Formulations containing high-concentration VEGF receptor fusion proteins

High-concentration VEGF receptor fusion protein formulations with specific buffers and surfactants address stability and viscosity issues, enabling efficient ocular administration and improved manufacturing.

JP7791125B2Active Publication Date: 2025-12-23REGENERON PHARMACEUTICALS INC
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2023026852
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-03-05
Filing Date
2023-02-24
Publication Date
2025-12-23
Estimated Expiration
2039-05-10

AI Technical Summary

Technical Problem

Developing high-concentration antibody formulations, particularly those containing vascular endothelial growth factor (VEGF) receptor fusion proteins, is challenging due to issues with protein aggregation, increased viscosity, and reduced stability, which affect efficacy and manufacturing efficiency.

Method used

Formulations comprising VEGF receptor fusion proteins with specific buffers, thermal stabilizers, and surfactants maintain pharmaceutically acceptable pH and viscosity, allowing for concentrations up to 275 mg/ml, with optional inclusion of viscosity-lowering agents like arginine hydrochloride.

Benefits of technology

The formulations provide stable, high-concentration VEGF receptor fusion proteins suitable for ocular administration, reducing injection volume and frequency, enhancing manufacturing and storage stability, and minimizing ocular effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007791125000041
    Figure 0007791125000041
  • Figure 0007791125000042
    Figure 0007791125000042
  • Figure 0007791125000043
    Figure 0007791125000043
Patent Text Reader

Abstract

Ophthalmic formulations are provided that have high concentrations of vascular endothelial growth factor (VEGF) receptor fusion proteins and have high stability during storage. Methods for treating intraocular neovascular disorders using the high concentration formulations are also provided. [Solution] The aqueous pharmaceutical formulation comprises a VEGF receptor fusion protein, an anti-VEGF antibody or antigen-binding fragment, or a VEGF-binding molecule at a concentration of at least about 100 mg / ml, about 5% sucrose, a histidine buffer, and about 0.03% surfactant, optionally in association with an additional therapeutic agent, and the formulation has a pH of about 5.0 to about 6.8.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims the benefit of U.S. Provisional Patent Application No. US62 / 813,882, filed March 5, 2019, U.S. Provisional Patent Application No. US62 / 769,876, filed November 20, 2018, U.S. Provisional Patent Application No. US62 / 752,127, filed October 29, 2018, and U.S. Provisional Patent Application No. US62 / 669,506, filed May 10, 2018, each of which is incorporated herein by reference in its entirety.

[0002]

[0003] Embodiments herein generally relate to formulations containing high concentrations of VEGF receptor fusion proteins suitable for ocular administration. More specifically, embodiments herein provide liquid pharmaceutical formulations for intravitreal administration, which formulations contain greater than 40 mg / ml of VEGF receptor fusion protein and exhibit pharmaceutically acceptable potency, stability, viscosity, and pH.

[0003] Sequence Listing An official copy of the sequence description will be submitted electronically via EFS-Web concurrently with the specification as an ASCII sequence listing approximately 7 KB in size with the filename "10430P1-US_SEQ_LIST_ST25.txt" created on May 9, 2018. The sequence description contained in this ASCII document is a part of the specification and is incorporated herein by reference in its entirety. [Background technology]

[0004] Developing therapeutically useful liquid formulations requires the combination of different amounts of components to provide a functional and stable delivery vehicle for the drug of interest. This is particularly true when the drug is a protein, especially an antibody. Antibody formulations have long presented challenges to drug developers and manufacturers because antibody activity and administration typically require pharmaceutically acceptable potency, osmolality, protein stability, viscosity, and appropriate pH. These challenges are exacerbated when antibodies are used at higher concentrations in the formulation, e.g., above 20–40 mg / ml, the concentration of most commercially available antibodies.

[0005] Higher-concentration antibody formulations allow for shorter injection times, smaller injection volumes, lower antibody administration frequency, and more efficient manufacturing and storage utility. However, as mentioned above, the higher the antibody or protein concentration, the more difficult it is to maintain the appropriate activity and delivery parameters of the formulation. In particular, high-concentration antibody and protein formulations often suffer from protein aggregation and increased viscosity, resulting in reduced overall antibody or protein efficacy, reduced manufacturing, and reduced storage stability. Due to the problems associated with high-concentration protein or antibody formulations, few pharmaceutically acceptable formulations have been developed. There is a need in the art for preparing high-concentration, highly stable antibody and protein formulations with appropriate efficacy, stability, viscosity, osmolality, and pH.

[0006] One such protein requiring a high-concentration formulation is a vascular endothelial growth factor (VEGF) receptor fusion protein. VEGF receptor fusion proteins are used to block VEGF function in many ophthalmic formulations, such as EYLEA® (Regeneron Pharmaceuticals, Inc.). High-concentration VEGF receptor fusion protein-containing formulations may allow for shorter ocular injection times, smaller injection volumes, fewer possible injections per administration cycle, and more efficient manufacturing and storage.

[0007] The present invention is directed to overcoming one or more of the problems discussed above. Summary of the Invention

[0008] Various embodiments described herein encompass high-concentration protein-containing formulations (e.g., suitable for intravitreal administration), particularly high-concentration vascular endothelial growth factor (VEGF) receptor fusion protein-containing formulations. High-concentration VEGF receptor fusion protein-containing formulations offer numerous therapeutic and economic benefits, including pharmaceutically acceptable efficacy, long-term manufacturing and storage stability, and viscosity and pH compatible with ocular injection. High-concentration VEGF receptor fusion protein-containing formulations also allow for a reduced ocular administration volume, an advantage that avoids undesirable effects on the eye with limited volume.

[0009] Embodiments herein provide formulations comprising a VEGF receptor fusion protein, a buffer, a thermal stabilizer, a viscosity-lowering agent, and a surfactant. In other embodiments, the formulation does not contain a viscosity-lowering agent. The formulations of the present invention have a pH and viscosity suitable for injection, particularly therapeutic ocular injection.

[0010] In embodiments of the invention, pharmaceutical formulations of the invention are provided having a concentration or concentrations of VEGF receptor fusion protein (as discussed herein) of at least 41 mg / ml, comprising a single dose of less than about 100 μl, less than about 50 μl, about 50 μl, about 57 μl, about 60 μl, about 70 μl, or about 75 μl of VEGF receptor fusion protein, a buffer, optionally a thermal stabilizer and / or a viscosity-reducing agent, a surfactant, wherein the formulation has a pH of about 5.0 to about 6.8 (e.g., 5.8).

[0011] In one embodiment of the present invention, the VEGF receptor fusion protein concentration is about 30 mg / ml, 60 mg / ml, 114 mg / ml, 120 mg / ml or 140 mg / ml.

[0012] In one embodiment of the present invention, the surfactant may be a nonionic surfactant (e.g., about 0.02% to about 0.1%, or about 0.03% (w / v)). In one embodiment of the present invention, the surfactant is a nonionic surfactant having a polyoxyethylene moiety, such as polysorbate 20 (PS20), polysorbate 80 (PS80), poloxamer 188, polyethylene glycol 3350, or a mixture thereof.

[0013] In one embodiment of the present invention, the buffer is a histidine-based buffer (e.g., 10 mM or 20 mM) such as histidine, histidine HCl, or histidine acetate; a phosphate-based buffer (e.g., 10 mM) such as sodium phosphate; an acetate-based buffer (e.g., sodium acetate and acetic acid); or a citrate-based buffer (e.g., sodium citrate and citric acid). In one embodiment of the present invention, when the buffer is a phosphate buffer, the pH is about 5.7 to about 8.0, about 5.8 to about 8.0, about 5.7 to about 7.0, about 5.8 to about 7.0, about 5.9 to about 7.0, or about 6.0 to about 7.0. When the buffer is a histidine buffer, the pH is about 5.5 to about 6.5. When the buffer is a citrate buffer, the pH is about 3.0 to about 6.2 or about 5.0 to about 6.0. When the buffer is an acetate buffer, the pH is about 3.7 to about 5.6 or about 5.0 to about 6.0.

[0014] In one embodiment of the present invention, the thermal stabilizer is a sugar such as sucrose (e.g., about 2.5%, 5%, or 8%, 10% or 20% (w / v), e.g., about 2-20%), mannitol, sorbitol, or trehalose, L-proline (e.g., about 2%, 3%, or 4% (w / v)), glycine (e.g., about 50 mM), glycerol, taurine (e.g., about 50 mM), or propanesulfonic acid (e.g., about 50 mM), or any combination of the above.

[0015] In some embodiments of the invention, the pharmaceutical formulations of the invention include a viscosity-lowering agent, such as arginine hydrochloride (e.g., L-arginine monohydrochloride) (e.g., 50 mM), lysine, sodium chloride (e.g., 40 mM or 50 mM), or magnesium chloride. Alternatively, in other embodiments, the formulations of the invention specifically exclude substantially all, if not all, viscosity-lowering agents.

[0016] In one embodiment of the present invention, a pharmaceutical formulation of the invention comprises, consists of, or consists essentially of the components of any one of Formulations A-KKKK described herein.

[0017] In aspects herein, pharmaceutical formulations of the invention may contain a VEGF receptor fusion protein (e.g., aflibercept or conbercept) at a concentration of about 41 mg / ml to about 275 mg / ml, about 80 mg / ml to about 275 mg / ml, about 140 mg / ml to about 159 or about 150 mg / ml, or about 80 mg / ml to about 100 mg / ml, including about 60 mg / ml, about 80 mg / ml, about 100 mg / ml, about 113.3 mg / ml, about 114.3 mg / ml, about 120 mg / ml, about 133.3 mg / ml, about 140 mg / ml, about 150 mg / ml, about 200 mg / ml, or about 250 mg / ml. In one embodiment of the invention, the formulation contains about 40 mg / ml of VEGF receptor fusion protein.

[0018] Some embodiments of the pharmaceutical formulations of the present invention contain a thermal stabilizer at a concentration of about 2% (w / v) to about 9% (w / v) or about 4% (w / v) to about 9%, provided that when the thermal stabilizer is taurine or propanesulfonic acid, the stabilizer is at a concentration of about 25 mM to about 100 mM, the surfactant is at a concentration of about 0.02% (w / v) to about 0.1% (w / v) (e.g., about 0.03%), and the buffer is at a concentration of about 5 mM to about 15 mM.

[0019] VEGF receptor fusion proteins include, for example: can be encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79 to 1374 or 79 to 1371 of SEQ ID NO: 1, may contain amino acids of SEQ ID NO: 2 or amino acids 27 to 457 or 27 to 458 of SEQ ID NO: 2, · (1) a VEGFR1 component comprising amino acids 27 to 129 of SEQ ID NO: 2; (2) a VEGFR2 component comprising amino acids 130 to 231 of SEQ ID NO: 2; (3) A multimerization component ("FcΔC1(a)") containing amino acids 232 to 457 or 458 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2, i.e., K458, may or may not be included in the VEGF receptor fusion protein). Amino acids 1 to 26 of SEQ ID NO: 2 may be comprising immunoglobulin-like (Ig) domain 2 of a first VEGF receptor (e.g., VEGFR1) and Ig domain 3 of a second VEGF receptor (e.g., VEGFR2), and optionally comprising Ig domain 4 of the second VEGF receptor (e.g., VEGFR2) and a multimerization component (e.g., an Fc domain of IgG); Conbercept, or Note the signal sequence of aflibercept. VEGF Trap atggtcagctactgggacaccggggtcctgctgtgcgcgctgctcagctgtctgcttctc acaggatctagttccggaagtgataccggtagacctttcgtagagatgtacagtgaaatc cccgaaattatacacatgactgaaggaagggagctcgtcattccctgccgggttacgtca cctaacatcactgttactttaaaaaagtttccacttgacactttgatccctgatggaaaa cgcataatctgggacagtagaaagggcttcatcatatcaaatgcaacgtacaaagaaata gggcttctgacctgtgaagcaacagtcaatgggcatttgtataagacaaactatctcaca catcgacaaaccaatacaatcatagatgtggttctgagtccgtctcatggaattgaacta tctgttggagaaaagcttgtcttaaattgtacagcaagaactgaactaaatgtggggatt gacttcaactgggaatacccttcttcgaagcatcagcataagaaacttgtaaaccgagac ctaaaaacccagtctgggagtgagatgaagaaatttttgagcaccttaactatagatggt gtaacccggagtgaccaaggattgtacacctgtgcagcatccagtgggctgatgaccaag aagaacagcacatttgtcagggtccatgaaaaggacaaaactcacacatgcccaccgtgc ccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggac accctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaa gaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagaca aagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctg caccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctccca gcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtac accctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtc aaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaac aactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaag ctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcat gaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga (SEQ ID NO: 1) MVSYWDTGVLLCALLSCLLLTGSSSGSDTGRPFVEMYSEIPEIIHMTEGRELVIPCRVTSPNITVTLKKFPLDTLIPDGKRIIWDSRKGFIISNATYKEIGLLTCEATVNGHLYKTNYLTHRQTNTIIDVVLSPSHGIELSVGEKLVLNCTARTELNVGIDFNWEYPSSKHQHKKLVNRDLKTQSGSEMKKFLSTLTIDGVTRSDQGLYTCAASSGLMTKKNSTFVRVHEKDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK (SEQ ID NO: 2) AA1 - 26 = Signal sequence AA27 - 129 = Flt1 - D2 (VEGFR1 - D2) AA130 - 231 = Flk1 - D3 (VEGFR2 - D3) AA232 - 458 = FcΔC1

[0020] Another embodiment of the present invention provides a container containing an aqueous solution of about 5 mM to about 25 mM of a pharmaceutically acceptable buffer, about 4% (w / v) to about 9% (w / v) of a pharmaceutically acceptable thermal stabilizer, about 0.02% (w / v) to about 0.1% (w / v) of a pharmaceutically acceptable surfactant, and about 41 mg / ml to about 275 mg / ml of a VEGF receptor fusion protein. When the thermal stabilizer includes either taurine or propanesulfonic acid, the taurine or propanesulfonic acid is present at a concentration of about 25 mM to about 100 mM. The aqueous solution has a pH of about 5.0 to about 6.8, and can be about 5.5 to about 6.2 (e.g., 5.8). In some embodiments, the container is a vial or syringe. In other embodiments, the aqueous solution does not contain inorganic salts. When the heat stabilizer is a sugar, it may be sucrose, mannitol, sorbitol, or trehalose and may be present at between about 4% (w / v) and 9% (w / v), and the surfactant may be a non-ionic surfactant and may contain a polyoxyethylene moiety such as polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350 at a concentration of about 0.02% to about 0.1% (w) weight per volume, more typically 0.02% to about 0.04% (w / v). In one embodiment of the invention, the VEGF receptor fusion protein is encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79-1374 or 79-1371 of SEQ ID NO: 1 and comprises amino acids of SEQ ID NO: 2 or amino acids 27-457 or 27-458 of SEQ ID NO: 2, and includes (1) a VEGFR1 component comprising amino acids 27-129 of SEQ ID NO: 2, (2) a VEGFR2 component comprising amino acids 130-231 of SEQ ID NO: 2, and (3) amino acids 232-457 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2). a multimerization component ("FcΔC1(a)") comprising a VEGF receptor fusion protein (e.g., a 5'-terminal end of a VEGF receptor, i.e., K458, which may or may not be included in the VEGF receptor fusion protein), comprising immunoglobulin-like (Ig) domain 2 of a first VEGF receptor (e.g., VEGFR1) and Ig domain 3 of a second VEGF receptor (e.g., VEGFR2), optionally further comprising Ig domain 4 of the second VEGF receptor (e.g., VEGFR2) and a multimerization component (e.g., an Fc domain of IgG), and is conbercept, or is aflibercept.

