Oligonucleotides and methods of use thereof for treating neurological disorders

Abstract

Disclosed herein are antisense oligonucleotide sequences and methods of their use for treating neurological diseases.

Description

[Technical Field]

[0001] cross reference This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62 / 856,264, filed June 3, 2019; U.S. Provisional Patent Application No. 62 / 914,252, filed October 11, 2019; and U.S. Provisional Patent Application No. 62 / 949,817, filed December 18, 2019, the entire disclosures of each of which are hereby incorporated by reference in their entirety for any purpose.

[0002] Array List This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. A copy of said ASCII file created on May 29, 2020 is available at: QRL-002WO _ It is named L.txt and is 378,978 bytes in size.

[0003] The present application relates to inhibitors of STMN2 transcripts containing cryptic exons, including STMN2 antisense oligonucleotide sequences, and methods for treating neurological disorders. [Background technology]

[0004] Motor neuron disease is a class of neurological disorders that causes the degeneration and death of motor neurons (neurons that control the voluntary movement of muscles by the brain). Motor neuron diseases can be sporadic or hereditary, and can affect upper and / or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.

[0005] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases that affects approximately 15,000 people in the United States. ALS is characterized by the degeneration and death of upper and lower motor neurons, leading to loss of voluntary muscle control. Motor neuron death is accompanied by muscle spasms and atrophy. Early symptoms of ALS include painful muscle cramps, muscle spasms, muscle weakness (e.g., affecting the arms, legs, neck, or diaphragm), slurred nasal voice, and difficulty chewing or swallowing. Loss of strength and control over movements, such as those required for speech, feeding, and breathing, ultimately occurs. Disease progression may be accompanied by weight loss, malnutrition, anxiety, and depression, and there is an increased risk of pneumonia, painful muscle spasms, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die of respiratory failure within five years of the first onset of symptoms. Currently, there is no effective treatment for ALS.

[0006] ALS occurs in individuals of all ages but is most common in those aged 55-75, with a slightly higher incidence in men. ALS can be characterized as sporadic or familial. Sporadic ALS appears to occur randomly and accounts for over 90% of all cases of ALS. Familial ALS accounts for 5-10% of all cases of ALS.

[0007] FTD refers to a spectrum of progressive neurodegenerative diseases caused by neuronal loss in the frontal and temporal lobes of the brain. FTD is characterized by behavioral and personality changes and language impairment. Forms of FTD include behavioral vulnerabilities (bvFTD), semantic primary progressive aphasia (svPPA), and non-fluent primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD, such as muscle weakness, atrophy, fasciculations, spasticity, muteness (dysarthria), and difficulty swallowing (dysphagia). While individuals typically die from FTD within 5–10 years, ALS with FTD often causes death within 2–3 years after disease symptoms first appear.

[0008] As with ALS, there is no known cure for FTD or ALS with FTD, and no known therapeutic agents to prevent or slow the progression of the disease.

[0009] Thus, there is an urgent need to identify compounds that can prevent, ameliorate, and treat neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, corticobasal degeneration (CBD), and / or neuropathy, such as chemotherapy-induced neuropathy.

[0010] The RNA-binding protein transactive response DNA-binding protein 43 (TDP-43) is involved in fundamental RNA processing activities, including RNA transcription, splicing, and transport. TDP-43 binds with high affinity to GU-rich sequences to thousands of pre-messenger RNA / mRNA targets, including autoregulation of its own mRNA via binding to the 3' untranslated region. Depletion of TDP-43 from an otherwise normal adult nervous system alters the splicing or expression levels of over 1,500 RNAs, including long intron-containing transcripts. See Melamed et al., Nat Neurosci. (2019), 22(2):180-190.

[0011] Cytoplasmic accumulation of TDP-43 and nuclear attrition have been reported in affected neurons in most cases of ALS and in approximately 45% of patients with FTD. See Melamed et al., Nat Neurosci. (2019), 22(2):180-190. Additionally, TDP-43 has been shown to regulate the expression of the neuronal outgrowth-related factor stathmin 2. See Melamed (2019); see also Klim et al., Nat Neurosci. (2019), 22(2):167-179. TDP-43 disruption has been shown to promote premature polyadenylation and aberrant splicing in intron 1 of stathmin 2 pre-mRNA, resulting in mRNA truncation and loss of functional STMN2 protein. See Melamed (2019). STMN2 encodes a protein required for normal motor neuron growth and repair. See Melamed (2019); see also Klim (2019).

[0012] The Stathmin2 gene has been noted to contain five constitutive exons (Refseq ID: NM_001199214.1) and a proposed alternative exon between exons 4 and 5. See Melamed (2019); see also Klim (2019). Reduced or mutated TDP-43 induces a novel spliced ​​exon, which maps within intron 1. See Melamed (2019); see also Klim (2019). This novel exon (designated "exon 2a" or "cryptic exon") appears in the STMN2 pre-mRNA when TDP-43 is depleted or when endogenous TDP-43 has the N352 mutation. See Melamed (2019); see also Klim (2019). The cryptic exon in the STMN2 pre-mRNA contains a cryptic polyadenylation sequence that causes premature polyadenylation of the pre-mRNA. See Melamed (2019); see also Klim (2019). This prematurely polyadenylated RNA contains 227 nucleotides derived from a cryptic exon, and its predicted 16-amino acid translation product initiates at a conventional AUG codon in exon 1 and terminates 11 codons into the cryptic exon. See Melamed (2019); see also Klim (2019).

