How to Produce Beta-Trypsin
A prokaryotic expression system combined with specific chromatography and activation techniques addresses the challenges of trypsin production, achieving high-purity and high-yield beta-trypsin suitable for pharmaceuticals and cosmetics.
Patent Information
- Application Number
- JP2023520068
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-10-01
- Filing Date
- 2021-10-01
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2041-10-01
AI Technical Summary
Existing methods for producing trypsin face challenges in achieving high yield and purity, particularly due to contamination risks from animal-derived sources and the need for excessive purification, which complicates the production of pharmaceutical-grade trypsin.
The production of beta-trypsin is achieved through a prokaryotic expression system, utilizing cation and anion exchange chromatography, and controlled activation conditions to avoid autolysis and enhance purity, meeting Good Manufacturing Practice (GMP) requirements.
This method enables the production of trypsin with >90% purity and high yield, suitable for pharmaceutical and cosmetic applications, while avoiding contamination and meeting GMP standards.
Smart Images

Figure 0007794816000035 
Figure 0007794816000036 
Figure 0007794816000037
Abstract
Description
[Technical Field]
[0001] The present invention relates to methods for producing recombinant trypsin, recombinant trypsin compositions and uses thereof. [Background technology]
[0002] Trypsin is a serine protease found in the digestive systems of many vertebrates, where it functions to hydrolyze proteins into smaller peptides by cleaving peptide chains at the carboxyl side of the amino acids lysine and arginine (unless either is followed by proline). Trypsin originates in the pancreas, where it is produced in an inactive (zymogen) form called trypsinogen. After production in the pancreas, trypsinogen enters the small intestine (via the bile duct), where it is converted to active trypsin. Trypsin (pre-activated from trypsinogen, e.g., by enteropeptidase) then cleaves the terminal hexapeptide from trypsinogen, resulting in a single-chain tryptic protein known as beta-trypsin. After autolysis, other active forms with two or more peptide chains, e.g., alpha-trypsin, which has two peptide chains linked by a disulfide bond, are generated. The activated trypsin can then perform its digestive function.
[0003] Trypsin is widely used in biotechnology and research. For example, it is used in the production of insulin in combination with carboxypeptidase B for the processing of proinsulin precursors into insulin. Trypsin is also used in the production of non-cytotoxic clostridial neurotoxins, such as botulinum neurotoxin (BoNT). BoNT is synthesized as an inactive single-chain polypeptide that is post-translationally activated by a proteolytic cleavage event to form two polypeptide chains joined by a disulfide bond. Cleavage occurs at a specific cleavage site, often referred to as the activation site, located between the cysteine residues that provide the interchain disulfide bond. Trypsin is often used to catalyze this cleavage event; therefore, it is advantageous not to need to engineer an exogenous cleavage site into BoNT.
[0004] Most commercially available trypsin products are purified from animal pancreases, usually bovine or porcine pancreases. However, purification from such animal sources carries the risk of contaminating the trypsin product with pathogens, such as viruses or prions, and may require excessive purification of the trypsin, reducing production yields. Furthermore, animal-derived trypsin is generally not useful for the production of pharmaceuticals such as insulin and BoNT because such trypsins do not meet Good Manufacturing Practice (GMP) requirements.
[0005] Thus, there is a lack of suitable methods for producing trypsin in high yield and of sufficient purity for use in the activation of proteins to be used in pharmaceutical or cosmetic compositions.
[0006] The present invention solves one or more of the problems set forth above. Summary of the Invention
[0007] More particularly, the present invention is based on the surprising discovery that β-trypsin can be produced in high purity and high yield by a prokaryotic expression system, in which a trypsinogen zymogen is expressed, subsequently purified, and then activated to provide trypsin. The inventors have found that the use of a prokaryotic expression system (e.g., a prokaryotic host cell) advantageously overcomes the problems of production scaling and poor protein yield that arise when using eukaryotic expression systems. For example, expression of trypsin in yeast generally results in low, economically unsatisfactory yields.
[0008] The present inventors have found that by expressing trypsinogen instead of the active form (trypsin), the protein does not exhibit autolysis during expression and purification, mitigating the problem of self-cleavage and the resulting reduction in production yield / purity. Advantageously, when trypsinogen is expressed, the protein forms insoluble inclusion bodies containing aggregated trypsinogen (which does not represent the final tertiary structure of the active molecule) that are proteolytically inactive, thus amplifying its ability to avoid autolysis. Insoluble inclusion bodies are insoluble (albeit stable) aggregates (usually nuclear or cytoplasmic aggregates) of the expressed protein. The advantage of expressing trypsinogen to form inclusion bodies was quite surprising, since it has generally been thought that the formation of insoluble inclusion bodies should be avoided when expressing proteins because the downstream processes required to solubilize and refold the proteins present in such inclusion bodies are thought to significantly impair production yield.
[0009] Advantageously, the present invention utilizes a combination of cation exchange chromatography (before trypsinogen renaturation) and anion exchange chromatography (following trypsinogen renaturation). The anion exchange chromatography step is conveniently performed at a pH below the pI of trypsinogen (e.g., such that trypsinogen has a net positive charge). The inventors surprisingly found that the net charge difference between the impurities / contaminants (net negative charge) and trypsinogen (net positive charge) at these conditions allows for rapid flow-through of trypsinogen for retention and collection of the impurities / contaminants on the anion exchange column, leading to increased removal of host cell-derived contaminants (e.g., bacterial endotoxins, host cell proteins, and host cell DNA) and, therefore, a highly pure trypsin product. Indeed, the inventors have demonstrated that purity levels of >90% are rapidly achievable by the methods of the present invention. As such, the present invention allows for the production of trypsin that meets Good Manufacturing Practice (GMP) requirements and advantageously finds utility in activating proteins to be used as part of pharmaceutical or cosmetic compositions. Advantageously, the "flow-through" approach applied to the anion exchange chromatography (AEX) step allows for the recovery of high yields (relative to AEX input) of the target polypeptide (trypsinogen), while contaminants remain bound to the column. Take, as an example, Figure 4A "First Confirmation Run," which outlines a table of protein yields after various steps of the method described herein. Notably, the "step yield" (yield relative to input) after AEX / Eshmuno Q is higher than after any of the other "purification steps" in the aforementioned "First Confirmation Run," while the "total yield" is reduced by only 3%. This observation indicates an advantageous "positive enrichment" of trypsinogen due to the removal of contaminants.
[0010] Furthermore, the inventors have demonstrated that certain steps, particularly the activation step (e.g., trypsinogen is cleaved to β-trypsin by autocleavage), provide improved results in the absence of aggregation inhibitors such as L-arginine. In the case of the activation step, the omission of L-arginine is thought to allow polypeptides to interact more easily, leading to improved trypsinogen-trypsinogen (or trypsin-trypsinogen) interactions required for activation / cleavage. Regardless, the presence of L-arginine in an initial step (e.g., renaturation) is advantageous. Thus, methods of the present invention in which the step of renaturing trypsinogen is performed in the presence of L-arginine (the presence of L-arginine is advantageous for supporting refolding) include subsequent steps performed in the absence of L-arginine. Such an approach involves / requires the presence of trypsinogen in a buffer in the absence of L-arginine for a certain period of time (e.g., during preparation for the activation step), which the inventors have demonstrated can lead to reduced stability of the trypsinogen preparation (see Example 2). Without wishing to be bound by theory, it is believed that in the absence of L-arginine, an aggregation inhibitor, (non-activated) trypsinogen molecules aggregate and form precipitates. Advantageously, however, the inventors have demonstrated that such aggregation can be suppressed or even avoided by adhering to certain temperature thresholds and / or maximum "holding times" (times during which trypsinogen is held in the absence of L-arginine).
[0011] Thus, the inventors have not only identified the problems associated with the approach of performing activation without L-arginine, but also demonstrated an advantageous solution for overcoming said problems. As such, it is possible to perform renaturation in the presence of L-arginine (when advantageous) without compromising the stability of the trypsinogen preparation, while still removing L-arginine (when disadvantageous) before the activation step. DETAILED DESCRIPTION OF THE INVENTION
[0012] In a first aspect, there is provided a method for producing beta-trypsin, comprising the steps of: a) renaturing denatured trypsinogen (or renaturing purified denatured trypsinogen), thereby producing renatured trypsinogen, wherein the renaturing step is carried out in a buffer containing L-arginine; b) purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen; and c) incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, which cleaves the trypsinogen into β-trypsin by said proteolytic activity; Including, Steps a) and b) are carried out under conditions that do not promote the proteolytic activity of trypsinogen, The method does not include the addition of an additional protease to cleave trypsinogen to beta-trypsin; At least step c) is carried out in a buffer that does not contain L-arginine, and Prior to step c), trypsinogen, when present in a buffer without L-arginine, is not subjected to a temperature of >8°C for more than 38 hours. A method is provided.
[0013] In a preferred embodiment, the term "prior to step c), the trypsinogen, when present in a buffer containing no L-arginine, is not subjected to a temperature of >8°C for more than 38 hours" refers to a step subsequent to the step of refolding denatured trypsinogen (e.g., the step of the first aspect), and optionally includes said step of refolding denatured trypsinogen.
[0014] Those skilled in the art will appreciate that the time a polypeptide (trypsinogen) may be subjected to temperatures >8° C. may vary as a function of temperature. For example, as the temperature increases (e.g., to >10° C., >15° C., etc.), it may be preferable to simultaneously decrease the time the polypeptide is subjected to such temperatures.
[0015] In certain embodiments, prior to step c), the trypsinogen when present in a buffer that does not contain L-arginine is not subjected to the following temperatures: ≥ 10°C for more than 30 hours, or ≥ 15°C for more than 20 hours, or ≥ 20°C for more than 15 hours, or ≧25℃, longer than 5 hours.
[0016] In one embodiment, prior to step c), the trypsinogen, when present in a buffer that does not contain L-arginine, is subjected to a temperature of 15-30°C for no longer than 20 hours, preferably the trypsinogen is subjected to a temperature of 15-30°C for no longer than 10 hours, more preferably the trypsinogen is subjected to a temperature of 15-30°C for no longer than 5 hours.
[0017] In an even more preferred embodiment, prior to step c), the trypsinogen when present in a buffer free of L-arginine is subjected to a temperature of between 15 and 30° C. for no longer than 2 hours.
[0018] For example, prior to step c), the trypsinogen may not be subjected to a temperature >8°C when present in a buffer that does not contain L-arginine.
[0019] The trypsinogen is preferably prokaryotically expressed, in other words, the denatured trypsinogen (e.g., in step a)) preferably originates from a prokaryotic host cell.
[0020] Step a) (e.g., of the first embodiment) may be preceded by one or more of the following steps: i. culturing a prokaryotic host cell containing a nucleotide sequence encoding trypsinogen, wherein the nucleotide sequence is operably linked to an inducible promoter; ii. inducing expression of trypsinogen by the host cell, thereby forming one or more insoluble inclusion bodies containing trypsinogen; iii. isolating one or more insoluble inclusion bodies from the host cells; iv. solubilizing one or more insoluble inclusion bodies, thereby producing denatured trypsinogen; and / or v. Purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen.
[0021] Preferably, prior to step a) (e.g., of the first embodiment), the denatured trypsinogen may be purified by cation exchange chromatography, thereby providing purified denatured trypsinogen, which may then be renatured during step a) of the method.
[0022] The following steps may be carried out before step a) (e.g., of the first embodiment): i. culturing a prokaryotic host cell containing a nucleotide sequence encoding trypsinogen, wherein the nucleotide sequence is operably linked to an inducible promoter; ii. inducing expression of trypsinogen by the host cell, thereby forming one or more insoluble inclusion bodies containing trypsinogen; iii. isolating one or more insoluble inclusion bodies from the host cells; iv. solubilizing one or more insoluble inclusion bodies, thereby producing denatured trypsinogen; and v. Purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen.
[0023] Steps a) and b) (e.g. of the first aspect) may be carried out in the absence of calcium. Additionally or alternatively, steps ii), iii), iv) and / or v) (e.g. of the first aspect as outlined in the previous paragraph) may be carried out in the absence of calcium.
[0024] In a second aspect, there is provided a method of producing beta-trypsin, the method comprising: a) culturing a prokaryotic host cell containing a nucleotide sequence encoding trypsinogen, wherein the nucleotide sequence is operably linked to an inducible promoter; b) inducing expression of trypsinogen by the host cell, thereby forming one or more insoluble inclusion bodies containing trypsinogen; c) isolating one or more insoluble inclusion bodies from the host cells; d) solubilizing one or more insoluble inclusion bodies, thereby producing denatured trypsinogen; e) purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen; f) renaturing the purified denatured trypsinogen, thereby producing renatured trypsinogen, optionally wherein the renaturing step is carried out in a buffer comprising L-arginine; g) purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen; h) incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, which cleaves the trypsinogen into beta-trypsin; and i) isolating beta-trypsin by affinity chromatography; wherein steps f) and g) are carried out under conditions that do not promote the proteolytic activity of trypsinogen, and the method does not include the addition of an additional protease to cleave trypsinogen to β-trypsin; Optionally, at least step h) is carried out in a buffer that does not contain L-arginine; Optionally, prior to step h), the trypsinogen when present in a buffer that does not contain L-arginine is subjected to a temperature >8° C. for no longer than 38 hours.
[0025] Preferably, the refolding step (eg step f)) is carried out in a buffer containing L-arginine.
[0026] In a preferred embodiment, the term "prior to step h), the trypsinogen when present in an L-arginine-free buffer is not subjected to a temperature of >8°C for longer than 38 hours" refers to a step subsequent to, and optionally including, the step of refolding denatured trypsinogen (e.g., step f) of the second aspect).
[0027] In certain embodiments, prior to step h), the trypsinogen when present in a buffer that does not contain L-arginine is not subjected to a temperature of: ≥ 10°C for more than 30 hours, or ≥ 15°C for more than 20 hours, or ≥ 20°C for more than 15 hours, or ≧25℃, longer than 5 hours.
[0028] In one embodiment, prior to step h), the trypsinogen when present in an L-arginine-free buffer is subjected to a temperature of 15-30°C for no longer than 20 hours, preferably the trypsinogen is subjected to a temperature of 15-30°C for no longer than 10 hours, more preferably the trypsinogen is subjected to a temperature of 15-30°C for no longer than 5 hours.
[0029] In an even more preferred embodiment, prior to step h), the trypsinogen, when present in a buffer free of L-arginine, is subjected to a temperature of between 15 and 30° C. for no longer than 2 hours.
[0030] For example, prior to step h), trypsinogen may not be subjected to temperatures >8°C if it is present in a buffer that does not contain L-arginine.
[0031] The term "L-arginine-free buffer" refers to a buffer that is substantially free of L-arginine. A buffer that is substantially free of L-arginine may have an L-arginine concentration of less than 50 mM, 25 mM, 10 mM, preferably less than 1 mM. More preferably, the term "L-arginine-free buffer" as used herein refers to a buffer that does not contain L-arginine.
[0032] In one embodiment, the step of purifying the renatured trypsinogen by anion exchange chromatography is carried out in a buffer that does not contain oxidized glutathione (GSSG) and / or reduced glutathione (GSH). For example, the step of purifying the renatured trypsinogen by anion exchange chromatography can be carried out in a buffer that does not contain GSSG or GSH.