[0021] In yet another embodiment, a pharmaceutical formulation of the present invention is provided having a VEGF receptor fusion protein in an aqueous vehicle, wherein the aqueous vehicle has a viscosity of about 10 cP to about 15 cP at 20°C, more typically about 10 cP to about 13 cP at 20°C, and most typically about 11 cP to 12 cP at 20°C (e.g., about 6.0, 7.3, 11.5, or 12.0 cP at 20°C). In one embodiment of the present invention, the viscosity is about 12 cP to about 15 cP at 20°C. The pH of the formulation can be about 5.8 to about 6.5 (e.g., about 5.8). In some cases, the formulation does not contain a viscosity-lowering agent, e.g., arginine hydrochloride, lysine, sodium chloride, or magnesium chloride. In other cases, the formulation contains 10 mM histidine hydrochloride or 10 mM histidine acetate. The sugar may be sucrose, mannitol, sorbitol, or trehalose and may be present at between about 4% (w / v) and 9% (w / v) (e.g., about 5%), and the surfactant may be a non-ionic surfactant and may contain a polyoxyethylene moiety, such as polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, at a concentration of between about 0.02% and about 0.1% (w / v) weight per volume, more typically 0.02% to about 0.04% (w / v) (e.g., 0.03%). Additionally, the formulation may further contain a heat stabilizer selected from either taurine or propanesulfonic acid, at a concentration of between about 25 mM and about 100 mM, more typically about 50 mM to about 70 mM. In one embodiment of the present invention, the formulation comprises a VEGF receptor fusion protein such as aflibercept (e.g., about 41-275 mg / ml, about 50 mg / ml, about 100 mg / ml, about 115 mg / ml, about 125 mg / ml, about 150 mg / ml, about 200 mg / ml, or any of the "high" concentrations discussed herein), at a pH of about 5.8, about 10 mM histidine-based buffer, about 5% (w / v) sucrose, about 0.03% (w / v) non-ionic surfactant such as a polysorbate, e.g., polysorbate 20, and about 50 mM arginine, L-arginine, or L-arginine monohydrochloride.In one embodiment of the present invention, the VEGF receptor fusion protein is encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79-1374 or 79-1371 of SEQ ID NO: 1 and comprises amino acids of SEQ ID NO: 2 or amino acids 27-457 or 27-458 of SEQ ID NO: 2, and includes (1) a VEGFR1 component comprising amino acids 27-129 of SEQ ID NO: 2, (2) a VEGFR2 component comprising amino acids 130-231 of SEQ ID NO: 2, and (3) amino acids 232-457 of SEQ ID NO: 2 (i.e., K458 is the C-terminal amino acid of SEQ ID NO: 2). a multimerization component ("FcΔC1(a)") comprising a first VEGF receptor (e.g., VEGFR1) and a multimerization component (e.g., an Fc domain of an IgG), which may or may not be included in a VEGF receptor fusion protein; an immunoglobulin-like (Ig) domain 2 of a first VEGF receptor (e.g., VEGFR1) and an Ig domain 3 of a second VEGF receptor (e.g., VEGFR2); optionally, an Ig domain 4 of a second VEGF receptor (e.g., VEGFR2) and a multimerization component (e.g., an Fc domain of an IgG); conbercept; or aflibercept.

[0022] In yet another embodiment, a pharmaceutical formulation of the invention is provided, comprising a VEGF receptor fusion protein at a concentration of about 80 mg / ml to about 275 mg / ml in a pharmaceutically acceptable buffer. Optionally, the stable pharmaceutical formulation may also include taurine or propanesulfonic acid. The formulation may be stable for about 24 to 36 months at a temperature of about 2°C to about 8°C. Optionally, the VEGF receptor fusion protein exhibits less than about a 5% increase in high molecular weight species, more typically less than about a 4.5% increase in high molecular weight species, when stored at these temperatures for this time. , exhibits less than about a 4.0% increase in high molecular weight species, less than about a 3.5% increase in high molecular weight species, less than about a 3.0% increase in high molecular weight species, less than about a 2.5% increase in high molecular weight species, less than about a 2.0% increase in high molecular weight species, and / or less than about a 1.5% increase in high molecular weight species. In other cases, the VEGF receptor fusion protein exhibits less than a 2.0%-3.0% increase in high molecular weight species when the formulation is stored at these temperatures for this time.

[0023] Embodiments herein may also include pharmaceutical formulations of the present invention comprising aflibercept, a pH buffer, a sugar, and a surfactant, wherein the aflibercept is at a concentration of 41 mg / ml to about 275 mg / ml. Alternatively, embodiments may be stable liquid pharmaceutical formulations comprising conbercept, a pH buffer, a sugar, and a surfactant, wherein the conbercept is at a concentration of 41 mg / ml to about 275 mg / ml. The stable liquid pharmaceutical formulation may also include taurine or propanesulfonic acid. In some aspects, the aflibercept or conbercept is at a concentration of either 80 mg / ml or 150 mg / ml. In other aspects, the formulation does not include inorganic salts, such as sodium chloride.

[0024] Some embodiments relate to sterile syringes, such as syringes prefilled with an aqueous solution having 80 mg / ml aflibercept, conbercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 5% (w / v) sucrose, mannitol, sorbitol, or trehalose, 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, and 40 mM sodium chloride. Aspects herein include the further addition of about 25 mM to about 100 mM, more typically about 50 mM to about 70 mM, of either taurine or propanesulfonic acid. In some embodiments, the syringe is prefilled with an aqueous solution having 80 mg / ml aflibercept, conbercept, 10 mM histidine HCl, histidine acetate, or sodium phosphate, 8% (w / v) sucrose, mannitol, sorbitol, or trehalose, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350. Embodiments herein include the further addition of about 25 mM to about 100 mM, more typically about 50 mM to about 70 mM, of either taurine or propanesulfonic acid. In yet other embodiments, the syringe is prefilled with an aqueous solution having 150 mg / ml aflibercept, conbercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 5% (w / v) sucrose, mannitol, sorbitol, or trehalose, 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, and 40 mM sodium chloride, at a pH of about 6.2. Embodiments herein may include the further addition of either taurine or propanesulfonic acid.In yet other embodiments, the syringe is prefilled with an aqueous solution having 150 mg / ml aflibercept, conbercept, 10 mM histidine hydrochloride, histidine acetate, or sodium phosphate, 8% (w / v) sucrose, mannitol, sorbitol, or trehalose, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, at a pH of about 6.2, wherein the aqueous solution does not contain inorganic salts. Embodiments may further include about 25 mM to about 100 mM, more typically about 50 mM to about 70 mM, of either taurine or propanesulfonic acid. In yet another embodiment, the syringe is pre-filled with an aqueous solution comprising 150 mg / ml aflibercept or conbercept, 10 mM sodium acetate or acetic acid, 5% (w / v) glycerol, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350 and 40 mM sodium chloride, at a pH of about 6.2. In yet another embodiment, the syringe is pre-filled with an aqueous solution comprising 150 mg / ml aflibercept or conbercept, 10 mM sodium acetate or acetic acid, 8% (w / v) glycerol, and 0.03% (w / v) polysorbate 20, polysorbate 80, poloxamer 188, or polyethylene glycol 3350, at a pH of about 6.2. It is a prefilled solution containing rubeto 80, poloxamer 188, or polyethylene glycol 3350 and 40 mM sodium chloride.

[0025] The present invention also provides methods for making any of the formulations described herein, including combining the components of the formulation into a single composition. Such methods may include adding the resulting formulation to a vial or injection device. Any compositions resulting from such methods also form part of the present invention. For example, embodiments herein also include methods for preparing a formulation by combining a histidine-based, citrate-based, acetate-based, or phosphate-based buffer with sucrose, polysorbate 20, and a VEGF receptor fusion protein, and optionally, one or more additional components, such as those discussed herein. In some cases, the formulation is prepared to also contain taurine or propanesulfonic acid, but if it does not contain taurine or propanesulfonic acid, it may also be free of inorganic salts. In embodiments herein, sucrose is present at a weight per volume of about 4% to about 10%, polysorbate 20 is present at a weight per volume of about 0.02% to about 0.1%, and the receptor fusion protein is present at a concentration of about 41 mg / ml to about 275 mg / ml. If the formulation includes taurine or propanesulfonic acid, it is present, for example, at about 25 mM to about 100 mM, but may also be included at 50 mM to 70 mM. The method may include loading a predetermined volume of the prepared formulation into a sterile syringe such that the volume contains a dose of 0.1 mg to 10 mg of VEGF receptor fusion protein.

[0026] The present invention also provides methods for administering the formulations of the present invention to a subject (e.g., a human), comprising intraocular injection (e.g., intravitreal injection) of the formulation into the subject's eye. The present invention also provides methods for administering the formulations of the present invention to a subject (e.g., a human), comprising implanting an intravitreal implant containing the formulation of the present invention into the vitreous of the subject.

[0027] Embodiments herein also include methods for treating an intraocular neovascular disorder, e.g., age-related macular degeneration (wet), macular edema after retinal vein occlusion, retinal vein occlusion (RVO), central retinal vein occlusion (CRVO), branch retinal vein occlusion (BRVO), diabetic macular edema (DME), choroidal neovascularization (CNV), iris neovascularization, neovascular glaucoma, post-operative fibrosis of glaucoma, proliferative vitreoretinopathy (PVR), optic lamina neovascularization, corneal neovascularization, retinal neovascularization, vitreous neovascularization, pan-vascularization, vascular retinopathy, or diabetic retinopathy (e.g., non-proliferative diabetic retinopathy and / or proliferative diabetic retinopathy), in a subject in need thereof by intraocularly injecting at least about 2 mg (e.g., 4 mg, 6 mg, or 8 mg) of a VEGF receptor fusion protein (e.g., aflibercept or conbercept), e.g., any formulation described herein, into the eye of the subject in need thereof. In one embodiment of the present invention, the injection volume is 100 microliters or less (e.g., 100 microliters, 50 microliters, or 57 microliters). The method involves intravitreal injection of a premixed aqueous solution having a VEGF receptor fusion protein at a concentration of 41 mg / ml to about 275 mg / ml, a pharmaceutically acceptable sugar, a pharmaceutically acceptable buffer, and a pharmaceutically acceptable surfactant. Treatment methods using a premixed aqueous solution do not require dilution. In embodiments herein, the premixed aqueous solution has a pH of about 6.0 to about 6.5 and a viscosity of about 10 cP to 13 cP.

[0028] In a therapeutic embodiment, the VEGF receptor fusion protein comprises VEGFR1R2-FcΔC1(a) encoded by the nucleic acid sequence of SEQ ID NO: 1, a VEGFR2 component comprising amino acids 27-129 of SEQ ID NO: 2, amino acids 130-231 of SEQ ID NO: 2, or a multimerization component comprising amino acids 232-457 of SEQ ID NO: 2, or any combination thereof. In one embodiment of the present invention, the VEGF receptor fusion protein is aflibercept or conbercept.

[0029] Other embodiments in accordance with the disclosure herein will become apparent from review of the detailed description set forth below.

[0030] These and other aspects, features, and advantages of the embodiments disclosed herein will become more apparent to those skilled in the art by reference to the accompanying drawings. [Brief explanation of the drawings]

[0031] [Figure 1A] This graph determines the stability of VEGF receptor fusion protein (aflibercept) in four different formulations (B, H, D, and G) over the course of 36 months at 2°C to 8°C. Size-exclusion ultra-performance liquid chromatography (SE-UPLC) was used to test the stability of the VEGF receptor fusion protein to identify the formation of high molecular weight (HMW) species (indicative of proteolysis). [Figure 1B] Figure 14 is a graph determining the stability of a VEGF receptor fusion protein (aflibercept) in four formulations (B, H, D, and G) over the course of 36 months at 2°C to 8°C. SE-UPLC was used to test the stability of the VEGF receptor fusion protein to identify the proportion of the major species in each formulation. [Figure 1C] Figure 1 is a bar graph showing the formation of VEGF receptor fusion protein charge variants in four formulations (B, H, D, and G) over the course of 36 months at 2°C to 8°C. Levels of acidic species were tested at time of manufacture (0.0), 12 months, 24 months, and 36 months using imaged capillary isoelectric focusing (iCIEF). [Figure 1D] Figure 1 is a bar graph showing the formation of VEGF receptor fusion protein charge variants in four formulations (B, H, D, and G) over the course of 36 months at 2°C to 8°C. Identification of the predominant species was tested using iCIEF at time of manufacture (0.0), 12 months, 24 months, and 36 months. [Figure 2A]1 is a graph showing the stability of VEGF receptor fusion protein (aflibercept) at 150 mg / ml in a 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% polysorbate 20 (w / v) formulation at pH 6.2, with or without L-arginine monohydrochloride, over the course of 28 days at 37° C. The stability of the VEGF receptor fusion protein was tested using SE-UPLC to identify the formation of HMW species. [Figure 2B] 1 is a graph showing the stability of 150 mg / ml VEGF receptor fusion protein in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% polysorbate 20 (w / v) formulations at pH 6.2 with or without L-arginine monohydrochloride over the course of 28 days at 37° C. SE-UPLC was used to test the stability of the VEGF receptor fusion protein to identify the percentage of the major species in each formulation. [Figure 3A] 1 is a bar graph showing the viscosity of 10 mM sodium phosphate buffered formulations with 155 mg / ml VEGF receptor fusion protein and no salt, 100 mM arginine, 200 mM arginine, 50 mM lysine, 200 mM lysine, 50 mM sodium chloride, or 100 mM sodium chloride. Viscosity was measured in cP at 20° C. [Figure 3B] 1 is a bar graph showing the viscosity of 10 mM histidine-buffered formulations of 155 mg / ml VEGF receptor fusion protein with no salt, 100 mM arginine, 200 mM arginine, 50 mM lysine, 200 mM lysine, 50 mM sodium chloride, or 100 mM sodium chloride. Viscosity was measured in cP at 20° C. [Figure 3C] 1 is a graph showing the viscosity of various concentrations of VEGF receptor fusion protein under various formulation conditions (with and without 50 mM arginine hydrochloride). Viscosity was measured in cP at 20° C. [Figure 4A]1 is a graph showing the stability of VEGF receptor fusion protein at 150 mg / ml in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20 at pH 6.2 with or without 50 mM L-arginine monohydrochloride over 12 months at 5° C. The VEGF receptor fusion protein was at 150 mg / ml. The stability of the VEGF receptor fusion protein was tested using SE-UPLC to identify the formation of HMW species. [Figure 4B] 1 is a graph showing the stability of 150 mg / ml VEGF receptor fusion protein in 10 mM sodium phosphate, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20 at pH 6.2 with or without 50 mM L-arginine monohydrochloride over 12 months at 5° C. The VEGF receptor fusion protein was at 150 mg / ml. SE-UPLC was used to test the stability of the VEGF receptor fusion protein to identify the percentage of the major species in each formulation. [Figure 5] 1 is a graph showing the viscosity of formulations under two buffer conditions, 10 mM phosphate buffer or 10 mM histidine buffer, at 20° C. The concentration of VEGF receptor fusion protein is varied from 10 mg / ml to 170 mg / ml. Viscosity is measured in mPa-S. [Figure 6] Dynamic light scattering screens are shown for a number of different formulation conditions, each with 2-10 mg / ml of protein. Diffusion interaction parameters showed that taurine and PSA (propanesulfonic acid) improved Kd. [Figure 7] 1 is a graph monitoring the percentage of high molecular weight (HMW) species over time in Formulations F1-F9 (Formulations WW-EEE) as measured by size-exclusion ultra-performance liquid chromatography (SE-UPLC) after 6 months of storage at 5° C. Formulations F1-F9 are listed in Table 7-1 herein. [Figure 8A]The percentage of high molecular weight species measured by SE-UPLC after 3 months of storage at 5°C (A) or after 28 days of incubation at 37°C (B) is shown. Formulations F1-F4 (EEE, SSS, CCC (140 mg / ml), and TTT) are shown in Table 8-1 below. [Figure 8B] The percentage of high molecular weight species measured by SE-UPLC after 3 months of storage at 5°C (A) or after 28 days of incubation at 37°C (B) is shown. Formulations F1-F4 (EEE, SSS, CCC (140 mg / ml), and TTT) are shown in Table 8-1 below. [Figure 9] The viscosity (cp) of formulations F1 to F12 at 20° C. at the initial time point is shown. Formulations F1 to F12 are shown in Table A below. [Table 1] [Figure 10] The osmolality (mmol / Kg) of formulations F1 to F12 (listed in Table A herein) is shown. [Figure 11A] shows the percentage of high molecular weight species over time by SE-UPLC for formulations F1-F6 (formulations GGG, HHH, III, JJJ, LLL, and KKK) after storage at 37°C for up to 28 days (A) or at 5°C for up to 3 months (B). [Figure 11B] shows the percentage of high molecular weight species over time by SE-UPLC for formulations F1-F6 (formulations GGG, HHH, III, JJJ, LLL, and KKK) after storage at 37°C for up to 28 days (A) or at 5°C for up to 3 months (B). [Figure 12] Table 9-3 (GGG-RRR) shows the dynamic light scattering (diffusion coefficient (cm2 / sec), radius (nm), and % Pd) at the initial time point for the formulations shown. [Figure 13A]Baseline FA images and OCT (30-degree lens) of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13B] Baseline FA images and OCT (30-degree lens) of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13C] Baseline FA images and OCT (30-degree lens) of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 13D] Baseline FA images and OCT (30-degree lens) of two different rabbits (326-OS and 329-OD) before aflibercept administration are shown (OD = Oculus Dexter (right eye), OS = Oculus Sinister (left eye)). (A) FA image of rabbit 326, left eye. (B) OCT image of rabbit 326, left eye. (C) FA image of rabbit 329, right eye. (D) OCT image of rabbit 329, right eye. [Figure 14A] A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 14B]A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 14C] A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 14D] A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 14E] A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 14F] A rabbit FA image on day 1 (A), day 7 (B), and day 14 (C) and OCT time course on day 1 (D), day 7 (E), and day 14 (F) are shown for one rabbit (326-OS) administered a histidine buffer formulation (30-degree lens) (7 mg / eye). [Figure 15A] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15B]For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15C] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15D] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15E] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15F] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15G] For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 15H]For one rabbit (326-OS) administered a histidine buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time course at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 16A] Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 16B] Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 16C] Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 16D] Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 16E] Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 16F]Shown are rabbit FA images on day 1 (A), week 1 (B), and week 2 (C) and OCT time course on day 1 (D), week 1 (E), and week 2 (F) for one rabbit (329-OS) administered a phosphate buffer formulation (30-degree lens) (7 mg / eye). [Figure 17A] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17B] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17C] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17D] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17E] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17F]For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17G] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 17H] For one rabbit (329-OS) administered a phosphate buffer formulation (55-degree lens) (7 mg / eye), rabbit FA images at weeks 3 (A), 4 (B), 7 (C), and 8 (D) and OCT time courses at weeks 3 (E), 4 (F), 7 (G), and 8 (H) are shown. [Figure 18A] Purity (percentage of native species) (A) and percentage of high molecular weight (HMW) species (B) of formulations UUU-BBBB analyzed by SE-UPLC at 37°C (up to 1 month) over time (see Table 11-1). [Figure 18B] Purity (percentage of native species) (A) and percentage of high molecular weight (HMW) species (B) of formulations UUU-BBBB analyzed by SE-UPLC at 37°C (up to 1 month) over time (see Table 11-1). [Figure 19A]1 shows the stability and purity analysis of a formulation having 114.3 mg / mL of VEGF trap (aflibercept) formulated in 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM arginine monohydrochloride by size exclusion chromatography measurement of (i) the percentage of high molecular weight species (HMW) after incubation for up to 2 months at 5° C. or 37° C. (A) and (ii) the percentage of major species (main peak) after incubation for up to 2 months at 5° C. or 37° C. (B), as well as by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C., by particle light obscuration analysis to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C. (D), and by microscopy measurement of subvisible particulate matter after incubation for up to 28 days at 37° C. (E). [Figure 19B] 1 shows the stability and purity analysis of a formulation having 114.3 mg / mL of VEGF trap (aflibercept) formulated in 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM arginine monohydrochloride by size exclusion chromatography measurement of (i) the percentage of high molecular weight species (HMW) after incubation for up to 2 months at 5° C. or 37° C. (A) and (ii) the percentage of major species (main peak) after incubation for up to 2 months at 5° C. or 37° C. (B), as well as by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C., by particle light obscuration analysis to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C. (D), and by microscopy measurement of subvisible particulate matter after incubation for up to 28 days at 37° C. (E). [Figure 19C]1 shows the stability and purity analysis of a formulation having 114.3 mg / mL of VEGF trap (aflibercept) formulated in 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM arginine monohydrochloride by size exclusion chromatography measurement of (i) the percentage of high molecular weight species (HMW) after incubation for up to 2 months at 5° C. or 37° C. (A) and (ii) the percentage of major species (main peak) after incubation for up to 2 months at 5° C. or 37° C. (B), as well as by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C., by particle light obscuration analysis to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C. (D), and by microscopy measurement of subvisible particulate matter after incubation for up to 28 days at 37° C. (E). [Figure 19D] 1 shows the stability and purity analysis of a formulation having 114.3 mg / mL of VEGF trap (aflibercept) formulated in 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM arginine monohydrochloride by size exclusion chromatography measurement of (i) the percentage of high molecular weight species (HMW) after incubation for up to 2 months at 5° C. or 37° C. (A) and (ii) the percentage of major species (main peak) after incubation for up to 2 months at 5° C. or 37° C. (B), as well as by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C., by particle light obscuration analysis to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C. (D), and by microscopy measurement of subvisible particulate matter after incubation for up to 28 days at 37° C. (E). [Figure 19E]1 shows the stability and purity analysis of a formulation having 114.3 mg / mL of VEGF trap (aflibercept) formulated in 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, 50 mM arginine monohydrochloride by size exclusion chromatography measurement of (i) the percentage of high molecular weight species (HMW) after incubation for up to 2 months at 5° C. or 37° C. (A) and (ii) the percentage of major species (main peak) after incubation for up to 2 months at 5° C. or 37° C. (B), as well as by microflow imaging (C) to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C., by particle light obscuration analysis to determine the presence of subvisible particulate matter after incubation for up to 28 days at 37° C. (D), and by microscopy measurement of subvisible particulate matter after incubation for up to 28 days at 37° C. (E). [Figure 20A] Stability and purity analysis of formulation CCC with 80, 100, 120, or 140 mg / ml aflibercept by SE-UPLC measurement of the percentage of high molecular weight species (HMW) after incubation at 2–8 °C for up to 6 months (A) or at 37 °C for up to 28 days (B) is shown. [Figure 20B] Stability and purity analysis of formulation CCC with 80, 100, 120, or 140 mg / ml aflibercept by SE-UPLC measurement of the percentage of high molecular weight species (HMW) after incubation at 2–8 °C for up to 6 months (A) or at 37 °C for up to 28 days (B) is shown. [Figure 21] Figure 1 shows the percentage of tested rabbit eyes with complete leakage suppression over time when administered 500 micrograms or 2 mg of aflibercept over time (Gehan-Breslow-Wilcoxon test (P 0.0453)). DETAILED DESCRIPTION OF THE INVENTION