[0013] The present invention provides inhibitors of STMN2 transcripts containing cryptic exons for treating neurological diseases or disorders. Summary of the Invention [Means for solving the problem]

[0014] Oligonucleotide inhibitors are described herein. In various embodiments, the oligonucleotides target transcripts to treat neurological diseases, including motor neuron disease and / or neuropathy. For example, transcript inhibitors can be used to treat PD, ALS, FTD, and ALS with FTD. In various embodiments, the oligonucleotide inhibitors are antisense oligonucleotides. In various embodiments, the oligonucleotide inhibitors target the stathmin 2 (STMN2) transcript. In some embodiments, the STMN2 transcript contains a cryptic exon, such as the cryptic exon having the sequence identified below in SEQ ID NO: 447.

[0015] Further disclosed herein are compounds comprising oligonucleotides comprising linked nucleosides having a sequence of at least 19 contiguous nucleobases that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to SEQ ID NO:944, or an equal-length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NO:944, or to an equal-length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a 19-50 contiguous nucleobase portion of SEQ ID NO:944, wherein at least one nucleoside linkage of the linked nucleoside is a non-natural linkage. Further disclosed herein are oligonucleotides comprising linked nucleosides having a sequence of at least 19 contiguous nucleobases that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to SEQ ID NO:944, or an equal-length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NO:944, or to an equal-length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to 19 to 50 contiguous nucleobases of SEQ ID NO:944, wherein at least one nucleoside linkage of the linked nucleoside is a non-natural linkage.

[0016] In various embodiments, the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with an equal-length portion of any one of SEQ ID NOs: 1-446, SEQ ID NOs: 894-918, SEQ ID NOs: 945-1390, or SEQ ID NOs: 1392-1432. In various embodiments, the sequence of nucleobases comprises a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with an equal-length portion of any one of SEQ ID NOs: 1-446, SEQ ID NOs: 894-918, SEQ ID NOs: 945-1390, or SEQ ID NOs: 1392-1432.

[0017] In various embodiments, the nucleobase sequences are selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141 , 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside linkage of the linked nucleoside is a non-natural linkage. In various embodiments, the nucleobase sequences are selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 11 1324, 1329, 1334, 1339, or 1344.

[0018] Further disclosed herein are compounds comprising oligonucleotides comprising linked nucleosides having a sequence of at least 19 consecutive nucleobases, wherein the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432. Further disclosed herein are oligonucleotides comprising linked nucleosides having a sequence of at least 19 consecutive nucleobases, wherein the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432. In various embodiments, the sequence of nucleobases comprises a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 894-918 or 1392-1432.

[0019] 1. A compound comprising an oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleobases, wherein the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-193, 170-194, 170-195, 171-195, 171-196, 171-197, 171-198, 171-199, 171-199, 171-200, 171-201, 171-202, 171-203, 171-204, 171-205, 171-206, 171-207, 171-208, 171-209 ...9, 171-209, Further disclosed herein are compounds comprising a portion of at least 10 consecutive nucleobases that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to an isometric portion of nucleobases within any one of sequences 194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300. An oligonucleotide comprising linked nucleosides having a sequence of nucleobases having a sequence of at least 19 consecutive nucleobases, wherein the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171 ... Further disclosed herein are oligonucleotides comprising a portion of at least 10 consecutive nucleobases that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to an isometric portion of a nucleobase within any one of 195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300.

[0020] In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of SEQ ID NO:944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an equal length portion of nucleobases contained within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of SEQ ID NO: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an equal length portion of nucleobases contained within any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of SEQ ID NO:944.

[0021] In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of SEQ ID NO: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of SEQ ID NO: 944. In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 172-197, 172-198, 172-199, 172-200, 172-201, 172-202, 172-203, 172-204, 172-205, 172-206, 172-207, 172-208, 172-209, 172-201 ...1, 172-201, 172-201, 172-203, 172-204, 172-205, 172-206, 172-207, 172-208, 172-209, 172-201, 172-201, 172 and comprising a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is complementary to an isometric portion of nucleobases contained in any one of 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300.In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-219, 192-219, 193-219, 194-219, 195-219, 196-219, 197-219, 198-219, 199-220, 199-221, 199-221, 199-222, 199-222, 199-223, 199-224, 199-225, 199-226, 199-227, 199-228, 199-300, 199-301, 199-401, 199-410, 199-501, 199-602, 199-703, 199-804, 199-905, 199-106, 199-201, 199-202, 199-303, 199-414, 199 and a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is complementary to an isometric portion of nucleobases contained in any one of 209, 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261.

