coding sequence and the poly(A) tail structure. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, e.g., iron-responsive elements. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0159] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' untranslated region can be 50-500 nucleotides in length or more.

[0160] modified mRNA The mRNA according to the present invention is typically synthesized as unmodified mRNA. In some embodiments, it may be advantageous to synthesize the mRNA encoding the codon-optimized DNAH5 coding sequence of the present invention with one or more modified nucleotides. Typically, the mRNA is modified to increase its stability or reduce its immunogenic properties, especially when administered to a subject as naked mRNA or in a complex form. Therefore, providing the mRNA encoding the codon-optimized DNAH5 coding sequence of the present invention may have a synergistic effect, resulting in a sustained in vivo function that exceeds that observed with unmodified mRNA.

[0161] Modification of mRNA can include, for example, modification of the nucleotides of the RNA. Modified mRNA according to the present invention can therefore include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, mRNA can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N -6-Isopentenyl-adenine, N6-Methyl-adenine, N6-Isopentenyl-adenine, 2-Thio-cytosine, 3-Methyl-cytosine, 4-Acetyl-cytosine, 5-Methyl-cytosine, 2,6-Diaminopurine, 1-Methyl-guanine, 2-Methyl-guanine, 2,2-Dimethyl-guanine, 7-Methyl-guanine, Inosine, 1-Methyl-inosine, Pseudouracil (5-uracil), Dihydro-uracil, 2-Thio-uracil uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5' -methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 1-methyl-pseudouracil, queosine, beta-D-mannosyl-queosine, wybutoxosine, and phosphoramidites, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine, etc.The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated by reference in their entireties.

[0162] In some embodiments, the mRNA of the present invention can comprise RNA backbone modification.Typically, backbone modification is the modification that chemically modifies the backbone phosphate of the nucleotide contained in RNA.Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methyl phosphonate, methyl phosphoramidite, phosphoramidite, phosphorothioate (for example, cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means that phosphodiester bond is replaced with other anionic group, cationic group, or neutral group.

[0163] In some embodiments, the mRNA of the present invention may contain sugar modifications. Typical sugar modifications are chemical modifications of the sugar of a nucleotide, including, but not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotide (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotide, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate, 2'-O-alkyloligoribonucleotide, 2'-fluoro-2'-deoxyuridine 5'-triphosphate ... and sugar modifications selected from the group consisting of 2'-C-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0164] In some embodiments, the mRNA of the present invention may contain a modification of the base of a nucleotide (base modification). Modified nucleotides containing base modifications are also called base-modified nucleotides. Examples of such base-modified nucleotides include 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacyt ... -azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0165] Cap Structure In some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase to create a 5'5'5 triphosphate linkage; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0166] Naturally occurring cap structures contain 7-methylguanosine, which is linked to the 5' end of the first transcribed nucleotide by a triphosphate bridge, resulting in a dinucleotide cap of mG(5')ppp(5')N (where N is any nucleoside). In vivo, the cap is added enzymatically. The cap is added in the nucleus and is catalyzed by the enzyme guanylyltransferase. Addition of the cap to the 5' end of RNA occurs immediately after transcription initiation. The terminal nucleoside is typically guanosine, in the reverse orientation relative to all other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0167] A common cap for mRNA produced by in vitro transcription is m7G(5')ppp(5')G, which is used as a dinucleotide cap during in vitro transcription with T7 or SP6 RNA polymerase to obtain RNAs with a cap structure at their 5' end. A common in vitro method for synthesizing capped mRNA uses a preformed dinucleotide of the form m7G(5')ppp(5')G ("m7GpppG") as the initiator of transcription.

[0168] To date, the usual form of synthetic dinucleotide cap used in in vitro translation experiments is the anti-inverted cap analog ("ARCA") or modified ARCA, which is generally a modified cap analog in which the 2' or 3' OH group is replaced with -OCH3.

[0169] Additional cap analogs include, but are not limited to, chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC, unmethylated cap analogs (e.g., GpppG), dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetric cap analogs (e.g., m7Gpppm7G), or anti-reverse cap analogs (e.g., ARCA, m7,2'OmeGpppG, m72'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG, and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al., "Novel 'anti-reverse' cap analogs with superior translational properties", RNA, 9:1108-1122 (2003)).

[0170] In some embodiments, a suitable cap is 7-methylguanylic acid ("m7G") linked to the 5' end of the first transcribed nucleotide by a triphosphate bridge, resulting in m7G(5')ppp(5')N, where N is any nucleoside. A preferred embodiment of the m7G cap utilized in embodiments of the present invention is m7G(5')ppp(5')G.

[0171] In some embodiments, the cap is a Cap 0 structure. The Cap 0 structure lacks ribose 2'-O-methyl residues attached to bases 1 and 2. In some embodiments, the cap is a Cap 1 structure. The Cap 1 structure has a 2'-O-methyl residue at base 2. In some embodiments, the cap is a Cap 2 structure. The Cap 2 structure has a 2'-O-methyl residue attached to both base 2 and base 3.

[0172] Various m7G cap analogs are known in the art, many of which are commercially available, including the above-mentioned m7GpppG, as well as the ARCA 3'-OCH3 and 2'-OCH3 cap analogs (Jemielity, J. et al., RNA, 9:1108-1122 (2003)). Additional cap analogs for use in embodiments of the present invention include N7-benzylated dinucleoside tetraphosphate analogs (as described in Grudzien, E. et al., RNA, 10:1479-1487 (2004)), phosphorothioate cap analogs (as described in Grudzien-Nogalska, E., et al., RNA, 13:1745-1755 (2007)), and cap analogs described in U.S. Patent Nos. 8,093,367 and 8,304,529 (including biotinylated cap analogs), which are incorporated herein by reference.

[0173] Tail Structure Typically, the presence of a "tail" serves to protect mRNA from exonuclease degradation. PolyA tails are thought to stabilize natural messenger and synthetic sense RNA. Therefore, in certain embodiments, a long polyA tail can be added to an mRNA molecule, resulting in a more stable RNA. PolyA tails can be added using various techniques recognized in the art. For example, long polyA tails can be added to synthetic or in vitro transcribed RNA using polyA polymerase (Yokoe, et al. Nature Biotechnology. 1996;14:1252-1256). Transcription vectors can also encode long polyA tails. In addition, polyA tails can be added by direct transcription from PCR products. PolyA can also be ligated to the 3' end of sense RNA using RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0174] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. Typically, the length of the poly(A) tail can be at least about 10, 50, 100, 200, 300, 400, or 500 nucleotides in length. In some embodiments, the poly(A) tail at the 3' end of the mRNA typically comprises about 10 to 800 adenosine nucleotides (e.g., about 300 to 500 adenosine nucleotides, about 300 to 800 adenosine nucleotides, about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). Typically, the poly(A) tail in the mRNA according to the present invention is about 300 to about 800 adenosine nucleotides in length. More commonly, the poly(A) tail is about 300 adenosine nucleotides in length.

[0175] In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly-C tail on the 3' end of the mRNA typically comprises about 10 to 200 cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). The poly-C tail can be added to or can replace the poly-A tail.

[0176] In some embodiments, the length of the poly-A or poly-C tail is adjusted to control the stability of the modified sense mRNA molecules of the present invention, and thus protein transcription. For example, because the length of the poly-A tail can affect the half-life of the sense mRNA molecule, the length of the poly-A tail can be adjusted to modify the level of resistance of the mRNA to nucleases, thereby controlling the time course of polynucleotide expression and / or polypeptide production in target cells.

[0177] 5' and 3' untranslated regions In some embodiments, the mRNA comprises a 5' untranslated region (UTR). In some embodiments, the mRNA comprises a 3' untranslated region. In some embodiments, the mRNA comprises both a 5' untranslated region and a 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, e.g., iron-responsive elements. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0178] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' untranslated region can be 50-500 nucleotides in length or more.

[0179] Exemplary 3' and 5' untranslated region sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' UTR can contain a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide. To further stabilize the polynucleotide, the inclusion of a sequence encoding human growth hormone (hGH) or a fragment thereof in the 3' end or untranslated region of the polynucleotide (e.g., mRNA) is also contemplated. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, for example, to improve the resistance of such polynucleotides to in vivo nuclease digestion.