[0032] The present invention provides formulations with high concentrations of VEGF receptor fusion proteins (e.g., aflibercept) that exhibit excellent functional and storage properties, developed despite significant technical hurdles. A common method for identifying suitable excipients for drug-containing formulations is by evaluating the stability of polypeptides under accelerated stress conditions, such as elevated temperatures (e.g., 37°C). Excipients that are unsuitable under non-stress conditions (e.g., lower temperatures, such as 5°C) will typically cause undesirable effects during short periods of stress, e.g., protein aggregation. This approach is common in the biotechnology and pharmaceutical industries, as it facilitates the removal of excipients that are unlikely to stabilize the drug product. See, e.g., Magari, Assessing Shelf Life Using Real-Time and Accelerated Stability Tests, Biopharm Intl. 16(11):36-48 (2003). In some cases, product release may be based on accelerated stability data, but this must be performed in parallel with real-time shelf-life analysis (non-accelerated). Magari (2003) and FDA, Guidelines for Submitting Documentation for the Stability of Human Drugs and Biologics, Rockville, MD (1987). However, here, while the presence of arginine in histidine formulations was stable at 5°C, arginine appeared to tend to decrease stability under temperature stress (37°C). See Figure 8 (A and B). This characteristic of the formulations described herein would have presented technical difficulties that would have led practitioners to avoid selecting arginine. Therefore, practitioners would have been less likely to select arginine as an excipient. Nevertheless, the formulations described herein have overcome these technical hurdles and achieved formulations with high stability. Formulation of VEGF Trap in histidine buffer also resulted in a beneficial decrease in viscosity compared to that observed with phosphate buffer formulations. Because a small needle hole is preferred for intravitreal injections (to reduce patient discomfort and ocular trauma), a relatively low viscosity is desirable. A formulation with a low viscosity makes injection of the formulation through a needle easier for the treating physician, as less force is required to push the formulation through the needle. Furthermore, histidine- and arginine-containing formulations were well tolerated in rabbit eyes.

[0033] Reference will now be made in detail to exemplary embodiments. It should be understood that the following description is not intended to limit the embodiments to any single preferred embodiment. On the contrary, they are intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the described embodiments, as set forth in the appended claims.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains.As used herein, the term "about" when used in relation to a specific listed numerical value means that this value can vary by 1% or less from the listed value.For example, when used in the present invention, the expression "about 100" includes 99 and 101, and all values ​​therebetween (for example, 99.1%, 99.2%, 99.3%, 99.4%, etc.).

[0035] In an embodiment of the invention, the pharmaceutical formulation of the invention is a USP formulation for small volume injection (SVP) of ophthalmic solutions. <789> For example, the fluid contains less than about 50 particles per ml greater than 10 μm in diameter, less than about 5 particles per ml greater than 25 μm in diameter, or less than about 2 particles per ml greater than 50 μm in diameter.

[0036] It should be noted that for purposes of this specification, "intravitreal injection" refers to an injection into the vitreous of the eye (near the retina at the back of the eye). The terms "suitable for intravitreal administration," "suitable for intravitreal injection," and the like mean that the formulation in question can be safely injected into the vitreous of a subject's eye without causing side effects beyond those known to be associated with intravitreal injection of EYLEA.

[0037] The term "pharmaceutical formulation" as used herein refers to a formulation comprising a pharmaceutically acceptable carrier, for example, used to administer a VEGF receptor fusion protein (e.g., aflibercept or conbercept) to a subject for therapeutic / medical use.

[0038] The term "pharmaceutically acceptable" refers to a formulation that is, within the scope of sound medical judgment, suitable for administration to the eye.

[0039] The term "subject" as used herein refers to any mammalian (e.g., rabbit, mouse, rat, or monkey) subject, particularly a human, for whom diagnosis, prognosis, or treatment with, for example, the formulations described herein, is desired.

[0040] The term "aqueous" formulation refers to a formulation that contains water.

[0041] The term "treat" or "treatment" refers to a therapeutic procedure that reverses, stabilizes, or eliminates an undesirable disease or disorder (e.g., an ocular neovascular disorder or cancer), e.g., with respect to an ocular neovascular disorder, by causing regression, stabilization, or elimination of one or more symptoms or signs of such disease or disorder by a clinically measurable degree, by causing a reduction or maintenance of the Diabetic Retinopathy Severity Score (DRSS), by improving or maintaining visual acuity (e.g., as measured by an increase in best corrected visual acuity, e.g., ETDRS letters), by increasing or maintaining visual field, and / or by reducing or maintaining central retinal thickness, and with respect to cancer, by halting or reversing the growth, survival, and / or metastasis of cancer cells in the subject. Typically, the therapeutic procedure is the administration of one or more doses of a therapeutically effective amount of a VEGF receptor fusion protein to a subject having the disease or disorder.

[0042] "Preventing" or "prevention" refers to a preventative measure to halt the onset of an unwanted disease or disorder (eg, an intraocular neovascular disorder).

[0043] SE-UPLC can be used in the present invention to quantify the presence of high molecular weight species in formulations. SE refers to size exclusion chromatography. UPLC refers to ultra-performance liquid chromatography. A suitable SE column, which can be used in a UPLC system to characterize such HMW species of VEGF receptor fusion proteins (e.g., aflibercept or conbercept) in formulations, can resolve molecules in the molecular weight range of approximately 10,000 to 450,000 daltons. See, for example, the ACQUITY UPLC Protein BEH SEC 200Å column. In embodiments of the present invention, two such columns are connected in tandem when quantifying HMW species in formulations. UPLC offers improvements over HPLC (high-performance liquid chromatography) in sensitivity and resolution. UPLC uses instruments that operate at high pressure and use finer particles (typically less than approximately 2.5 μm) than those used in HPLC. Furthermore, UPLC mobile phases operate at higher linear velocities than HPLC.

[0044] Embodiments herein include formulations comprising a high concentration (e.g., about 60 mg / ml, about 80 mg / ml, about 90 mg / ml, about 100 mg / ml, about 113.3 mg / ml, about 114.3 mg / ml, about 120 mg / ml, about 133.3 mg / ml, about 140 mg / ml, about 150 mg / ml, about 200 mg / ml, or about 250 mg / ml) of a VEGF receptor fusion protein (e.g., aflibercept or conbercept). Suitable formulations included herein include a high concentration VEGF receptor fusion protein, a buffer, a thermal stabilizer, and a surfactant. In some aspects, suitable formulations further include a viscosity-lowering agent. In other aspects, suitable formulations substantially exclude all viscosity-lowering agents. Exemplary formulations include: It has a pH of about 5.0 to about 6.8 (eg, 5.8), but can include any pH useful for administration of the VEGF receptor fusion protein to the eye of a subject.

[0045] The present invention includes formulations comprising a VEGF receptor fusion protein (e.g., aflibercept or conbercept) in association with one or more additional therapeutic agents (e.g., an Ang-2 inhibitor (e.g., an anti-ANG2 antibody or antigen-binding fragment thereof or nesbacumab), a Tie-2 receptor activator, an anti-PDGF, PDGF receptor, or PDGF receptor beta antibody or antigen-binding fragment thereof, and / or an additional VEGF antagonist such as bevacizumab, ranibizumab, pegaptanib, or a soluble form of human vascular endothelial growth factor receptor-3 (VEGFR-3) comprising extracellular domains 1-3 expressed as an Fc fusion protein), as well as methods of prevention or treatment comprising administration of a formulation as discussed herein. In embodiments of the present invention, the formulations of the present invention comprise a VEGF receptor fusion protein, such as aflibercept, but exclude additional therapeutic agents (e.g., an antibody or antigen-binding fragment thereof).

[0046] The term "associated" indicates that the formulation and additional therapeutic agent may be formulated into a single composition, e.g., for simultaneous delivery, or may be formulated separately into two or more compositions (e.g., a kit). The additional therapeutic agent may itself be formulated into its own pharmaceutical formulation. Each may be administered to a subject at the same time as the other or at a different time than when the other is administered, e.g., each administration may be given non-concurrently (e.g., separately or sequentially) spaced apart over a given period of time. Furthermore, the formulation and additional therapeutic agent may be administered to a subject by the same route or by different routes.

[0047] In embodiments of the invention, a formulation of the invention comprises any one or more of sodium sulfate (e.g., 50 mM), sodium thiocyanate (e.g., 50 mM), sodium citrate (e.g., 40 mM), glycine (e.g., 50 mM), sodium chloride (e.g., 50 mM), lysine (e.g., 50 mM), sodium aspartate (e.g., 50 mM), and / or sodium glutamate (e.g., 50 mM). For example, in embodiments, a formulation comprises a combination of sodium citrate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), glycine (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), sodium aspartate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM), or sodium glutamate (e.g., 50 mM) and arginine hydrochloride (e.g., 50 mM).

[0048] VEGF receptor fusion proteins and other VEGF inhibitors For purposes of this specification, a "VEGF receptor fusion protein" refers to a molecule comprising one or more VEGF receptors or domains thereof fused to another polypeptide that interferes with the interaction between VEGF and a native VEGF receptor, e.g., two of such fusion polypeptides combine to form a homodimer or other multimer. Such VEGF receptor fusion proteins are sometimes referred to as "VEGF traps" or "VEGF traps." VEGF receptor fusion proteins within the context of the present disclosure encompassed by this definition include chimeric polypeptides comprising two or more immunoglobulin (Ig)-like domains of a VEGF receptor, such as VEGFR1 (also known as Flt1) and / or VEGFR2 (also known as Flk1 or KDR), and may also include a multimerization domain (e.g., an Fc domain).

[0049] An exemplary VEGF receptor fusion protein is the molecule designated VEGF1R2-FcΔC1(a), which is encoded by the nucleic acid sequence of SEQ ID NO: 1 or nucleotides 79-1374 or 79-1371 thereof.

[0050] VEGF1R2-FcΔC1(a) consists of three components: (1) a VEGFR1 component comprising amino acids 27 to 129 of SEQ ID NO: 2; (2) a VEGFR2 component comprising amino acids 130 to 231 of SEQ ID NO: 2, and (3) A multimerization component ("FcΔC1(a)") comprising amino acids 232 to 457 of SEQ ID NO: 2 (the C-terminal amino acid of SEQ ID NO: 2, i.e., K458, may or may not be included in the VEGF receptor fusion protein; see U.S. Patent No. 7,396,664 or U.S. Patent No. 7,354,579, which are incorporated herein for all purposes). Note that amino acids 1 to 26 of SEQ ID NO: 2 are a signal sequence. In embodiments of the invention, a VEGF receptor fusion protein comprises amino acids 27-458 or 27-457 of SEQ ID NO:2.

[0051] In an embodiment of the invention, the VEGF receptor fusion protein comprises: (1) immunoglobulin-like (Ig) domain 2 of the first VEGF receptor (e.g., VEGFR1), and (2) Ig domain 3 of a second VEGF receptor (e.g., VEGFR2); (3) and, optionally, further comprising Ig domain 4 of a second VEGF receptor (e.g., VEGFR2); (4) A multimerizing component (e.g., the Fc domain of IgG). For example, in an embodiment of the invention, a VEGF receptor fusion protein has the following arrangement of the domains: [VEGFR1 Ig domain 2]-[VEGFR2 Ig domain 3]-[MC] (e.g., a homodimer thereof) or [VEGFR1 Ig domain 2]-[VEGFR2 Ig domain 3]-[VEGFR2 Ig domain 4]-[MC] (e.g., a homodimer thereof).