[0022] In various embodiments, the oligonucleotide is 19 and 40 nucleosides in length.In various embodiments, the oligonucleotide comprises at least one nucleoside bond selected from the group consisting of phosphodiester bond, phosphorothioate bond, alkylphosphate bond, alkylphosphonate bond, 3-methoxypropylphosphonate bond, phosphorodithioate bond, phosphotriester bond, methylphosphonate bond, aminoalkylphosphotriester bond, alkylenephosphonate bond, phosphinate bond, phosphoramidate bond, phosphoramidothioate bond, phosphorodiamidate (including, for example, phosphorodiamidate morpholino (PMO), 3' aminoribose or 5' aminoribose) bond, aminoalkylphosphoramidate bond, thiophosphoramidate bond, thionoalkylphosphonate bond, thionoalkylphosphotriester bond, thiophosphate bond, selenophosphate bond and boranophosphate bond, or any combination(s) thereof. In various embodiments, at least 2, 3, or 4 internucleoside linkages of the oligonucleotide are phosphodiester internucleoside linkages. In various embodiments, the oligonucleotide comprises at least 2, 3, or 4 modified internucleoside linkages.

[0023] In various embodiments, each modified internucleoside bond of the oligonucleotide is independently selected from phosphorothioate bond, phosphoramidate bond, phosphoramidothioate bond, and phosphorodiamidate bond.In various embodiments, all internucleoside bonds of the oligonucleotide are phosphorothioate bond.In various embodiments, the phosphorothioate internucleoside bond is one of Rp configuration or Sp configuration.In various embodiments, the oligonucleotide comprises at least one modified nucleobase.In various embodiments, at least one modified nucleobase is 5-methylcytosine, pseudouridine, or 5-methoxyuridine.

[0024] In various embodiments, the oligonucleotide comprises at least one modified sugar moiety, which is one of a 2'-OMe (2'-OCH3 or 2'-O-methyl) modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl) (2'-O(CH2)2OCH3 (2'MOE)), a 2'-deoxy-2'-fluoronucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a constrained ethyl 2'-4'-bridged nucleic acid (cEt), an S-cEt, a hexitol nucleic acid (HNA), and a tricyclic analog (e.g., tcDNA).

[0025] In various embodiments, the oligonucleotide comprises three linked nucleosides linked through phosphodiester internucleoside linkages at the 5'-terminus and three linked nucleosides linked through phosphodiester internucleoside linkages at the 3'-terminus. In various embodiments, the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked through phosphorothioate internucleoside linkages. In some embodiments, all cytosine nucleosides in the STMN2 antisense oligonucleotides of the present invention comprise modified sugar moieties containing 2'-MOE, all nucleosides comprise modified nucleobases 5-methylcytosine, and all internucleoside linkages are phosphorothioate linkages. In various embodiments, the oligonucleotide comprises three linked nucleosides linked through phosphorothioate internucleoside linkages at the 5'-terminus and three linked nucleosides linked through phosphorothioate internucleoside linkages at the 3'-terminus. In various embodiments, the oligonucleotide comprises five linked nucleosides linked through phosphodiester internucleoside linkages. In various embodiments, each of the five linked nucleosides is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside.

[0026] In various embodiments, the oligonucleotides exhibit at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase in full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotides exhibit at least a 100% increase in full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotides exhibit at least a 200% increase in full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotides exhibit at least a 300% increase in full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotides exhibit at least a 400% increase in full-length STMN2 transcript or STMN2 protein. In various embodiments, the increase in full-length STMN2 protein is measured relative to the reduced levels of full-length STMN2 protein achieved using a TDP43 antisense oligonucleotide. In various embodiments, the oligonucleotides exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length STMN2 transcripts or STMN2 protein, hi various embodiments, the oligonucleotides exhibit at least 50%, 60%, 70%, 80%, or 90% reduction of STMN2 transcripts with cryptic exons.

[0027] Further disclosed herein is a pharmaceutical composition comprising one or more of the above-mentioned oligonucleotides, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. Further disclosed herein is a method for treating neurological disease and / or neuropathy in a patient in need thereof, comprising administering to the patient any of the above-mentioned oligonucleotides or a pharmaceutically acceptable salt thereof, or the above-mentioned pharmaceutical composition.