[0180] In certain embodiments, the codon-optimized DNAH5 mRNA comprises a coding region with a codon-optimized coding region flanked by 5' and 3' untranslated regions, designated as X and Y, respectively (see below). X-Code Region-Y wherein the coding region sequence is SEQ ID NO:6 or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:6; SEQ ID NO:7 or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:7; SEQ ID NO:8 or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:8. a sequence 9% or more identical to SEQ ID NO:9, or a sequence 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:9; SEQ ID NO:10, or a sequence 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:10; SEQ ID NO:11, or a sequence 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:11; a sequence identical to SEQ ID NO:12, or a sequence identical to SEQ ID NO:12 by 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more; a sequence identical to SEQ ID NO:13, or a sequence identical to SEQ ID NO:13 by 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more; a sequence identical to SEQ ID NO:14, or a sequence identical to SEQ ID NO:14 by 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more; a sequence that is 9% or more identical to SEQ ID NO: 15, or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identical to SEQ ID NO: 15; a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identical to SEQ ID NO: 16; a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identical to SEQ ID NO: 17;a sequence that is 99% or more identical to SEQ ID NO:18, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:18; a sequence that is 99% or more identical to SEQ ID NO:19, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:19; a sequence that is 99% or more identical to SEQ ID NO:20, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:20; a sequence that is 99% or more identical to SEQ ID NO:21, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%; a sequence that is 99% or more identical to SEQ ID NO:21, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%; a sequence that is 99% or more identical to SEQ ID NO:23, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%; a sequence that is 99% or more identical to SEQ ID NO:24, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:24; a sequence that is 99% or more identical to SEQ ID NO:24, SEQ ID NO:25, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:25; a sequence that is 99% or more identical to SEQ ID NO:26, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:26; a sequence that is 99% or more identical to SEQ ID NO:27, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:27; a sequence that is 99% or more identical to SEQ ID NO:27, SEQ ID NO:28, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:28; a sequence that is 99% or more identical to SEQ ID NO:29, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% to SEQ ID NO:29;a sequence that is 99% or more identical to SEQ ID NO:30, or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:30, SEQ ID NO:31, or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:31; X (5'UTR sequence) AGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 2] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97, 98%, 99% or more identical to SEQ ID NO: 2; or GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 3] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 3, and Y (3'UTR sequence) is CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 4] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 4, or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU [SEQ ID NO: 5] or a sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 5. In vitro transcription In a specific embodiment of the present invention, codon-optimized human dynein axoneme heavy chain 5 messenger RNA (DNAH5 mRNA) was synthesized by in vitro transcription from a plasmid DNA template encoding the gene, followed by the addition of a 5' cap structure (Fechter, P.; Brownlee, GG "Recognition of mRNA cap structures by viral and cellular proteins" J. Gen. Virology 2005, 86, 1239-1249) and a 3' poly(A) tail of approximately 100, 200, 250, 300, 400, 500, or 800 nucleotides in length, as determined by gel electrophoresis.

[0181] Delivery Vehicle According to the present invention, mRNA encoding a DNAH5 protein described herein (e.g., a full-length, fragment, or portion of a DNAH5 protein) may be delivered as naked RNA (unpackaged) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "implantation vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.

[0182] In some embodiments, the mRNA encoding the DNAH5 protein may be delivered via a single delivery vehicle. In some embodiments, the mRNA encoding the DNAH5 protein may be delivered via one or more delivery vehicles, each with a different composition. According to various embodiments, suitable delivery vehicles include, but are not limited to, polymeric carriers such as polyethyleneimine (PEI), lipid nanoparticles, and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of natural and synthetic origin, natural lamellar bodies, synthetic lamellar bodies, and semi-synthetic lamellar bodies, nanoparticles, calcium phosphosilicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, microcrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other targeting tags.

[0183] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, either alone or in combination with other carriers, including various lipids, as described herein. Thus, in some embodiments, the liposome delivery vehicles used herein also encompass polymers, including nanoparticles. Suitable polymers may include, for example, polyacrylates, polyalkoxyacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is included, the PEI may be branched PEI with a molecular weight ranging from 10 to 40 kDa, for example, 25 kDa branched PEI (Sigma #408727).

[0184] Liposomes: In some embodiments, a suitable delivery vehicle is a liposome. As used herein, liposomes are generally characterized as microscopic vesicles having an internal aqueous space separated from the external medium by one or more bilayer membranes. The bilayer membrane of a liposome is typically formed by amphiphilic molecules, such as lipids of synthetic or natural origin, containing spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome may also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, liposomes typically serve to transport desired mRNA to target cells or tissues. Exemplary liposomes according to the present invention comprise one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

[0185] cationic lipids As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH.

[0186] Some cationic lipids have been described in the literature, and many of them are commercially available.The cationic lipids suitable for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2010 / 144740, which is incorporated herein by reference.

[0187] In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0188] Other suitable cationic lipids for use in the compositions and methods of the present invention include the ionizable cationic lipids described in International Patent Publication WO2013 / 149140, which is incorporated herein by reference.In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of one of the following formulas: [ka] or a pharmaceutically acceptable salt thereof, wherein R and R are each independently hydrogen, an optionally substituted, variably saturated or unsaturated C-C 20 Alkyl, and optionally substituted, variably saturated or unsaturated C-C 20 acyl, wherein L and L are each independently hydrogen, optionally substituted C-C 30 Alkyl, optionally substituted variably unsaturated C-C 30 Alkenyl, and optionally substituted C-C 30 alkynyl, wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and wherein n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include the cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0189] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids described as amino alcohol lipidoids in International Patent Publication WO2010 / 053572, which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0190] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0191] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0192] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharmaceutically acceptable salts thereof.

[0193] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications WO2013 / 063468 and WO2016 / 205691, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R L Each instance of is independently an optionally substituted C-C 40 In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0194] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; and each R A are independently hydrogen, optionally substituted C alkyl, optionally substituted C alkenyl, optionally substituted C alkynyl, optionally substituted C carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C aryl, optionally substituted 5-14 membered heteroaryl or halogen; and each R B are independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl, or halogen. In certain embodiments, the compositions and methods of the invention provide a cationic lipid "Target 23" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0195] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof.

[0196] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in J. McClellan, MCKing, Cell, 1999, 14, 149-152, which are incorporated herein by reference. 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277. In certain embodiments, the cationic lipid of the compositions and methods of the present invention is a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0197] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0198] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0199] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 One of the following is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O-; another L 1 or L 2 -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O- or a direct bond; G 1 and G 2are each independently unsubstituted C-C 12 Alkylene or C1-C 12 Alkenylene; G 3 is C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 alkyl; R 1 and R 2 are independently C6-C 24 Alkyl or C6-C 24 alkenyl; R 3 is H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 and R 4 is C1-C 12 alkyl; R 5 is H or C1-C6 alkyl; and x is 0, 1, or 2.