[0033] The term "GSSG-free buffer" refers to a buffer that is substantially free of GSSG. A buffer that is substantially free of GSSG may have a GSSG concentration of less than 50 mM, 25 mM, 10 mM, preferably less than 1 mM. More preferably, the term "GSSG-free buffer" as used herein refers to a buffer that is free of GSSG. The term "GSH-free buffer" refers to a buffer that is substantially free of GSH. A buffer that is substantially free of GSH may have a GSH concentration of less than 50 mM, 25 mM, 10 mM, preferably less than 1 mM. More preferably, the term "GSH-free buffer" as used herein refers to a buffer that is free of GSH.
[0034] Steps f) and g) (e.g. of the second aspect) may be carried out in the absence of calcium. Additionally or alternatively, steps b), c), d) and / or e) (e.g. of the second aspect) may be carried out in the absence of calcium.
[0035] The method of the invention may include one or more further purification steps which may or may not be carried out under conditions which promote the proteolytic activity of trypsinogen, although said further steps are preferably also carried out under conditions which do not promote the proteolytic activity of trypsinogen.
[0036] In one embodiment, the step of incubating purified trypsinogen under conditions that promote the proteolytic activity of trypsinogen (e.g., step c of the first aspect, step h of the second aspect above) is carried out up to 120 minutes from the step of providing purified renatured trypsinogen (e.g., up to 120 minutes from step b of the first aspect, step g of the second aspect), preferably up to 75 minutes from the step of providing purified renatured trypsinogen.
[0037] In a more preferred embodiment, the step of incubating the purified trypsinogen under conditions that promote the proteolytic activity of trypsinogen is carried out up to 60 minutes after the step of providing purified renatured trypsinogen. This can be particularly advantageous if the purified renatured trypsinogen is maintained at a temperature of 15-25°C (e.g., 20°C) prior to the step of incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0038] In embodiments in which anion exchange chromatography is performed in the absence of L-arginine (or other stability-enhancing excipients), it may be particularly advantageous to perform the step within 120 minutes (preferably within 75 minutes, more preferably within 60 minutes) of the step of providing purified renatured trypsinogen. Working within this time frame can avoid trypsinogen precipitation / aggregation (with concomitant loss of proteolytic activity and autocleavage to β-trypsin) that may otherwise occur due to the lack of L-arginine in purified renatured trypsinogen preparations.
[0039] For example, the step of incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen can be carried out up to 45, 30, or 15 minutes from the step of providing purified renatured trypsinogen. Again, this can be particularly advantageous if the purified renatured trypsinogen is held at a temperature of 15-25°C (e.g., 20°C) prior to the step of incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0040] Advantageously, by providing the step of purifying the renatured trypsinogen (e.g., step g) by anion exchange chromatography, the inventors have found that it is possible to obtain a β-trypsin preparation of higher purity and yield when compared to prior art β-trypsin preparations lacking the (additional) chromatography step. This technical effect was entirely unexpected, since anion exchange chromatography (normally used to purify proteins with low isoelectric points, pIs) was not predicted to provide an advantage in the purification of trypsinogen, which has a high pI of 9.3 (and therefore would not bind to the ion exchange resin and would have a net positive or neutral charge at the usual pH values used in purification). However, the inventors have found that the high pI of trypsinogen can be exploited, as it allows the protein to easily pass through the anion exchange column, while impurities (e.g., impurities with a net negative charge) are retained and therefore separated from the trypsinogen. Thus, the anion exchange chromatography step can be performed under conditions that provide renatured trypsinogen with a net positive charge, allowing it to be separated from net negative-charge impurities. As outlined above, the "flow-through" approach applied to the anion exchange chromatography (AEX) step allows for the recovery of a high yield (relative to the AEX input) of the target polypeptide (trypsinogen), while contaminants remain bound to the column. Take, as an example, Figure 4A "First Confirmation Run," which outlines a table of protein yields after various steps of the method described herein. Notably, the "step yield" (yield relative to input) after AEX / Eshmuno Q is higher than after any of the other "purification steps" in the aforementioned "First Confirmation Run," while the "total yield" is reduced by only 3%. This observation indicates an advantageous "positive enrichment" of trypsinogen due to the removal of contaminants.
[0041] In one embodiment, the anion exchange chromatography step is carried out under conditions in which the renatured trypsinogen has a net positive charge.
[0042] The step of purifying the denatured trypsinogen by cation exchange chromatography can (additionally or alternatively) be carried out under conditions in which the renatured trypsinogen has a net positive charge, e.g., under such conditions, trypsinogen binds to a cation exchange resin (which has a negative charge).
[0043] Without wishing to be bound by theory, it is believed that by utilizing this additional purification step prior to the activation step (e.g., step h), the activation step is not hindered by impurities retained by the anion exchange resin, and therefore may provide improved yields of activated beta-trypsin. This is in contrast to prior art methods in which a final purification or "polishing" step is utilized only after activation (i.e., the actual trypsin preparation itself is polished).
[0044] In a preferred embodiment, the renatured trypsinogen is present in a fraction that does not interact, or only weakly interacts, with the anion exchange chromatography medium. For example, the fraction may contain a pH that is below the isoelectric point (pI) of the renatured trypsinogen (e.g., a pH less than 9.2, preferably ≦9.0, more preferably ≦8.5). A particularly preferred pH is in the range of about pH 6.5 to 7.5.
[0045] Isoelectric point (pI) is a specific property of a given protein. More specifically, isoelectric point (pI) is defined as the pH value at which a protein exhibits a net charge of zero. An increase in pI means that a higher pH value is required for the protein to exhibit a net charge of zero. Therefore, an increase in pI represents an increase in the net positive charge of a protein at a given pH. Conversely, a decrease in pI means that a lower pH value is required for the protein to exhibit a net charge of zero. Therefore, a decrease in pI represents a decrease in the net positive charge of a protein at a given pH.
[0046] Methods for determining the pI of a protein are known in the art and will be familiar to those skilled in the art. As an example, the pI of a protein can be calculated from the average pKa value of each amino acid present in the protein ("calculated pI"). Such calculations can be performed using computer programs known in the art, such as the Compute pI / MW Tool from ExPASy (https: / / web.expasy.org / compute_pi / ), which is a preferred method for calculating pI according to the present invention. Comparison of pI values between different molecules should be performed using the same calculation technique / program. If necessary, the calculated pI of a protein can be experimentally confirmed using the technique of isoelectric focusing ("observed pI"). This technique uses electrophoresis to separate proteins according to their pI. Isoelectric focusing is usually performed using a gel with an immobilized pH gradient. When an electric field is applied, proteins migrate down the pH gradient until they reach a pH at which they have a zero net charge, which is the pI of the protein. The results provided by isoelectric focusing are usually relatively low resolution in nature, and therefore the inventors believe that the results provided by calculated pI (as above) are more appropriate to use. Throughout this specification, "pI" means "calculated pI" unless otherwise specified.
[0047] For example, "conditions under which the renatured trypsinogen has a net positive charge" may mean that the anion exchange chromatography step is carried out at a pH of less than 9.2, preferably ≦9.0, and more preferably ≦8.5. For example, the pH may be appropriately ≧pH 6.5 and ≦8.0, and even more appropriately ≧pH 6.5 and ≦7.5. For example, the renatured trypsinogen (e.g., to be purified by anion exchange chromatography) may be present in a buffer having a pH of less than 9.2, preferably ≦9.0, and more preferably ≦8.5.
[0048] In a preferred embodiment, the pH during anion exchange in the methods described herein may be ≧pH 7.3 and ≦7.6.
[0049] The methods of the present invention may include a buffer exchange step to provide renatured trypsinogen in a buffer lacking a stability-enhancing excipient (such as L-arginine), optionally performed prior to purifying the trypsinogen by anion exchange chromatography to obtain purified trypsinogen. An example of such a buffer (e.g., lacking a stability-enhancing excipient) is 25-100 mM Tris, preferably 50 mM Tris. The buffer may have a pH of 7.0-8.0, preferably about pH 7.4.
[0050] In one embodiment, the step of purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen (e.g., step g)), is carried out at a temperature of less than 15°C, for example, at a temperature of 1 to 10°C, more preferably at a temperature of 2 to 8°C. Alternatively, the step of purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen (e.g., step g)), can be carried out at a temperature of at least 15°C, for example, at a temperature of 15 to 25°C, more preferably at a temperature of 20 to 25°C.
[0051] Advantageously, the volume of renatured trypsinogen may be reduced prior to anion exchange chromatography to reduce the volume to be subjected to purification.
[0052] In one embodiment, the method includes subjecting the renatured trypsinogen (e.g., prior to anion exchange chromatography) to a volume reduction step, e.g., thereby providing renatured trypsinogen with reduced volume. Additionally or alternatively, the method may include subjecting the purified renatured trypsinogen to a volume reduction step (e.g., following anion exchange chromatography), e.g., thereby providing purified renatured trypsinogen with reduced volume.
[0053] The "volume reduction step" reduces the volume of the renatured trypsinogen relative to the volume of the renatured trypsinogen before the volume reduction step. The volume can be reduced by at least 2-fold, 4-fold, 10-fold, 15-fold, or 20-fold relative to the volume before the volume reduction step. Preferably, the volume reduction step reduces the volume of the renatured trypsinogen by at least 10-fold relative to the volume of the renatured trypsinogen before the volume reduction step.
[0054] In a preferred embodiment, the volume reduction step is carried out before the step of purifying the renatured trypsinogen by anion exchange chromatography.
[0055] The method may further comprise subjecting the renatured trypsinogen (e.g., prior to anion exchange chromatography) to a filtration step that removes molecules having a size less than 20 kDa, preferably less than 15 kDa, and more preferably less than 10 kDa. Additionally or alternatively, the method may further comprise subjecting the purified renatured trypsinogen (e.g., following anion exchange chromatography) to a filtration step that removes molecules having a size less than 20 kDa, preferably less than 15 kDa, and more preferably less than 10 kDa.
[0056] The filtration step preferably has the effect of removing L-arginine from the renatured trypsinogen (e.g., prior to anion exchange chromatography) or from the purified renatured trypsinogen (e.g., following anion exchange chromatography). Thus, the method may further comprise the step of subjecting the renatured trypsinogen (e.g., prior to anion exchange chromatography) to a filtration step that removes L-arginine. Additionally or alternatively, the method may further comprise the step of subjecting the purified renatured trypsinogen (e.g., following anion exchange chromatography) to a filtration step that removes L-arginine.
[0057] Additionally or alternatively, the filtration step may have the effect of removing GSSG or GSH.
[0058] In a preferred embodiment, a filtration step is carried out before the step of purifying the renatured trypsinogen by anion exchange chromatography.
[0059] The volume reduction step can be performed before, simultaneously with, or subsequent to the filtration step, for example, the renatured trypsinogen can be subjected to tangential flow filtration to simultaneously reduce the volume, e.g., provide a volume reduction step and remove molecules having a size of less than 20 kDa (preferably less than 15 kDa, more preferably less than 10 kDa), e.g., a filtration step.
[0060] A "filtration step" encompasses any suitable means for removing molecules having a size as described herein (e.g., less than 20 kDa). For example, a filtration step can be performed using a filter, e.g., a filter with a molecular weight cutoff of 20 kDa (preferably 15 kDa, more preferably 10 kDa). For example, the filter can retain molecules having a size of ≧20 kDa, preferably ≧15 kDa, more preferably ≧10 kDa.
[0061] Additionally or alternatively, the filtration step can be carried out by dialysis, for example by separating renatured trypsinogen from molecules having a size of less than 20 kDa (preferably less than 15 kDa, more preferably less than 10 kDa) based on differences in their rates of diffusion through a semipermeable membrane, e.g., dialysis tubing.
[0062] "Denatured" trypsinogen is trypsinogen that has not been folded into the protein's native structure (e.g., secondary and / or tertiary), such that the trypsinogen does not have the basal level of proteolytic activity that folded trypsinogen has. Denatured trypsinogen can be provided by contacting trypsinogen with a denaturing agent, e.g., urea and / or a reducing agent, e.g., 1,4-dithiothreitol (DTT).
[0063] Advantageously, denatured trypsinogen does not self-cleave (autolyze) during the purification process of the present invention, resulting in a higher yield of trypsinogen (and thus beta-trypsin).
[0064] Reference to "renaturing" purified denatured trypsinogen means that the denatured trypsinogen is folded into the protein's native structure (e.g., secondary and / or tertiary, thus providing folded / renatured trypsinogen). Denatured trypsinogen can be renatured by contacting the denatured trypsinogen with an aggregation inhibitor, such as arginine (e.g., L-arginine), oxidized glutathione (GSSG), and / or reduced glutathione (GSH), preferably L-arginine.
[0065] It is preferable to refold most or all of the denatured trypsinogen to increase the yield of refolded trypsinogen to be cleaved, and thus provide an increased yield of β-trypsin. The inventors have identified particularly advantageous conditions under which the refolding step can be carried out, which increase the yield of refolded trypsinogen.
[0066] In one embodiment, in the step of refolding purified denatured trypsinogen, L-arginine is present at a concentration of 0.6 M to <1 M. For example, L-arginine may preferably be present at a concentration of about 0.75 M. The present inventors have surprisingly found that an L-arginine concentration in this range (0.6 M to <1 M) is particularly advantageous for enhancing the yield of refolded trypsinogen (see FIG. 6A).
[0067] Additionally or alternatively, in the step of refolding purified denatured trypsinogen, the denatured trypsinogen may be present at a concentration of <0.2 mg / mL. For example, the denatured trypsinogen may be present at a concentration of >0.06 mg / mL to <0.2 mg / mL, preferably 0.08 mg / mL to 0.15 mg / mL, and more preferably about 0.1 mg / mL. The inventors have surprisingly found that performing the renaturation step using a (starting) denatured trypsinogen concentration within this range (<0.2 mg / mL) is particularly advantageous for enhancing the yield of renatured trypsinogen (see FIG. 6B).
[0068] Both of these conditions (L-arginine and denatured trypsinogen concentrations) can be used in combination to synergistically enhance the yield of renatured trypsinogen (see Figure 6B).
[0069] Alternatively, or in addition, the denatured trypsinogen can be regenerated by removing the denaturant, for example, removing the denaturant utilized during the step of solubilizing one or more insoluble inclusion bodies (e.g., step d). The denaturant can be removed by filtration and / or diafiltration.
[0070] The term "producing denatured trypsinogen" means producing denatured trypsinogen that is not contained within insoluble inclusion bodies. For example, "producing denatured trypsinogen" preferably includes producing soluble (e.g., solubilized) denatured trypsinogen.
[0071] A particularly advantageous prokaryotic host cell that can be used to form such insoluble inclusion bodies is an E. coli host cell. Thus, in one embodiment, the prokaryotic host cell is an E. coli host cell (such as E. coli BL21(DE3)).
[0072] Trypsinogen is known to undergo autoactivation, a self-amplifying biomolecular reaction in which trypsinogen is autoactivated to provide trypsin, which in turn can activate a trypsinogen molecule to produce two trypsin molecules. Furthermore, this autocatalytic activity is known to be either promoted or disrupted depending on factors such as local pH, the presence or absence of metal ions, and / or the presence or absence of trypsinogen inhibitors. As an example (regarding the latter), inhibitors of certain proteases (e.g., trypsinogen) may be present in the pancreas (where trypsinogen is produced) to suppress proteolytic activity and thus prevent autolysis of the pancreas, which can lead to pancreatitis. Furthermore, metal ion (e.g., calcium) concentrations in the pancreas may be maintained below thresholds that would otherwise promote the proteolytic activity of proteases such as trypsinogen and trypsin. Indeed, it has been demonstrated that hypercalcemia (resulting in abnormally high serum calcium concentrations) can induce pancreatitis due to overactivation of proteases in the pancreas.