[0028] In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0029] Further disclosed herein is a method for restoring axonal outgrowth and / or regeneration of neurons, comprising exposing motor neurons to any of the above-described oligonucleotides or a pharmaceutically acceptable salt thereof, or the above-described pharmaceutical composition. Further disclosed herein is a method for increasing, promoting, stabilizing, or maintaining STMN2 expression and / or function in neurons, comprising exposing cells to any of the above-described oligonucleotides or a pharmaceutically acceptable salt thereof, or the above-described pharmaceutical composition. In various embodiments, the neurons are neurons in a patient in need of treatment for a neurological disease and / or neuropathy. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0030] In various embodiments, the exposing step is performed in vivo or ex vivo. In various embodiments, the exposing step comprises administering a STMN2 oligonucleotide (STMN2 AON) or pharmaceutical composition thereof disclosed herein to a patient in need thereof. In various embodiments, the STMN2 oligonucleotide or pharmaceutical composition thereof is administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally, intraduodenally, or intravenously), intralesionally, intrathecally, intracisternally, orally, rectally, bucally, sublingually, intravaginally, intrapulmonary, intratracheally, intranasally, transdermally, or intraduodenally. In various embodiments, the STMN2 oligonucleotide or pharmaceutical composition thereof is administered orally. In various embodiments, a therapeutically effective amount of the STMN2 oligonucleotide or pharmaceutical composition thereof is administered intrathecally or intracisternally.

[0031] In various embodiments, the patient is a human. In various embodiments, the pharmaceutical composition is suitable for topical, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), intralesional, oral, intrapulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, intravaginal, or intraduodenal administration.

[0032] Further disclosed herein is the use of the above-mentioned STMN2 oligonucleotide or its pharmaceutically acceptable salt, or pharmaceutical composition, in the manufacture of a medicament for treating neurological disease or neuropathy.In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD).In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0033] Further disclosed herein is a method for treating a neurological disease or neuropathy in a patient in need thereof, the method comprising administering a therapeutically effective amount of the above-described STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition to the patient in need thereof. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally, intraduodenally, or intravenously), intralesionally, orally, intrapulmonary, intrarectally, bucally, sublingually, intravaginally, intratracheally, intranasally, intracisternally, intrathecally, transdermally, or intraduodenal. In various embodiments, the pharmaceutical composition is administered intrathecally or intracisternally. In various embodiments, a therapeutically effective amount of an STMN2 oligonucleotide or a pharmaceutical composition thereof is administered intrathecally or intracisternally. In various embodiments, the patient is a human.

[0034] Further disclosed herein is an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof, which is used as a medicine in the treatment of neurological disease or neuropathy.In certain embodiments, the present disclosure provides an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof for use in the treatment of neurological disease or neuropathy.In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD).In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0035] Further disclosed herein is an STMN2 oligonucleotide, or a pharmaceutically acceptable salt thereof, comprising linked nucleosides having a nucleobase sequence of any one of SEQ ID NOs: 1-446, 894-918, 945-1390, or 1392-1432; wherein the oligonucleotide is selected from the group consisting of phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, phosphorodithioate linkages, phosphotriester linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoramidothiate linkages, phosphorodiamidate linkages, aminoalkylphosphoramidate linkages, and the like. In this case, the nucleoside comprises at least one nucleoside linkage selected from the group consisting of a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or at least one nucleoside of the linked nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl)nucleoside (2'-O-methoxyethylribonucleoside (2'-MOE)), a 2'-O-methylnucleoside, a 2'-deoxy-2'-fluoronucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a constrained methoxyethyl (cMOE), a constrained ethyl (cET), and a peptide nucleic acid (PNA).

[0036] In various embodiments, at least one internucleoside bond of the oligonucleotide is a phosphorothioate bond. In various embodiments, the oligonucleotide comprises three linked nucleosides linked through phosphodiester internucleoside bond at the 5'-terminus and three linked nucleosides linked through phosphodiester internucleoside bond at the 3'-terminus. In various embodiments, the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked through phosphorothioate internucleoside bond. In various embodiments, the oligonucleotide comprises five linked nucleosides linked through phosphodiester internucleoside bond. In various embodiments, each of the five linked nucleosides is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages, and optionally each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0037] Further disclosed herein is a pharmaceutical composition comprising any of the above-described oligonucleotides or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient. Further disclosed herein is an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof that is capable of increasing, restoring, or stabilizing the expression of STMN2 mRNA capable of translating functional STMN2 and / or the activity and / or function of STMN2 protein in cells or human patients with neurological diseases or disorders, and the level of increasing, restoring, or stabilizing expression and / or activity and / or function is sufficient to allow the oligonucleotide to be used as a pharmaceutical for treating neurological diseases or disorders. In various embodiments, the oligonucleotide contains one or more chiral centers and / or double bonds. In various embodiments, the oligonucleotide exists as a stereoisomer selected from geometric isomers, enantiomers, and diastereomers.

[0038] A method for treating a neurological disease and / or neuropathy in a patient in need thereof, comprising administering to a patient in need thereof a therapeutically effective amount of an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition as described above, and administering to the patient a therapeutically effective amount of riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZI for treating the neurological disease. Further disclosed herein are methods that include administering in combination with a second therapeutic agent selected from LUCOPLAN (RA101495), dual AON intrathecal agents (e.g., BIIB067, BIIB078), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers, anticonvulsants, and psychostimulants, and / or a therapy (e.g., selected from breathing care, physical therapy, occupational therapy, speech therapy, nutritional support).