[0200] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0201] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the present invention is a compound of one of the following formulas: [ka] and pharmaceutically acceptable salts thereof. For any one of these four formulas, R4 is -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) n In certain embodiments, the cationic lipid is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle, wherein n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0202] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications WO2017 / 173054 and WO2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0203] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cleavable cationic lipids described in International Patent Publication WO2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and wherein R2 is selected from the group consisting of one of the following two formulae: [ka] wherein R and R are each independently an optionally substituted variably saturated or unsaturated C-C 20 Alkyl and optionally substituted variably saturated or unsaturated C6-C 20 acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid "HGT4001" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0204] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having any of the general formulas or structures (1a)-(21a), (1b)-(21b), and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having a structure according to formula (I'): [ka] During the ceremony, R X are independent, -H, -L 1 -R 1 , or -L 5A -L 5B -B', L 1 , L 2 , and L 3 each independently represents a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NR L - and L 4A and L 5A are each independently —C(O)—, —C(O)O—, or —C(O)NR L - and L 4B and L 5B are each independently, C1-C 20 Alkylene, C2-C 20 Alkenylene, or C2-C 20is alkynylene, Each B and B' is NR 4 R 5 or a 5- to 10-membered nitrogen-containing heteroaryl; R 1 , R 2 , and R 3 are each independently, C6-C 30 Alkyl, C6-C 30 Alkenyl, or C6-C 30 is alkynyl, Each R 4 and R 5 are independently hydrogen, C1-C 10 Alkyl, C2-C 10 Alkenyl, or C2-C 10 is alkynyl, Each R L are independently hydrogen, C1-C 20 Alkyl, C2-C 20 Alkenyl, or C2-C 20 Cationic lipids are provided which are alkynyl. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid that is compound (139) of 62 / 672,194, having the following compound structure: [ka]

[0205] In some embodiments, the compositions and methods of the present invention comprise the cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride ("DOTMA") (Feigner et al., incorporated herein by reference). al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355). Other cationic lipids suitable for the compositions and methods of the present invention include, for example, 5-carboxyspermylglycinedioctadecylamide ("DOGS"), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium ("DOSPA") (Behr et al. Proc. Nat'l Acad. Sci. 86, 6982 (1989); U.S. Pat. No. 5,171,678, U.S. Pat. No. 5,334,761), l,2-dioleoyl-3-dimethylammonium-propane ("DODAP"), and l,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0206] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"); N-dioleyl-N,N-dimethylammoni ammonium chloride ("DODAC"), N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimyrityloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta-oxybutan-4-yl)]-1-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); l,2-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP"); l,2-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA");(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (c)-N,fsl-dimethyl 3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2S)"); 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("DLin-K-XTC2-DMA"), and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (see WO 2010 / 042877, incorporated herein by reference; Semple et al., Nature Biotech. 28:172-176 (2010)). (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Publication No. 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0207] In some embodiments, one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").

[0208] In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., measured by weight of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., measured by mole % of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by mole % of the lipid nanoparticles.

[0209] In some embodiments, sterol-based cationic lipids may be used instead of or in addition to the cationic lipids described herein.Suitable sterol-based cationic lipids include dialkylamino-containing sterol-based cationic lipids, imidazole-containing sterol-based cationic lipids, and guanidinium-containing sterol-based cationic lipids. For example, certain embodiments are directed to compositions comprising one or more sterol-based cationic lipids, including imidazole, e.g., imidazole cholesterol ester, or the “ICE” lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by structure (I) below. In certain embodiments, lipid nanoparticles for delivery of RNA (e.g., mRNA) encoding functional proteins may include one or more imidazole-based cationic lipids, such as imidazole cholesterol ester, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by the following structures: [ka]

[0210] In some embodiments, the proportion of cationic lipid in the liposome can be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid comprises about 30-50% by weight of the liposome (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, the cationic lipid (e.g., ICE lipid) comprises about 30%, about 35%, about 40%, about 45%, or about 50% by molar ratio of the liposome.

[0211] Non-cationic / Helper Lipids In some embodiments, the provided liposomes comprise one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylcholine (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (DPPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleoyl ... and mixtures thereof.

[0212] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other excipients, such as cationic lipids. In some embodiments, the non-cationic lipids may comprise a molar ratio of about 5% to about 90%, or about 10% to about 70%, of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that do not carry a net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the proportion of non-cationic lipids in the liposomes may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0213] Cholesterol-based lipids In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. al. BioTechniques 23,139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise a molar percentage of about 2% to about 30%, or about 5% to about 20%, of the total lipid present in the liposome. In some embodiments, the percentage of cholesterol-based lipid in the liposome may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0214] PEGylated lipids In some embodiments, the provided liposomes contain one or more PEGylated lipids. For example, the present invention contemplates the use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-l-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), in combination with one or more cationic lipids, and in some embodiments, with other lipids comprising the liposome. Contemplated PEG-modified lipids include, but are not limited to, polyethylene glycol chains up to 2 kDa, up to 3 kDa, up to 4 kDa, or up to 5 kDa in length covalently attached to lipids having alkyl chains C6-C20 in length. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. The addition of such moieties can prevent aggregation of the complex, increase circulation lifetime, and provide a means for increasing delivery of lipid-nucleic acid compositions to target cells (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or the moieties can be selected to rapidly exchange from the formulation in vivo (see U.S. Pat. No. 5,885,613). In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, a particularly useful exchangeable lipid is PEG-ceramide with a shorter acyl chain (e.g., C14 or C18).

[0215] In some embodiments, particularly useful interchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention may comprise about 0% to about 15%, about 0.5% to about 15%, about 1% to about 15%, about 4% to about 10%, or about 2% by molar percentage of the total lipids present in the liposomes. The PEG-modified phospholipids and derivatized lipids may constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable lipid solution, by weight or molar percentage. In some embodiments, the PEGylated lipids constitute about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution, by weight or molar percentage.

[0216] According to various embodiments, the selection of cationic lipid, non-cationic lipid, and / or PEG-modified lipid that comprise liposome, and the relative molar ratio of these lipids to each other are based on the characteristics of selected lipid, the nature of the target cell of interest, and the characteristics of the mRNA to be delivered.Further considerations include, for example, the saturation degree of the alkyl chain of selected lipid, as well as size, charge, pH, pKa, fusogenicity and toxicity.Therefore, molar ratio can be adjusted accordingly.

[0217] Liposomal formulation Liposomes suitable for the present invention may contain one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEGylated lipids, and / or polymers described herein in various proportions.Typically, liposomes according to the present invention contain cationic lipids, non-cationic lipids, cholesterol lipids, and PEGylated lipids.As a non-limiting example, suitable liposome formulations may contain a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K. Additional combinations of lipids are described in the art, e.g., U.S. Patent No. 62 / 420,421 (filed November 10, 2016), U.S. Patent No. 62 / 421,021 (filed November 11, 2016), U.S. Patent No. 62 / 464,327 (filed February 27, 2017), and PCT application entitled "Novel ICE-based Lipid Nanoparticle Formulation for Delivery of mRNA," filed November 10, 2017, the disclosures of which are incorporated herein by reference in their entireties.

[0218] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the proportion of the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome by molar ratio.

[0219] In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEGylated lipid may be approximately 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEGylated lipid is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEGylated lipid is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEGylated lipid is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEGylated lipid is approximately 50:25:20:5.

[0220] Liposome formation The liposome import vehicle for use in the compositions of the present invention can be prepared by various techniques currently known in the art. The liposomes for use in the provided compositions can be prepared by various techniques currently known in the art. For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques by dissolving the lipids in a suitable solvent, depositing the selected lipids on the inner wall of a suitable container or vessel, and then evaporating the solvent to leave a thin film on the inside of the vessel, or by spray drying. Subsequently, an aqueous phase can be added to the vessel with vortexing, thereby forming MLVs. Unilamellar vesicles (ULVs) can then be formed by homogenizing, sonicating, or extruding the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.

[0221] In certain embodiments, provided compositions comprise liposome, in this case mRNA is associated on both surfaces of liposome and is encapsulated in the liposome.For example, during the preparation of the compositions of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.For example, during the preparation of the compositions of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.

[0222] In some embodiments, the compositions and methods of the present invention comprise mRNA encapsulated in liposomes. In some embodiments, one or more mRNA species may be encapsulated in the same liposome. In some embodiments, one or more mRNA species may be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes. The liposomes differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes may have different compositions of cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes may have different molar ratios of cationic lipids, neutral lipids, cholesterol, and PEG-modified lipids used to make the liposomes.

[0223] The process of incorporating desired mRNA into liposomes is often referred to as "loading." Exemplary methods are described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. In a typical embodiment, the mRNA of the present invention is encapsulated in liposomes using the method described in WO2018 / 089801 (the teachings of which are incorporated herein by reference in their entirety). Briefly, mRNA is encapsulated by mixing a solution containing preformed liposomes with mRNA, so that liposomes encapsulating the mRNA are formed.