[0073] The term "conditions that promote the proteolytic activity of trypsinogen" means that trypsinogen is incubated under conditions that favor / stimulate a basal level of proteolytic activity of trypsinogen, resulting in its autocleavage / autolysis into trypsin; for example, the incubation conditions may include the presence of a substance that accelerates (e.g., promotes) the autolysis of trypsinogen. Thus, the term "promote" may be used synonymously with the terms "stimulate," "induce," and / or "accelerate."
[0074] Conditions that promote the proteolytic activity of trypsinogen are well known in the art and include incubation of trypsinogen in the presence of metal ions, e.g., 50 mM calcium, Ca ++It has been shown that the presence of trypsinogen (in 0.1 M Tris-HCl buffer, pH 8.1) allows autoactivation of trypsinogen even in the presence of trypsin inhibitors (J Kay, B Kassell, J Biol Chem. 1971 Nov;246(21):6661-5). The presence of other metal ions (such as strontium, barium, magnesium, sodium, lithium, potassium, ammonium, rubidium, cesium, and neodymium) is also known to provide suitable conditions for promoting the proteolytic activity of trypsinogen.
[0075] The amino terminus of vertebrate trypsinogen contains the sequence Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 4, highly conserved during vertebrate evolution). Trypsinogen can autocleave the peptide bond between the lysine residue of this conserved sequence and the following amino acid residue, usually isoleucine (e.g., under conditions that promote the proteolytic activity of trypsinogen). The resulting N-terminal peptide, known as "trypsinogen activation peptide," is then released (see Figure 3). Trypsinogen activation peptide (TAP) is a by-product of the trypsinogen (auto)activation process.
[0076] Autoactivated trypsinogen that lacks the trypsinogen activation peptide is sometimes referred to herein as "truncated trypsinogen" (or simply "trypsin").
[0077] The conditions can be confirmed to be suitable for promoting the proteolytic activity of trypsinogen by detecting cleaved trypsinogen (lacking the trypsinogen activation peptide) after incubating purified renatured trypsinogen under the above conditions, optionally in the presence of, for example, a trypsin inhibitor at a concentration that inhibits trypsin activity.
[0078] Due to the removal of the trypsinogen activation peptide, the size of the activated trypsinogen molecule is usually reduced from about 24 kDa to about 23.8 kDa. Therefore, cleavage of the trypsinogen activation peptide can be conveniently detected by identifying a reduction in the size of the trypsinogen molecule, indicating a change from the inactive / zymogen form (containing the trypsinogen activation peptide) to a cleaved trypsinogen (e.g., trypsin) form lacking the trypsinogen activation peptide. Such a reduction in size can be conveniently measured by SDS-PAGE analysis or by chromatography (see Figure 3A). Suitable chromatographic techniques include high-performance liquid chromatography, such as reverse-phase high-performance liquid chromatography.
[0079] Additionally or alternatively, the proteolytic activity of trypsinogen can be confirmed by detecting the presence of (cleaved) trypsinogen activator peptide, for example, by a suitable immunoassay (preferably, an ELISA) for the specific detection of cleaved trypsinogen activator peptide. An example of a suitable commercially available kit for performing an ELISA to quantify TAP is the "Bovine Trypsinogen Activator Peptide (TAP) ELISA Kit" (MyBioSource Inc., catalog number MBS2609836).
[0080] "Conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after one hour, at least 20% of the trypsinogen present in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. For example, after one hour, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% (preferably at least 40%) of the trypsinogen in the sample has released its trypsinogen activation peptide and is therefore converted to trypsin. Preferably, "conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after one hour, at least 50% of the trypsinogen in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. The percentage (%) values are intended to be relative to the baseline level of trypsinogen, e.g., the level of trypsinogen at ≦1 minute, ≦0.5 minutes, or ≦0.1 minutes (preferably 0 minutes) after the start of the step of incubating purified, renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0081] "Conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 1 hour, at least 20% of the trypsinogen present in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. For example, after 5 hours, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% (preferably at least 40%) of the trypsinogen in the sample has released its trypsinogen activation peptide and is therefore converted to trypsin. Preferably, "conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 5 hours, at least 50% of the trypsinogen in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. The percentage (%) values are intended to be relative to the baseline level of trypsinogen, e.g., the level of trypsinogen at ≦1 minute, ≦0.5 minutes, or ≦0.1 minutes (preferably 0 minutes) after the start of the step of incubating purified, renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0082] "Conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 1 hour, at least 20% of the trypsinogen present in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. For example, after 10 hours, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% (preferably at least 40%) of the trypsinogen in the sample has released its trypsinogen activation peptide and is therefore converted to trypsin. Preferably, "conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 5 hours, at least 50% of the trypsinogen in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. The percentage (%) values are intended to be relative to the baseline level of trypsinogen, e.g., the level of trypsinogen at ≦1 minute, ≦0.5 minutes, or ≦0.1 minutes (preferably 0 minutes) after the start of the step of incubating purified, renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0083] "Conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 10 hours, at least 20% of the trypsinogen present in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. For example, after 15 hours, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% (preferably at least 50%) of the trypsinogen in the sample has released its trypsinogen activation peptide and is therefore converted to trypsin. Preferably, "conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after 20 hours, at least 50% (preferably at least 80%) of the trypsinogen in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. The percentage (%) values are intended to be relative to the baseline level of trypsinogen, e.g., the level of trypsinogen at ≦1 minute, ≦0.5 minutes, or ≦0.1 minutes (preferably 0 minutes) after the start of the step of incubating purified, renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0084] Preferably, the determination is carried out in the presence of a trypsin inhibitor (e.g., at a concentration that inhibits trypsin activity). Examples of suitable trypsin inhibitors include diisopropyl fluorophosphate, 3,4-dichloroisocoumarin serine protease inhibitor, benzamidine hydrochloride, and 4-amidinophenylmethanesulfonyl fluoride hydrochloride serine protease inhibitor. A preferred trypsin inhibitor is diisopropyl fluorophosphate, preferably at a concentration of 0.05 to 0.15 mM (more preferably, about 0.10 mM).
[0085] In contrast, "conditions that do not promote the proteolytic activity of trypsinogen" can be conditions under which trypsinogen has substantially no proteolytic activity. Thus, "conditions that do not promote the proteolytic activity of trypsinogen" can be conditions under which, after one hour, less than 20% of the trypsinogen present in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin. For example, after one hour, less than 15%, 10%, 5%, 1%, or 0.01% of the trypsinogen in the sample has released its trypsinogen activation peptide and is therefore converted to trypsin. Preferably, "conditions that promote the proteolytic activity of trypsinogen" can be conditions under which, after one hour, 0% of the trypsinogen in the sample has released its trypsinogen activation peptide (e.g., autocleaved) and is therefore converted to trypsin.
[0086] The proteolytic activity of trypsinogen can be promoted (e.g., accelerated) by incubating trypsinogen in the presence of suitable metal ions, such as alkali metal ions, alkaline earth metal ions, and / or lanthanide ions. Specific examples of suitable metal ions include calcium, strontium, barium, magnesium, sodium, lithium, potassium, ammonium, rubidium, cesium, and / or neodymium cations. For ease of use, the cations can be associated with appropriate anions, such as sulfate, citrate, acetate, chloride, and / or fluoride anions. Metal ions (e.g., cations) may be added to a final concentration of at least 10 mM, more preferably at least 20 mM (e.g., in a step of incubating purified, renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen). For example, metal ions may be added to a final concentration of 20 to 150 mM. In a preferred embodiment, metal ions are added to a final concentration of 50 to 100 mM.
[0087] In one embodiment, the proteolytic activity of renatured trypsinogen and / or trypsinogen is enhanced by calcium (e.g., Ca ++ This is promoted by the addition of
[0088] In one embodiment, calcium may be added to a final concentration of at least 10 mM, preferably at least 20 mM, in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen (e.g., step c of the first aspect, step h of the second aspect). For example, calcium may be added to a final concentration of 20 to 150 mM, preferably 50 to 100 mM.
[0089] In one embodiment, in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen (e.g., step c of the first aspect, step h of the second aspect), the sample is incubated for 5 to 48 hours, preferably 5 to 20 hours. The sample may be incubated (in step c) at a temperature of 15 to 30°C (preferably about 25°C). Advantageously, such temperatures may promote the catalytic activity of trypsin / trypsinogen.
[0090] Additionally or alternatively, such conditions that promote the proteolytic activity of trypsinogen may include the presence of an optimum pH that is favorable for trypsinogen autolysis and thus stimulates a basal level of proteolytic activity of trypsinogen. Thus, the pH may be adjusted in an appropriate manner to promote said proteolytic activity.
[0091] By promoting a basal level of trypsinogen for autolysis (which then converts trypsinogen itself into fully active trypsin), the resulting trypsin can further contribute to the proteolytic cleavage of the remaining trypsinogen, allowing for efficient production of trypsin. Advantageously, this obviates the need to provide exogenous trypsin (or other non-trypsinogen proteolytic peptides) to promote / catalyze activation, which may be of low purity and / or may have contaminants that compromise the GMP status of the process.
[0092] In a preferred embodiment, the proteolytic activity of the renatured trypsinogen is promoted (eg, stimulated) by adding calcium.
[0093] Calcium may be added (e.g., in step h) to a final concentration of at least 10 mM, more preferably at least 20 mM, in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen. For example, calcium may be added (e.g., in step h) to a final concentration of 20 to 150 mM in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen.
[0094] In a preferred embodiment, calcium is added to a final concentration of 50-100 mM (in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, e.g., in step h).
[0095] The inventors have identified advantageous incubation times and temperatures for the activation step (e.g., step h) that allow, for example, a good yield of activated β-trypsin, but without "overactivation" that can result in autocleavage of β-trypsin (e.g., to the less preferred α-trypsin).
[0096] In one embodiment, in the step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen (e.g., step h) (activation step), the sample is incubated for 5 to 48 hours, preferably 5 to 20 hours.
[0097] In the step of incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen (e.g., step h)), the sample can be incubated at a temperature of 15 to 30°C (e.g., about 25°C).
[0098] To ensure that the trypsinogen does not exhibit proteolytic activity during purification, the method steps can advantageously be carried out under conditions that do not promote the proteolytic activity of the (renatured) trypsinogen.
[0099] In one embodiment (e.g., of the first aspect), steps a) and b) are carried out in the absence of metal ions that promote proteolytic activity (e.g., so that calcium is not available to promote proteolytic activity). Additionally or alternatively, steps ii), iii), iv) and / or v) (e.g., of the first aspect) are carried out in the absence of such metal ions. Such metal ions include calcium, strontium, barium, magnesium, sodium, lithium, potassium, ammonium, rubidium, cesium, and neodymium cations.
[0100] In one embodiment (e.g., of the second aspect), steps f) and g) are carried out in the absence of metal ions that promote proteolytic activity (e.g., so that calcium is not available to promote proteolytic activity). Additionally or alternatively, steps b), c), d), and / or e) (e.g., of the second aspect) are carried out in the absence of such metal ions. Such metal ions include calcium, strontium, barium, magnesium, sodium, lithium, potassium, ammonium, rubidium, cesium, and neodymium cations.
[0101] The term "lack (absence) of metal ions that promote proteolytic activity" means that such metal ions are substantially free of such metal ions (e.g., the concentration of such metal ions is below the threshold required to promote proteolytic activity). Reference to "substantially free of such metal ions" can refer to metal ion concentrations of ≦2 mM, ≦1 mM, or ≦0.5 mM, preferably ≦0.1 mM. In a more preferred embodiment, "substantially free of metal ions" means that such metal ions are not present.
[0102] In one embodiment (e.g. of the first aspect), steps a) and b) are carried out in the absence of calcium (e.g. such that calcium is not available to promote proteolytic activity). Additionally or alternatively, steps ii), iii), iv) and / or v) (e.g. of the first aspect) are carried out in the absence of calcium.
[0103] In a preferred embodiment (e.g., of the second aspect), steps a), b), ii), iii), iv) and / or v) are carried out in the absence of calcium. For example, each of steps a), b), ii), iii), iv) and v) (e.g., of the second aspect) may be carried out in the absence of calcium.
[0104] In one embodiment (e.g. of the second aspect), steps f) and g) are carried out in the absence of calcium (e.g. such that calcium is not available to promote proteolytic activity). Additionally or alternatively, steps b), c), d) and / or e) (e.g. of the second aspect) are carried out in the absence of calcium.
[0105] In a preferred embodiment (e.g., of the second aspect), steps b), c), d), e), f) and / or g) are carried out in the absence of calcium. For example, each of steps b), c), d), e), f) and g) can be carried out in the absence of calcium.
[0106] The term "absence of calcium" means that calcium is substantially absent (e.g., the concentration of calcium is below the threshold required to promote proteolytic activity). Reference to "substantially free of calcium" can refer to a calcium concentration of ≦2 mM, ≦1 mM, or ≦0.5 mM, preferably ≦0.1 mM. In a more preferred embodiment, "substantially free of calcium" means that calcium is not present.
[0107] Optionally, step b) and / or step c) (e.g., of the first aspect) may be carried out at a temperature of 1 to 10°C, preferably 2 to 8°C. Optionally, step ii) and / or step iii) (e.g., of the second aspect) may be carried out at a temperature of 1 to 10°C, preferably 2 to 8°C.
[0108] The inventors have found that the beta-trypsin preparations produced by the methods of the present invention are of higher purity and exhibit higher levels of proteolytic activity than prior art beta-trypsin preparations.