[0039] In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy. [Brief explanation of the drawings]

[0040] [Figure 1A] Figure 1A is a schematic depiction of portions of the STMN2 transcript and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. In Figure 1A, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 1B] Figure 1B is another schematic depiction of portions of the STMN2 transcript in SY5Y cells and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. In Figure 1B, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 1C]Figure 1C is another schematic depiction of STMN2 antisense oligonucleotides designed to target portions of the STMN2 transcript in human motor neurons and specific portions of the STMN2 transcript. In Figure 1C, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 2] Figure 2 is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-36, QSN-55, QSN-177, QSN-203, QSN-244, and QSN-395). [Figure 3] Figure 3 is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction in mRNA levels of STMN2 transcripts with cryptic exons in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). [Figure 4] Figure 4 is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, as well as the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). [Figure 5A]Figure 5A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction in mRNA levels of STMN2 transcripts with cryptic exons in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). [Figure 5B] Figure 5B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). [Figure 6] Figure 6A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two duplicate experiments. Figure 6B is a bar graph showing the results of RT-qPCR analysis of the full-length STMN2 mRNA levels in the presence of TDP43 antisense and the restoration of the full-length STMN2 transcript in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two duplicate experiments. [Figure 7]Figure 7A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA level of STMN2 transcripts with cryptic exons in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). Figure 7B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). [Figure 8] Figure 8A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA level of STMN2 transcripts with cryptic exons in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). Figure 8B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). [Figure 9]Figure 9A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, as well as the reduction of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). Figure 9B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, as well as the restoration of full-length STMN2 transcripts in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). [Figure 10] Figure 10A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-181 STMN2 antisense oligonucleotide. Figure 10B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-181 STMN2 antisense oligonucleotide. [Figure 11] Figure 11A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-185 STMN2 antisense oligonucleotide. Figure 11B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-185 STMN2 antisense oligonucleotide. [Figure 12] Figure 12A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-197 STMN2 antisense oligonucleotide. Figure 12B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-197 STMN2 antisense oligonucleotide. [Figure 13] Figure 13A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons across different dosages of QSN-144 STMN2 antisense oligonucleotide. Figure 13B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-144 STMN2 antisense oligonucleotide. [Figure 14] Figure 14A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons across different dosages of QSN-173 STMN2 antisense oligonucleotide. Figure 14B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript across different dosages of QSN-173 STMN2 antisense oligonucleotide. [Figure 15] Figure 15A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons across different dosages of QSN-237 STMN2 antisense oligonucleotide. Figure 15B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript across different dosages of QSN-237 STMN2 antisense oligonucleotide. [Figure 16] Figure 16 is a protein blot and a quantified bar graph showing normalized amounts of STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts for two different STMN2 antisense oligonucleotides (QSN-173 and QSN237). [Figure 17] Figure 17A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 17B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotide. [Figure 18]Figure 18A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-185 STMN2 antisense oligonucleotide. Figure 18B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different variants of QSN-185 STMN2 antisense oligonucleotide. [Figure 19] Figure 19A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 19B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript using different variants of QSN-173 STMN2 antisense oligonucleotide. [Figure 20] Figure 20A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 20B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotide. [Figure 21]Figure 21A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 21B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-173 STMN2 antisense oligonucleotide. [Figure 22] Figure 22A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-144 STMN2 antisense oligonucleotide. Figure 22B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-144 STMN2 antisense oligonucleotide. [Figure 23] FIG. 23 shows a dose-response curve demonstrating the increasing restoration of full-length STMN2 transcript with increasing concentrations of STMN2 AON. [Figure 24A] FIG. 24A shows a Western blot assay demonstrating a qualitative increase in full-length STMN2 protein in response to higher concentrations of STMN2 AON. [Figure 24B] FIG. 24B shows the quantified levels of full-length STMN2 protein normalized to GAPDH in response to different concentrations of STMN2 AON. [Figure 25]Figure 25A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-144 STMN2 AONs and AON variants. Figure 25B is a bar graph showing the results of RT-qPCR analysis of the TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-144 STMN2 AONs and AON variants. [Figure 26] Figure 26A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different QSN-173 STMN2 AONs and AON variants. Figure 26B is a bar graph showing the results of RT-qPCR analysis of the TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-173 STMN2 AONs and AON variants. [Figure 27] Figure 27A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-185 STMN2 AONs and AON variants. Figure 27B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-185 STMN2 AONs and AON variants. [Figure 28]Figure 28A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-237 STMN2 AONs and AON variants. Figure 28B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-237 STMN2 AONs and AON variants. [Figure 29] Figure 29A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 29B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 30] FIG. 30 is a bar graph showing reversal of cryptic exon induction in human motor neurons using QSN-237 STMN2 antisense oligonucleotide, even when considering increased proteasome inhibition. [Figure 31A] Figure 31A shows a bar graph depicting the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons and STMN2 full-length mRNA levels, demonstrating reduction of mRNA levels of STMN2 transcripts with cryptic exons and restoration of full-length STMN2 transcripts using different STMN2 AONs and AON variants. [Figure 31B]Figure 31B shows a bar graph depicting the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons and STMN2 full-length mRNA levels, demonstrating the reduction of mRNA levels of STMN2 transcripts with cryptic exons and the restoration of full-length STMN2 transcripts using different STMN2 AONs and AON variants. [Figure 32] FIG. 32 is a bar graph showing the results of Western blot analysis of STMN2 protein levels, demonstrating the restoration of full-length STMN2 protein using different STMN2 AONs and AON variants. [Figure 33A] Figure 33A is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction in mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 33B] Figure 33B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 34A] Figure 34A is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction of mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). [Figure 34B] Figure 34B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). [Figure 34C]Figure 34C is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction in mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). [Figure 34D] Figure 34D is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). [Figure 34E] Figure 34E is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating the reduction of mRNA levels of STMN2 transcripts with cryptic exons using a different STMN2 AON (QSN-249). [Figure 34F] Figure 34F is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the restoration of full-length STMN2 transcripts using a different STMN2 AON (QSN-249). DETAILED DESCRIPTION OF THE INVENTION