[0224] Typically, nucleic acids incorporated into liposomes are located entirely within the interior space of the liposome within the liposome bilayer membrane; however, as noted above, a portion of the mRNA (e.g., 10% or less of the total mRNA in the liposome composition) may also be associated with the outer surface of the liposome membrane. The incorporation of nucleic acids into liposomes is also referred to herein as "encapsulation." Typically, the purpose of incorporating mRNA into liposomes is to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid and / or systems or receptors that cause rapid excretion of the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate delivery of the mRNA to target cells or tissues.

[0225] Liposome size Suitable liposomes according to the present invention can be made in a variety of sizes. In some embodiments, the provided liposomes can be made smaller than conventionally known mRNA-encapsulating liposomes. In some embodiments, reduced liposome size increases the efficiency of mRNA delivery. The appropriate liposome size can be selected taking into account the location of the target cell or tissue, and in part, the intended use of the liposomes.

[0226] In some embodiments, liposomes of appropriate size are selected to promote the systemic distribution of the antibody encoded by mRNA.In some embodiments, it may be desirable to limit the transfection of mRNA to specific cells or tissues.For example, to target hepatocytes, liposomes can be sized so that their size is smaller than the fenestration of the endothelial layer covering the hepatic sinusoids of the liver, and in this case, liposomes can easily penetrate the endothelial fenestration and reach the target hepatocytes.

[0227] Alternatively or additionally, liposomes may be sized to be of sufficient diameter to limit or intentionally prevent distribution within particular cells or tissues, for example, liposomes may be sized to be larger than the fenestrations in the endothelial layer lining the liver sinusoids, thereby limiting distribution of the liposomes to hepatocytes.

[0228] In some embodiments, the size of a liposome is determined by the maximum diameter of the liposome particle. In some embodiments, suitable liposomes have a size of about 250 nm or less (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less). In some embodiments, suitable liposomes have a size in the range of about 10 to 250 nm (e.g., about 10 to 225 nm, 10 to 200 nm, 10 to 175 nm, 10 to 150 nm, 10 to 125 nm, 10 to 100 nm, 10 to 75 nm, or 10 to 50 nm). In some embodiments, suitable liposomes have a size in the range of about 100 to 250 nm (e.g., about 100 to 225 nm, 100 to 200 nm, 100 to 175 nm, or 100 to 150 nm). Liposomes with a size of 80 to 200 nm are particularly suitable for some applications. In some embodiments, suitable liposomes have a size in the range of about 10 to 100 nm (e.g., in the range of about 10 to 90 nm, 10 to 80 nm, 10 to 70 nm, 10 to 60 nm, or 10 to 50 nm). In certain embodiments, suitable liposomes have a size of less than about 100 nm.

[0229] Various alternative methods known in the art are available for sizing liposome populations. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of liposome suspensions, either by bath or probe sonication, results in a gradual reduction in size to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method that utilizes shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated using a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 micrometers, is observed. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis.

[0230] Liposomal formulation for DNAH5 mRNA delivery and expression This section provides examples of liposome formulations for effective delivery and expression of DNAH5 mRNA in vivo.

[0231] lipid material The formulations described herein comprise multi-component lipid mixtures in various ratios utilizing one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol-based lipids), and PEGylated lipids designed to encapsulate mRNA encoding the DNAH5 protein. Cationic lipids include (but are not limited to) DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. “Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids” J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), and C12-200 (Love, KT et al. “Lipid-like materials for low-dose in vivo gene silencing” PNAS 2010,107,1864-1869), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione), HGT5000, HGT5001, HGT4003, ICE, OF-02, dialkylamino-based, imidazole-based, guanidinium-based, etc.Helper lipids include (but are not limited to) DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), cholesterol, and the like. PEGylated lipids include, but are not limited to, poly(ethylene) glycol chains up to 5 kDa in length covalently attached to lipids with alkyl chains C6-C20 in length.

[0232] Example of a formulation protocol A.cKK-E12 An aliquot of a 50 mg / mL ethanol solution of cKK-E12, DOPE, cholesterol, and DMG-PEG2K was mixed and diluted to a final volume of 3 mL with ethanol. Separately, a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock. The lipid solution was quickly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting liposome suspension was filtered, dialyzed against 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentrations of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90), were determined.

[0233] 12 B.C.-200 Mix an aliquot of a 50 mg / mL ethanol solution of c12-200, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0234] C.HGT4003 Mix an aliquot of a 50 mg / mL ethanol solution of HGT4003, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0235] D.ICE Mix an aliquot of a 50 mg / mL ethanol solution of ICE, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0236] E.HGT5001 Mix an aliquot of a 50 mg / mL ethanol solution of HGT5001, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0237] F.HGT5000 Mix an aliquot of a 50 mg / mL ethanol solution of HGT5000, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5T mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5T mRNA, Zave, Dv(50), and Dv(90).

[0238] G.DLinKC2DMA Mix an aliquot of a 50 mg / mL ethanol solution of DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0239] H.DODAP Mix an aliquot of a 50 mg / mL ethanol solution of DODAP, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0240] I.DODMA Mix an aliquot of a 50 mg / mL ethanol solution of DODMA, DOPE, cholesterol, and DMG-PEG2K and dilute to a final volume of 3 mL with ethanol. Separately, prepare a buffered aqueous solution of DNAH5 mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Quickly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting liposome suspension, dialyze it against 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. Determine the final concentration of DNAH5-encapsulated mRNA, Zave, Dv(50), and Dv(90).

[0241] Clinical or therapeutic candidate mRNA preparations are selected from the exemplary codon-optimized mRNA sequences with 5'-cap and 3'-polyA tail, and are formulated with the above-mentioned suitable lipid combinations.Clinically relevant mRNA candidates are characterized by efficient delivery and uptake by in vivo tissue, high level of expression and sustained protein production, and there is no detectable adverse effect caused by either pharmacologically active ingredients or lipids in liposomes, or any excipients used in the preparation, in the subject to which the therapeutic agent is administered.In general, high efficiency with low dose administration is favorable for the selection process of relevant candidate therapeutic agents.

[0242] Pharmaceutical Composition The present invention provides compositions for use in the treatment of primary ciliary dyskinesia (PCD). The compositions of the present invention are for use in the manufacture of a medicament for the treatment of primary ciliary dyskinesia (PCD).

[0243] To facilitate expression of mRNA in vivo, delivery vehicles such as liposomes may be formulated in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizing reagents, or may be formulated in a pharmaceutical composition in which they are mixed with suitable excipients. Techniques for drug formulation and administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition.

[0244] The provided liposome-encapsulated or liposome-bound mRNA and compositions containing the same can be administered and dosed according to current medical practice, taking into account the subject's clinical condition, the site and method of administration, the administration schedule, the subject's age, sex, and weight, and other factors relevant to a clinician skilled in the art. As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of therapeutic agent contained in the pharmaceutical composition of the present invention. Generally, a therapeutically effective amount is an amount sufficient to provide a meaningful benefit to the mammalian subject (e.g., treat, regulate, cure, prevent, and / or ameliorate PCD). For example, a therapeutically effective amount can be an amount sufficient to achieve the desired therapeutic and / or prophylactic effect. Typically, the amount of therapeutic agent (e.g., mRNA encoding a DNAH5 protein) administered to a subject in need thereof will depend on the subject's characteristics. Such characteristics include the subject's condition, disease severity, general health, age, sex, and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other relevant factors. Furthermore, both objective and subjective assays can be optionally used to identify optimal dosage ranges.

[0245] In some embodiments, an effective therapeutic dose of a pharmaceutical composition comprising mRNA encoding a dynein axoneme heavy chain 5 protein is administered to a mammal for a period between doses or at a dose interval sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal for a longer period compared to the pre-treatment state.

[0246] In some embodiments, the mammal is a human. A suitable therapeutic dose applicable to humans can be derived based on animal studies. A basic guideline for deriving a human equivalent dose from studies conducted on animals is available on the U.S. Food and Drug Administration (FDA) website at https: / / www.fda.gov / downloads / drugs / guidances / ucm078932.pdf, entitled "Guidance for Industry Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers." Based on allometric guidelines, for example, a suitable dose of 0.6 mg / kg in mice corresponds to a human equivalent dose of 0.0048 mg / kg. Therefore, taking into account the derived human equivalent dose, a predicted human therapeutic dose can be derived based on studies on other animals.