[0109] In another aspect, the present invention provides a beta-trypsin composition (e.g., obtainable by a method described herein), wherein at least 80% of the total polypeptides included in the composition are beta-trypsin, and wherein the composition has an activity level of at least 3000 USP units / (mg of total polypeptide), optionally wherein the activity level is determined by an assay comprising: a) 0.075 mL of a beta-trypsin composition (e.g., a test sample) is mixed with 3.125 mL of substrate N α - mixing with a reaction buffer comprising (or consisting of) benzoyl-L-arginine ethyl ester (BAEE), sodium phosphate and hydrochloric acid and having a temperature of 25°C to provide a mixture comprising: i. 0.25 mM BAEE, ii. 67 mM sodium phosphate buffer; iii. 0.031-0.063 mM hydrochloric acid; iv. pH of 7.6 at 25°C, and v. 3.2 mL volume, b) incubating at 25°C for 4 minutes; c) Absorbance at 253 nm (A) of the mixture immediately after preparation and after incubation in step b). 253 ) and calculating the BAEE units (U) / ml of enzyme in the beta-trypsin composition using the following formula:
number
[0110] In another aspect, the present invention provides a beta-trypsin composition (e.g., obtainable by a method described herein), wherein at least 80% of the total polypeptides included in the composition are beta-trypsin, and wherein the composition has an activity level of at least 3000 USP units / (mg of total polypeptide), optionally wherein the activity level is determined by an assay comprising: a) mixing 0.075 mL of a beta-trypsin composition (e.g., a test sample) with 3.125 mL of a reaction buffer comprising (or consisting of) the substrate Nα-benzoyl-L-arginine ethyl ester (BAEE), sodium phosphate, and hydrochloric acid, and having a temperature of 25°C, to provide a mixture having: i. 0.25 mM BAEE, ii. 67 mM sodium phosphate buffer; iii. 0.031-0.063 mM hydrochloric acid; iv. pH of 7.6 at 25°C, and v. 3.2mL volume, b) incubating at 25°C for 5 minutes; c) Absorbance at 253 nm (A) of the mixture immediately after preparation and after incubation in step b). 253 ) and calculating the BAEE units (U) / ml of enzyme in the beta-trypsin composition using the following formula:
number
[0111] In another aspect, the present invention provides a beta-trypsin composition (e.g., obtainable by a method described herein), wherein at least 80% of the total polypeptides included in the composition are beta-trypsin, and wherein the composition has an activity level of at least 3000 USP units / (mg of total polypeptide), optionally wherein the activity level is determined by an assay comprising: a) mixing 0.075 mL of a beta-trypsin composition (e.g., a test sample) with 3.125 mL of a reaction buffer comprising (or consisting of) the substrate Nα-benzoyl-L-arginine ethyl ester (BAEE), sodium phosphate, and hydrochloric acid, and having a temperature of 25°C, to provide a mixture having: i. 0.075 ml of beta-trypsin composition; ii. 0.25 mM BAEE; iii. 67 mM sodium phosphate buffer; iv. 0.031-0.063 mM hydrochloric acid; v. pH of 7.6 at 25°C, and vi. 3.2 mL volume; b) providing a control sample to which no beta-trypsin composition is mixed, the control sample comprising (or consisting of): i. 0.25 mM BAEE, ii. 67 mM sodium phosphate buffer; iii. 0.031-0.063 mM hydrochloric acid; iv. pH of 7.6 at 25°C; v. 3.2 mL volume, and vi. No beta-trypsin composition; c) incubating the mixture of step a) and the control sample of step b) for 5 minutes at 25°C; d) The absorbance at 253 nm (A) of the mixture of step a) 253 ) every minute for 5 minutes, and detecting the absorbance at 253 nm (A) of the control sample of step b). 253 ) every minute for 5 minutes, and ΔA using the maximum linear velocity of the mixture of step a) and the control sample of step b). 253 / min and calculate the BAEE units (U) / ml of enzyme in the beta-trypsin composition using the following formula:
number
[0112] The term "immediately after preparation of the mixture" can mean within ≦15 seconds, ≦10 seconds, ≦5 seconds, or ≦1 second after preparation of the mixture.
[0113] Absorbance A 253 When measuring (e.g., using a spectrophotometer), the light path is preferably 1 cm. 253 When measuring (eg, using a spectrophotometer), the volume of the vessel (eg, cuvette) containing the sample to be measured is preferably 3.2 ml.
[0114] One BAEE unit of trypsin activity produces an A of 0.001 per minute using BAEE as substrate at pH 7.6 at 25°C in a 3.20 ml reaction volume. 253 Therefore, 0.001 is the A based on the unit definition. 253 The change is / min.
[0115] A 253 is usually detected by diluting an aliquot of the mixture with a larger volume (e.g., of buffer) to provide a diluted sample, a dilution factor (DF) is used, and A 253 is measured in the diluted sample. For example, if a 10 μl aliquot of the mixture is diluted in a volume of 1 mL, the dilution factor is 100.
[0116] The beta-trypsin composition (e.g., obtainable by the methods described herein) may have an activity level of at least 3500 USP units / mg total polypeptide, 4000 USP units / mg total polypeptide, 4500 USP units / mg total polypeptide, or 5000 USP units / mg total polypeptide.
[0117] In one embodiment, at least 85% (preferably at least 90%, more preferably at least 95%) of the total polypeptides in the composition is beta-trypsin.
[0118] Beta-trypsin produced by the methods of the present invention is particularly advantageous for activating clostridial neurotoxins (e.g., BoNTs such as BoNT / E) by cleaving single-chain clostridial neurotoxins to yield active two-chain clostridial neurotoxins.
[0119] In one embodiment, the method of the present invention further comprises contacting the single-chain clostridial neurotoxin having an activation loop with beta-trypsin (e.g., beta-trypsin produced by the methods described herein), wherein the beta-trypsin hydrolyzes the peptide bond of the activation loop of the single-chain clostridial neurotoxin, thereby producing a di-chain clostridial neurotoxin.
[0120] One aspect of the present invention provides a method of producing a di-chain Clostridial neurotoxin, the method comprising: a) providing a single-chain clostridial neurotoxin having an activation loop; and b) contacting a single-chain Clostridial neurotoxin with a beta-trypsin composition disclosed herein (e.g., obtainable by the methods described herein); c) Here, beta-trypsin hydrolyzes the peptide bond of the activation loop of the single-chain clostridial neurotoxin, thereby generating the di-chain clostridial neurotoxin. The present invention further encompasses di-chain clostridial neurotoxins obtainable by such methods (methods for producing di-chain clostridial neurotoxins disclosed herein).
[0121] Preferably, the Clostridial neurotoxin is a botulinum neurotoxin. Examples of suitable botulinum neurotoxin serotypes include A, B, C1, D, E, F, and G. In a preferred embodiment, the botulinum neurotoxin is botulinum neurotoxin serotype E (BoNT / E).
[0122] Botulinum neurotoxins (BoNTs) are produced by C. botulinum in the form of large protein complexes consisting of BoNT itself complexed with several accessory proteins. There are seven distinct classes of botulinum neurotoxins: botulinum neurotoxin serotypes A, B, C1, D, E, F, and G, all of which share a similar structure and mode of action. Different BoNT serotypes can be distinguished based on inactivation by specific neutralizing antisera, and such serotype classification correlates with the percentage of sequence identity at the amino acid level. BoNT proteins of a given serotype are further divided into different subtypes based on the percentage of amino acid sequence identity.
[0123] In nature, clostridial neurotoxins are synthesized as single-chain polypeptides, which are post-translationally modified by a proteolytic cleavage event to form two polypeptide chains linked together by a disulfide bond. Cleavage occurs at a specific cleavage site, often referred to as the activation site, located between cysteine residues that provide the interchain disulfide bond. The active form of the toxin is this two-chain form. The two chains are termed the heavy chain (H chain), with a molecular weight of approximately 100 kDa, and the light chain (L chain), with a molecular weight of approximately 50 kDa. The H chain carries a C-terminal targeting moiety (H chain). C domain) and N-terminal translocation component (H N The cleavage site is located between the light chain and the translocation component. CAfter binding of the domain to its target neuron and internalization of the bound toxin into the cell by endosomes, H N The domain translocates the L chain across the endosomal membrane into the cytosol, where the L chain provides the protease function (also known as a non-cytotoxic protease). Non-cytotoxic proteases act by proteolytically cleaving intracellular transport proteins known as SNARE proteins (e.g., SNAP-25, VAMP, or syntaxin)—see Gerald K (2002) "Cell and Molecular Biology" (4th edition) John Wiley & Sons, Inc. The acronym SNARE is derived from the term Soluble NSF Attachment Receptor, where NSF stands for N-ethylmaleimide-sensitive factor. SNARE proteins are essential for intracellular vesicle fusion and, ultimately, for the secretion of molecules from cells via vesicle transport. The protease function is a zinc-dependent endopeptidase activity and exhibits high substrate specificity for SNARE proteins. Thus, once delivered to the desired target cell, the non-cytotoxic protease can inhibit cellular secretion from the target cell. The L-chain proteases of clostridial neurotoxins are non-cytotoxic proteases that cleave SNARE proteins.
[0124] When a single-chain BoNT / E1 protein (for example) is contacted with trypsin, the proteolytic action of trypsin cleaves the single-chain protein at a site between the L-chain protease component and the translocation component to generate a two-chain protein, with the two chains linked by a disulfide bridge. More specifically, the two chains formed after cleavage of single-chain BoNT / E1 at the activation site are a first chain of amino acid residues 1-419 and a second chain of amino acid residues 423-1252, with residues 420, 421, and 422 removed by the cleavage event. β-trypsin can therefore be used to activate single-chain polypeptides by converting them to the active two-chain form. Advantageously, therefore, the use of β-trypsin means that an exogenous (non-native) cleavage site does not need to be engineered into the BoNT / E1 of the present invention.
[0125] An exemplary BoNT / E L chain reference sequence includes amino acid residues 1-422 of BoNT / E. However, slight variations may occur according to subserotype, so this reference sequence should be considered a guide. For example, US2007 / 0166332 (incorporated herein by reference in its entirety) cites slightly different BoNT / E L chain sequences of amino acid residues M1-R422.
[0126] BoNT / EH C An example of a domain reference sequence includes amino acid residues R846 to K1252.
[0127] The light chain of BoNT / E can be as follows (SEQ ID NO: 2): 1 PKINSFNYND PVNDRTILYI KPGGCQEFYK SFNIMKNIWI IPERNVIGTT 51 PQDFHPPTSL KNGDSSYYDP NYLQSDEEKD RFLKIVTKIF NRINNNLSGG 101 ILLEELSKAN PYLGNDNTPD NQFHIGDASA VEIKFSNGSQ DILLPNVIIM 151 GAEPDLFETN SSNISLRNNY MPSNHGFGSI AIVTFSPEYS FRFNDNSMNE 201 FIQDPALTLM HELIHSLHGL YGAKGITTKY TITQKQNPLI TNIRGTNIEE 251 FLTFGGTDLN IITSAQSNDI YTNLLADYKK IASKLSKVQV SNPLLNPYKD 301 VFEAKYGLDK DASGIYSVNI NKFNDIFKKL YSFTEFDLAT KFQVKCRQTY 351 IGQYKYFKLS NLLNDSIYNI SEGYNINNLK VNFRGQNANL NPRIITPITG 401 RGLVKKIIRF CKNIVSVKGI R
[0128] The heavy chain of BoNT / E can be as follows (SEQ ID NO: 3): 1 KSICIEINNG ELFFVASENS YNDDNINTPK EIDDTVTSNN NYENDLDQVI 51 LNFNSESAPG LSDEKLNLTI QNDAYIPKYD SNGTSDIEQH DVNELNVFFY 101 LDAQKVPEGE NNVNLTSSID TALLEQPKIY TFFSSEFINN VNKPVQAALF 151 VSWIQQVLVD FTTEANQKST VDKIADISIV VPYIGLALNI GNEAQKGNFK 201 DALELLGAGI LLEFEPELLI PTILVFTIKS FLGSSDNKNK VIKAINNALK 251 ERDEKWKEVY SFIVSNWMTK INTQFNKRKE QMYQALQNQV NAIKTIIESK 301 YNSYTLEEKN ELTNKYDIKQ IENELNQKVS IAMNNIDRFL TESSISYLMK 351 LINEVKINKL REYDENVKTY LLNYIIQHGS ILGESQQELN SMVTDTLNNS 401 IPFKLSSYTD DKILISYFNK FFKRIKSSSV LNMRYKNDKY VDTSGYDSNI 451 NINGDVYKYP TNKNQFGIYN DKLSEVNISQ NDYIIYDNKY KNFSISFWVR 501 IPNYDNKIVN VNNEYTIINC MRDNNSGWKV SLNHNEIIWT LQDNAGINQK 551 LAFNYGNANG ISDYINKWIF VTITNDRLGD SKLYINGNLI DQKSILNLGN 601 IHVSDNILFK IVNCSYTRYI GIRYFNIFDK ELDETEIQTL YSNEPNTNIL 651 KDFWGNYLLY DKEYYLLNVL KPNNFIDRRK DSTLSINNIR STILLANRLY 701 SGIKVKIQRV NNSTNDNLV RKNDQVYINF VASKTHLFPL YADTATTNKE 751 KTIKISSSGN RFNQVVVMNS VGNNCTMNFK NNNGNNIGLL GFKADTVVAS 801 TWYYTHMRDH TNSNGCFWNF ISEEHGWQEK
[0129] BoNT / E H C The domain is H CC and H CN It contains two distinct structural features called domains. The amino acid residues involved in receptor binding are H CC It is believed to be located mainly in the BoNT / EH domain. CN An example of a domain reference sequence includes amino acid residues 846-1085.
[0130] The above sequence positions may vary slightly depending on the subtype and may be used in conjunction with the appropriate (reference) BoNT / EH CNA further example of a domain comprises amino acid residues 848-1085.
[0131] BoNT / E can be produced by C. botulinum or C. butyricum, preferably C. botulinum. In one embodiment, BoNT / E is produced in a non-clostridial cell. Alternatively (and preferably), BoNT / E can be produced in recombinant form (e.g., in E. coli). Thus, in one embodiment, BoNT / E for use in the present invention is produced in a heterologous expression system, e.g., E. coli. In one embodiment, the E. coli cell is E. coli BLR(DE3).
[0132] Further details regarding BoNT / E produced in heterologous expression systems (such as E. coli) are described in WO2014 / 068317 A1, which is incorporated herein by reference.
[0133] In one embodiment, reference to beta-trypsin encompasses trypsin-like enzymes that cleave the same protease cleavage site as trypsin.
[0134] Trypsin cleaves protein sequences in which specific amino acids are located at specific positions on either side of the cleaved peptide bond. Such sequences can be represented by the nomenclature P4-P3-P2-P1-cleaved bond-P'1-P'2-P'3-P'4, where P1 through P4 represent the amino acids located at positions 1 through 4, respectively, on the N-terminal side of the cleaved peptide bond, and P'1 through P'4 represent positions 1 through 4, respectively, C-terminal to the cleaved peptide bond.
[0135] Most particularly, trypsin cleaves protein sequences in which either an Arg or a Lys amino acid occupies the P1 position. When Lys is in the P1 position, there are three main types of sequences that are not susceptible to trypsin: (1) Pro at the P'1 position normally reduces susceptibility to trypsin cleavage (but not when Trp is at the P2 position); (2) either Cys or Asp at the P2 position, together with Asp at the P'1 position, reduces susceptibility to cleavage by trypsin; and (3) Cys at position P2, together with either His or Try at position P'1, reduces susceptibility to cleavage by trypsin.
[0136] When Arg is at the P1 position, there are three main types of sequences that are not susceptible to trypsin: (1) Pro at the P'1 position normally reduces susceptibility to cleavage by trypsin (this is not the case when Met or possibly Glu is at the P2 position), (2) Cys at position P2, together with Lys at position P'1, reduces susceptibility to cleavage by trypsin; and (3) Arg at position P2, together with either His or Arg at position P'1, reduces susceptibility to cleavage by trypsin.
[0137] The method of producing a di-chain clostridial neurotoxin can further comprise the step of separating the di-chain clostridial neurotoxin from the beta-trypsin.
[0138] Suitable methodologies are described in WO2014 / 068317, which is incorporated herein by reference. For example, the method may further include contacting a solution containing the di-chain Clostridial neurotoxin protein and beta-trypsin with a hydrophobic surface, whereby the di-chain Clostridial neurotoxin protein preferentially binds to the hydrophobic surface, thereby separating the di-chain Clostridial neurotoxin protein from the beta-trypsin.
[0139] Trypsinogen is an inactive zymogen that is converted to trypsin by cleavage and removal of the leader sequence. For example, trypsinogen may have a leader containing the sequence Val(Asp)4Lys (SEQ ID NO: 5) present at the N-terminus of the protein. Examples of suitable trypsinogens include bovine, human, porcine, ovine, and / or murine trypsinogen.
[0140] In one embodiment, the trypsinogen is wild-type trypsinogen (and thus the beta-trypsin is wild-type trypsin).
[0141] In a preferred embodiment, the trypsinogen (and thus also the beta-trypsin) is bovine trypsinogen. Thus, the prokaryotic host cell of the methods described herein may comprise a nucleotide sequence encoding bovine trypsinogen.