[0052] In an embodiment of the invention, the VEGF receptor fusion protein is, for example, a VEGF minitrap, which is a VEGF trap molecule with a truncated multimerization component (e.g., Fc), e.g., the minitrap still contains the Fc hinge region. See, e.g., WO2005 / 00895 or U.S. Patent No. 7,396,664.

[0053] The present disclosure also includes within its scope, in place of VEGF receptor fusion proteins, VEGF binding molecules and anti-VEGF antibodies and antigen-binding fragments thereof, i.e. Bevacizumab (e.g., at a concentration of about 80-90 or 88 mg / ml), ranibizumab (e.g., at a concentration of about 20-40 mg / ml, e.g., 21-35, 21 or 35 mg / ml), anti-VEGF aptamers such as pegaptanib (e.g., pegaptanib sodium), Single-chain (e.g., V L -V H ) an anti-VEGF antibody (e.g., a concentration of about 200-400 or 200, 210, 400, or 420 mg / ml), an anti-VEGF DARPin, such as Abiciperpegol DARPin (e.g., at a concentration of about 70-140 mg / ml, 70 or 140 mg / ml); or Note that this includes high concentration formulations containing bispecific anti-VEGF antibodies that also bind ANG2, such as RG7716 (e.g., at concentrations of about 100-400, 100, 105, 400, or 420 mg / ml). To minimize the repetition of the embodiments discussed herein, it is contemplated that the scope of the present invention includes embodiments in which any of the formulations discussed herein include, in place of a VEGF receptor fusion protein, an anti-VEGF antibody or antibody fragment or other VEGF binding molecule discussed herein (e.g., substituted with an anti-VEGF DARPin) at any of the concentrations discussed herein. For example, the present invention includes formulations having 35 or 80 mg / ml ranibizumab, a buffer, a heat stabilizer, a viscosity-lowering agent, and a surfactant. .

[0054] DARPins are engineered ankyrin repeat proteins. They generally contain three to four tightly packed repeats of approximately 33 amino acid residues, each containing a β-turn and two antiparallel α-helices. This rigid framework provides protein stability while allowing the presentation of a variable region, typically containing six amino acid residues per repeat, for target recognition.

[0055] An "anti-VEGF" antibody or antigen-binding fragment of an antibody refers to an antibody or fragment that specifically binds to VEGF.

[0056] Exemplary VEGF receptor fusion proteins include aflibercept (EYLEA®, Regeneron Pharmaceuticals, Inc.) or conbercept (commercially sold by Chengdu Kanghong Biotechnology Co., Ltd.). See International Patent Application Publication Nos. WO2005 / 121176 or WO2007 / 112675. The terms "aflibercept" and "conbercept" include biosimilar versions thereof. A biosimilar version of a reference product (e.g., aflibercept) generally refers to a product that contains the same amino acid sequence, but includes a product that is a biosimilar under the U.S. Biologics Price Competition and Innovation Act.

[0057] The pharmaceutical formulations of the present invention are "highly concentrated." Highly concentrated pharmaceutical formulations of the present invention contain a VEGF receptor fusion protein at a concentration of at least 41 mg / ml, at least 80 mg / ml, at least 100 mg / ml, at least 125 mg / ml, at least 140 mg / ml, at least 150 mg / ml, at least 175 mg / ml, at least 200 mg / ml, at least 225 mg / ml, at least 250 mg / ml, or at least 275 mg / ml. Alternatively, "highly concentrated" can refer to a formulation containing a VEGF receptor fusion protein concentration of about 140 mg / ml to about 160 mg / ml, at least about 140 mg / ml but less than 160 mg / ml, 41 mg / ml to about 275 mg / ml, about 70 mg / ml to about 75 mg / ml, or about 80 mg / ml to about 250 mg / ml.In some embodiments, the concentration of the VEGF receptor fusion protein in the formulation is 41 mg / ml, 42 mg / ml, 43 mg / ml, 44 mg / ml, 45 mg / ml, 46 mg / ml, 47 mg / ml, 48 mg / ml, 49 mg / ml, 50 mg / ml, 51 mg / ml, 52 mg / ml, 53 mg / ml, 54 mg / ml, 55 mg / ml, 56 mg / ml, 57 mg / ml, 58 mg / ml, 59 mg / ml, 60 mg / ml, 61 mg / ml, 62 mg / ml, 63 mg / ml, 64 mg / ml, 65 mg / ml, 66 mg / ml, 67 mg / ml, 68 mg / ml, 69 mg / ml, 70 mg / ml, 71 mg / ml, 72 mg / ml, 73 mg / ml, 74 mg / ml, 75 mg / ml, 76 mg / ml, 77 mg / ml, 78 mg / ml, 79 mg / ml, 80 mg / ml, 81 mg / ml, 82 mg / ml, 83 mg / ml, 84 mg / ml, 85 mg / ml, 86 mg / ml, 87 mg / ml, 88 mg / ml, 89 mg / ml, 90 mg / ml, 91 mg / ml, 92 mg / ml, 93 mg / ml, 94 mg / ml, 95 mg / ml, 96 mg / ml, 97 mg / ml, 98 mg / ml, 99 mg / ml, 100 mg / ml, 101 mg / ml, 102 mg / ml, 103 mg / ml, 104 mg / ml, 105 mg / ml, 106 mg / ml, 107 mg / ml, 108 mg / ml, 109 mg / ml, 110 mg / ml, 111 mg / ml, 112 mg / ml, 113 mg / ml, 113.3 mg / ml, 114 mg / ml, 114.1 mg / ml, 114.2 mg / ml, 114.3 mg / ml, 114.4 mg / ml, 114.5 mg / ml, 114.6 mg / ml, 114.7 mg / ml, 114.8 mg / ml, 114.9 mg / ml, 115 mg / ml, 116 mg / ml, 117 mg / ml, 118 mg / ml, 119 mg / ml, 120 mg / ml. 、121mg / ml、122mg / ml、123mg / ml、124mg / ml、125mg / ml、126mg / ml、127mg / ml、128mg / ml、129mg / ml、130mg / ml、131mg / ml、132mg / ml、133mg / ml、133mg / ml、133.3mg / ml、133.4mg / ml、134mg / ml、135mg / ml、136mg / ml、137mg / ml、138mg / ml、139mg / ml、140mg / ml、141mg / ml、142mg / ml、143mg / ml、144mg / ml、145mg / ml、146mg / ml、147mg / ml、148mg / ml、149mg / ml、150mg / ml、151mg / ml、152mg / ml、153mg / ml、154mg / ml、155mg / ml、156mg / ml、157mg / ml、158mg / ml、159mg / ml、160mg / ml、161mg / ml、162mg / ml、163mg / ml、164mg / ml、165mg / ml、166mg / ml、167mg / ml、168mg / ml、169mg / ml、170mg / ml、171mg / ml、172mg / ml、173mg / ml、174mg / ml、175mg / ml、176mg / ml、177mg / ml、178mg / ml、179mg / ml、180mg / ml、181mg / ml、182mg / ml、183mg / ml、184mg / ml、185mg / ml、186mg / ml、187mg / ml、188mg / ml、189mg / ml、190mg / ml、191mg / ml、192mg / ml、193mg / ml、194mg / ml、195mg / ml、196mg / ml、197mg / ml、198mg / ml、199mg / ml、200mg / ml、201mg / ml、202mg / ml、203mg / ml、204mg / ml、205mg / ml、206mg / ml、207mg / ml、208mg / ml、209mg / ml、210mg / ml、211mg / ml、212mg / ml、213mg / ml、214mg / ml、215mg / ml、216mg / ml、217mg / ml、218mg / ml、219mg / ml、220mg / ml、221mg / ml、222mg / ml、223mg / ml、224mg / ml、225mg / ml、226mg / ml、227mg / ml、228mg / ml, 229mg / ml, 230mg / ml, 231mg / ml, 232mg / ml, 233mg / ml, 234mg / ml, 235mg / ml, 236mg / ml, 237mg / ml, 238mg / ml, 239mg / ml, 240m g / ml, 241mg / ml, 242mg / ml, 243mg / ml, 244mg / ml, 245mg / ml, 246mg / ml, 247mg / ml, 248mg / ml, 249mg / ml, 250mg / ml, 251mg / ml, 252mg / ml, For example, the VEGF receptor fusion protein may be present at any of the following concentrations: 253 mg / ml, 254 mg / ml, 255 mg / ml, 256 mg / ml, 257 mg / ml, 258 mg / ml, 259 mg / ml, 260 mg / ml, 261 mg / ml, 262 mg / ml, 263 mg / ml, 264 mg / ml, 265 mg / ml, 266 mg / ml, 267 mg / ml, 268 mg / ml, 269 mg / ml, 270 mg / ml, 271 mg / ml, 272 mg / ml, 273 mg / ml, 274 mg / ml, or 275 mg / ml. Other VEGF receptor fusion protein concentrations are contemplated herein, so long as the concentrations function according to the embodiments herein.

[0058] In an embodiment of the invention, the pharmaceutical formulation of the invention is concentrated to contain about 4, 6, 8, 10, 12, 14, 16, 18, or 20 mg of VEGF receptor fusion protein (e.g., aflibercept), or is in a volume of about 100 μl or less, about 75 μl or less, or about 70 μl or less, e.g., about 50 μl, 51 μl, 52 μl, 53 μl, 54 μl, 55 μl, 56 μl, 57 μl, 58 μl, 59 μl, 60 μl, 61 μl, 62 μl, 63 μl, 64 μl, 65 μl, 66 μl, 67 μl, 68 μl, 69 μl, 70 μl, 71 μl, 72 μl, 73 μl, 74 μl, 75 μl, 76 μl, 77 μl, 78 μl, 79 μl, 80 μl, 81 μl, 82 μl, 83 μl, 84 μl, 85 μl, 86 μl, 87 μl, 88 μl, 89 μl, 90 μl, 91 μl, 92 μl, 93 μl, 94 μl, 95 μl, 96 μl, 97 μl, 98 μl, 99 μl, or 100 μl of such protein in any of its acceptable doses discussed herein.

[0059] The present invention includes any of the formulations described in "Exemplary Formulations" herein, except that the concentration of VEGF receptor fusion protein (e.g., aflibercept) is replaced with the concentrations described in this section ("VEGF Receptor Fusion Proteins and Other VEGF Inhibitors").

[0060] buffer solution As used herein, a buffer solution refers to a solution that resists pH changes due to the use of acid-base conjugates. A buffer solution can maintain a pH in the range of about 5.0 to about 6.8, more typically about 5.8 to about 6.5, and most typically about 6.0 to about 6.5. In some cases, the pH of the formulations of the present invention is about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, or about 6.8. Exemplary buffer solutions for inclusion in the formulations herein include histidine-based buffers, such as histidine, histidine hydrochloride, and histidine acetate. Alternatively, buffers for inclusion in the formulations herein may be phosphate-based buffers, such as sodium phosphate, acetate-based buffers, such as sodium acetate or acetic acid, or citrate-based buffers, such as sodium citrate or citric acid. It is recognized that the buffer may be a mixture of the above, so long as it functions to buffer the formulation within the above pH range. In some cases, the buffer is about 5 mM to about 25 mM, or more typically about 5 mM to about 15 mM. The buffer may be about 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 21 mM, 22 mM, 23 mM, 24 mM, or 25 mM.

[0061] In one embodiment of the present invention, the histidine-based buffer is prepared using histidine and histidine monohydrochloride.

[0062] surfactants As used herein, surfactant refers to a component that protects high-concentration VEGF receptor fusion proteins from stresses induced by various surfaces and interfaces. Therefore, surfactants can be used to limit or minimize aggregation of VEGF receptor fusion proteins and promote protein solubility. Suitable surfactants herein are designated as nonionic and may include surfactants with polyoxyethylene moieties. Exemplary surfactants in this category include polysorbate 20, polysorbate 80, poloxamer 188, polyethylene glycol 3350, and mixtures thereof. Surfactants in formulations may be present at about 0.02% to about 0.1% weight per volume (w / v), more typically about 0.02% to about 0.04% (w / v). In some cases, the surfactant is about 0.02% (w / v), about 0.03% (w / v), about 0.04% (w / v), about 0.05% (w / v), about 0.06% (w / v), about 0.07% (w / v), about 0.08% (w / v), about 0.09% (w / v), or about 0.1% (w / v).

[0063] heat stabilizer The term "thermal stabilizer" as used herein refers to a component that provides thermal stability to the VEGF receptor fusion protein against thermal denaturation and protects the VEGF receptor fusion protein from losing its potency or activity.Suitable thermal stabilizers include sugars, such as sucrose, trehalose, sorbitol, or mannitol, or amino acids, such as L-proline, L-arginine (e.g., L-arginine monohydrochloride), or taurine.In addition, thermal stabilizers can also include substituted acrylamide or propanesulfonic acid, or can be compounds such as glycerol.

[0064] In some cases, the formulations herein include a sugar and taurine, a sugar and an amino acid, a sugar and propanesulfonic acid, a sugar and taurine, glycerol and taurine, glycerol and propanesulfonic acid, an amino acid and taurine, or both an amino acid and propanesulfonic acid. Additionally, the formulations may include a sugar, taurine and propanesulfonic acid, glycerol, taurine and propanesulfonic acid, and L-proline, taurine and propanesulfonic acid.

[0065] Embodiments herein typically have a single thermal stabilizer present, each independently present at about 2% (w / v) to about 10% (w / v), or 4% (w / v) to about 10% (w / v), or about 4% (w / v) to about 9% (w / v), or about 5% (w / v) to about 8% (w / v). The thermal stabilizer in the formulation may be present at a concentration of about 2% (w / v), about 2.5% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), about 10% (w / v), or about 20% (w / v).

[0066] With respect to taurine and propanesulfonic acid, in one embodiment of the present invention, these heat stabilizers may be present in the formulation at about 25 mM to about 100 mM, more typically about 50 mM to about 75 mM (relative to other heat stabilizers).

[0067] Viscosity Reducer Viscosity-lowering agents are typically used to reduce or prevent protein aggregation. Viscosity-lowering agents for inclusion herein include sodium chloride, magnesium chloride, D- or L-arginine (e.g., L-arginine monohydrochloride), lysine, or mixtures thereof. When present herein, the viscosity-lowering agent may be present at about 10 mM to about 100 mM, more typically about 30 mM to about 75 mM, and even more typically about 40 mM to about 70 mM. In some cases, the viscosity-lowering agent is present at about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, or about 100 mM.

[0068] Viscosity of the formulation Formulations according to embodiments herein may also have a viscosity that is pharmaceutically acceptable for intraocular administration, e.g., intravitreal injection. Viscosity generally refers to a measure of a fluid's resistance to being deformed by either shear or tensile stress (typically measured, for example, by techniques known in the art, such as a viscometer or rheometer). Typical viscosities of formulations according to embodiments herein are about 5.0 cP (centipoise) to about 15 cP, about 11 cP to about 14 cP, about 12 cP to about 15 cP, or about 11 cP to about 12 cP. Thus, the viscosity of the formulations herein can be about 5.0 cP, about 6.0, about 7.1 cP, about 7.2 cP, about 7.3 cP, about 7.4 cP, about 7.5 cP, about 7.6 cP, about 10 cP, about 10.5 cP, about 11.0 cP, about 11.5 cP, about 12.0, about 12.5 cP, about 13.0 cP, about 13.5 cP, about 14.0 cP, about 14.5 cP, or about 15.0 cP (e.g., when measured at 20°C).

[0069] Various embodiments herein do not require the inclusion of inorganic salts or other viscosity-lowering agents to maintain these highly useful viscosities. Typically, highly concentrated protein solutions require viscosity-lowering agents to avoid protein aggregation and high viscosity, which can complicate intravitreal injection and reduce the efficacy of the VEGF receptor fusion protein. Thus, some embodiments herein include solutions that are substantially free of sodium chloride (NaCl), magnesium chloride (MgCl), D- or L-arginine hydrochloride, lysine, or other viscosity-lowering agents. This includes formulations with no added ingredients.

[0070] Osmolality of the formulation Osmolality is an important attribute of injectable formulations. It is desirable for the product to match physiological osmolality conditions. Furthermore, osmolality provides a measure of the soluble content in solution. In embodiments of the present invention, the osmolality of the formulations of the present invention is less than about 506 mmol / Kg, or between about 250 and about 506 mmol / Kg, e.g., about 250, 260, 270, 280, 290, 299, 300, 310, 314, 315, 316, 324, 343, 346, 349, 369, 384, 403, 426, 430, or 506 mmol / Kg. In one embodiment of the present invention, the osmolality is less than about 250 mmol / Kg.