[0247] In some embodiments, the dosing interval is once every 15 days or more, or once every 20 days or more, or once every 21 days or more, or once every 22 days or more, or once every 23 days or more, or once every 24 days or more, or once every 25 days or more, or once every 26 days or more, or once every 27 days or more, or once every 28 days or more, or once every 29 days or more, or once every 30 days or once every 31 days or more. In some embodiments, the dosing interval is once every 40 days, 45 days, 50 days, or 60 days, or any number of days in between. In some embodiments, the dosing interval is once every 80 days, 90 days, 120 days, or 150 days, or any number of days in between.

[0248] In some embodiments, the therapeutic low dose is administered at a dosing interval of once every two weeks or more, which is sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal compared to the pre-treatment state. In some embodiments, the therapeutic low dose is administered at a dosing interval of once every three weeks or more, which is sufficient to reduce the level of at least one symptom or biomarker associated with PCD in the mammal compared to the pre-treatment state. In some embodiments, the dosing interval is once every four weeks or more. In some embodiments, the dosing interval is once every five weeks or more. In some embodiments, the dosing interval is once every six weeks or more. In some embodiments, the dosing interval is once every eight weeks or more. In some embodiments, the dosing interval is once every 12 weeks, or 15 weeks, or 18 weeks or more.

[0249] In some embodiments, the dosing interval is once a month. In some embodiments, the dosing interval is once every two months. In some embodiments, the dosing interval is once every three months, once every four months, once every five months, once every six months, or anywhere in between.

[0250] In some embodiments, administration of a provided composition increases the expression level of dynein axoneme heavy chain 5 mRNA in a biological sample from a subject, compared to the baseline expression level before treatment. Typically, the baseline level is measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition increases the expression level of DNAH5 mRNA by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition increases the expression level of DNAH5 mRNA, compared to the expression level of DNAH5 mRNA in a subject not receiving treatment.

[0251] According to the present invention, a therapeutically effective dose of a provided composition, when administered regularly, results in an increase in DNAH5 protein expression or activity levels in a subject compared to baseline DNAH5 protein expression or activity levels before treatment. Typically, DNAH5 protein expression or activity levels are measured in a biological sample obtained from the subject, such as blood, plasma or serum, urine, or a solid tissue extract. In some embodiments, administration of a provided composition results in detectable DNAH5 expression in the liver. In some embodiments, administration of a provided composition increases DNAH5 protein expression or activity levels in a biological sample (e.g., plasma / serum or urine) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels before treatment. In some embodiments, administration of provided compositions increases DNAH5 protein expression or activity levels in a biological sample (e.g., plasma / serum or urine) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels before treatment for at least 24 hours, at least 48 hours, at least 72 hours, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, or at least 15 days.

[0252] In some embodiments, the therapeutic dose is sufficient to at least somewhat stabilize, improve, or eliminate symptoms or other indicators, such as biomarkers, selected by one of skill in the art as appropriate measures of disease progression, regression, or improvement.

[0253] Suitable routes of administration include, for example, oral, rectal, vaginal, transmucosal, pulmonary, including intratracheal or inhalation administration, or intestinal administration, parenteral delivery, including intradermal, transdermal (topical), intramuscular, subcutaneous, intramedullary injection, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal.

[0254] In some embodiments, a therapeutically effective dose comprising mRNA encoding a dynein axonemal heavy chain protein is administered to a subject by intramuscular administration.

[0255] In some embodiments, a therapeutically effective dose comprising mRNA encoding a dynein axoneme heavy chain protein is administered to a subject by subcutaneous administration.

[0256] In certain embodiments, intramuscular administration is into a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, administration results in delivery of mRNA to muscle cells. In some embodiments, administration results in delivery of mRNA to hepatocytes (i.e., liver cells). In certain embodiments, intramuscular administration results in delivery of mRNA to muscle cells.

[0257] Most commonly, a therapeutically effective dose comprising mRNA encoding a dynein axonemal heavy chain protein is administered to a subject by intravenous administration.

[0258] Alternatively or additionally, the liposome-encapsulated mRNA and compositions of the present invention can be administered locally rather than systemically, for example, by directly injecting the pharmaceutical composition into the target tissue, preferably in a sustained-release formulation. Local delivery can be achieved in various ways depending on the tissue to be targeted. For example, an aerosol containing the compositions of the present invention can be inhaled (in the case of nasal, tracheal, or bronchial delivery), the compositions of the present invention can be injected, for example, at the site of injury, disease symptoms, or pain, the compositions can be provided in a lozenge for oral, tracheal, or esophageal use, in liquid, tablet, or capsule form for gastric or intestinal administration, in suppository form for rectal or vaginal use, or can be delivered to the eye using a cream, droplet, or even injection. Formulations containing the provided compositions complexed with therapeutic molecules or ligands can also be administered surgically, for example, in combination with a polymer or other structure or substance that allows the composition to diffuse from the implantation site to surrounding cells. Alternatively, they can be applied surgically without the use of a polymer or support.

[0259] In certain embodiments, the DNA encoding the mRNA H5 is administered intravenously, and the intravenous administration is associated with delivery of the mRNA to hepatocytes.

[0260] In some embodiments, a therapeutically effective dose comprising mRNA encoding a dynein axoneme heavy chain protein is administered for proper delivery to the liver of a mammal, hi some embodiments, a therapeutically effective dose comprising mRNA encoding a dynein axoneme heavy chain protein is administered for proper expression in hepatocytes of the administered mammal.

[0261] The provided methods of the present invention contemplate single administration as well as multiple administrations of a therapeutically effective amount of a therapeutic agent (e.g., an mRNA encoding a DNAH5 protein) described herein. The therapeutic agent may be administered at regular intervals depending on the nature, severity, and extent of the subject's condition (e.g., PCD). In some embodiments, a therapeutically effective amount of a therapeutic agent (e.g., an mRNA encoding a DNAH5 protein) of the present invention may be administered intrathecally periodically at regular intervals (e.g., once a year, once every six months, once every five months, once every three months, every other month (every two months), monthly (every month), every other week (every two weeks), twice a month, once every 30 days, once every 28 days, once every 14 days, once every 10 days, once every 7 days, weekly, twice a week, daily, or continuously).

[0262] In some embodiments, the provided liposomes and / or compositions are formulated for sustained release of the mRNA contained therein. Such sustained-release compositions can be administered to a subject at extended dosing intervals as needed. For example, in one embodiment, the compositions of the present invention are administered to a subject twice a day, daily, or every other day. In some embodiments, the compositions of the present invention are administered to a subject twice a week, once a week, once every 7 days, once every 10 days, once every 14 days, once every 28 days, once every 30 days, once every two weeks, once every three weeks, once every four weeks, once a month, twice a month, once every six weeks, once every eight weeks, once every two months, once every three months, once every four months, once every six months, once every eight months, once every nine months, or annually.

[0263] In a preferred embodiment, the compositions of the present invention are administered to a subject once a week, once every two weeks, or once a month. In a more preferred embodiment, the compositions of the present invention are administered to a subject once a week or once a month. In a most preferred embodiment, the compositions of the present invention are administered to a subject once a month.

[0264] In some embodiments, the mRNA is administered simultaneously with an additional therapy.

[0265] Also contemplated are compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) to either deliver or release mRNA over an extended period of time. Preferably, the sustained release means employed is combined with modifications made to the mRNA to enhance stability.

[0266] A therapeutically effective amount is generally administered in a dosing regimen that may include multiple unit doses. For any particular therapeutic protein, the therapeutic effect (and / or appropriate unit dose within an effective dosing regimen) may vary, for example, depending on the route of administration and in combination with other pharmaceutical agents. Additionally, the specific therapeutically effective amount (and / or unit dose) for any particular patient may depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the particular pharmaceutical agent employed; the particular composition employed; the patient's age, weight, general health, sex, and diet; the time of administration, route of administration, and / or excretion or metabolic rate of the particular protein employed; the duration of treatment; and similar factors well known in the medical field. According to the present invention, a therapeutically effective dose of a provided composition, when administered regularly, reduces the intensity, severity, or frequency of, or delays the onset of, at least one symptom or characteristic of PCD.