[0142] The nucleotide sequence encoding bovine trypsinogen may have at least 70% sequence identity to SEQ ID NO: 1. In one embodiment, the nucleotide sequence encoding bovine trypsinogen may have at least 80% or 90% sequence identity to SEQ ID NO: 1.
[0143] A nucleotide sequence encoding bovine trypsinogen may preferably have at least 70% sequence identity to SEQ ID NO: 1, provided that nucleotides 1 to 45 at the 5' end of the sequence correspond to nucleotides 1 to 45 at the 5' end of SEQ ID NO: 1. In one embodiment, a nucleotide sequence encoding bovine trypsinogen may preferably have at least 80% or 90% sequence identity to SEQ ID NO: 1, provided that nucleotides 1 to 45 at the 5' end of the sequence correspond to nucleotides 1 to 45 at the 5' end of SEQ ID NO: 1.
[0144] Preferably, the nucleotide sequence encoding bovine trypsinogen comprises (or consists of) the sequence SEQ ID NO:1.
[0145] The trypsinogen sequence may further comprise or be fused to a sequence that facilitates the purification of the recombinant protein. For example, the trypsinogen sequence may comprise a His-tag (polyhistidine tag), an amino acid motif with at least four (preferably at least six) consecutive histidine residues. Such His-tags may be suitably used for affinity purification of the tagged trypsinogen.
[0146] Trypsin is a serine protease that catalyzes the cleavage of peptide bonds at the carboxy terminus of basic amino acid residues such as lysine and arginine. Trypsin proteins are classified as EC 3.4.21.4. The detailed mechanism of catalytic hydrolysis of peptide (and ester) substrates by serine proteases is established and known in the art, with trypsin being a particularly well-understood member of this class of enzyme. A preferred form of trypsin is beta-trypsin, also known as the native form of trypsin provided following trypsinogen activation. Autolysis of beta-trypsin (which can be cleaved at Lys131-Ser132 in the bovine sequence) yields alpha-trypsin, which is held together by disulfide bridges.
[0147] Trypsin is autocatalytic and therefore cleaves itself (e.g., to α-trypsin and / or to inactive peptides). Advantageously, once trypsin is produced, inhibitors of proteolytic activity (e.g., calcium-mediated proteolytic activity) can be added to prevent further cleavage.
[0148] In one embodiment, the method of the present invention may further comprise the step of adding a chelating agent (capable of binding and capturing metal ions) to inhibit the proteolytic activity of trypsinogen and / or β-trypsin. Advantageously, this may reduce autolysis of β-trypsin once it is produced by preventing metal ion (e.g., calcium)-mediated promotion of proteolytic activity. For example, the addition of a chelating agent (such as a calcium chelator) may be used to stop / quench the proteolytic activity promoted in step c) of the first aspect and step h) of the second aspect.
[0149] Preferably, the chelating agent is a calcium chelating agent.
[0150] Preferred chelating agents include EDTA, HEDTA, EDG, EDDS, GLDA, MGDA, isomers thereof or combinations thereof, especially EDTA.
[0151] To still further improve the level of purity of the β-trypsin product, further purification (or "polishing") steps can be performed. For example, the inventors have found that subjecting β-trypsin to an affinity chromatography step can be used to separate β-trypsin from α-trypsin.
[0152] In one embodiment, the method of the present invention (eg, the second aspect) may further comprise the step of isolating the beta-trypsin.
[0153] In one embodiment, beta-trypsin is isolated by affinity chromatography, preferably benzamidine affinity chromatography.
[0154] An "inducible promoter" is a nucleic acid sequence that promotes transcription of a nucleotide sequence (e.g., a gene) operably linked to the promoter once the promoter's activity is induced. An inducible promoter can be regulated (induced) upon addition of a suitable inducer. Thus, an inducible promoter can be used to regulate the transcription / expression of an operably linked gene by switching the promoter from an "off" state to an "on" state upon introduction of the inducer. A suitable inducer is isopropyl β-D-1-thiogalactopyranoside (IPTG).
[0155] By "operably linked" to an inducible promoter, transcription of a nucleotide sequence (e.g., a gene) operably linked to the inducible promoter is under the control of the inducible promoter, such that the nucleotide sequence is transcribed (switching the promoter from an "off" state to an "on" state) upon introduction of an inducer.
[0156] Advantageously, inducing expression (by step b)) may provide a "burst" of transcription and expression, resulting in an increased proportion of expressed trypsinogen present in insoluble inclusion bodies.
[0157] In one embodiment, trypsinogen expression is induced by adding IPTG, preferably to provide a final concentration of 0.25-0.75 mM, more preferably about 0.5 mM.
[0158] Preferably, trypsinogen expression is induced for at least 4 hours, more preferably trypsinogen expression is induced for at least 6 hours.
[0159] In one embodiment, trypsinogen expression is induced for at least 4 to 12 hours. For example, trypsinogen expression can be induced for at least 6 to 10 hours.
[0160] In a particularly preferred embodiment, trypsinogen expression is induced for about 8 hours.
[0161] The inventors have found that it is advantageous to monitor the growth of the culture, and have found that purifying beta-trypsin from cultures at particular stages of growth (e.g., as measured by optical density) results in improved yields.
[0162] In one embodiment, the host cells are grown at an optical density at 600 nm (OD ) of 35 to 65. 600 ), or more preferably, 40 to 60 OD (OD 600 ) and cultivated.
[0163] One or more of the process steps described herein may be followed by a filtration step, preferably a diafiltration step.
[0164] For example, the renatured trypsinogen can be subjected to filtration (e.g., diafiltration) following the step of renaturing purified denatured trypsinogen (e.g., step f) thereby producing renatured trypsinogen) of the presently described method of producing β-trypsin.
[0165] In one embodiment, the beta-trypsin (produced by the methods of the present invention) can be subjected to a filtration (e.g., diafiltration) step, for example, where the method further comprises isolating the beta-trypsin (e.g., by affinity chromatography), and the purified beta-trypsin can be subjected to a filtration (e.g., diafiltration) step.
[0166] The filtration preferably involves subjecting the renatured trypsinogen, beta-trypsin and / or affinity chromatography purified beta-trypsin to a filtration step that removes molecules having a size less than about 0.2 microns.
[0167] Additionally or alternatively, the filtration step may be carried out using a filtration system comprising, for example, a 0.5 m 2 or 0.2 m 2 Tangential flow filtration utilizing cassettes may be included.
[0168] Furthermore, the inventors have optimized the purification protocol to identify particularly suitable operating conditions for some of the method steps described herein, which may result in further improvements in beta-trypsin yield and purity. Examples of such optimized conditions are outlined below, where references to steps refer to the corresponding steps in the method of the second aspect described herein. Details of the buffers mentioned are provided in the Examples.
[0169] For example, the step of isolating one or more insoluble inclusion bodies from host cells (e.g., step c)) may include one or more (or all) of the following steps: obtaining a bacterial pellet from a prokaryotic cell culture (e.g., by centrifuging the prokaryotic cell culture); resuspending the pellet in a suitable buffer, for example, SM-E01 buffer (described in the Examples); lysing the bacterial cells by homogenization, for example, preferably at a pressure of 650 to 750 bar, to obtain a lysate; obtaining a pellet from the lysate (e.g., by centrifuging the lysate); and washing the lysate, preferably by resuspending the lysate in SM-F01 and / or SM-F02 buffer (described in the Examples). The temperature during one or more (preferably all) of the above steps may be 2 to 8°C.
[0170] The step of solubilizing one or more insoluble inclusion bodies and thereby producing denatured trypsinogen (e.g., step d)) can include one or more (or all) of the following steps: resuspending the IBs in a suitable buffer, such as S-F01 buffer (described in the Examples), by homogenization (e.g., for 12 to 15 hours with stirring at 250 to 400 rpm) to provide solubilized denatured trypsinogen; centrifuging the solubilized denatured trypsinogen (e.g., at 700 to 900 rpm for 50 to 50 minutes) and retaining the supernatant; and filtering the supernatant, for example, using a filter with a pore size of 0.2 μm. The temperature during one or more (preferably all) of the above steps can be 2 to 8° C.
[0171] The step of purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen (e.g., step e)), may include one or more (or all) of the following steps: equilibrating a column with a suitable buffer (such as S-F02 buffer, as described in the Examples), preferably wherein the column has a volume of 1492 to 1649 mL and / or a bed height of 15 to 25 cm (preferably 20 cm), and / or is packed with Eshmuno S resin; loading the denatured trypsinogen onto the column; washing the column with a suitable buffer (such as S-F02 buffer, as described in the Examples); and eluting the denatured trypsinogen from the column with a suitable buffer (such as S-G01 buffer, as described in the Examples) to provide purified denatured trypsinogen.
[0172] The step of renaturing purified denatured trypsinogen to thereby produce renatured trypsinogen (e.g., step f)) may include one or more (or all) of the following steps: adding a suitable buffer (such as S-H01 buffer, described in the Examples) to the purified denatured trypsinogen to provide a concentration of purified denatured trypsinogen of 0.05 to 0.5 mg / ml (preferably, about 0.1 mg / ml); stirring the solution, for example, at 200 rpm; incubating the solution for 48 to 168 hours; and filtering the solution, for example, using a filter having a pore size of 0.2 μm and / or 0.5 μm. The temperature during one or more (preferably all) of the above steps may be 2 to 8°C.
[0173] The step of purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen (e.g., step g)), may include one or more (or all) of the following steps: equilibrating a column with a suitable buffer (such as S-H02 buffer, as described in the Examples), preferably wherein the column has a volume of 177 to 216 mL and / or a bed height of 5 to 15 cm (preferably 10 cm) and / or is packed with Eshmuno Q resin; loading the renatured trypsinogen onto the column; collecting the flow-through to provide purified renatured trypsinogen; and washing the column with a suitable buffer (such as S-H02 buffer, as described in the Examples). The temperature during one or more (preferably all) of the above steps may be 2 to 8°C.
[0174] The step of incubating purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, whereby trypsinogen is cleaved into β-trypsin by said proteolytic activity (e.g., step h)) may include one or more (or all) of the following steps: incubating purified renatured trypsinogen in the presence of calcium (e.g., S12 buffer, as described in the Examples), where calcium is present at a concentration of 60 to 90 mM (preferably, about 75 mM); adding a calcium chelating agent (e.g., S-K01 buffer, as described in the Examples) and adjusting the pH to preferably 7.2 to 7.6 (e.g., using S-01 buffer, as described in the Examples); filtering the solution, for example, using a filter with a pore size of 0.2 μm and / or 0.5 μm. The incubation may be carried out at a temperature of 20 to 25°C.
[0175] sequence homology
[0176] Any of a variety of sequence alignment methods can be used to determine percent identity, including, but not limited to, global, local, and hybrid methods, such as segmental approaches. Protocols for determining percent identity are routine within the skill of those in the art. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by summing the scores of individual residue pairs and by imposing gap penalties. Non-limiting methods include, for example, CLUSTAL W (see, e.g., Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice, 22(22) Nucleic Acids Research 4673-4680 (1994)), and iterative refinement (see, e.g., Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. Mol. Biol. 823-838 (1996)). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences.Non-limiting methods include, for example, Match-box (see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501-509 (1992)); Gibbs sampling (see, e.g., C.E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment, 262(5131) Science 208-214 (1993)); Align-M (see, e.g., Ivo Van Walle et al., Align-M - A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20(9) Bioinformatics:1428-1435 (2004)).
[0177] Thus, percent sequence identity is determined by conventional methods. See, e.g., Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment score using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.) as shown below (amino acids are designated by standard single-letter codes):
[0178] The "percent sequence identity" between two or more nucleic acid or amino acid sequences is a function of the number of identical positions shared by the sequences. Thus, percent identity can be calculated as the number of identical nucleotides / amino acids divided by the total number of nucleotides / amino acids and multiplied by 100. The calculation of percent sequence identity may also take into account the number of gaps and the length of each gap that need to be introduced to optimize the alignment of two or more sequences. The alignment comparison of two or more sequences and the determination of percent identity can be performed using a specific mathematical algorithm, such as BLAST, which will be familiar to those skilled in the art.
[0179] Alignment scores for determining sequence identity
[0180] ARNDCQEGHILKMFPSTWYV A4 R -1 5 N -2 0 6 D -2 -2 1 6 C 0 -3 -3 -3 9 Q -1 1 0 0 -3 5 E -1 0 0 2 -4 2 5 G 0 -2 0 -1 -3 -2 -2 6 H -2 0 1 -1 -3 0 0 -2 8 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4
[0181] The percent identity is then calculated as: [total number of identified matches × 100] / [length of the longer sequence plus the number of gaps introduced in the longer sequence to align the two sequences]
[0182] Substantially homologous polypeptides are characterized as having one or more amino acid substitutions, deletions, or additions. These changes are preferably minor in nature, such as conservative amino acid substitutions (see below) and other substitutions that do not significantly affect the folding or activity of the polypeptide, usually small deletions of from 1 to about 30 amino acids and small amino- or carboxyl-terminal extensions, e.g., amino-terminal methionine residues, small linker peptides of up to about 20-25 residues, or affinity tags.
[0183] Conservative amino acid substitutions Basicity: Arginine lysine histidine Acidic: glutamic acid Aspartic acid polarity: glutamine Asparagine Hydrophobicity: Leucine Isoleucine Balin Aromatic: phenylalanine Tryptophan Tyrosine small: glycine Alanine Serine Threonine methionine
[0184] In addition to the 20 standard amino acids, non-standard amino acids (e.g., 4-hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline, and α-methylserine) can be substituted for amino acid residues in the polypeptides of the invention. A limited number of non-conservative amino acids, amino acids not encoded by the genetic code, and unnatural amino acids can be substituted for polypeptide amino acid residues. The polypeptides of the invention can also include non-naturally occurring amino acid residues.
[0185] Non-naturally occurring amino acids include, but are not limited to, trans-3-methylproline, 2,4-methano-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo-threonine, methyl-threonine, hydroxy-ethylcysteine, hydroxyethylhomo-cysteine, nitro-glutamine, homoglutamine, pipecolic acid, t-leucine, norvaline, 2-azaphenylalanine, 3-azaphenyl-alanine, 4-azaphenyl-alanine, and 4-fluorophenylalanine. Several methods for incorporating non-naturally occurring amino acid residues into proteins are known in the art. For example, an in vitro system can be used in which nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNAs are known in the art. Transcription and translation of the plasmid containing the nonsense mutation is carried out in a cell-free system containing E. coli S30 extract and commercially available enzymes and other reagents. The protein is purified by chromatography. See, e.g., Robertson et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9, 1993). In the second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNA (Turcatti et al., J. Biol. Chem. 271:19991-8, 1996).In the third method, E. coli cells are cultured in the absence of the natural amino acid to be replaced (e.g., phenylalanine) and in the presence of the desired unnatural amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The unnatural amino acid is incorporated into the polypeptide in place of its natural counterpart. See Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to unnatural species by in vitro chemical modification. To further expand the scope of substitutions, chemical modification can be combined with site-directed mutagenesis (Wynn and Richards, Protein Sci. 2:395-403, 1993).
[0186] A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for amino acid residues in the polypeptides of the invention.
[0187] Essential amino acids in the polypeptides of the invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244:1081-5, 1989). In addition to mutations of putative contact site amino acids, sites of biological interaction can also be determined by physical analysis of the structure, such as those determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling. See, e.g., de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homology with related components of the polypeptides of the invention (e.g., translocation or protease components).