[0071] Purity and Stability of the Formulation The formulations containing the high-concentration VEGF receptor fusion proteins described herein are stable during manufacturing and storage. The term "stable" herein refers to a formulation containing a VEGF receptor protein that maintains both chemical and physical stability over the manufacturing and storage period of the formulation, e.g., maintains integrity and minimizes degradation, denaturation, or unfolding. The stability of the VEGF receptor protein can be determined using analytical techniques available in the art at different temperatures and over different periods of time. In particular, the chemical stability (potency) of the VEGF receptor can be determined using various bioassays (e.g., VEGF receptor activity measured by the VEGF receptor fusion proteins of the present invention). 165The BAF / 3VEGFR1 / EPOR cell line used to determine binding can be used to determine physical stability, and the physical stability can be determined using size exclusion (SE) chromatography analysis, UPLC (Ultra-Performance Liquid Chromatography) size exclusion (SE) chromatography, appearance, OD, pH, charge variant formation, and high molecular weight (HMW) analysis. A stable VEGF receptor fusion protein is one that exhibits limited changes in its OD, pH, charge variant formation, and HMW species formation.

[0072] As used herein, "high molecular weight" (HMW) species refers to any species of polypeptide or polypeptide complex in a formulation containing a given VEGF Trap (e.g., aflibercept) that elutes from a size exclusion column (e.g., SE-UPLC) beyond the VEGF Trap polypeptide and / or its homodimer (e.g., higher molecular weight). The proportion of HMW species refers to the proportion of such species relative to the total amount of polypeptide in the formulation, for example, by SE-UPLC analysis.

[0073] In embodiments of the invention, as discussed more fully in the Examples below, stable formulations exhibit significant VEGF receptor fusion protein potency and physical stability over periods of up to 12 months, up to 24 months, and / or up to 36 months when stored at about 2°C to about 8°C.

[0074] In an embodiment of the invention, the formulation of the invention is as follows: have about a 3, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 30, 35, or 37% (or 10-15% or 15-20% or 10-20%) increase in high molecular weight species after about 28 days at about 37°C (e.g., as measured by SE-UPLC or SEC) after about 28 days at about 37°C, have about a 5, 6, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22% (or 5-20% or 5-10% or 10-15% or 15%-20%) reduction in the major species (e.g., as measured by SE-UPLC or SEC) After about 28 days at about 37°C, have greater than or equal to about 80, 81, 82, 83, 84, 85, 86, or 87% (or 80-85%) of the protein as the major species (e.g., as measured by SE-UPLC or SEC) After about 28 days at about 37°C, have an increase of about 1 or 1.5 or 2% (or 1-2%) in low molecular weight species (e.g., as measured by SE-UPLC or SEC) after about one month at about 37°C, about a 16% increase in high molecular weight species, and / or about a 17% decrease in the major species and / or about a 0.5% or <1% increase in low molecular weight species, and / or after about two months at about 5°C, about a 1% decrease in the major species, and / or about a 1% increase in the high molecular weight species and / or no significant or detectable amounts of low molecular weight (LMW) species, and / or having about 97% major species after about two months at about 5°C (e.g., as measured by SE-UPLC or SEC). After about 12 months at about 2-8°C, there is an increase of about 3-3.5% in high molecular weight species (as measured, for example, by SE-UPLC or SEC) have a decrease of about 1%, or 1, 2, 3, or 4% (e.g., 1-4% or 3-4%) in the major species after about 12 months at about 2-8°C (e.g., as measured by SE-UPLC or SEC); After approximately 12 months at approximately 2-8°C, have greater than approximately 94 or 95% of the protein as the major species (e.g., as measured by SE-UPLC or SEC) After about 3 months at about 2-8°C, there is an increase of about 1 or 2% in high molecular weight species (as measured, for example, by SE-UPLC or SEC) After about 6 months at about 2-8°C, have an increase of about <1, 1, or 2% in high molecular weight species (e.g., as measured by SE-UPLC or SEC) 5°C at approximately 5°C 1 After 2 or 6 months, have approximately 2.5, 3.0, or 3.5 (or 2.5-3.5%) total high molecular weight species (e.g., as measured by SE-UPLC or SEC) After about 6 months at about 2-8°C, there is a decrease of about 1% or 1 or 2% (or about 0.5-2% or 1-2%) in the major species (as measured, for example, by SE-UPLC or SEC). After about 6 months at about 2-8°C, have greater than about 96, 97, or 98% (or 96-98%) of the protein as the major species (e.g., as measured by SE-UPLC or SEC) after about 24 or 36 months at about 2-8°C, has an increase in high molecular weight species of about 5 or 6 or 7% (e.g., about 1.5, 2, 3, 4 or 5%) (or 1.5-5% or 1.5-2.5%), and / or about 3.0, 3.25, 4.0, 4.5 or 5% total high molecular weight species, and / or a decrease in the major species of about 2 or 3% (or 2-3%), and / or about 95 or 96% or more (or 95-96%) total amount of the major species (e.g., as measured by SE-UPLC or SEC); Approximately 97, 98, 99, or 100% (or 97-100%) of the aflibercept in the formulation is recoverable by RP-HPLC after approximately one month at approximately 37°C. Immediately after manufacture and purification, has less than about 1.5, 2, 2.5, 3.0, or 3.5% high molecular weight species (e.g., as measured by SE-UPLC or SEC) After about 6 months at about 37°C, have at least about 70% or 75% (e.g., 70-75%) of aflibercept as the major species / main peak (e.g., as measured by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing) (non-acidic and non-basic species) After about 36 months at about 2-8°C, have an increase of about 1 or 2% (or 1-2%) in acidic species (as measured, for example, by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing) After approximately 36 months at approximately 2-8°C, there is a decrease of approximately 1% or less in the major species / main peak (e.g., capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing). (when measuring by movement) After approximately 36 months at approximately 2-8°C, have approximately 78-79% of the major species / main peak (as measured, for example, by capillary isoelectric focusing (clEF) or imaging capillary isoelectric focusing) and / or When administered intravitreally to humans or mammals such as rabbits or mice (e.g., with an ocular neovascular disorder such as wet AMD), it does not cause any adverse events clinically different from those observed with EYLEA (e.g., when EYLEA is administered intravitreally at 0.5 or 2.0 mg), or cause clinically significant inflammation in the eye, long-term elevation of intraocular pressure (IOP), long-term elevation or decrease of blood pressure, and / or retinal detachment.

[0075] Furthermore, in embodiments of the present invention, the high concentration VEGF receptor fusion proteins are stable because they exhibit little or no formation of acidic charge variants over the course of manufacture and storage, e.g., they exhibit little or no formation of charge variants as tested by imaging capillary isoelectric focusing.

[0076] In an embodiment of the invention, the formulations of the invention exhibit about 8% or less low molecular weight (LMW) species.

[0077] In an embodiment of the invention, the formulations of the invention have less than about 0.2, 0.4 or 0.5 EU (endotoxin units) / ml endotoxin.

[0078] In an embodiment of the invention, the formulations of the invention are essentially free of particulate matter or particulate matter having a size of about 1, 2, 5, 10, 25, or 50 micrometers (or larger).

[0079] In an embodiment of the invention, when a formulation of the invention is analyzed by non-reducing CE-SDS (SDS capillary gel electrophoresis), at least 97% of the total peak area is the main peak.

[0080] In an embodiment of the invention, when a formulation of the invention is analyzed by size exclusion UPLC (SE-UPLC), at least 93, 94, or 95% of the total peak area is the main peak and no more than 3.5, 4, 5, or 6% is aggregates.

[0081] In embodiments of the invention, the formulations of the invention are stored at 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, or 8°C, between 2 and 8°C (e.g., an average temperature of 5°C), 23°C, 25°C, 30°C, or 37°C.

[0082] Exemplary Formulations Exemplary high concentration VEGF receptor fusion protein-containing formulations include: Formulation A: 80 mg / ml aflibercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation B: 80 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8 to 6.2; Formulation C: 80 mg / ml aflibercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation D: 80 mg / ml aflibercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 8, with a pH of 6.2 0, and 40 mM sodium chloride; Formulation E: 80 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation F: 80 mg / ml aflibercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation G: 80 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, having a pH of 5.8 to 6.2, optionally without a viscosity-lowering agent. Formulation H: 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation I: 80 mg / ml aflibercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent; Formulation J: 80 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation K: 80 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation L: 80 mg / ml aflibercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent; Formulation M: 150 mg / ml aflibercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation N: 150 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation O: 150 mg / ml aflibercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation P: 150 mg / ml aflibercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2; Formulation Q: 150 mg / ml aflibercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8 to 6.2; Formulation R: 150 mg / ml aflibercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation S: 150 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-lowering agent. Formulation T: 150 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2 (e.g., 6.2), optionally without a viscosity-reducing agent. Formulation U: 150 mg / ml aflibercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation V: 150 mg / ml aflibercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-lowering agent; Formulation W: 150 mg / ml aflibercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent; Formulation X: 150 mg / ml aflibercept, 10 mM citrate buffer, 8% (w / v) sucrose, 0.03% (w / v) polysorbate 80, pH 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation Y: 80 mg / ml conbercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation Z: 80 mg / ml conbercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation AA: 80 mg / ml conbercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation BB: 80 mg / ml conbercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2; Formulation CC: 80 mg / ml conbercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation DD: 80 mg / ml conbercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation EE: 80 mg / ml conbercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8-6.2, optionally without a viscosity-reducing agent. Formulation FF: 80 mg / ml conbercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation GG: 80 mg / ml conbercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation HH: 80 mg / ml conbercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation II: 80 mg / ml conbercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, having a pH of 5.8 to 6.2, optionally without a viscosity-lowering agent; Formulation JJ: 80 mg / ml conbercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation KK: 150 mg / ml conbercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate, with a pH of 5.8-6.2. 20 mM sorbate, and 40 mM sodium chloride, Formulation LL: 150 mg / ml conbercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2; Formulation MM: 150 mg / ml conbercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation NN: 150 mg / ml conbercept, 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 6.2. Formulation 00: 150 mg / ml conbercept, 10 mM phosphate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation PP: 150 mg / ml conbercept, 10 mM citrate buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 80, and 40 mM sodium chloride, with a pH of 5.8-6.2. Formulation QQ: 150 mg / ml conbercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8-6.2, optionally without a viscosity-reducing agent. Formulation RR: 150 mg / ml conbercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation SS: 150 mg / ml conbercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 20, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation TT: 150 mg / ml conbercept, 10 mM histidine-based buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8-6.2, optionally without a viscosity-reducing agent. Formulation UU: 150 mg / ml conbercept, 10 mM phosphate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation VV: 150 mg / ml conbercept, 10 mM citrate buffer, 8% (w / v) sucrose, and 0.03% (w / v) polysorbate 80, with a pH of 5.8 to 6.2, optionally without a viscosity-reducing agent. Formulation WW: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM taurine, with a pH of 5.8. Formulation XX: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8; Formulation YY: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM taurine, with a pH of 5.8. Formulation ZZ: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8. Formulation AAA: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, with a pH of 5.8. tallow, 0.03% (w / v) polysorbate 20, and 50 mM PSA; Formulation BBB: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 2.5% (w / v) sucrose, 2.0% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA, with a pH of 5.8. Formulation CCC: 80, 100, 120, or 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM arginine hydrochloride, with a pH of 5.8. Formulation DDD: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM histidine-based buffer, 4% (w / v) proline, 0.03% (w / v) polysorbate 20, and 50 mM PSA, with a pH of 5.8. Formulation EEE: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and optionally no heat stabilizer, with a pH of 5.8. Formulation FFF: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM sodium phosphate, 5% (w / v) sucrose and 0.03% polysorbate 20, with pH 6.2. Formulation GGG: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium sulfate, pH 5.8 Formulation HHH: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium thiocyanate, pH 5.8 Formulation III: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 40 mM sodium citrate, pH 5.8; Formulation JJJ: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM glycine, pH 5.8 Formulation KKK: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium chloride at pH 5.8, Formulation LLL: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM lysine, pH 5.8 Formulation MMM: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium aspartate, pH 5.8 Formulation NNN: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium glutamate at pH 5.8, Formulation OOO: 140 mg / ml VEGF receptor fusion protein, 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium citrate, 50 mM arginine hydrochloride, pH 5.8 Formulation PPP: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM glycine, 50 mM arginine hydrochloride, pH 5.8 Formulation QQQ: 140 mg / ml of VEGF receptor fusion protein (e.g., Afliber) sept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium aspartate, 50 mM arginine hydrochloride, pH 5.8 Formulation RRR: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine, 5% sucrose, 0.03% polysorbate 20, 50 mM sodium glutamate, 50 mM arginine hydrochloride at pH 5.8, Formulation SSS: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM His, 5% sucrose, 0.03% polysorbate 20, 10 mM L-arginine hydrochloride, pH 5.8 Formulation TTT: 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM His, 5% sucrose, 0.03% polysorbate 20, 100 mM L-arginine hydrochloride, pH 5.8 Formulation UUU: 30 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, pH 6.2 Formulation VVV: pH 6.2, 30 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, Formulation WWW: pH 6.2, 60 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, Formulation XXX: 60 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, pH 6.2 Formulation YYY: 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, pH 6.2 Formulation ZZZ: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, Formulation AAAA: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl, Formulation BBBB: pH 6.2, 120 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20% sucrose, 10 mM phosphate, 0.03% polysorbate 20, 50 mM NaCl, Formulation CCCC: pH 6.2, 140 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 10 mM sodium phosphate, 5% sucrose, 40 mM sodium chloride, 0.03% PS20, Formulation DDDD: 80 mg / ml VEGF receptor fusion protein (e.g., aflibercept), 20 mM histidine-based buffer, 5% (w / v) sucrose, 0.03% (w / v) polysorbate 20, and 50 mM L-arginine monohydrochloride, with a pH of 5.8. Formulation EEEE: 120.0 mg / ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., 12 mg / ml), 20 mM histidine-based buffer (e.g., 2 mM), 5% (w / v) sucrose (e.g., 0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., 5 mM), with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1). Formulation FFFF: 113.3 mg / ml of VEGF receptor fusion protein (e.g., aflibercept) with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1) (e.g., 102-125 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM), Formulation GGGG: 114.3 mg / ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., 103-126 mg / ml), 10 mM histidine-based buffer (e.g., +1 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM), with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1). Formulation HHHH: 100.0 mg / ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., +10 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM), with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1). Formulation III: 133.3 mg / ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., 13 mg / ml), 20 mM histidine-based buffer (e.g., 2 mM), 5% (w / v) sucrose (e.g., 0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., 5 mM), with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1), Formulation JJJJ: 150 mg / ml aflibercept (e.g., aflibercept) (e.g., +15 mg / ml), 10 mM sodium phosphate, 8% (w / v) sucrose (e.g., +0.8%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%) and 50 mM L-arginine hydrochloride, with a pH of 6.2 (e.g., 6.0-6.4 or 5.9-6.5). Formulation KKKK: 114.3 mg / ml VEGF receptor fusion protein (e.g., aflibercept) (e.g., +14 mg / ml), 20 mM histidine-based buffer (e.g., +2 mM), 5% (w / v) sucrose (e.g., +0.5%), 0.03% (w / v) polysorbate 20 (e.g., 0.02-0.04%), and 50 mM L-arginine monohydrochloride (e.g., +5 mM), with a pH of 5.8 (e.g., 5.6-6.0 or 5.5-6.1), Or any formulation described herein.

[0083] In embodiments of the invention, the concentration of any formulation component (e.g., all components) listed above or discussed herein (e.g., any one of Formulations A through KKKK) is the specifically mentioned concentration plus about 3%, 5%, or about 10%.

[0084] Manufacturing method Embodiments herein include methods of making pharmaceutical formulations of the invention containing a VEGF receptor fusion protein (e.g., any of Formulations A-KKKK described herein), comprising combining the components of the formulation into a single composition and, optionally, introducing the formulation into a container or device, e.g., a vial, or a delivery device, e.g., a pre-filled syringe. The product of such a method, the formulation, vial, or device, is part of the invention.