[0267] Also contemplated herein are lyophilized pharmaceutical compositions comprising one or more of the liposomes disclosed herein, and related methods for using such compositions, e.g., as disclosed in International Patent Application PCT / US12 / 41663, filed June 8, 2012. The teachings of this application are incorporated herein by reference in their entirety. For example, lyophilized pharmaceutical compositions according to the present invention can be reconstituted prior to administration or reconstituted in vivo. For example, lyophilized pharmaceutical compositions can be formulated into an appropriate dosage form (e.g., an intradermal dosage form such as a disk, rod, or membrane) and administered such that the dosage form is rehydrated in vivo over time by the individual's body fluids.

[0268] In some embodiments, the pharmaceutical composition comprises a lyophilized liposome delivery vehicle comprising a cationic lipid, a non-cationic lipid, a PEG-modified lipid, and cholesterol.In some embodiments, the pharmaceutical composition has a Dv50 of less than 500nm, 300nm, 200nm, 150nm, 125nm, 120nm, 100nm, 75nm, 50nm, 25nm or less upon reconstitution.In some embodiments, the pharmaceutical composition has a Dv90 of less than 750nm, 700nm, 500nm, 300nm, 200nm, 150nm, 125nm, 100nm, 75nm, 50nm, 25nm or less upon reconstitution. In some embodiments, the pharmaceutical composition upon reconstitution has a polydispersity index value of less than 1, 0.95, 0.9, 0.8, 0.75, 0.7, 0.6, 0.5, 0.4, 0.3, 0.25, 0.2, 0.1, 0.05 or less, hi some embodiments, the pharmaceutical composition upon reconstitution has an average particle size of 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, 25 nm or less.

[0269] In some embodiments, the lyophilized pharmaceutical composition further comprises one or more lyoprotectants, such as sucrose, trehalose, dextran, or inulin. Typically, the lyoprotectant is sucrose. In some embodiments, the pharmaceutical composition is stable for at least 1 month or at least 6 months when stored at 4° C., or for at least 6 months when stored at 25° C. In some embodiments, the biological activity of the mRNA in the reconstituted lyophilized pharmaceutical composition is greater than 75% of the biological activity observed before lyophilization of the composition.

[0270] The provided liposomes and compositions can be administered to any desired tissue.In some embodiments, the DNAH5 mRNA delivered by the provided liposomes or compositions is expressed in the tissue to which the liposomes and / or compositions are administered.In some embodiments, the delivered mRNA is expressed in a tissue different from the tissue to which the liposomes and / or compositions are administered.Examples of tissues that the delivered mRNA can be delivered to and / or expressed include, but are not limited to, the liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph node, skin, and / or cerebrospinal fluid.

[0271] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit particular medical needs, hi some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, or 1 month after administration of provided liposomes and / or compositions.

[0272] In some embodiments, a therapeutically effective dose of a provided composition, when administered regularly, results in a decrease in methylmalonic acid levels in a subject compared to baseline methylmalonic acid levels before treatment.

[0273] In some embodiments, administration of a provided composition increases the level of DNAH5 protein in liver cells (e.g., hepatocytes) of a subject compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition increases the level of DNAH5 protein in liver cells by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition increases the level of DNAH5 protein in liver cells compared to the level of DNAH5 protein in liver cells of a subject not treated.

[0274] In some embodiments, administration of a provided composition increases the level of DNAH5 protein in the subject's plasma or serum compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition increases the level of DNAH5 protein in the plasma or serum by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition increases the level of DNAH5 protein in the plasma or serum compared to the level of DNAH5 protein in the plasma or serum of a subject not receiving treatment.

[0275] In some embodiments, administration of a provided composition increases DNAH5 enzyme activity in a biological sample from a subject compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., liver). In some embodiments, administration of a provided composition increases DNAH5 enzyme activity by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition increases DNAH5 enzyme activity compared to the DNAH5 enzyme activity of a subject not receiving treatment.

[0276] In some embodiments, the subject is a mammal. In some embodiments, the mammal is an adult. In some embodiments, the mammal is an adolescent. In some embodiments, the mammal is an infant or juvenile mammal. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the subject is between 6 and 80 years old. [Example]

[0277] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the present invention and are not intended to limit it.

[0278] Example 1. Examples of liposome formulations for delivery and expression of DNAH5 mRNA This example provides an example of a liposome formulation for effective delivery and expression of hDNAH5 mRNA in vivo.

[0279] lipid material The formulations described in the following examples, unless otherwise noted, contain multi-component lipid mixtures using one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), and PEGylated lipids in various ratios designed to encapsulate human dynein axoneme heavy chain 5 (hDNAH5) mRNA. Unless otherwise specified, the multi-component lipid mixture used in the following examples was an ethanol solution of imidazole cholesterol ester ("ICE") cationic lipid, a non-cationic lipid such as DOPE, and a PEGylated lipid such as DMG-PEG2K. messenger RNA material

[0280] Codon-optimized hDNAH5 messenger RNA was synthesized by in vitro transcription from a plasmid DNA template encoding the gene. After in vitro transcription, a 5' cap structure (Cap1) (Fechter, P. Brownlee, GG, "Recognition of mRNA cap structures by viral and cellular proteins" J. Gen. Virology 2005, 86, 1239-1249) and a 3' poly(A) tail were added. The poly(A) tail averaged approximately 135 nucleotides in length. The 5' and 3' untranslated regions present in each mRNA product are designated X and Y, respectively, and are defined as described (see below). Codon-optimized hDNAH5 mRNA: X-Code Region-Y 5' and 3' UTR sequences X(5'UTR sequence) = AGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO:2] or GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 3] Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 4] or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU [SEQ ID NO: 5]

[0281] Code Region The MRT-1 codon-optimized hDNAH5 messenger RNA coding region comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. A 3'-GFP tagged version of MRT-1 codon-optimized hDNAH5, MRT-hDNA5-GFP, was also prepared using molecular cloning techniques well known in the art.

[0282] Formulation Protocol hDNAH5 mRNA was encapsulated in multicomponent liposomes at an N / P ratio of approximately 10, as described in WO2018 / 089790, published May 17, 2018 (hereby incorporated by reference).

[0283] Example 2. Administration and delivery of hDNAH5 mRNA to the lungs and expression of hDNAH5 protein in vivo This example demonstrates an exemplary method for administering hDNAH5 mRNA-loaded liposomal nanoparticles and for analyzing the mRNA delivered to the lung epithelium in vivo and the subsequently expressed hDNAH5 protein.

[0284] The study in this example was conducted using male 129S1 / SvimJ mice approximately 10-12 weeks old. Three groups of mice (n=5 each) were exposed to a single intratracheal aerosol administration of the test substance (Groups 1 and 2) or control via a Microsprayer® (50 μL / animal). The test substance in Group 1 was MRT-1 hDNAH5 mRNA at 10 μg / animal, prepared as described in Example 1. The test substance in Group 2 was hDNAH5-GFP mRNA (i.e., a sequence containing both MRT1 hDNAH5 mRNA and green fluorescent protein (GFP) mRNA) at 10 μg / animal (unless otherwise specified), prepared as described in Example 1. Controls included either saline administered at the same dose as the test substance, or an unrelated mRNA in the same delivery vehicle. Mice were euthanized 24 hours (±5%) after administration.

[0285] Separation of plasma for analysis All animals were euthanized by isoflurane overdose via a nose cone, followed by thoracotomy and terminal blood collection. Whole blood (maximum obtainable amount) was collected via cardiac puncture from euthanized animals and discarded. Animals were then perfused with saline.

[0286] Isolation of organ tissue for analysis After perfusion, the liver and entire airway (trachea to lungs) of each mouse were harvested. The entire airway was dissected from the upper trachea to the lungs and then cut sagittally to obtain left and right sections of the entire airway. Figure 1A shows the lung dissection scheme. The left section of the entire airway was fixed in buffer for subsequent immunohistochemical and histological analysis. The right section of the entire airway was snap-frozen and stored at -70°C for subsequent qPCR analysis of the trachea (1), upper lobe (2), middle lobe (3), lower lobe (4), and post-caval lobe (5). The liver was also snap-frozen and stored at -70°C.