[0041] The characteristics and other details of the present disclosure will now be more specifically described. Certain terms used in the present specification, examples, and appended claims are summarized here. These definitions should be read in light of the remainder of the present disclosure and should be understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0042] The terms "treat," "treatment," "treating," and the like are used herein to generally mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in terms of partial or complete curing of the disease and / or side effects attributable to the disease. The term "treatment," as used herein, covers any treatment of disease in mammals, particularly humans, and includes (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or extent; (b) palliating the disease, i.e., causing some or all of the disease to improve; or (c) preventing the recurrence of the disease, i.e., preventing the disease from returning to an active state after a previous successful treatment of the symptoms of the disease or of the disease.

[0043] "Preventing" includes delaying the onset of clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or condition that manifest in a subject who is suffering from or believed to be susceptible to the condition, disorder, disease, or condition, but who has not yet experienced or exhibited clinical or subclinical symptoms of the condition, disorder, disease, or condition. "Preventing" includes prophylactically treating a condition, disorder, disease, or condition that manifests in or manifests in a subject, including prophylactically treating clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or condition that manifests in or manifests in a subject.

[0044] The terms "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" as used herein refer interchangeably to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may also contain other active compounds that provide complementary, additional, or enhancing therapeutic functions.

[0045] The term "pharmaceutical composition," as used herein, refers to a composition comprising at least one biologically active compound, such as an STMN2 antisense oligonucleotide (AON) as disclosed herein, formulated together with one or more pharmaceutically acceptable excipients.

[0046] The terms "individual," "patient," or "subject" are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or non-human primates, most preferably humans. The compounds of the present invention can be administered to mammals, such as humans, but also to other mammals, such as animals requiring veterinary treatment, including domestic animals (e.g., dogs, cats, etc.), livestock (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammal treated in the methods of the present invention is desirably a mammal in which modulation of STMN2 expression and / or activity is desired.

[0047] The terms "STMN2 oligonucleotide," "STMN2 antisense oligonucleotide," or "STMN2 AON" refer to an oligonucleotide capable of increasing, restoring, or stabilizing the activity of full-length STMN2, e.g., the expression of full-length STMN2 mRNA and / or full-length STMN2 protein. Generally, an STMN2 oligonucleotide targets an STMN2 transcript containing a cryptic exon, thereby reducing the level of the mature STMN2 transcript containing the cryptic exon. A patient suffering from ALS, FTD, ALS with FTD, or another neurological or motor neuron disease may be a patient diagnosed with the disease or a patient exhibiting symptoms of the disease. A patient suffering from ALS, FTD, ALS with FTD, or another neurological or motor neuron disease may be a patient who previously suffered from the disease, recovered from the disease and / or disease symptoms, or experienced complete or partial improvement, followed by a complete or partial recurrence of the disease or disease symptoms. A patient suffering from ALS, FTD, ALS with FTD, or another neurological or motor neuron disease or condition may harbor a genetic mutation associated with the symptoms of the disease or condition.For example, patients suffering from ALS have been reported to have elevated levels of SOD1, C9orf72, ataxin 2 (ATXN2), charged multivesicular body protein 2B (CHMP2B), dynactin 1 (DCTN1), human epidermal growth factor receptor 4 (ERBB4), FIG4 phosphoinositide 5-phosphatase (FIG4), NIMA-related kinase 1 (NEK1), heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), neurofilament heavy chain (NEFH), peripherin (PRPH), TAR DNA-binding protein 43 (TDP43 or TARDBP), and fused in sarcoma (Fused in Sarcoma (FUS), ubiquilin-2 (UBQLN2), kinesin family member 5A (KIF5A), valosin-containing protein (VCP), arsin (ALS2), senataxin (SETX), sigma non-opioid intracellular receptor 1 (SIGMAR1), survival of motor neuron 1, telomere (SMN1), spastic paraplegia 11, autosomal recessive (SPG11), transient receptor potential cation channel subfamily M member 7 (TRPM7), vesicle-associated membrane protein-associated protein B / C (VAPB), angiogenesis Patients may harbor genetic mutations in any of the following genes: ANG (ANG), profilin-1 (PFN1), matrin-3 (MATR3), coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), tubulin, alpha 4A (TUBA4A), TBK1, C21orf2, sequestosome-1 (SQSTM1, also known as ubiquitin-binding protein p62), and / or optineurin (OPTN), particularly mutations associated with ALS or a high risk of developing ALS.