[0085] In embodiments of the invention, a method for producing a VEGF receptor fusion protein comprising a pharmaceutical formulation of the invention (e.g., any of Formulations A-KKKK described herein) includes culturing a host cell (e.g., a Chinese fluoxetine-1-phosphate dehydrogenase (C1H2)-containing a fliberceptor-binding protein (VEGF-binding protein) in a culture medium and under conditions in which the protein is expressed. and culturing the protein in host cells (eg, hamster ovary cells), purifying the protein from the host cells and / or culture medium, and combining a portion of the protein with the excipients of a pharmaceutical formulation described herein. Again, the product of such a method, a formulation, vial, or device, is part of the invention.

[0086] In embodiments of the present invention, considerations are made regarding the amount and type of VEGF receptor fusion protein required in the formulation for its high concentration and for its end use. The same considerations are made regarding the amount and type of buffer, amount and type of surfactant, amount and type of thermal stabilizer, and the inclusion or specific exclusion of viscosity-lowering agents. These components are combined and mixed to ensure that the formulation has a desired pH, e.g., about 5.0 to about 6.8 (e.g., 5.8), and / or a desired viscosity, e.g., about 6.0, 7.3, 11.5, or 12.0 cP at 20°C. In embodiments of the present invention, formulations containing high concentrations of VEGF receptor fusion protein may be sterilized and stored under stable conditions, e.g., at 2-8°C (5°C) for up to 24 or 36 months.

[0087] For example, Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, NY, Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, NY, Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parental Medications, Marcel Dekker, NY, Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY, Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY, Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New See New York, NY.

[0088] Intraocular neovascular disorders and cancer Pharmaceutical formulations of the present invention containing a VEGF receptor fusion protein (e.g., any of Pharmaceutical Formulations A to KKKK) can be used to treat or prevent any intraocular neovascular disorder by administering a therapeutically effective amount of the VEGF receptor fusion protein in the formulation of the present invention to a subject in need thereof, for example, by intravitreal injection. An intraocular neovascular disorder herein refers to any disease of the eye caused by or associated with the growth or proliferation of blood vessels and / or vascular leakage. Non-limiting examples of intraocular neovascular disorders treatable or preventable using the formulations and methods herein include the following: Age-related macular degeneration (wet), Macular edema, Macular edema after retinal vein occlusion, Retinal vein occlusion (RVO), Central retinal vein occlusion (CRVO), Branch retinal vein occlusion (BRVO), ·Diabetic macular edema (DME), ·Choroidal neovascularization (CNV), ·iris angiogenesis, Neovascular glaucoma, Postoperative fibrosis in glaucoma Proliferative vitreoretinopathy (PVR), ·Optic disc neovascularization, ·Cornea neovascularization, ·Retinal neovascularization, Vitreous neovascularization, Pannus, ·pterygia, ·Vascular retinopathy, diabetic retinopathy (e.g., non-proliferative diabetic retinopathy (e.g., characterized by a Diabetic Retinopathy Severity Scale (DRSS) level of about 47 or 53) or proliferative diabetic retinopathy, e.g., in subjects not suffering from DME), and · Diabetic retinopathy in patients with diabetic macular edema (DME).

[0089] Pharmaceutical formulations of the present invention containing VEGF receptor fusion proteins (e.g., any of Pharmaceutical Formulations A to KKKK) can be used to treat or prevent any cancer by administering a therapeutically effective amount of the VEGF receptor fusion protein in the formulation of the present invention to a subject in need thereof, for example, by intramuscular, intratumoral, subcutaneous, or intravenous injection. Cancers include those that depend to some extent on angiogenesis for their growth, proliferation, survival, and / or metastasis. In embodiments of the present invention, the cancer is colorectal cancer, lung cancer, skin cancer, breast cancer, brain cancer, gastric cancer, renal cancer, prostate cancer, liver cancer, or pancreatic cancer.

[0090] Thus, the present invention provides methods for treating or preventing an intraocular neovascular disorder in a subject in need thereof, comprising administering a therapeutically effective amount of a VEGF receptor fusion protein (e.g., aflibercept) (e.g., about 4, 6, or 8.0, 8.1, 8.4, or 8.5 mg), e.g., in a pharmaceutical formulation according to the present invention, intraocularly, e.g., into the vitreous of the subject's eye. In embodiments of the invention, the VEGF receptor fusion protein is administered to both eyes. In embodiments of the invention, a therapeutically effective dose of the VEGF receptor fusion protein is administered about every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks. In embodiments of the invention, such methods of treatment or prevention are carried out in the absence of a significant increase in blood pressure (systolic and / or diastolic) and / or the occurrence of hypertension (e.g., Grade 1, Grade 2, or Grade 3) and / or abnormally high intraocular pressure in the subject. In embodiments of the invention, the methods include the step of monitoring the subject following said administration for a significant increase in blood pressure (systolic and / or diastolic) and / or the occurrence of hypertension (e.g., Grade 1, Grade 2, or Grade 3) and / or abnormally high intraocular pressure.

[0091] Mode of Administration The pharmaceutical formulations of the present invention containing VEGF receptor fusion proteins may be administered according to known medically approved delivery systems. In embodiments herein, these delivery systems may include administering the formulation to a patient via ocular, intraocular, intrachoroidal, intravitreal, or subconjunctival injection. Alternatively, the pharmaceutical formulations of the present invention may also be administered to a patient via topical routes, such as eye drops, eye gels, eye ointments, etc. Other possible delivery routes for the formulations herein include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral.

[0092] In an embodiment of the invention, intravitreal injection of the pharmaceutical formulation of the invention is performed by puncturing the eye with a syringe and needle (e.g., a 30 gauge needle) containing the formulation, and injecting the formulation (e.g., about 100 microliters (about 40, 50, 55, 56, 57, 57.1, 58, 60, 70, or 75 microliters) or less) into the vitreous of the eye (e.g., a therapeutically effective amount of VEGF receptor The method includes administering a sufficient amount of the fusion protein, e.g., about 4, 5, 6, 7, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, or 8.9, 9, 10, 12, 14, 16, 18, or 20 mg of the VEGF receptor fusion protein, to the eye being injected. Optionally, the method includes administering a local anesthetic (e.g., proparacaine, lidocaine, or tetracaine), an antibiotic (e.g., a fluoroquinolone), an antiseptic (e.g., povidone-iodine), and / or a pupil dilator to the eye being injected. In an embodiment of the invention, a sterile field around the injected eye is established prior to injection. In an embodiment of the invention, following intravitreal injection, the subject is monitored for elevated intraocular pressure and / or blood pressure. In an embodiment of the invention, the other eye is injected using the same procedure.

[0093] Amount of VEGF receptor fusion protein administered Each dose of high concentration VEGF receptor fusion protein administered to a subject over the course of treatment may contain the same or substantially the same amount of fusion protein, or alternatively, the amount administered at any one time may be different or may vary over the course of treatment.

[0094] An effective or therapeutically effective amount of a VEGF receptor fusion protein for treating or preventing cancer (e.g., mediated at least in part by angiogenesis) or an intraocular neovascular disorder refers to an amount of VEGF receptor fusion protein sufficient to cause regression, stabilization, or elimination of one or more symptoms or signs of cancer or an intraocular neovascular disorder to any clinically measurable extent, e.g., with respect to an intraocular neovascular disorder, by causing a reduction or maintenance of the Diabetic Retinopathy Severity Score (DRSS), improving or maintaining vision (e.g., in best corrected vision as measured by an increase in ETDRS letters), increasing or maintaining the visual field, and / or reducing or maintaining central retinal thickness, and with respect to cancer, by arresting or reversing the growth, survival, and / or metastasis of cancer cells in the subject.In embodiments of the invention, an effective or therapeutically effective amount of a VEGF receptor fusion protein for treating or preventing an intraocular neovascular disorder is about 0.5 mg to about 10 mg or 0.5 mg to about 20 mg per dose, including about 0.5 mg or more, or about 2 mg or more, for example, about 2.1 mg, 2.2 mg, 2.3 mg, 2.4 mg, 2.5 mg, 2.6 mg, 2.7 mg, 2.8 mg, 2.9 mg, 3.0 mg, 3.1 mg, 3.2 mg, 3.3 mg, 3.4 mg, 3.5 mg, 3.6 mg, 3.7 mg, 3.8 mg, 3.9 mg, 4.0 mg, or more. g, 4.1mg, 4.2mg, 4.3mg, 4.4mg, 4.5mg, 4.6mg, 4.7mg, 4.8mg, 4.9mg, 5.0mg, 5.1mg, 5.2mg, 5.3mg, 5.4mg, 5.5mg, 5.6mg, 5.7mg, 5.8mg, 5.9mg, 6.0mg, 6 .1mg, 6.2mg, 6.3mg, 6.4mg, 6.5mg, 6.6mg, 6.7mg, 6.8mg, 6.9mg, 7.0mg, 7.1mg, 7.2mg, 7.3mg, 7.4mg, 7.5mg, 7.6mg, 7.7mg, 7.8mg, 7.9mg, 8.0mg, 8.1mg , 8.2mg, 8.3mg, 8.4mg, 8.5mg, 8.6mg, 8.7mg, 8.8mg, 8.9mg, 9mg, 9.1mg, 9.2mg, 9.3mg, 9.4mg, 9.5mg, 9.6mg, 9.7mg, 9.8mg, 9.9mg, 10.0mg, 10.1mg, 10 .2mg, 10.3mg, 10.4mg, 10.5mg, 10.6mg, 10.7mg, 10.8mg, 10.9mg, 11mg, 11.1mg, 11.2mg, 11.3mg, 11.4mg, 11.5mg, 11.6mg, 11.7mg, 11.8mg, 11.9mg, 12 mg, 12.1mg, 12.2mg, 12.3mg, 12.4mg, 12.5mg, 12.6mg, 12.7mg, 12.8mg, 12.9mg, 13mg, 13.1mg, 13.2mg, 13.3mg, 13.4mg, 13.5mg, 13.6mg, 13.7mg, 13. 8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4mg, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, 15mg, 15.1mg, 15.2mg, 15.3mg, 15.4mg, 15.5mg, 15.6. mg, 15.7mg, 15.8mg, 15.9mg, 16mg, 16.1mg, 16.2mg, 16.3mg, 16.4mg, 16.5mg, 16.6mg, 16.7m g, 16.8mg, 16.9mg, 17mg, 17.1mg, 17.2mg, 17.3mg, 17.4mg, 17.5mg, 17.6mg, 17.7mg, 17.8mg , 17.9 mg, 18 mg, 18.1 mg, 18.2 mg, 18.3 mg, 18.4 mg, 18.5 mg, 18.6 mg, 18.7 mg, 18.8 mg, 18.9 mg, 19 mg, 19.1 mg, 19.2 mg, 19.3 mg, 19.4 mg, 19.5 mg, 19.6 mg, 19.7 mg, 19.8 mg, 19.9 mg, or 20 mg. In an embodiment of the invention, an effective or therapeutically effective amount of a VEGF receptor fusion protein for treating or preventing cancer is about 4 mg / kg (e.g., intravenously). This dose may be administered, for example, every two weeks.

[0095] In embodiments of the invention, the VEGF receptor fusion protein is administered in a volume sufficient to deliver a desired dose of the fusion protein, e.g., as described above. In embodiments of the invention, the delivered volume (e.g., for the treatment or prevention of intraocular neovascular disorders by intravitreal injection) is about 100 microliters or less (e.g., approximately any of the following volumes: 25 microliters, 26 microliters, 27 microliters, 28 microliters, 29 microliters, 30 microliters, 31 microliters, 32 microliters, 33 microliters, 34 microliters, 35 microliters, 36 microliters, 37 microliters, 38 microliters, 39 microliters, 40 microliters, 41 microliters, 42 microliters, 43 microliters, 44 microliters, 45 microliters, 46 microliters, 47 microliters, 48 ​​microliters, 49 microliters, 50 microliters, 51 microliters, 52 microliters, 53 microliters, 54 microliters, 55 microliters, 56 microliters, 57 microliters, 58 microliters). torr, 59 microliters, 60 microliters, 61 microliters, 62 microliters, 63 microliters, 64 microliters, 65 microliters, 66 microliters, 67 microliters, 68 microliters, 69 microliters, 70 microliters, 71 microliters, 72 microliters, 73 microliters, 74 microliters, 75 microliters, 76 microliters, 77 microliters, 78 microliters, 79 microliters, 80 microliters, 81 microliters, 82 microliters, 83 microliters, 84 microliters, 85 microliters, 86 microliters, 87 microliters, 88 microliters, 89 microliters, 90 microliters, 91 microliters, 92 microliters, 93 microliters, 94 microliters, 95 microliters, 96 microliters, 97 microliters, 98 microliters, or 99 microliters).

[0096] In embodiments of the invention, formulations are administered in volumes of about 60 microliters or less, about 70 microliters or less, about 75 microliters or less, or about 100 microliters or less (e.g., for the treatment or prevention of intraocular neovascular disorders via intravitreal injection). For example, in embodiments of the invention, about 2, 4, 6, 8.0, 8.1, 8.0-8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, or 10 mg of VEGF receptor fusion protein are administered in volumes of about 50, 60, 70, or 75 microliters.

[0097] The scope of the present invention also includes methods for delivering 0.5 or 2 mg of VEGF receptor fusion protein (e.g., by intravitreal injection to treat or prevent intraocular neovascular disorders) in a pharmaceutical formulation of the present invention in a low volume, such as less than 50 μl (e.g., about 1, 5, 10, 17, 17.5, 18, 18.5, 20, 30, 40, or 45 μl). do.

[0098] The present invention also includes compositions comprising, consisting of, or consisting essentially of "single-dose volumes" of the pharmaceutical formulations of the invention, i.e., volumes containing a single dose of a VEGF receptor fusion protein (e.g., aflibercept) in a pharmaceutical formulation of the invention (e.g., about 50 μl, or 60 μl, 70 μl, or 75 μl, or any volume containing about 4, 6, 8, or 10 mg of a VEGF receptor fusion protein). As discussed below, containers (e.g., vials or injection devices) containing single-dose volumes, optionally with a small overfill volume of the formulation, are also part of the invention.

[0099] Container and injection device High-concentration VEGF receptor fusion protein formulations according to embodiments herein (e.g., any of Formulations A through KKKK) can be pre-packaged or pre-loaded into a variety of useful containers and injection devices. Accordingly, the present invention includes containers and injection devices containing such formulations. In one embodiment herein, the container is a vial, which may be sterile. In another embodiment herein, the container is a test tube, which may be sterile. In an embodiment of the present invention, the injection device (which may be sterile) is a syringe (e.g., a pre-filled syringe or an auto-injector). In an embodiment of the present invention, the injection device is an intravitreal implant, e.g., a refillable intravitreal implant.

[0100] A "pre-filled" syringe is a syringe that is filled with a formulation of the present invention prior to sale or use by a physician or patient.

[0101] As used herein, "sterile" refers to being sterile or free from substantially all or all living microorganisms and their spores.

[0102] As used herein, a syringe includes a barrel, plunger, and needle made, for example, of glass or a polymer, such as a cycloolefin, as described in U.S. Patent Publication No. 2017 / 0232199, which is incorporated herein for all purposes.

[0103] The container and injection device may be coated with silicone (eg, silicone oil or baked silicone (eg, <40 μg or <100 μg)).

[0104] In an embodiment of the invention, the container or injection device is substantially metal-free, substantially tungsten-free, or low-tungsten.

[0105] In an embodiment of the invention, the syringe includes one or more dose line markings and / or is a dose metering system.

[0106] Containers according to embodiments herein may hold high-concentration VEGF receptor fusion protein formulations. In some aspects, the container or injection device may include a label with instructions for use. In some cases, the container or injection device herein may include a package insert containing instructions for use as described throughout this specification.

[0107] In other embodiments, as described above, volumes containing a single or multiple doses (e.g., two or more) of a high concentration VEGF receptor fusion protein (e.g., where the dose is 2 mg, 4 mg, 6 mg, 8 mg, or 10 mg of VEGF receptor fusion protein) can be pre-packaged in a container or injection device, e.g., a sterile syringe, for storage until use. In one example, the volume in the container contains a single dose of VEGF receptor fusion protein, optionally further including a small overfill volume. Sterile pre-filled The filled syringes can be maintained under storage conditions (e.g., 2°C to 8°C) for, for example, up to 12, 24, or 36 months. Overfilling is an excess volume meant to be sufficient to allow for withdrawal and / or administration of an appropriate volume. In embodiments of the present invention, the containers have a single-dose or multi-dose capacity and an overfill capacity of about 5% to 10%.

[0108] Syringe sizes can be, for example, 0.3 cc, 0.5 cc, or 1 cc. Sterile syringes typically contain needles useful for ocular injections, typically about 1 / 2 inch in length, or 12.5 mm to 16 mm, and can be 29 gauge, 30 gauge, 31 gauge, 32 gauge, or 33 gauge, based on patient and medical professional preference. Other needle lengths and gauges can be used, as long as the needle is effective for achieving intravitreal injections.