[0188] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods in which two or more positions in a polypeptide are simultaneously randomized, functional polypeptides are selected, and the mutagenized polypeptides are then sequenced to determine the range of permissible substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO Publication WO 92 / 06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).
[0189] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994) and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide those skilled in the art with a general dictionary of many of the terms used in this disclosure.
[0190] The present disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present disclosure. Numeric ranges include the numbers defining the range. Unless otherwise specified, any nucleic acid sequence is written left to right in 5' to 3' orientation, and amino acid sequences are written left to right in amino to carboxy orientation, respectively.
[0191] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure.
[0192] Amino acids are referred to herein using the amino acid name, three-letter abbreviation, or single-letter abbreviation. The term "protein," as used herein, includes proteins, polypeptides, and peptides. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some instances, the term "amino acid sequence" is synonymous with the term "peptide." In some instances, the term "amino acid sequence" is synonymous with the term "enzyme." The terms "protein" and "polypeptide" are used interchangeably herein. In the present disclosure and claims, conventional single-letter and three-letter codes for amino acid residues may be used. The three-letter codes for amino acids are defined in accordance with the IUPAC IMB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that a polypeptide may be encoded by more than one nucleotide sequence due to the degeneracy of the genetic code.
[0193] Other definitions of terms may appear throughout this specification. Before exemplary embodiments are described in more detail, it is to be understood that the present disclosure is not limited to the particular embodiments described, and as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure is defined only by the appended claims.
[0194] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of that range is also specifically disclosed, unless the context clearly dictates otherwise. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value within that stated range is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded, and each range where one, both, or both limits are included in the smaller range is also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. When a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0195] It must be noted that, herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, a reference to "a protein" includes a plurality of such proteins, a reference to "the protein" includes a reference to one or more proteins and equivalents thereof known to those skilled in the art, and so forth.
[0196] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application, and nothing herein should be construed as an admission that such publications constitute prior art to the claims appended hereto. Embodiments of the present invention will now be described, by way of example only, with reference to the following figures and examples. [Brief explanation of the drawings]
[0197] [Figure 1] FIG. 1 is a diagram outlining the manufacturing process for producing β-trypsin. [Figure 2]FIG. 2 shows an SDS-PAGE gel (Coomassie blue stained) demonstrating that trypsinogen was successfully expressed (lane 1), present in the eluate after cation exchange chromatography (CEX) (lane 2), and present in the filtrate after renaturation and filtration (lane 3). [Figure 3] FIG. 3 shows an SDS-PAGE gel (Coomassie blue stained) demonstrating that β-trypsin is present in the second peak during affinity chromatography purification and can therefore be separated from α-trypsin, which is present in the first peak. [Figure 4] Figure 4 shows the protein yield and purity provided by different steps of the claimed method. Results from three independent runs are shown. A: Table demonstrating protein yield. B: SDS-PAGE gel (Coomassie blue stain) demonstrating increasing purity as the method progresses, showing significantly reduced contaminants when CEX was followed by AEX (compare lanes 5 and 7). EsmunoS = CEX; EsmunoQ = AEX. [Figure 5] Figure 5 shows RP-HPLC profiles of trypsinogen demonstrating stability for up to 40 hours at 2-8°C and lack of stability at higher temperatures (ambient / room temperature). A: RP-HPLC of trypsinogen where refolding at ambient temperature leads to aggregation of refolded trypsinogen and reduced yield. Refolding was performed as described in the Examples (at 0.1 mg / ml in a refolding buffer with 20 mM Tris, 1.5 mM GSH, 1.5 mM GSSG, 0.75 M L-arginine, pH 8). B: RP-HPLC profile of refolded, filtered trypsinogen in SH-02 buffer demonstrating stability for up to 40 hours at 2-8°C. [Figure 6]Figure 6A shows RP-HPLC profiles of renatured trypsinogen after refolding at different L-arginine concentrations (using a starting protein concentration of approximately 0.1 mg / ml).B - RP-HPLC profiles of renatured trypsinogen after refolding with different (denatured) trypsinogen concentrations (in refolding buffer with 0.75 M L-Arg at 2-8°C). [Figure 7] Figure 7A shows a benzamidine affinity chromatography trace demonstrating the separation of the alpha-trypsin (first peak) and beta-trypsin (second peak) peaks. B - SDS-PAGE analysis demonstrates the separation of alpha- and beta-trypsin by benzamidine affinity chromatography. [Example]
[0198] Materials and Methods
[0199] Bacterial strains
[0200] E. coli BL21(DE3) was transformed with a bovine trypsinogen expression vector (pET-28b+ plasmid having the sequence of SEQ ID NO: 1 under the control of an IPTG-inducible promoter). For convenience, this strain is referred to as "RCB" throughout the examples.
[0201] Buffers and culture media
[0202] Inoculation medium:
[0203] The inoculum (pre-culture) medium composition is outlined below. This medium contains four solutions that are prepared separately and sterilized by autoclaving (121°C, 1 atm, 20 min). The solutions are then mixed (under laminar flow) and subsequently used to provide the inoculum medium: [Table 1]
[0204] Production culture medium:
[0205] The production culture medium (e.g., minimal fermentor medium) composition is outlined below. Prior to use, P1 and C1 were sterilized by autoclaving (121°C, 1 atm, 20 min). To prepare the production culture medium, 1100 mL of N1 solution was sterilized by autoclaving (121°C, 1 atm, 30 min) in a fermentor. The production culture medium was pre-warmed to +37°C and then inoculated. The production medium was the following (solution M, same as in the table above): [Table 2]
[0206] C2+P2+M solution
[0207] An additional glucose, magnesium, and trace element supply solution (referred to as C2+P2+M solution) was used during biosynthesis. Before use, the prepared solutions were sterilized by autoclaving (121°C, 1 atm, 20 min). Then, each of solutions P2, C2, and M was mixed (under laminar flow) before use. The "C2+P2+M" solution was as follows (same solution M as in the table above): [Table 3]
[0208] N2 solution
[0209] The N2 solution was sterilized by autoclaving (121°C, 1 atm, 20 min) prior to use. During the production culture, N2 solution additions (outlined below) were performed at fixed times. Four additions of N2 solution were used as follows (volumes are for a 1.2 L w / v fermentation process, increased proportionally for larger scale fermentation processes): (1) 25 mL at OD600nm of 60-70 OU; (2) 25 mL at OD600nm of 120-140 OU; (3) 12.5 mL at 1.5 hours after induction (IPTG); and (4) 12.5 mL at 2 hours after induction. The N2 solutions were as follows: [Table 4]
[0210] buffer
[0211] The following table outlines the buffers utilized during the various method steps of the present invention. For convenience, "buffer identifiers" are referred to throughout the examples. [Table 5-1] [Table 5-2]
[0212] [Example 1]
[0213] Production of β-trypsin using an Escherichia coli heterologous expression system
[0214] Beta-trypsin was manufactured according to the manufacturing process provided in Figure 1. Further details regarding the manufacturing process are provided below.
[0215] 1.1 Bacterial cultures and cultivation processes
[0216] An inoculum culture was first prepared (using the inoculum medium). Three 1000 mL shake flasks were prepared, and 460 mL (+ / - 10 mL) of the inoculum culture was added to each flask and heated to 30°C. A vial of RCB suspension (cryofrozen) was thawed (5-20 minutes), and 1-1.5 mL of RCB was inoculated into the inoculum medium in the flask. The flasks were incubated at 30°C (+ / - 2°C) with shaking at 300 (+ / - 50) RPM for 17-18 hours to provide the inoculum culture.
[0217] The production culture was then prepared. 10 mL of production medium was inoculated with the inoculum culture to provide an initial OD600nm (of the production culture) of 0.5 OU. The fermentation conditions were as follows: - Temperature set point 37+ / -2℃. - DO set point 20% - Airflow 0.3~7L / min - Agitation (stirring) 300 rpm - Oxygen 0-7L / min - pH set point 6.8 + / - 0.2 (adjusted by addition of NH4OH)
[0218] During cultivation, samples were taken for optical density and glucose concentration measurements. When OD600nm reached 20 O.U., feeding with glucose (P2+C2+M solution) was started. When OD600nm reached 60 O.U., addition of N2 solution was started (further details are provided above under the heading "N2 solution"). When the OD600nm of the production culture was approximately 50, trypsinogen expression was induced by addition of IPTG (to a final concentration of 0.5 mM). Induction was carried out for approximately 7 hours.
[0219] The production culture was harvested 7 hours after induction by centrifugation at 8000 rpm for 20-30 minutes (at 4° C.). The cell pellet was collected and stored at −20±5° C. until further use.
[0220] Three 10 L production runs (batches) were performed to monitor the consistency of biomass yield and trypsinogen expression. The results of the three runs are outlined below: [Table 6]
[0221] 1.2. Inclusion body (IB) extraction and washing
[0222] The pellet was resuspended in SM-E01 buffer (at 2-8°C) at a ratio of 1:4. Resuspension was performed for 20-40 minutes. Cell disruption (to extract IBs) was performed using a GEA Panda homogenizer at 650-750 bar for two cycles at 2-8°C. The pH was then adjusted to 7.4-7.6 once the lysate temperature reached 5-15°C. The lysate (containing IBs) was then centrifuged at 8000 rpm (Avanti J-26XPI) for 50-55 minutes (at 2-8°C).
[0223] First IB wash: The pellet (of the lysate) was then washed with SM-F01 buffer at a dilution ratio of 1:15 and resuspended in SM-F01 buffer (homogenized for 15-25 minutes). The resuspended material was then centrifuged at 8000 rpm (Avanti J-26XPI) for 25-35 minutes (temperature: 2-8°C).
[0224] Second and third IB washes: The pellet was then washed with SM-F02 buffer at a dilution ratio of 1:15 and resuspended in SM-F02 buffer (homogenizer for 15-25 minutes). The resuspended material was then centrifuged at 8000 rpm (Avanti J-26XPI) for 15-25 minutes (temperature: 2-8°C). This was repeated for the third IB wash. The IBs were then stored (in bags) at 20 + / - 5°C until further use.
[0225] 1.3.IB dissolution
[0226] The IBs were resuspended in S-F01 buffer at a ratio of 1:19 (e.g., 1 g of IBs per 19 grams of buffer). Resuspension was performed in a homogenizer for 12-15 hours with mixing at 250-400 rpm until complete dissolution. The solubilized material was then centrifuged at 800 rpm (Avanti J-26XPI-JLA-8.1000 rotor) for 50-60 minutes (temperature 2-8°C). The supernatant was then retained for further use and filtered using a 0.2 μm filter (Opticap XL300 or larger, filtration speed 50-100 LHM and approximately 4 L / m).2 The solution was filtered using a filter throughput of 1000 s.p.m.
[0227] An aliquot of the supernatant was run on an SDS-PAGE gel to confirm the presence of trypsinogen (see Figure 2).
[0228] 1.4. Purification of Denatured Trypsinogen
[0229] The denatured trypsinogen was purified by cation exchange chromatography using a column with EshmunoS resin (Merck Millipore), which allowed for the removal of host cell proteins, host cell DNA, bacterial endotoxins, and protein-related impurities and for the concentration of trypsinogen before refolding.
[0230] The columns had a volume of 1492-1649 mL and a bed height of 20 cm. The columns were packed to achieve the following parameters: HETP (cm) of <= 0.06 and A of 0.6-1.8. S .
[0231] The column was equilibrated with S-F02 buffer - flow rate, cm / h: target = 75, range = 60-80; column volume, CV: target = 7, range = 6-8.
[0232] Cation exchange chromatography (run in bind and elute mode) was performed according to the following parameters: [Table 7]
[0233] Fractionation started at UV280-0.1 and ended at UV280-0.09.
[0234] The eluted material was diluted with S-G01 buffer to a volume of 10 L. An aliquot of the eluted material was run on an SDS-PAGE gel to confirm the presence of trypsinogen (see Figure 2).
[0235] A more detailed outline of the cation exchange chromatography conditions is as follows: [Table 8]
[0236] 1.5. Trypsinogen Refolding and Filtration
[0237] The eluted material was cooled to 2-8°C (and refolding was carried out at this temperature).
[0238] Refolding was performed by adding S-H01 buffer to the eluted material to provide 0.1 mg / ml of protein in buffer. The solution was mixed at 200 rpm and incubated at 2-8°C for 48-168 hours. The solution was then filtered using an OpticapXL150 0.5 / 0.2 μm filter.
[0239] Advantageously, the use of L-arginine as an aggregation inhibitor in S-H01 did not cause filter clogging in step 1.6, which occurred when PEG was utilized as the aggregation inhibitor.
[0240] Varying concentrations of L-arginine were tested for S-H01 buffer, and particularly favorable L-arginine concentrations were indicated by RP-HPLC analysis (where higher peaks indicate higher refolding efficiency). More specifically, refolding of trypsinogen (at a protein concentration of 0.1 mg / ml) was tested in the presence of 0.5 to 0.75 M (in increments of 0.05 M), indicating 0.75 M as the most favorable concentration for refolding (see Figure 6A).
[0241] Furthermore, a protein concentration of 0.1 mg / ml during refolding resulted in a higher yield of renatured trypsinogen compared to higher (e.g., 0.2 mg / ml) or lower (e.g., 0.075 mg / ml) concentrations; see Figure B.
[0242] The inventors have found that trypsinogen remains stable at low temperatures (e.g., 2-8°C) for extended periods of time (>=36 hours, see Figure 5A), allowing refolding to proceed to completion.
[0243] The operating parameters for refolding are outlined below: [Table 9]
[0244] 1.6. Filtration before UF / DF
[0245] The renatured trypsinogen was filtered through an Opticap XL150 0.5 / 0.2 μm at 400 LHM, the maximum speed available on a laboratory scale. The final operating parameters were as follows: [Table 10]
[0246] Any remaining refolded protein was washed off the filter using chase buffer (50 mM Tris, pH 7.4) and the following operating parameters were used: [Table 11]
[0247] 1.7. Ultrafiltration / Diafiltration (Tangential Flow Filtration, TFF)
[0248] Tangential flow filtration was used for both volume reduction and dialysis into a buffer suitable for the activation step (lacking L-Arg), which was performed prior to anion exchange chromatography (AEX) so that the flow-through (from the AEX column) was in buffer ready for the activation step.
[0249] By using selective membrane sizes in tangential flow filtration, this filter setup can be used to perform protein concentration (ultrafiltration) and diafiltration (diafiltration), commonly abbreviated as UF / DF. A molecular weight cutoff (MWCO) of 10 kDa (2-3 times smaller than the target protein) was used. This size retains the target protein but allows the highly viscous L-arginine buffer to pass through. A Millipore Pellicon 2, A-Screen filter (MWCO 10 kDa) was used (no protein was observed in the filtered product).
[0250] UF / DF allowed for a 10x reduction in protein volume as well as buffer exchange (diafiltration).
[0251] Therefore, the solution (of renatured trypsinogen) was filtered using a filter with a molecular weight cut-off of 10 kDa (Millipore Pellicon 2). The solution was concentrated 10 times. The operating conditions are outlined below: [Table 12]
[0252] Buffer exchange (to S-H02 buffer) was then achieved using diafiltration mode, where S-H02 buffer was added to the retentate system at the same rate that the current buffer (S-H01) was removed by the filtrate. The diavolume (DV) is the point at which the retentate volume of buffer has been exchanged. The diafiltration process is terminated when the conductivity and pH of the filtrate reach the target values. The operating conditions are outlined below: [Table 13]
[0253] An aliquot of the resulting TFF retentate was run on an SDS-PAGE gel to confirm the presence of trypsinogen (see Figure 2).