[0287] qPCR assay Mouse tracheas and lung lobes were homogenized in the presence of Trizol to completely lyse them, and then RNA was extracted using silica membrane-based spin columns. mRNA levels are determined using RT-qPCR. First, purified RNA is reverse transcribed (RT) into cDNA using random primers. PCR reactions are then performed using sequence-specific primers and quantified in real time using TaqMan fluorophore probes (qPCR). Purified in vitro transcribed hDNAH5 run as a reference in the qPCR assay is used to generate a standard curve and calculate the number of hDNAH5 copies per milligram of tissue analyzed. The results of the qPCR analysis are shown in Figure 1B.

[0288] Immunohistochemistry (IHC) analysis - DNAH5 or GFP hDNAH5 and GFP proteins in the trachea and lung were characterized by IHC staining. Briefly, harvested tissues were fixed in formalin and embedded in paraffin blocks. Longitudinal sections (5 microns thick) of the tissue were mounted on glass slides for staining. Antigen retrieval was performed using an EDTA-based buffer, followed by blocking with hydrogen peroxide and goat serum. Primary antibodies against hDNAH5 (Ab122390) and GFP (Ab290) were incubated with the respective samples overnight at 4°C. Enzyme-conjugated secondary antibodies were used to detect bound primary antibodies. Images of the stained slides were captured at 20X magnification. The results of the IHC analysis are shown in Figure 2.

[0289] result This example demonstrates the successful in vivo administration, delivery, and expression of therapeutic mRNAs over 10 kb in size. Specifically, in this example, hDNAH5 mRNA, a 14 kb mRNA, was encapsulated, administered by nebulization, and successfully delivered to the lungs in vivo. Figure 1B provides qPCR data demonstrating successful hDNAH5 mRNA deposition in cells of the trachea (1), upper lobe (2), middle lobe (3), lower lobe (4), and post-caval lobe (5) for each of mice in groups 1 and 2. Figure 2A provides exemplary IHC images showing positive staining for hDNAH5 protein expressed from hDNAH5 mRNA lung tissues of mice in groups 1 and 2. Additionally, Figure 2B shows IHC images, from top to bottom (left to right in Figure 2B), of positive staining for hDNAH5 protein in tracheal tissues and whole lung tissues of mice in groups 1 and 2.

[0290] Exemplary Sequences Exemplary codon-optimized mRNA sequences are shown in SEQ ID NOs: 6 to 31. For purposes of sequence disclosure, U and T are used interchangeably.

[0291] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. An mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) for delivering human DNAH5 in vivo, The mRNA is administered to a subject in need thereof; The mRNA, wherein the mRNA comprises a coding sequence that is SEQ ID NO:

7.

2. 1. An mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) for treating primary ciliary dyskinesia (PCD), comprising: the mRNA is administered to a subject in need of treatment at an effective dose and at an effective interval such that at least one symptom or characteristic of a PCD is reduced in intensity, severity, or frequency, or its onset is delayed; The mRNA comprises a coding sequence which is SEQ ID NO:

7.

3. The mRNA of claim 1 or claim 2, wherein the DNAH5 mRNA is encapsulated in a liposome.

4. The mRNA of claim 3, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

5. The one or more cationic lipids are cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole cholesterol ester), HGT5000, HGT5001, HGT4003, DDAB, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP , DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2 5. The mRNA of claim 4, wherein the mRNA is selected from the group consisting of (2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, and combinations thereof.

6. The mRNA of claim 5, wherein the cationic lipid is ICE (imidazole cholesterol ester).

7. 7. The mRNA of any one of claims 4 to 6, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), or a combination thereof.

8. The one or more PEG-modified lipids are 6 -C 20 Lipids with long alkyl chains The mRNA of any one of claims 4 to 7, comprising a covalently attached poly(ethylene) glycol chain of up to 5 kDa in length.

9. The cationic lipid comprises 30 to 60% of the liposome by molar ratio.

9. The mRNA according to any one of 4 to 8.

10. 10. The mRNA of claim 9, wherein the cationic lipid comprises 30%, 40%, 50%, or 60% of the liposome by molar ratio.

11. The mRNA according to any one of claims 3 to 10, wherein the liposome comprises ICE (imidazole cholesterol ester), DOPE, and DMG-PEG2K.

12. The mRNA of any one of claims 3 to 11, wherein the liposome has a diameter of 80 nm to 200 nm.

13. The mRNA of any one of claims 3 to 11, wherein the liposome has a diameter of 100 nm or less than 100 nm.

14. The mRNA of any one of claims 1 to 13, wherein the DNAH5 mRNA is codon-optimized.

15. The mRNA of any one of claims 1 to 14, wherein the DNAH5 mRNA comprises one or more modified nucleotides.

16. 16. The mRNA of claim 15, wherein the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.

17. The mRNA of any one of claims 1 to 13, wherein the mRNA is unmodified.

18. The mRNA according to any one of claims 1 to 17, wherein the mRNA comprises a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO: 2 or 3.

19. The mRNA has a 3'-untranslated region (3' The mRNA according to any one of claims 1 to 18, comprising a nucleotide sequence identical to that of the mRNA of claim 1, ...

20. The mRNA of any one of claims 1 to 19, wherein the mRNA is administered to the subject by intratracheal delivery, intranasal delivery, intravenous delivery, intramuscular delivery, or subcutaneous delivery.

21. The mRNA according to any one of claims 1 to 20, wherein the administration of the mRNA to the subject is carried out by intratracheal delivery.

22. The mRNA of any one of claims 1 to 20, wherein the administration of the mRNA to the subject is carried out by intranasal delivery.

23. The mRNA of any one of claims 1 to 22, wherein the mRNA is administered once a day.

24. The mRNA of any one of claims 1 to 22, wherein the mRNA is administered once a week.

25. The mRNA of any one of claims 1 to 22, wherein the mRNA is administered once every two weeks.

26. The mRNA of any one of claims 1 to 22, wherein the mRNA is administered twice a month.

27. The mRNA of any one of claims 1 to 22, wherein the mRNA is administered once a month.

28. 28. The mRNA of any one of claims 1 to 27, wherein administration of the mRNA results in detectable expression of DNAH5 protein in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis.

29. The mRNA of any one of claims 1 to 28, wherein administration of the mRNA results in detectable DNAH5 protein expression in the lung.

30. The mRNA of any one of claims 1 to 29, wherein administration of the mRNA results in detectable DNAH5 protein expression in the lung epithelium.

31. A method for delivering human DNAH5 for in vivo tracheal expression, comprising administering mRNA encoding human axonal dynein heavy chain 5 (DNAH5) to a subject in need thereof, wherein the mRNA is encapsulated in a liposome; The liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; The mRNA is administered by aerosol at an interval of at least once a week, twice a week, or once a day so that DNAH5 expression is maintained in the trachea; The mRNA comprises the coding sequence of SEQ ID NO:

7.

32. A method for delivering human DNAH5 for in vivo tracheal expression, comprising administering mRNA encoding human axonal dynein heavy chain 5 (DNAH5) to a subject in need thereof, wherein the mRNA is encapsulated in a liposome; The liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; the mRNA is administered by aerosol at an administration interval of at least once a week, twice a week, or once a day so as to result in detectable expression of DNAH5 encoded by the mRNA in the trachea within at least 24 hours of the first administration; The mRNA comprises the coding sequence of SEQ ID NO:

7.

33. 33. The mRNA of claim 31 or 32, wherein the liposome comprises one or more cholesterol-based lipids.

34. The mRNA of any one of claims 31 to 33, wherein said administration results in DNAH5 expression in the lung.

35. The mRNA of any one of claims 31 to 34, wherein the liposome has a diameter of 80 nm to 200 nm.

36. 36. The mRNA of claim 35, wherein the liposome has a diameter of 100 nm or less.

37. The mRNA according to any one of claims 31 to 36, wherein the cationic lipid constitutes 30% to 60% of the liposome by molar ratio.