[0109] While the present invention has been particularly shown and described with reference to several embodiments, those skilled in the art will understand that changes in form and detail may be made in the various embodiments disclosed herein without departing from the spirit and scope of the invention, and that the various embodiments disclosed herein are not intended to serve as limitations on the claims.

[0110] Further formulations The present invention includes the following formulations comprising greater than 40 mg / ml of a VEGF receptor fusion protein (e.g., aflibercept or conbercept) and:

[0111] (a) a buffer solution containing a histidine salt (e.g., histidine-HCl or histidine acetate, e.g., 10 mM to 50 mM) and having a pH in the range of 5.7 to 6.2; a sugar such as sucrose, trehalose, mannitol, or glucose (e.g., 6% to 10%); a surfactant selected from the group consisting of polysorbate 20 and polysorbate 80 (e.g., 0% to 0.1%);

[0112] (b) a histidine-containing buffer such as L-histidine / histidine hydrochloride (e.g., 10 mM); e.g., a nonionic surfactant such as polysorbate 20 (e.g., 0.03%), an inorganic salt such as NaCl (e.g., 40 mM), and a carbohydrate such as sucrose (e.g., 5%), at a pH of 6.0 to 6.5 (e.g., 6.2 or 6.5);

[0113] (c) citric acid (e.g., 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, or 30 mM), sucrose (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%), arginine (e.g., 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, 50 mM, or 100 mM), and polysorbate 20 (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.10%);

[0114] (d) buffers (e.g., 5-20 or 5-50 mM) such as phosphate, histidine, acetate, succinate, citrate, glutamate, and / or lactate; tonicity agents such as polysorbates (e.g., PS20 or PS80), polyethylene glycol dodecyl ether, poloxamer, 4-(l,l,3,3-tetramethylbutyl)phenyl-polyethylene glycol, alkyl saccharides or alkyl glycosides, polyols, or amino acids, e.g., sucrose, trehalose, sorbitol, mannitol, glycerol, proline, arginine, methionine, glycine, or lysine, where the formulation has a final osmolality of about 300 mOsm / kg, the concentration of chloride anion is less than about 10 mM, and the pH is 5.0-6.5. ;or

[0115] (e) 10 mM sodium phosphate, 40 mM sodium chloride, 0.03% polysorbate 20, and 5% sucrose, pH 6.2. [Example]

[0116] The following examples are provided for illustrative purposes and are not intended to limit the scope of the present invention. Although efforts have been made to ensure accuracy with respect to the numerical values ​​used, some experimental error and deviation should be taken into account. Any formulations described in these examples are part of the present invention.

[0117] In these examples, where experiments are performed at 2-8°C, for temperature, 5°C is the target, with a tolerance of +3°C variation.

[0118] Example 1: 80 mg / ml VEGF receptor fusion protein formulation maintains potency, physical stability and charge over a 36 month period. A series of four different formulations containing 80 mg / ml of VEGF receptor fusion protein (aflibercept) was tested for long-term potency, physical stability, and charge variant development. The ingredient list for each of the four formulations is shown in Table 1-1. Each formulation was evaluated for VEGF receptor fusion protein HMW species formation over a 36-month storage period at 2°C to 8°C, as well as the percentage of the major species by SE-UPLC. Each VEGF receptor fusion protein-containing formulation was also evaluated using imaging capillary isoelectric focusing over the same time and temperature periods. Finally, the potency of each formulation was tested by bioassay over the same time and temperature periods. [Table 2] [Table 3] [Table 4] [Table 5] [Table 6]

[0119] The data are presented in Figures 1A, 1B, 1C, and 1D. Figure 1A shows the percentage of HMW species of the VEGF receptor fusion protein formed for each of the four formulations. VEGF TRAP demonstrates that the rate of HMW species formation is slightly slower when the formulation is histidine-based compared to sodium phosphate. As shown in Figure 1A, after 36 months of storage at 2-8°C, the percentage of HMW species increased by only 2.6% in the sodium phosphate formulations (formulations 1 and 2), compared to a 1.6-1.9% increase in the histidine buffer (formulations 3 and 4). As shown in Figure 1B, the data were confirmed and SE-UPLC was used to identify the percentage of the major VEGF receptor fusion protein species present over the same time frame and temperature range. As a point of comparison, assays performed on the current EYLEA® formulation (40 mg / ml) with 10 mM sodium phosphate showed a 1.2% increase in the percentage of HMW species after 36 months of storage at 2-8°C. Additionally, each of the four 80 mg / ml VEGF TRAP formulations was tested for potency and compared to EYLEA® activity (not shown). Potency was maintained by bioassay for all four formulations and for EYLEA®. These data demonstrate that the formulations herein can maintain VEGF receptor fusion protein stability comparable to EYLEA®.

[0120] Referring to Figures 1C and 1D, the percentage of VEGF TRAP charge variants formed after 36 months of storage at 2–8°C was also examined. Figure 1C shows that VEGF TRAP in formulations 1–4 showed no significant change in the percentage of acidic species over the course of 36 months, while Figure 1D shows the same results for the percentage of major species over the course of 36 months. The results that VEGF TRAP maintained its charge variants during storage indicate that the quality of VEGF TRAP was maintained and that processes such as deamination, N-terminal pyroglutamic acid formation, isomerization, and aggregation did not occur over the storage parameters.

[0121] The data in Example 1 demonstrate that a formulation with twice the VEGF TRAP concentration found in EYLEA® can maintain physical stability, quality, and potency over the course of 36 months at 2-8°C. Furthermore, while all four formulations demonstrated similar potency over this period, the histidine-containing formulation resulted in a slightly smaller increase in HMW species formation (a sign of proteolysis), indicating that histidine may be the buffer of choice in some circumstances. However, results for both the histidine and phosphate-based buffers demonstrated excellent stability over the course of the study.

[0122] Example 2: VEGF TRAP stability at 150 mg / ml in sodium phosphate buffer / sucrose formulation. The physical stability of 150 mg / ml VEGF Trap (aflibercept) was tested for two sodium phosphate formulations at 37°C for 28 days. The ingredient list for each of the two formulations is shown in Table 2-1. For each formulation, the HM The formation of W species and the proportion of the major species by SE-UPLC were assessed. [Table 7] [Table 8] [Table 9]

[0123] Figure 2A shows the significant difference in HMW species (%) formed between the two formulations during 28 days of storage at 37°C. There was no significant difference between the two formulations, which was confirmed by the percentage of the major species by SE-UPLC (Figure 2B). There was no change in appearance, turbidity, or pH of the two formulations over the course of 28 days (not shown).

[0124] The results were then compared to a formulation containing 40 mg / ml EYLEA® and Formulation 1 of Example 1 (80 mg / ml VEGF TRAP in sodium phosphate buffer). As expected, the 150 mg / ml VEGF TRAP formulation had a higher rate of HMW species formation compared to the EYLEA® formulation and a slightly higher rate of HMW species formation compared to Formulation 1 of Example 1.

[0125] Further testing was performed on formulations containing high concentrations of VEGF TRAP, and histidine-containing formulations demonstrated better protection of these molecules than sodium phosphate-based formulations. Furthermore, the inclusion of sodium chloride in each of the formulations tested actually resulted in destabilization of VEGF TRAP at 37°C. The data in Example 2 demonstrate that the formulations herein provide excellent protection for physical stability, even at high concentrations of 150 mg / ml VEGF receptor fusion protein and at storage at fairly extreme temperatures.

[0126] Example 3: Pharmaceutically acceptable formulation viscosity can be achieved with 150 mg / ml VEGF TRAP. The viscosity behavior of formulations containing multiple VEGF traps (aflibercept) was examined. Formulations containing VEGF traps ranging from 10 mg / ml to 160 mg / ml were tested in the presence and absence of various viscosity-lowering agents.

[0127] Figure 3A shows a formulation containing 155 mg / ml VEGF Trap in 10 mM sodium phosphate buffer, 5% sucrose, pH 6.2, with combinations of inorganic salts, arginine, lysine, sodium chloride, and magnesium chloride showing little difference in viscosity. In each case, viscosity was measured in cP at 20°C. A range of viscosities was observed, from approximately 17 cP (no inorganic salts) to 15 cP (100 mM magnesium chloride), with little change depending on which viscosity-lowering agent was used, or if no viscosity-lowering agent was present at all. Figure 3B shows a similar series of formulations, except the base buffer is 10 mM histidine and pH 5.8. Here, the absence of inorganic salts resulted in a formulation with a viscosity of 11.5 cP, while 50 mM lysine provided a formulation with a viscosity of 14 cP. The histidine-containing buffer provided excellent viscosity consistent with other low-concentration biologic injectables.

[0128] Figure 3C shows the viscosity of VEGF Trap in 10 mM sodium phosphate, 5% sucrose, pH 6.2, without arginine, and with 50 mM arginine hydrochloride at concentrations ranging from 10 mg / ml to 160 mg / ml. The inclusion of viscosity-reducing agents resulted in similar viscosities at all VEGF Trap concentrations tested. As shown in Figures 3A and 3B, the viscosity-reducing agents had little positive effect on the viscosity of the formulation, even at high protein concentrations. This is a surprising result, as arginine and other viscosity-reducing agents have previously been shown to have beneficial properties on the viscosity of high protein concentrations. [Table 10] [Table 11]

[0129] Example 4: Arginine hydrochloride improves the stability of VEGF TRAP at 150 mg / ml in a sodium phosphate buffer / sucrose formulation. The physical stability of 150 mg / ml VEGF Trap (aflibercept) was tested for two sodium phosphate formulations at 2-8°C for 12 days. The ingredients for each of the two formulations are listed in Table 4-1. Formulation 2 also contains 50 mM arginine hydrochloride. Each formulation was evaluated for HMW species formation and the proportion of the major species by SE-UPLC over the course of 12 months of storage at 37°C. [Table 12]

[0130] Figure 4A shows that the inclusion of 50 mM arginine hydrochloride in the formulation improved the physical stability of VEGF TRAP. This stabilizing attribute of VEGF TRAP is confirmed in Figure 4B, where the proportion of the major VEGF TRAP species remains high in the presence of 50 mM arginine hydrochloride. This data indicates that there are situations in which the addition of arginine hydrochloride provides a stabilizing effect on stored VEGF TRAP. Tabular size exclusion chromatography data are presented in Tables 4-2 and 4-3. [Table 13] [Table 14]

[0131] Example 5: Viscosity of VEGF TRAP from 10 mg / ml to 170 mg / ml in histidine and phosphate buffers Figure 5 shows that both 10 mM phosphate buffer and 10 mM histidine buffer have high useful viscosities over a range of VEGF TRAP (aflibercept) concentrations. At higher VEGF TRAP concentrations, the histidine buffer showed improved viscosity (compared to phosphate). Viscosity was measured at 20°C.

[0132] Example 6: Taurine and propanesulfonic acid provide improved stability for high concentration VEGF TRAP (aflibercept) formulations. Experiments were conducted to determine the effect of multiple formulation combinations on protein stability. Figure 6 shows dynamic light scattering plots for formulations with either 2 mg / ml protein to 10 mg / ml protein (aflibercept). Formulations containing 70 mM taurine or 70 mM PSA showed reduced self-interaction at higher concentrations. These data suggest that taurine and PSA are the two factors at play in this case. As such, it has been shown that it may be a useful ingredient in highly concentrated protein formulations.

[0133] Example 7: Long-term stability studies of various histidine-containing formulations. A total of nine different aflibercept formulations were tested using various buffer concentrations, heat stabilizers, and hydrophobic salts. The nine formulations, F1-F9, are summarized in Table 7-1 below. [Table 15]

[0134] Each formulation was compounded into a 15 mL Falcon tube at 14 mM. The formulation was then sterile filtered using a 0.22 μM syringe filter and filled into sterile 2 mL Type 1 glass vials. In a laminar flow hood, eight vials were filled at 0.4 mL volumes for each formulation.

[0135] SE-UPLC (molecular weight species) was performed on all samples to determine the chemical stability of each formulation.

[0136] The percentage of HMW species over time for each of Formulations F1 to F9 is shown in Figure 7 (see also Table 7-2). For Formulations F4 and F7, the percentage of HMW species was lowest after 4 months at 5°C. The results showed that the addition of excipients such as arginine and proline significantly reduced the rate of HMW species (%) formation in VEGF Trap formulations. [Table 16] [Table 17] [Table 18]

[0137] Example 8: Stability study of 140 mg / mL VEGF Trap with varying arginine concentrations. The effect of varying the concentration of arginine-HCl on the stability of four 140 mg / ml VEGF Trap (aflibercept) eye drug formulations was examined. Stability evaluation was performed at storage conditions of 2-8°C. The drug product (DP) was also incubated under stress (37°C) conditions. The four formulations ( F1 to F4) are listed in Table 8-1 below. [Table 19]

[0138] Approximately 145 mL of the 187 mg / mL VEGF Trap Histidine formulation was thawed. 36 mL of each formulation, except for F3, was compounded, resulting in 39 mL of bulk F3. Each formulation was filter-sterilized in a laminar flow hood (LFH) using a 0.22 μm Durapore PVDF sterilizing filter prior to filling. Stability testing was performed using clean, pyrogen-free 2 mL Type I Schott glass vials stoppered with 13 mm serum stoppers (S2-F451 4432 / 50B2-40).

[0139] SE-UPLC analysis of the formulations was performed as described above. Using SE-UPLC, the HMW measurements (%) for each formulation over time are shown in Figure 8 (A and B). Table 8-2 and Table 8- See also 3.

[0140] When stored at 5°C, these formulations showed a decrease in the rate of HMW species (%) formation that was proportional to the concentration of arginine-HCl. However, under stress, this effect was reversed. The formulations showed a clear increase in HMW species (%) at 37°C, which was proportional to the concentration of arginine-HCl. This characteristic made the discovery of arginine's beneficial effect on aflibercept in the presence of a histidine buffer highly unlikely. Typically, during formulation development in the biotechnology industry, the effects of various excipients on a drug are first screened for short periods under stress (e.g., high temperatures such as 37°C). The goal of this approach is to quickly eliminate excipients that are unlikely to perform well over long periods in the absence of stress (e.g., low temperatures such as 5°C). Here, arginine was identified as a useful excipient despite its impact on stability at 37°C. Because formulated drug products are typically stored at 4–5°C for several months after manufacture, aflibercept in an arginine and histidine buffer is a valuable formulation for long-term drug stability. [Table 20] [Table 21] [Table 22] [Table 23]

[0141] Example 9: Stability of VEGF Trap in the presence of counterions from the Hofmeister series and other excipients. The effect of various counterions and other excipients on the stability of several formulations was determined.

[0142] A. Counterion Screening Counterions (e.g., sulfate, thiocyanate, and citrate) were tested in the sodium salt form with a high concentration of VEGF Trap (aflibercept) formulation (140 mg / ml). Additionally, other amino-added excipients (e.g., glycine and lysine) were also tested.

[0143] Approximately 42 ml of 187 mg / ml VEGF Trap eye drug substance was thawed. 50 ml of intermediate formulated drug substance (155.56 mg / ml) was prepared with a concentration of 110% of the 140 mg / ml formulated drug substance and target excipient concentrations (excluding counterions, glycine and lysine).

[0144] The intermediate formulated drug substance was further diluted with 0.5M excipient source solution (counterion, glycine or lysine) to produce the 140 mg / ml drug substance formulations listed in Table 9-1 below. Each final formulation was filter-sterilized using a 0.22 μm PVDF syringe filter in a laminar flow hood before being filled into clean, pyrogen-free 2 mL Type I Schott glass vials stoppered with 13 mm serum stoppers S2-F451 4432 / 50 82-40 (ELN Item No. 19700004 Wash No. 0000078949). Sixty vials were filled with 0.5 ml of each formulation. Six vials were filled with 1.5 ml. [Table 24]

[0145] B. Glutamate and Aspartate Screening The stability of a high-concentration formulation of VEGF Trap (aflibercept) (140 mg / ml) in the presence of organic counterions in combination with arginine hydrochloride was tested. Additionally, two new counterions (glutamate and aspartate) were tested for compatibility with high concentrations of VEGF Trap (both in combination with and without arginine hydrochloride). The formulations tested are summarized in Table 9-2 below.