[0254] Three batches were run (following steps 1.1-1.6) and monitored for consistency of biomass, IB, and protein production. The results of the three batches are outlined below: [Table 14]
[0255] 1.8. Purification of renatured trypsinogen
[0256] The renatured trypsinogen was purified by anion exchange chromatography (run in flow-through mode) using a column with Eshmuno Q resin (Merck Millipore). Advantageously, this allowed for further removal of bacterial endotoxins and host cell DNA due to the net charge difference between trypsinogen and these impurities, resulting in the impurities being efficiently retained and therefore removed from the trypsinogen present in the flow-through.
[0257] The columns had a volume of 177-216 mL and a bed height of 10 cm. The columns were packed to achieve the following parameters: HETP (cm) of <= 0.06 and A of 0.6-1.8.S .
[0258] The column was equilibrated with S-H02 buffer; flow rate, cm / h: target = 150 cm / h, range = 100-160 cm / h; column volume, CV: target = 7, range = 6-8. The residence time on the column was therefore approximately 4 min. The flow-through (containing purified renatured trypsinogen) was immediately collected.
[0259] Anion exchange chromatography (run in flow-through mode) was performed according to the following parameters: [Table 15]
[0260] A more detailed outline of the anion exchange chromatography operating conditions is as follows (CV = column volume, e.g., 177-216 mL): [Table 16]
[0261] The flow-through material (containing the renatured trypsinogen) was collected.
[0262] 1.9. Activation (Cleavage of Trypsinogen to Generate Trypsin) and Filtration
[0263] Activation began within 60 minutes of collecting the flow-through material. Advantageously, by working within this time frame, we found that aggregation of trypsinogen protein (after anion exchange chromatography) could be reduced (see Example 3).
[0264] The flow-through material was at 20-25°C before activation began. S-12 solution was added to the flow-through material (to provide a final calcium concentration of 75 mM) and incubated at 20-25°C for 20-24 hours. Activation was quenched by the addition of S-K01 buffer (final concentration 80 mM), and the pH was adjusted to 7.2-7.6 with S-01 buffer.
[0265] The solution was then filtered through an Opticap XL150 0.5 / 0.2 μm filter. The operating parameters were as follows: [Table 17]
[0266] Chase buffer (S-H02) was used to wash any remaining refolded trypsinogen from the filter. The operating parameters were as follows: [Table 18]
[0267] 1.10. Affinity Chromatography (Benzamidine)
[0268] The activated trypsin was purified (e.g., polished) by affinity chromatography using a column with benzamidine Sepharose FF (Merck Millipore). This allowed for further removal of bacterial endotoxins and host cell proteins, as well as unactivated trypsinogen and α-trypsin. P-aminobenzamidine, a synthetic inhibitor of trypsin and trypsin-like serine proteases, was covalently bound to a long spacer arm attached to Sepharose 4 Fast Flow. Benzamidine resin was used to separate the trypsin forms: alpha and beta. This step allowed for the separation of both forms (see Figure 7).
[0269] The columns had a volume of 177-216 mL and a bed height of 10 cm. The columns were packed to achieve the following parameters: HETP (cm) of <= 0.06 and A of 0.6-1.8. S .
[0270] The column was equilibrated with S-H02 buffer - flow rate, cm / h: target = 150, range = 100-160, column volume, CV: target = 5, range = 4.5-5.5.
[0271] Affinity chromatography was performed according to the following parameters: [Table 19]
[0272] The elution was collected between 40 mAu and 30 mAu, and only the second peak fractions (which contained β-trypsin) were pooled. Aliquots of the first and second peaks were run on an SDS-PAGE gel to confirm the presence of β-trypsin in the second peak fractions (see Figure 3).
[0273] A detailed outline of the benzamidine chromatography conditions is as follows: [Table 20]
[0274] 1.11. Final Ultrafiltration / Diafiltration (Tangential Flow Filtration, TFF)
[0275] The eluate (from the affinity chromatography) was filtered using a filter (Millipore Pellicon 2 Type A cassette) with a molecular weight cutoff of 5 kDa (approximately 5 times smaller than the protein, ensuring that the protein is retained while allowing buffer species to be removed). The eluate was concentrated to provide a protein concentration of approximately 2 mg / ml. The operating conditions are outlined below: [Table 21]
[0276] Buffer exchange (to S-M01 buffer) was then achieved using diafiltration mode, where buffer is added to the retentate system at the same rate that the current buffer (S-L02) is removed by the filtrate. The diavolume (DV) is the point at which the retentate volume of buffer has been exchanged. After 5 DV, 99.9% of the old buffer has been removed. The diafiltration process ends when the conductivity and pH of the filtrate reach the target values. The operating conditions are outlined below: [Table 22]
[0277] 1.12. Final concentration and storage
[0278] A final ultrafiltration step brings the protein concentration to 2.5 mg / ml (by diafiltration using a 0.2 μm filter as above). The operating parameters were as follows: [Table 23]
[0279] The product was then dispensed into 20 mL aliquots in 30 mL PETG bottles and stored at -80 + / - 10°C.
[0280] The purity of β-trypsin in the final filtrate was found to be >90% (determined by SDS-PAGE).
[0281] The product was lyophilized to drug product using the following cycle parameters: [Table 24]
[0282] [Example 2]
[0283] Suppression of trypsinogen instability after anion-exchange chromatography.
[0284] Renatured trypsinogen was prepared according to steps 1 to 1.8 of Example 1.
[0285] Prior to performing step 1.9 (activation by cleavage of trypsinogen to provide trypsin), the renatured trypsinogen (output of step 1.8) was held at room temperature (e.g., about 20°C) for different time points, i.e., ≤60 min or >60 min, after which protein stability was assessed by visual inspection (where cloudiness of the protein preparation indicated lack of stability, and absence of cloudiness indicated stability). Advantageously, a maximum holding time of 60 min was shown to prevent the appearance of cloudiness, demonstrating the ability to suppress trypsinogen instability after AEX by performing step 1.9 within a maximum of 60 min. [Table 25]
[0286] [Example 3]
[0287] Measurement of the cleavage activity of β-trypsin produced by the method of the present invention
[0288] Trypsin activity of purified β-trypsin using Nα-benzoyl-L-arginine ethyl ester (BAEE) as a substrate. This procedure involves continuous spectrophotometric rate determination (A) based on the following reaction: 253 , light path = 1 cm): BAEE + H2O (in the presence of trypsin) > Nα-benzoyl-L-arginine + ethanol [In the formula, BAEE-N α -benzoyl-L-arginine ethyl ester] Unit Definition - One BAEE unit of trypsin activity is a ΔA of 0.001 per minute using BAEE as the substrate at pH 7.6, 25°C, and a reaction volume of 3.20 ml.253 Generate.
[0289] Reagents and equipment:
[0290] Sodium phosphate, monobasic (e.g., Sigma catalog number S0751), Nα-benzoyl-L-arginine ethyl ester (BAEE, e.g., Sigma catalog number B4500), 1 M NaOH solution, 1 M hydrochloric acid.
[0291] Preparation instructions - Use ultrapure water (resistivity ≥ 18 MΩ x cm at 25°C) to prepare the reagent. - Buffer (67 mM sodium phosphate buffer, pH 7.6 at 25°C) - Prepare an 8.04 mg / ml solution using sodium phosphate, monobasic, in ultrapure water. Adjust to pH 7.6 at 25°C using 1 M NaOH solution. - Substrate solution (0.25 mM Na-benzoyl-L-arginine ethyl ester) - Prepare a 0.086 mg / ml solution in buffer using Na-benzoyl-L-arginine ethyl ester (BAEE, e.g. Sigma catalogue number B4500). - HCl solution (1 mM HCl) - Prepare a 1,000-fold dilution of 1 M HCl solution in ultrapure water. - Enzyme solution (trypsin) - Immediately prior to use, dilute the trypsin composition (both test and control reference samples) to 1 mg (of polypeptide) / ml in cold (2-8°C) HCl solution.
[0292] procedure
[0293] In a 3.20 ml reaction mixture, the final concentrations are 70 mM (e.g., 62.8 mM) sodium phosphate, 0.23 mM Nα-benzoyl-L-arginine ethyl ester, 0.031-0.063 mM hydrochloric acid, and 42.5-115.0 units of trypsin.
[0294] 1. Pipette the following reagents into a suitable quartz cuvette: [Table 26]
[0295] 2. Mix by inversion and equilibrate to 25°C using an appropriately thermostated spectrophotometer. Then add: [Table 27]
[0296] 3. Mix immediately by inversion and record the increase in A253 for 5 minutes. ΔA253 is calculated using the maximum linear velocity for both the blank and test using a 1 minute period and 4 data points. 253 / min.
[0297] calculation:
number
number
[0298] Convert BAEE units / ml to USP units / mg by dividing BAEE units / ml by the concentration of the beta-trypsin composition (eg, mg of polypeptide / ml) and then dividing by three.
[0299] result:
[0300] The activity was directly compared to that of a reference standard (RS). RS = Trypsin BRP (European Pharmacopoeia) Reference Standard obtained from EDQM catalogue number T2600000 batch 2 diluted to 1 mg / ml. The test sample (e.g., a beta-trypsin composition produced by the method of the present invention) was also diluted to 1 mg / ml. The activity of the beta-trypsin produced by the present invention was 12,342 BAEE U / mg. The activity of the RS was 8,233 BAEE U / mg. Thus, the activity of the claimed beta-trypsin composition is approximately 50% higher than that of the RS.
[0301] Certain properties of beta trypsin compositions were evaluated (Sample 1 = liquid trypsin release, Sample 2 = lyo trypsin release), see the table below: [Table 28]
[0302] All publications mentioned in the above specification are incorporated herein by reference. Various modifications and variations of the described methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in biochemistry and biotechnology or related fields are intended to be within the scope of the following claims.
[0303] array
[0304] Accession No. 1 (Bovine Trypsinogen) CATATGTAGAAGGAGATATACCATGGTGGATGATGATGATAAAATTGTGGGCGGCTATACCT GCGGCGCGAACACCGTGCCGTATCAGGTGAGCCTGAACAGCGGCTATCATTTTTGCGGCGGC AGCCTGATTAACAGCCAGTGGGTGGTGAGCGCGGCGCATTGCTATAAAAGCGGCATTCAGGT GCGCCTGGGCGAAGATAACATTAACGTGGTGGAAGGCAACGAACAGTTTATTAGCGCGAGC AAAAGCATTGTGCATCCGAGCTATAACAGCAACACCCTGAACAACGATATTATGCTGATTAAA CTGAAAAGCGCGGCGAGCCTGAACAGCCGCGTGGCGAGCATTAGCCTGCCGACCAGCTGCGC GAGCGCGGGCACCCAGTGCCTGATTAGCGGCTGGGGCAACACCAAAAGCAGCGGCACCAGCT ATCCGGATGTGCTGAAATGCCTGAAAGCGCCGATTCTGAGCGATAGCAGCTGCAAAAGCGCG TATCCGGGCCAGATTACCAGCAACATGTTTTGCGCGGGCTATCTGGAAGGCGGCAAAGATAG CTGCCAGGGCGATAGCGGCGGCCCGGTGGTGTGCAGCGGCAAACTGCAGGGCATTGTGAGC TGGGGCAGCGGCTGCGCGCAGAAAAACAAACCGGGCGTGTATACCAAAGTGTGCAACTATGT GAGCTGGATTAAACAGACCATTGCGAGCAACTAGAAGCTT
[0305] Accession No. 2 (L chain of BoNT / E) 1 PKINSFNYND PVNDRTILYI KPGGCQEFYK SFNIMKNIWI IPERNVIGTT 51 PQDFHPPTSL KNGDSSYYDP NYLQSDEEKD RFLKIVTKIF NRINNNLSGG 101 ILLEELSKAN PYLGNDNTPD NQFHIGDASA VEIKFSNGSQ DILLPNVIIM 151 GAEPDLFETN SSNISLRNNY MPSNHGFGSI AIVTFSPEYS FRFNDNSMNE 201 FIQDPALTLM HELIHSLHGL YGAKGITTKY TITQKQNPLI TNIRGTNIEE 251 FLTFGGTDLN IITSAQSNDI YTNLLADYKK IASKLSKVQV SNPLLNPYKD 301 VFEAKYGLDK DASGIYSVNI NKFNDIFKKL YSFTEFDLAT KFQVKCRQTY 351 IGQYKYFKLS NLLNDSIYNI SEGYNINNLK VNFRGQNANL NPRIITPITG 401 RGLVKKIIRF CKNIVSVKGI R
[0306] Sequence No. 3 (heavy chain of BoNT / E) 1 KSICIEINNG ELFFVASENS YNDDNINTPK EIDDTVTSNN NYENDLDQVI 51 LNFNSESAPG LSDEKLNLTI QNDAYIPKYD SNGTSDIEQH DVNELNVFFY 101 LDAQKVPEGE NNVNLTSSID TALLEQPKIY TFFSSEFINN VNKPVQAALF 151 VSWIQQVLVD FTTEANQKST VDKIADISIV VPYIGLALNI GNEAQKGNFK 201 DALELLGAGI LLEFEPELLI PTILVFTIKS FLGSSDNKNK VIKAINNALK 251 ERDEKWKEVY SFIVSNWMTK INTQFNKRKE QMYQALQNQV NAIKTIIESK 301 YNSYTLEEKN ELTNKYDIKQ IENELNQKVS IAMNNIDRFL TESSISYLMK 351 LINEVKINKL REYDENVKTY LLNYIIQHGS ILGESQQELN SMVTDTLNNS 401 IPFKLSSYTD DKILISYFNK FFKRIKSSSV LNMRYKNDKY VDTSGYDSNI 451 NINGDVYKYP TNKNQFGIYN DKLSEVNISQ NDYIIYDNKY KNFSISFWVR 501 IPNYDNKIVN VNNEYTIINC MRDNNSGWKV SLNHNEIIWT LQDNAGINQK 551 LAFNYGNANG ISDYINKWIF VTITNDRLGD SKLYINGNLI DQKSILNLGN 601 IHVSDNILFK IVNCSYTRYI GIRYFNIFDK ELDETEIQTL YSNEPNTNIL 651 KDFWGNYLLY DKEYYLLNVL KPNNFIDRRK DSTLSINNIR STILLANRLY 701 SGIKVKIQRV NNSTNDNLV RKNDQVYINF VASKTHLFPL YADTATTNKE 751 KTIKISSSGN RFNQVVVMNS VGNNCTMNFK NNNGNNIGLL GFKADTVVAS 801 TWYYTHMRDH TNSNGCFWNF ISEEHGWQEK
[0307] SEQ ID NO: 4 (5 x C-terminal residues of TAP) Asp-Asp-Asp-Asp-Lys
[0308] SEQ ID NO: 5 (6 x C-terminal residues of TAP) Val-Asp-Asp-Asp-Asp-Lys [Explanation of symbols]