38. The mRNA according to any one of claims 31 to 37, wherein the mRNA encoding the human DNAH5 protein is codon-optimized.

39. The mRNA encoding the human DNAH5 protein according to any one of claims 31 to 37, wherein the mRNA comprises one or more modified nucleotides.

40. A composition comprising mRNA encoding human axonal dynein heavy chain 5 (DNAH5), wherein the composition is encapsulated in a liposome for delivery of human DNAH5 for in vivo tracheal expression, and the composition is administered to a subject in need thereof; The liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; The mRNA is administered by aerosol at an interval of at least once a week, twice a week, or once a day so that DNAH5 expression is maintained in the trachea; The composition, wherein the mRNA comprises the coding sequence of SEQ ID NO:

7.

41. A composition comprising mRNA encoding human axonal dynein heavy chain 5 (DNAH5), wherein the composition is encapsulated in a liposome for delivery of human DNAH5 for in vivo tracheal expression, and the composition is administered to a subject in need thereof; The liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; The mRNA is administered for at least 1 week, such that detectable expression of DNA H5 encoded by the mRNA occurs in the trachea within at least 24 hours of the first administration. It is administered by nebulization at intervals of once a week, twice a week, or once a day. The composition, wherein the mRNA comprises the coding sequence of SEQ ID NO:

7.

42. 42. The composition of claim 40 or 41, wherein the liposome comprises one or more cholesterol-based lipids.

43. 43. The composition of any one of claims 40 to 42, wherein said administration results in DNAH5 expression in the lung.

44. 44. The composition of any one of claims 40 to 43, wherein the liposomes have a diameter of 80 nm to 200 nm.

45. 45. The composition of claim 44, wherein the liposome has a diameter of 100 nm or less.

46. 46. ​​The composition of any one of claims 40 to 45, wherein the cationic lipid constitutes 30% to 60% of the liposome by molar ratio.

47. The composition of any one of claims 40 to 46, wherein the mRNA encoding the human DNAH5 protein is codon-optimized.

48. 48. The composition of any one of claims 40 to 47, wherein the mRNA encoding human DNAH5 protein comprises one or more modified nucleotides.

49. 1. A composition comprising mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) protein for delivering human DNAH5 in vivo, comprising: The composition is administered to a subject in need thereof; The composition, wherein the mRNA comprises the coding sequence set forth in SEQ ID NO:

7.

50. 1. A composition for treating primary ciliary dyskinesia (PCD), comprising mRNA encoding human axonemal dynein heavy chain 5 (DNAH5), The composition is characterized in that it is administered to a subject in need of treatment at an effective dose and at an administration interval of mRNA such that at least one symptom or characteristic of a PCD is reduced in intensity, severity, or frequency or delayed in onset; The composition, wherein the mRNA comprises the coding sequence set forth in SEQ ID NO:

7.

51. 51. The composition of claim 49 or claim 50, wherein the DNAH5 mRNA is encapsulated in a liposome.

52. 52. The composition of claim 51, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

53. The one or more cationic lipids may be selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinC2DMA, ICE (imidazole cholesterol ester), HGT5000, HGT5001, HGT4003, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl) 53. The composition of claim 52, wherein the compound is selected from the group consisting of 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, and combinations thereof.

54. 54. The composition of claim 53, wherein the cationic lipid is ICE (imidazole cholesterol ester).

55. 55. The composition of any one of claims 49-54, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), or a combination thereof.

56. The one or more PEG-modified lipids are 6 -C 20 Lipids with long alkyl chains 56. The composition of any one of claims 52 to 55, comprising a covalently attached poly(ethylene) glycol chain of up to 5 kDa in length.

57. 57. The composition of any one of claims 49 to 56, wherein the cationic lipid comprises 30 to 60% of the liposome by molar ratio.

58. 58. The composition of claim 57, wherein the cationic lipid comprises 30%, 40%, 50%, or 60% of the liposome by molar ratio.

59. 59. The composition of any one of claims 49 to 58, wherein the liposome comprises ICE (imidazole cholesterol ester), DOPE, and DMG-PEG2K.

60. 60. The composition of any one of claims 51 to 59, wherein the liposomes have a diameter of 80 nm to 200 nm.

61. 60. The composition of any one of claims 51 to 59, wherein the liposomes have a diameter of 100 nm or less.

62. 62. The composition of any one of claims 50 to 61, wherein the DNAH5 mRNA is codon-optimized.

63. 63. The composition of any one of claims 50 to 62, wherein the DNAH5 mRNA comprises one or more modified nucleotides.

64. the one or more modified nucleotides are pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8- 64. The composition of claim 63, wherein the amino acid is selected from oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.

65. 62. The composition of any one of claims 50 to 61, wherein the mRNA is unmodified.

66. 66. The composition of any one of claims 50 to 65, wherein the mRNA comprises a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO: 2 or 3.

67. The composition of any one of claims 50 to 66, wherein the mRNA comprises a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO: 4 or 5.

68. 68. The composition of any one of claims 50 to 67, wherein the composition is administered to the subject by intratracheal, intranasal, intravenous, intramuscular, or subcutaneous delivery.

69. The composition of any one of claims 50 to 68, wherein the composition is administered to the subject by intratracheal delivery.

70. The composition of any one of claims 50 to 68, wherein the composition is administered to the subject by intranasal delivery.

71. The composition of any one of claims 50 to 70, wherein the composition is administered once a day.

72. 71. The composition of any one of claims 50 to 70, wherein the composition is administered once a week.

73. 71. The composition of any one of claims 50 to 70, wherein the composition is administered once every two weeks.

74. 71. The composition of any one of claims 50 to 70, wherein the composition is administered twice a month.

75. 71. The composition of any one of claims 50 to 70, wherein the composition is administered once a month.

76. 76. The composition of any one of claims 50 to 75, wherein administration of the composition results in detectable expression of DNAH5 protein in one or more internal organs selected from lung, heart, liver, spleen, kidney, brain, stomach, intestine, ovary, and testis.

77. 77. The composition of any one of claims 50 to 76, wherein administration of the composition results in detectable DNAH5 protein expression in the lung.

78. 78. The composition of any one of claims 50 to 77, wherein administration of the composition results in detectable DNAH5 protein expression in the lung epithelium.

79. 1. A composition for use in treating primary ciliary dyskinesia (PCD), the composition comprising mRNA encoding human axonemal dynein heavy chain 5 (DNAH5) encapsulated in a liposome; the liposome comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; The composition, wherein the mRNA comprises the coding sequence set forth in SEQ ID NO:

7.

80. 80. The composition of claim 79, wherein the mRNA has a 5'-untranslated region (5'-UTR) having the sequence set forth in SEQ ID NO: 2, and a 3'-untranslated region (3'-UTR) having the sequence set forth in SEQ ID NO: 4 or 5.

81. 81. The composition of claim 79 or 80, wherein the mRNA comprises one or more modified nucleotides.

82. 82. The composition of claim 81, wherein the one or more modified nucleotides are selected from pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine.

83. 81. The composition of claim 79 or 80, wherein the mRNA is unmodified.

84. 84. The composition of any one of claims 79 to 83, wherein the liposomes have a diameter of 100 nm or less.

85. The one or more cationic lipids may be selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinC2DMA, ICE (imidazole cholesterol ester), HGT5000, HGT5001, HGT4003, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4 85. The composition of any one of claims 79-84, wherein the compound is selected from the group consisting of -(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), ccBene, and combinations thereof.

86. 86. The composition of any one of claims 79 to 85, wherein the cationic lipid is ICE (imidazole cholesterol ester).

87. 87. The composition of any one of claims 79-86, wherein the one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), or a combination thereof.

88. 88. Any of claims 79 to 87, wherein the one or more non-cationic lipids are DOPE. The composition according to any one of claims 1 to 4.

89. The one or more PEG-modified lipids may be C 6 -C 20 89. The composition of any one of claims 79 to 88, comprising poly(ethylene) glycol chains up to 5 kDa in length covalently attached to lipids having long alkyl chain(s).

90. A pharmaceutical composition comprising the composition of any one of claims 79 to 89 and an excipient.

Images