[0146] Approximately 50 ml of 187 mg / ml VEGF Trap drug substance was thawed. 60 ml of intermediate formulated drug substance (155.56 mg / ml) was prepared, containing 110% of the 140 mg / ml formulated drug substance and target excipient concentrations (excluding counterions, citrate, glycine, glutamate, and aspartate). The intermediate formulated drug substance was further diluted with 1M stock excipient solutions (arginine hydrochloride, sodium citrate, glycine, monosodium glutamate, and sodium aspartate) to produce the 140 mg / ml drug substance listed in the table below. Each final formulation was filter-sterilized using a 0.22 μm PVDF syringe filter in a laminar flow hood before being filled into clean, pyrogen-free 2 mL Type I Schott glass vials stoppered with 13 mm serum stoppers S2-F451 4432 / 50 B2-40 (ELN Item No. 19700004 Wash No. 0000078949). Sixty vials were filled with 0.5 mL of each formulation. Six vials were filled with 1.5 mL. [Table 25]

[0147] Viscosity testing was performed using a RHEOSENSEm-VROC® viscometer. Approximately 0.5 mL of undiluted sample was loaded into a glass syringe. The sample was equilibrated to the desired temperature and loaded into the chip or measurement cell. Viscosity was calculated by measuring the pressure drop from inlet to outlet, which correlates to the shear stress at the chip wall. Results are expressed as mPas-1 or cp. See Figure 9 and Table 9-3.

[0148] Osmolality tests were performed using a VAPRO vapor pressure osmometer. Approximately 10 μL of undiluted sample was inoculated onto a paper disk. The decrease in dew point temperature as a function of the solution's vapor pressure was measured via a sensitive thermocouple and reported as the solution's osmolality. Results are expressed as mmol / kg or mOsm. See Figure 10 and Table 9-3.

[0149] High molecular weight species in certain formulations were assessed by SE-UPLC over time after storage at 37° C. or 5° C. See Figure 11 (A and B) and Tables 9-4 and 9-5.

[0150] Dynamic light scattering experiments were performed using a DynaPro® Plate Reader II. Approximately 100 μL of undiluted sample was loaded into a 96-well plate. 35 acquisitions were performed for each well at 25°C. Analysis of the autocorrelation function using regularization was performed using the DYNAMICS The analysis was performed using v7.1 software. Radius (nm) vs. % intensity plots and % mass vs. radius (nm) plots were generated to derive the average molecular radius and % polydispersity (%Pd) for each sample. See Figure 12. [Table 26] [Table 27] [Table 28] [Table 29]

[0151] Example 10: Tolerance of IVT delivery of high-dose VEGF Trap (140 mg / ml) in normal rabbits. Anti-VEGF therapeutics administered via intravitreal injection are currently the standard of care for the treatment of neovascular age-related macular degeneration, diabetic macular edema, and retinal vascular occlusive disease. However, monthly or bimonthly intravitreal injections pose a significant treatment burden for patients, caregivers, and physicians. There is an urgent need for more effective and durable treatments in clinical practice. This study investigated the tolerability of a stably formulated, high-dose VEGF Trap (140 mg / ml, equivalent to 14-fold the clinical dose) in normal New Zealand White rabbit eyes.

[0152] Two formulations of high-dose VEGF Trap (aflibercept) in histidine buffer or phosphate buffer were tested. Three rabbits per cohort received 7 mg of VEGF Trap in 50 μL via unilateral intravitreal injection of each formulation. Signs of ocular inflammation were monitored by slit lamp, optical coherence tomography (OCT), and fundus angiography at days 1, 4, and 1 week after intravitreal administration, and weekly thereafter up to week 12. Intraocular pressure was measured using a TonoPen before and 10 and 30 minutes after intravitreal injection, and at all follow-up time points thereafter. Animals were euthanized at week 12.

[0153] The rabbits' eyes were administered one of the following: (1) 140 mg / ml aflibercept, 20 mM histidine, 5% sucrose, 50 mM arginine HCl, 0.03% PS20, pH 5.8; or (2) 140 mg / ml aflibercept, 10 mM sodium phosphate, 5% sucrose, 40 mM sodium chloride, 0.03% PS20, pH 6.2.

[0154] Two of six eyes in the histidine buffer group showed dark shadows in the vitreous up to 8 weeks after IVT, and slit-lamp examination confirmed that this was a localized cataract due to posterior lens damage (procedure-related).One of six eyes in the phosphate buffer group showed dark shadows in the vitreous up to 8 weeks after IVT, and slit-lamp examination confirmed that this was a localized cataract due to posterior lens damage (procedure-related).

[0155] The tested high-dose VEGF Trap (140 mg / ml) formulation was well tolerated in normal New Zealand White rabbit eyes within 12 weeks after a single intravitreal injection. No abnormalities or signs of inflammation were observed in the fundus after a single intravitreal injection of 7 mg of VEGF Trap. The vitreous was clear, and the retinal vascular pattern appeared normal. No retinal detachment, hemorrhage, or optic disc changes were observed. There was no change in intraocular pressure compared to baseline. Baseline fluorescein angiography (FA) and optical coherence tomography (OCT) images of the rabbit eyes are shown in Figure 13 (A-D). Time-dependent changes in FA and OCT images of rabbit eyes in each treatment group over 8 weeks are shown in Figures 14, 15, 16, and 17. Data from the left (OS) or right (OD) eyes of rabbits 326 and 329 are shown.

[0156] Example 11: Evaluation of the stability of formulations UUU to BBBB This study investigated the stability of VEGF Trap (aflibercept) at 60 mg / ml and 120 mg / ml in 10 mM phosphate, 10% or 20% sucrose (Suc), 0 or 50 mM NaCl, 0.03% polysorbate 20, pH 6.2 when incubated for up to 6 months at 37° C. The formulations for this stability study are shown in Table 11-1 below. [Table 30]

[0157] The formulations were filter sterilized using a PVDF 0.2 μm filter in a laminar flow hood before dispensing.

[0158] Vials containing each formulation were stored at 37°C for 1 month. [Table 31] [Table 32]

[0159] All formulations were essentially free of particles by visual inspection and optical density measurements. There was no significant loss of protein as recovered by RP-HPLC after 1 month at 37°C (Table 11-2), and this trend continued out to 6 months.

[0160] The primary degradation pathway of VEGF Trap was aggregation under these conditions (Figure 18(A and B), Table 11-3). The stability of VEGF Trap was determined by the protein and sucrose. The degradation rate was dependent on the sucrose concentration. Formulations with lower concentrations of VEGF Trap and higher concentrations of sucrose were more stable. Maintaining the same protein-to-sucrose ratio did not result in the same degradation rate. For example, F1 and F4 had the same protein-to-sucrose ratio of 3:1, but F4 was less stable than F1 due to its higher protein concentration. Similar trends were observed up to 6 months.

[0161] Example 12: Repeated dose intravitreal toxicity study in monkeys with different aflibercept formulations. This example evaluates the safety of various formulations in cynomolgus monkeys. A total of seven intravitreal doses were administered to both eyes approximately every four weeks for Groups 1-3, and a total of three intravitreal doses were administered to both eyes approximately every four weeks for Groups 4-9. Terminal necropsies were performed approximately one week after the final dose (N=3 / sex / group), and recovery necropsies (2 / sex / group) were performed approximately 12 weeks after the final dose.

[0162] The following evaluations are performed: Safety assessment based on clinical signs, body weight, vital signs, electrocardiogram data (pre-dose, end of treatment and end of recovery), blood pressure measurements (via tail cuff), clinical and anatomic pathology Regular comprehensive eye examinations during the recovery period, including slit lamp examination, indirect ophthalmoscopy, and intraocular pressure measurement Fundus photography, fluorescein angiography, and electroretinogram at pretreatment, week 9 (all groups), week 26 (groups 1-3 only), and at the end of the recovery period Blood and vitreous samples for bioanalysis, ADA analysis, and toxicokinetic evaluation (at the end of the study) [Table 33]

[0163] Formulations tested in any one or more of Groups 1, 2, 3, 4, 5, 6, 7, 8, and / or 9 are expected to be determined to have a safety profile comparable to EYLEA in cynomolgus monkeys, as measured in the evaluations described above.

[0164] Example 13: Stability studies with VEGF Trap products. A formulation containing 114.3 mg / mL VEGF Trap (aflibercept) and 10 mM histidine, pH 5.8, 5% sucrose, 0.03% polysorbate 20, and 50 mM arginine monohydrochloride was prepared in a laminar flow hood (LFH) using a 0.22 μm Durapore PVDF sterile filter prior to filling. 0.3 mL of drug product was filled into clean, pyrogen-depleted 3 mL Type I Schott glass vials and stoppered with 13 mm serum stoppers (S2-F4514432 / 50B2-40). Samples were analyzed at various time points after storage at 37°C or 5°C by size exclusion chromatography (SEC) to determine the presence of high molecular weight species (HMW), low molecular weight species (LMW), and the main peak (main), as well as by microflow imaging, HIAC liquid particle counting (by light obscuration), and microscopy to determine the presence of particles of various sizes.

[0165] Stability and purity data after storage at 37°C, 25°C, and 2-8°C are shown in Figure 19 (A-E). See also Tables 13-1 to 13-4. [Table 34] [Table 35] [Table 36] [Table 37]

[0166] Example 14: Stability study using various concentrations of VEGF Trap. The effect of varying VEGF Trap concentrations on the stability of four VEGF Trap (aflibercept) eye drug formulations was examined. Concentrations ranged from 80 to 140 mg / mL. Stability evaluation was performed at storage conditions of 2 to 8°C. The drug product (DP) was also incubated under stress (37°C) conditions. The four formulations evaluated in this stability study (each of which is designated herein as "CCC") are listed in Table 14-1, shown below.

[0167] Approximately 27 mL of each formulation was prepared in a laminar flow hood (LFH) using a 0.22 μm Durapore PVDF sterile filter prior to filling. Clean, pyrogen-free 2 mL Type I Schott glass vials were filled and stoppered with 13 mm serum stoppers (S2-F4514432 / 50B2-40). Samples were analyzed by size-exclusion ultra-performance liquid chromatography (SE-UPLC) at various time points after storage at 37°C or 2-8°C for the presence (%) of high molecular weight species (HMW) and The main peak (main) was determined.

[0168] Data showing the percentage of HMW after incubation at 2-8°C or 37°C for up to 6 months are shown in Figure 20 (A and B). See also Tables 14-2 and 14-3. When stored at 37°C and 5°C, these formulations showed a positive correlation of the percentage of HMW formation with the concentration of VEGF Trap. The 140 mg / mL formulation showed the highest percentage of HMW species formation. did. [Table 38] [Table 39] [Table 40]

[0169] Example 15: High doses of Eylea are effective in D, L-AAA models of persistent neovascular leakage. The duration of action in the steroid class was extended. In this example, it was determined that there was a four-fold increase in efficacy in dose on the duration of action of aflibercept for inhibiting chronic retinal vascular leakage in the D,L-AAA model.

[0170] The animals used were New Zealand White rabbits 3 months after DL-AAA (DL-α-aminoadipic acid) disease induction. The treatment groups were as follows: Placebo (buffer solution) 50 mcl / eye, n=6 eyes Aflibercept 500mcg in 50mcl, n=7 eyes Aflibercept 2 mg in 50 mcl, n=8 eyes

[0171] The formulation used in each treatment group was 10 mM histidine, 8% sucrose, and 0.03% PS20, pH 5.8. Ocular examinations performed at baseline and weeks 1, 2, 4, 6, 7, 9, 10, 11, 13, and 18 included intraocular pressure (IOP), red-free imaging (to assess vascular morphology), fluorescein angiography (FA) to assess vascular leakage, and optical coherence tomography (OCT) to identify vitreous inflammation. Serum (ADA) and plasma (drug levels) were collected at baseline and weeks 1, 2, 4, 6, and 9.

[0172] The FA study data for each group are shown in Figure 21. These data showed that the inhibition of vascular leakage in the retinas of animals treated with the high dose of aflibercept lasted longer than that of animals treated with the low dose. The number of treated eyes with complete inhibition of vascular permeability was significantly higher in the 2 mg group at all sampling times up to 18 weeks after treatment.

Claims

1. An aqueous pharmaceutical formulation for use in a method for treating an intraocular neovascular disorder in a human subject in need thereof, comprising at least 100 mg / ml aflibercept, a histidine-based buffer, and L-arginine, having a pH of 5.0 to 6.8, and a viscosity of about 5 to 15 centipoise (cP) at 20°C, The method comprises administering at least about 8 mg of aflibercept into the vitreous of a subject's eye in a volume of about 100 microliters or less.

2. 10. The method of claim 1, wherein the subject has a maintained or reduced central retinal thickness following the intravitreal injection.

3. 10. The method of claim 1, wherein the subject maintains or improves best-corrected visual acuity following the intravitreal injection.

4. 2. The liquid medical formulation according to claim 1, which has a viscosity of about 10 to 13 cP at 20°C.

5. 2. The liquid medical formulation according to claim 1, which has a viscosity of about 11 to 12 cP at 20°C.

6. 2. The liquid medical formulation according to claim 1, which has a viscosity of about 12 to 15 cP at 20°C.

7. 2. The liquid pharmaceutical formulation according to claim 1, having a viscosity of about 5 cP at 20°C.

8. 2. The liquid pharmaceutical formulation according to claim 1, having a viscosity of about 6 cP at 20°C.

9. 10. The liquid medical formulation of claim 1, wherein the formulation comprises a sugar.

10. 2. The liquid pharmaceutical formulation of claim 1, wherein the formulation comprises sucrose, trehalose, sorbitol, mannitol, propanesulfonic acid, or glycerol.

11. 2. The liquid medical formulation of claim 1, wherein the formulation comprises a non-ionic surfactant.

12. 2. The aqueous medical formulation according to claim 1, wherein the intraocular neovascular disorder is age-related macular degeneration (wet), macular edema, macular edema after retinal vein occlusion, retinal vein occlusion (RVO), central retinal vein occlusion (CRVO), branch retinal vein occlusion (BRVO), diabetic macular edema (DME), choroidal neovascularization (CNV), iris neovascularization, neovascular glaucoma, postoperative fibrosis in glaucoma, proliferative vitreoretinopathy (PVR), optic lamina neovascularization, corneal neovascularization, retinal neovascularization, vitreous neovascularization, vascular retinopathy, diabetic retinopathy, non-proliferative diabetic retinopathy, and / or proliferative diabetic retinopathy.

13. 13. The liquid medical formulation according to claim 12, wherein the intraocular neovascular disorder is wet age-related macular degeneration.

14. 13. The liquid medical formulation according to claim 12, wherein the intraocular neovascular disorder is diabetic macular edema.

15. 13. The liquid medical formulation according to claim 12, wherein the intraocular neovascular disorder is diabetic retinopathy.

16. 13. The aqueous medical formulation according to claim 12, wherein the intraocular neovascular disorder is non-proliferative diabetic retinopathy.

17. 13. The liquid medical formulation according to claim 12, wherein the intraocular neovascular disorder is proliferative diabetic retinopathy.

18. 13. The liquid medical formulation according to claim 12, wherein the intraocular neovascular disorder is macular edema following retinal vein occlusion.

19. 2. The liquid pharmaceutical formulation according to claim 1, wherein the pH is about 5.

8.

20. 2. The liquid medical formulation according to claim 1, wherein the concentration of aflibercept is 103 to 126 mg / ml.

21. 14. The liquid medical formulation according to claim 13, wherein the concentration of aflibercept is 114.3 mg / ml.

22. 10. The liquid medical formulation according to claim 1, which is administered by intravitreal injection from a prefilled syringe.

23. 2. The liquid medical formulation according to claim 1, comprising about 114.3 mg / ml of aflibercept, The method comprises administering about 8 mg of aflibercept into the vitreous of a subject's eye in a volume of about 70 microliters.

24. 24. The liquid medical formulation according to claim 23, wherein the intraocular neovascular disorder is wet age-related macular degeneration.

25. 24. The liquid medical formulation according to claim 23, wherein the intraocular neovascular disorder is diabetic macular edema.

26. 24. The liquid medical formulation according to claim 23, wherein the intraocular neovascular disorder is diabetic retinopathy.

27. 2. The liquid medical formulation according to claim 1, comprising about 103 to 126 mg / ml of aflibercept, The method comprises administering about 70 microliters of the aqueous pharmaceutical formulation into the vitreous of the subject's eye.

28. 28. The liquid medical formulation according to claim 27, wherein the intraocular neovascular disorder is wet age-related macular degeneration.

29. 28. The liquid medical formulation according to claim 27, wherein the intraocular neovascular disorder is diabetic macular edema.

30. 28. The liquid medical formulation according to claim 27, wherein the intraocular neovascular disorder is diabetic retinopathy.

Citation Information

Patent Citations

  • vegf antagonist formulation

    JP2008535819A

  • Vegf antagonist formulations suitable for intravitreal administration

    JP2009540001A

  • VEGF antagonist formulations

    US20160244504A1

  • A stable liquid formulation of fusion protein with IGG FC domain

    WO2016208989A1

  • Anti-factor d antibody variant conjugates and uses thereof

    WO2017075252A1