[0048] Patients at risk for ALS, FTD, ALS with FTD, or another neurological or motor neuron disease can include patients with a family history of the disease or a genetic predisposition to the disease (e.g., patients harboring a gene mutation associated with increased disease risk), or patients exposed to environmental factors that increase disease risk. For example, a patient may be at risk for ALS if they harbor a mutation in any of the genes encoding SOD1, C9orf72, ATXN2, CHMP2B, DCTN1, ERBB4, FIG4, HNRNPA1, NEFH, PRPH, NEK1, TDP43, FUS, UBQLN2, KIF5A, VCP, ALS2, SETX, SIGMAR1, SMN1, SPG11, TRPM7, VAPB, ANG, PFN1, MATR3, CHCHD10, TUBA4A, TBK1, SQSTM1, C21orf2, and / or OPTN, particularly if the mutation is associated with ALS or a high risk of developing ALS. At-risk patients may also include those diagnosed with ALS, FTD, ALS with FTD, or a disease or condition with a high co-morbidity with another neurological or motor neuron disease (e.g., patients with ALS, FTD, and dementia, for which a family history of bulbar-onset ALS is significantly associated with higher odds (see Trojsi, F., et al. (2017) “Comorbidity of dementia with amyotrophic lateral sclerosis (ALS): insights from a large multicenter Italian cohort” J ​​Neurol 264: 2224-31)).

[0049] As used herein, "STMN2" (also known as superior cervical ganglion 10 protein), stathmin-like 2, SCGN10, SCG10, neuron growth-associated protein, neuron-specific growth-associated protein, or protein SCG10 (superior cervical ganglion NEAR neuron-specific 10) refers to the gene or gene product (e.g., the protein or mRNA transcript (including pre-mRNA) encoded by the gene) identified by Entrez Gene ID number 11075, and allelic variants thereof, and orthologs found in species other than human (e.g., non-human primates or mice).

[0050] As used herein, the term "therapeutically effective amount" refers to an amount of a target inhibitor of a cryptic exon-containing STMN2 transcript that elicits a biological or medical response in a tissue, system, animal, or human that is of interest to a researcher, veterinarian, physician, or other clinician. The inhibitors of cryptic exon-containing STMN2 transcripts of the present invention are administered in a therapeutically effective amount to treat and / or prevent a disease, condition, disorder, or state, such as ALS, FTD, ALS with FTD, or another motor neuron disease or neurological disease or condition. Alternatively, a therapeutically effective amount of an inhibitor of a cryptic exon-containing STMN2 transcript is the amount required to achieve the desired therapeutic and / or prophylactic effect, such as an amount that causes prevention or reduction of symptoms associated with a disease associated with decreased STMN2 activity in motor neurons.

[0051] The phrase "oligonucleotide targeting an STMN2 transcript" refers to an oligonucleotide that binds to an STMN2 transcript. In various embodiments, the oligonucleotide binds to a region of the STMN2 transcript. Table 1 shows exemplary regions of the STMN2 transcript, representing sequences corresponding to regions of branch points (e.g., branch points 1, 2, and 3), the 3' splice acceptor region, the ESE binding region, the TDP43 binding site, the cryptic exon, and the polyA region. In various embodiments, the oligonucleotide binds to a region of the STMN2 transcript that has a cryptic exon, but that is located no more than 75 nucleobases upstream or downstream from any of the branch points (e.g., branch points 1, 2, and 3), the 3' splice acceptor region, the ESE binding region, the TDP43 binding site, the cryptic exon, and the polyA region.

[0052] The term "pharmaceutically acceptable salt(s)" as used herein refers to salts of acidic or basic groups that may be present in the inhibitors of STMN2 transcripts containing cryptic exons used in the present compositions. The inhibitors of STMN2 transcripts containing cryptic exons contained in the present compositions are basic in nature and can form a wide variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including, but not limited to, malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, hydrogensulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronic acid, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoic acid)) salts. The inhibitors of STMN2 transcripts containing cryptic exons contained in the present compositions contain an amino moiety, which can form pharmaceutically acceptable salts with various amino acids in addition to the acids listed above. Compounds contained in the present compositions that are acidic in nature can form base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts, particularly calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the present disclosure include, for example, pharmaceutically acceptable salts of STMN2 AONs containing the nucleobase sequences of any of SEQ ID NOS: 1-446, 894-918, 945-1390, or 1392-1432.