[0309] [Figure 1] IB dissolving: IB dissolving Buffer: 8mM Urea, 100mM DTT, 20mM Citric acid, pH-5.0: Buffer: 8M Urea, 100mM DTT, 20mM Citric acid, pH5.0 Time: 12h: Time: 12 hours Centrifugation before EshmunoS: Centrifugation before EshmunoS Temp: 20-25℃: Temperature: 20-25℃ Equilibration / wash: 8M Urea, 20mM Citric acid, pH-5.0: Equilibration / wash: 8M Urea, 20mM Citric acid, pH-5.0 Elution: 8M Urea, 20mM Citric Acid, 0.1M NaCl, pH-5.0: Elution: 8M Urea, 20mM Citric Acid, 0.1M NaCl, pH5.0 Start fractionation UV280-0.1, End fractionation UV280-0.09 Refolding: Buffer solution: 50mM Tris, 1.5mM GSH, 1.5mM GSSG, 0.75M L-Arginine, pH-8.0: Buffer solution: 50mM Tris, 1.5mM GSH, 1.5mM GSSG, 0.75M L-Arginine, pH8.0 Time: ≥ 48h: Filtration after refolding: Filtration after refolding Temp: 2-8℃: Temperature: 2-8℃ Concentration factor 10x: Concentration factor 10x Diafiltration parameter: stop DF after conductivity reaches 5mS / cm: Cassette area: 2m 2 TMP-1.5 bar: Cassette area: 2m 2 , TMP-1.5 bar Filtraton before chromatography is required. Equilibrium / wash buffer: 50mM Tris, pH-7.4: Equilibration / wash buffer: 50mM Tris, pH 7.4 Chromatography type: FT: Chromatography type: FT Temp: Ambient during flow through (FT), 2-8°C otherwise: Activation: Activation Activation is performed by spiking with calcium, final concentration CaCl2 - 75mM: Activation is performed by spiking with calcium, final concentration CaCl2 - 75mM Activation can be monitored by RP-HPLC: Benzamidine: Benzamidine Equilibration: 50mM Tris, 0,1M NaCl, pH-7.4: Equilibration: 50mM Tris, 0,1M NaCl, pH-7.4 Elution pH gradient: Elution pH gradient Buffer A: 15mM Na2HPO, 30mM Trisodium citrate, pH-7.4 Buffer B: 15mM NaH2PO, 30mM Citric acid, pH-3.0: Buffer A: 15mM Na2HPO, 30mM Trisodium citrate, pH-7.4 Buffer B: 15mM NaH2PO, 30mM Citric acid, pH-3.0 Final UFDF: Final UFDF 5kDa cassette: 5kDa cassette Replace buffer to 10mM Citric Acid, pH-3.0 final concentration 2.5 mg / mL: Replace buffer with 10mM Citric Acid, pH-3.0 final concentration 2.5 mg / mL Storage at -80℃: Store at -80℃ Trypsin: Trypsin Trypsinogen [Figure 2] Tripsinogen: Trypsinogen Inclusion Body: Inclusion body After CEX: After CEX After refolding and filtration: Ladder: Ladder [Figure 3A] Trypsin in vivo Processing: Trypsin in vivo processing (bovine sequence) Trypsinogen: Trypsinogen Signal: Signal Activation peptide: Activation peptide Enterokinase Clevage: Enterokinase cleavage β-Trypsin: β-trypsin Substrate Binding: Substrate binding Active site serine: Active site serine α-Trypsin: α-trypsin Chain 1: Chain 1 Chain 2: Chain 2 Autolytic Cleavage [Figure 3B] After Activation: After activation 1st peak (α-trypsin): 1st peak (α-trypsin) 2nd peak (β-trypsin): 2nd peak (β-trypsin) Final β-Trypsin: Final β-Trypsin [Figure 4A] Sample: 1st confirmation run: First confirmation run 2nd confirmation run: 2nd confirmation run 3rd confirmation run: 3rd confirmation run Amount: amount Step yield %: Step yield % Total Yield: Total yield Solubilized IB: Solubilized IB Refolding: Activation: Activation Benzamidine: Benzamidine [Figure 4B] First consistency run Second consistency run Third consistency run Line: Line Sample: Marker: Marker Trypsinogen standard: Trypsinogen standard Trypsin standard: Trypsin standard Solubilized IB: Solubilized IB EshmunoS pool: EshmunoS pool Refolding: Activation: Activation Benzamidine: Benzamidine [Figure 5A] Minutes: Ambient / Room Temperature: Ambient / Room temperature [Figure 5B] Minutes: 0 hours, 2-8℃: 0 hours, 2-8℃ 24 hours, 2-8℃: 24 hours, 2-8℃ 48 hours, 2-8℃: 48 hours, 2-8℃ [Figure 7A] 1st peak: First peak 2nd peal: Second peak [Figure 7B] Trypsinogen: Trypsinogen Trypsin (ph. Eur) std: Trypsin (European Pharmacopoeia) standard benzamidine 1st peak: benzamidine 1st peak benzamidine 2nd peak: benzamidine 2nd peak
Claims
1. 1. A method for producing beta-trypsin, comprising: (A) refolding denatured trypsinogen, thereby producing renatured trypsinogen, wherein the refolding step is carried out in a buffer containing L-arginine; (B) purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen; and (C) incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, whereby trypsinogen is cleaved into β-trypsin by said proteolytic activity; wherein steps (A) and (B) are carried out under conditions that do not promote the proteolytic activity of trypsinogen; The method does not include the addition of an additional protease to cleave trypsinogen to beta-trypsin; At least step (C) is carried out in a buffer that does not contain L-arginine, and Prior to step (C), trypsinogen, when present in a buffer containing no L-arginine, is not subjected to a temperature of >8°C for more than 38 hours.
2. 2. The method of claim 1, wherein the following steps are carried out before step (A): (i) culturing a prokaryotic host cell containing a nucleic acid comprising a nucleotide sequence encoding trypsinogen, wherein the nucleotide sequence is operably linked to an inducible promoter; (ii) inducing expression of trypsinogen by the host cell, thereby forming one or more insoluble inclusion bodies containing trypsinogen; (iii) isolating one or more insoluble inclusion bodies from the host cells; (iv) solubilizing one or more insoluble inclusion bodies, thereby producing denatured trypsinogen; and (v) purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen.
3. The method described in claim 1 or 2, further comprising a step of isolating beta-trypsin.
4. 1. A method for producing beta-trypsin, comprising: (A) culturing a prokaryotic host cell containing a nucleic acid comprising a nucleotide sequence encoding trypsinogen, wherein the nucleotide sequence is operably linked to an inducible promoter; (B) inducing expression of trypsinogen by the host cell, thereby forming one or more insoluble inclusion bodies containing trypsinogen; (C) isolating one or more insoluble inclusion bodies from the host cells; (D) solubilizing one or more insoluble inclusion bodies, thereby producing denatured trypsinogen; (E) purifying the denatured trypsinogen by cation exchange chromatography, thereby providing purified denatured trypsinogen; (F) renaturing the purified denatured trypsinogen, thereby producing renatured trypsinogen; (G) purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen; (H) incubating the purified renatured trypsinogen under conditions that promote the proteolytic activity of trypsinogen, whereby the trypsinogen is cleaved into β-trypsin by said proteolytic activity; and (I) Isolating β-trypsin by affinity chromatography wherein steps (F) and (G) are carried out under conditions that do not promote the proteolytic activity of trypsinogen, and the method does not include the addition of an additional protease to cleave trypsinogen to β-trypsin.
5. 5. The method according to claim 1, further comprising subjecting the renatured trypsinogen to a volume reduction step.
6. 6. The method according to any one of claims 1 to 5, comprising subjecting the renatured trypsinogen to a filtration step that removes molecules having a size of less than 20 kDa.
7. 6. The method of claim 5, wherein the volume reduction step is carried out before, simultaneously with, or subsequent to the filtration step.
8. A method described in any one of claims 1 to 7, wherein the step of incubating purified renatured trypsinogen in claim 1 (C) or claim 4 (H) under conditions that promote the proteolytic activity of trypsinogen, and cleaving trypsinogen into beta-trypsin by said proteolytic activity, is initiated within 120 minutes of the completion of the step of purifying renatured trypsinogen by anion exchange chromatography in claim 1 (B) or claim 4 (G), respectively, thereby providing purified renatured trypsinogen.
9. A method described in any one of claims 1 to 8, wherein the proteolytic activity of the purified renatured trypsinogen in claim 1 (C) or claim 4 (H) is promoted by adding calcium.
10. (a) adding a calcium chelating agent to inhibit the proteolytic activity of trypsinogen or β-trypsin after trypsinogen has been cleaved by β-trypsin.
10. The method of claim 9, further comprising:
11. A method described in any one of claims 4 to 10, wherein the step of refolding the purified denatured trypsinogen in claim 4 (F), thereby producing refolded trypsinogen, is carried out in a buffer containing L-arginine.
12. 12. The method according to any one of claims 4 to 11, wherein at least the step of incubating the purified renatured trypsinogen of claim 4(H) under conditions that promote the proteolytic activity of trypsinogen, and cleaving trypsinogen into β-trypsin by said proteolytic activity, is carried out in a buffer that does not contain L-arginine.
13. A method described in any one of claims 4 to 12, wherein the purified renatured trypsinogen in claim 4 (H) is incubated under conditions that promote the proteolytic activity of trypsinogen, and before the step in which the trypsinogen is cleaved into beta-trypsin by said proteolytic activity, the trypsinogen is exposed to a temperature of 15 to 30°C when present in a buffer that does not contain L-arginine for longer than 2 hours.
14. In the step of renature of denatured trypsinogen in claim 1 (A), thereby producing renatured trypsinogen, the renaturing step is carried out in a buffer containing L-arginine, or in the step of renature of purified denatured trypsinogen in claim 4 (F), thereby producing renatured trypsinogen, 14. The method of claim 1, wherein L-arginine is present at a concentration of from 0.6 M to less than 1 M.
15. A method according to any one of claims 1 to 14, wherein in the step of regenerating denatured trypsinogen in claim 1 (A), thereby producing regenerated trypsinogen, the regeneration step is carried out in a buffer containing L-arginine, or in the step of regenerating purified denatured trypsinogen in claim 4 (F), thereby producing regenerated trypsinogen, the denatured trypsinogen is present at a starting concentration of less than 0.2 mg / mL.
16. A method according to any one of claims 1 to 14, wherein in the step of regenerating denatured trypsinogen in claim 1 (A), thereby producing regenerated trypsinogen, the regeneration step is carried out in a buffer containing L-arginine, or in the step of regenerating purified denatured trypsinogen in claim 4 (F), thereby producing regenerated trypsinogen, the denatured trypsinogen is present at a starting concentration of greater than 0.06 mg / mL to less than 0.2 mg / mL.
17. A method described in any one of claims 3 to 16, wherein the step of isolating beta trypsin in claim 3 or the step of isolating beta trypsin by affinity chromatography in claim 4 (I) is carried out by benzamidine affinity chromatography.
18. The method of claim 1(A) of regenerating denatured trypsinogen, thereby producing renatured trypsinogen, wherein the renaturing step is carried out in a buffer containing L-arginine, and the method of claim 1(B) of purifying the renatured trypsinogen by anion exchange chromatography, thereby providing purified renatured trypsinogen, are carried out in the absence of calcium, and the method of claim 2(ii) of inducing expression of trypsinogen by a host cell, thereby producing one or more trypsinogen-containing ...
18. The method of any one of claims 2, 3, 5-10 or 14-17, wherein the steps of forming insoluble inclusion bodies, isolating one or more insoluble inclusion bodies from the host cell in claim 2(iii), solubilizing one or more insoluble inclusion bodies in claim 2(iv), thereby producing denatured trypsinogen, and / or purifying the denatured trypsinogen by cation exchange chromatography in claim 2(v), thereby providing purified denatured trypsinogen, are performed in the absence of calcium.
19. A method according to any one of claims 4 to 17, wherein the steps of refolding purified denatured trypsinogen in claim 4(F), thereby producing renatured trypsinogen, and purifying the renatured trypsinogen by anion exchange chromatography in claim 4(G), thereby providing purified renatured trypsinogen, are carried out in the absence of calcium, and the steps of inducing expression of trypsinogen by host cells in claim 4(B), thereby forming one or more insoluble inclusion bodies containing trypsinogen, isolating one or more insoluble inclusion bodies from host cells in claim 4(C), solubilizing one or more insoluble inclusion bodies in claim 4(D), thereby producing renatured trypsinogen, and / or purifying the renatured trypsinogen by cation exchange chromatography in claim 4(E), thereby providing purified renatured trypsinogen, are carried out in the absence of calcium.
20. 20. The method according to any one of claims 1 to 19, wherein the trypsinogen and beta-trypsin are wild-type trypsinogen and wild-type beta-trypsin, respectively.
21. 21. The method of claim 1, wherein the trypsinogen and beta-trypsin are bovine trypsinogen and bovine beta-trypsin, respectively.
22. The method of any one of claims 2 to 21, wherein the prokaryotic host cell in claim 2(i) or claim 4(A) is an Escherichia coli host cell.
23. A method described in any one of claims 2 to 22, wherein expression of trypsinogen in claim 2(ii) or claim 4(B) is induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.25 to 0.75 mM.
24. A method described in any one of claims 2 to 23, wherein the expression of trypsinogen in claim 2(ii) or claim 4(B) is induced for at least 4 hours.
25. A method described in any one of claims 2 to 24, wherein expression of trypsinogen in claim 2(ii) or claim 4(B) is induced for 4 to 12 hours.
26. The prokaryotic host cell of claim 2(i) or claim 4(A) having an optical density at 600 nm (OD ) of 35 to 65. 600 The method according to any one of claims 2 to 25, wherein the culture medium is cultured until the culture medium reaches a temperature of 100°C.
27. 27. The method of any one of claims 1 to 26, wherein the renatured trypsinogen is present in a fraction that does not interact with the anion exchange chromatography medium.
28. A method described in any one of claims 1 to 27, wherein the purified renatured trypsinogen of claim 1 (C) or claim 4 (H) is incubated under conditions that promote the proteolytic activity of trypsinogen, and calcium is added to a final concentration of at least 10 mM in the process in which trypsinogen is cleaved into β-trypsin by said proteolytic activity.
29. A method described in any one of claims 1 to 28, wherein the purified renatured trypsinogen of claim 1 (C) or claim 4 (H) is incubated under conditions that promote the proteolytic activity of trypsinogen, and calcium is added to a final concentration of 20 to 150 mM in the process in which trypsinogen is cleaved into β-trypsin by said proteolytic activity.
30. A method described in any one of claims 1 to 29, wherein the purified renatured trypsinogen of claim 1 (C) or claim 4 (H) is incubated under conditions that promote the proteolytic activity of trypsinogen, and in the process in which trypsinogen is cleaved into β-trypsin by the proteolytic activity, the purified renatured trypsinogen is incubated for 5 to 48 hours.
31. A method described in any one of claims 1 to 30, wherein the purified renatured trypsinogen of claim 1 (C) or claim 4 (H) is incubated under conditions that promote the proteolytic activity of trypsinogen, and in the process in which trypsinogen is cleaved into β-trypsin by the proteolytic activity, the purified renatured trypsinogen is incubated at a temperature of 15 to 30°C.
32. 32. The method of any one of claims 1 to 31, further comprising contacting the single-chain clostridial neurotoxin having an activation loop with beta-trypsin, wherein the beta-trypsin hydrolyzes the peptide bond of the activation loop of the single-chain clostridial neurotoxin, thereby generating a di-chain clostridial neurotoxin.
Citation Information
Patent Citations
Recombinant clostridium botulinum neurotoxins
JP2019068823A
Chymotrypsin-free trypsin
WO2001019970A2
Process for the production of recombinant trypsin
WO2012104099A1