[0053] The disclosed inhibitors of STMN2 transcripts containing hidden exons may contain one or more chiral centers, groups, bonds, and / or double bonds and therefore exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. The term "stereoisomer" as used herein refers to any geometric isomer, enantiomer, or diastereomer. These compounds may be designated with the symbols "R" or "S" (or "Rp" or "Sp") depending on the configuration of the substituents surrounding a stereogenic atom, such as a stereogenic carbon, phosphorus, or sulfur atom. In some embodiments, one or more bonds in a compound may have the Rp or Sp configuration (e.g., one or more phosphorothioate linkages have the Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of the other phosphorothioate linkages (e.g., one phosphorothioate linkage has the Rp configuration and a second phosphorothioate linkage has the Sp configuration). The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Although mixtures of enantiomers or diastereomers are sometimes designated "(±)" in nomenclature, those skilled in the art will recognize that the structure may implicitly suggest chiral centers. Individual stereoisomers of the present inhibitors of STMN2 transcripts containing cryptic exons can be prepared synthetically from commercially available starting materials containing asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution techniques well known to those skilled in the art. Such resolution methods are exemplified by (1) coupling the mixture of enantiomers to an asymmetric auxiliary, separating the resulting mixture of diastereomers by recrystallization or chromatography, and liberating the optically pure product from the auxiliary; (2) salt formation utilizing an optically active resolving agent; or (3) directly separating the mixture of optical enantiomers on a chiral chromatographic column.Stereoisomeric mixtures can be resolved into their stereoisomeric components by well-known methods, such as chiral-phase gas chromatography, chiral-phase supercritical fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent, etc. Stereoisomers can also be obtained from stereomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0054] The inhibitors of STMN2 transcripts containing cryptic exons disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, etc., and the present invention is intended to encompass both solvated and unsolvated forms.

[0055] The present disclosure also encompasses isotopically labeled compounds of the present invention (i.e., isotopically labeled inhibitors of STMN2 transcripts containing cryptic exons) that are identical to those cited herein, except that one or more atoms are replaced with an atom having an atomic mass or mass number different from the atomic mass or mass number found abundantly in nature. Examples of isotopes that can be incorporated into compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, e.g., 2 H, 3 H, 11 C. 13 C. 14 C. 15 N, 18 O. 17 O. 31 P, 32 P, 33 P, 35 S, 18 F, and 36 Cl, etc.

[0056] Certain isotopically labeled compounds of the present disclosure (e.g., 3 H and 14C) are useful in compound and / or substrate tissue distribution assays. 3 H) and carbon-14 (i.e. 14 C) isotopes are particularly preferred for their ease of preparation and detectability. Additionally, heavier isotopes such as deuterium (i.e. 2 H) or the like may offer certain therapeutic advantages due to increased metabolic stability (e.g., longer in vivo half-life or reduced dosage requirements) and therefore may be preferable in some circumstances.

[0057] As used herein, "2'-O-(2-methoxyethyl)" (2'-MOE and 2'-O(CH2)2OCH3, and MOE as well) refers to an O-methoxyethyl modification at the 2' position of the furanose ring. 2'-O-(2-methoxyethyl) is used interchangeably with "2'-O-methoxyethyl" in this disclosure. The sugar moiety in a nucleoside modified with 2'-MOE is a modified sugar.

[0058] As used herein, "2'-MOE nucleoside" (also 2'-O-(2-methoxyethyl) nucleoside) refers to a nucleoside that includes a 2'-MOE modified sugar moiety.

[0059] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a substituent other than H or OH at the 2' position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0060] As used herein, "5-methylcytosine" (5-MeC) means a cytosine modified by attaching a methyl group to position 5. 5-Methylcytosine (5-MeC) is a modified nucleobase.

[0061] As used herein, "bicyclic sugar" means a furanose ring modified by bridging two atoms. Bicyclic sugars are modified forms of sugars.

[0062] As used herein, "bicyclic nucleoside" (also BNA) refers to a nucleoside having a sugar moiety that includes a bridge (linking two carbon atoms of the sugar ring, thereby forming a bicyclic ring system). In certain embodiments, the bridge links the 4'-carbon and the 2'-carbon of the sugar ring.

[0063] As used herein, "cap structure" or "terminal cap moiety" means a chemical modification incorporated at either end of an antisense compound.

[0064] As used herein, "cEt" or "constrained ethyl" refers to a bicyclic nucleoside having a sugar moiety that includes a bridge connecting the 4'-carbon and the 2'-carbon (having the formula: 4'-CH(CH3)-O-2').

[0065] As used herein, "constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside that includes a bicyclic sugar moiety that includes a 4'-CH(CH3)-O-2' bridge.

[0066] As used herein, "internucleoside linkage" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, "non-natural linkage" refers to an "modified internucleoside linkage."

[0067] As used herein, in the context of oligonucleotides, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.

[0068] As used herein, "locked nucleic acid" or "LNA" or "LNA nucleoside" refers to a nucleic acid monomer having a bridge (e.g., a methylene, ethylene, aminooxy, or oxyimino bridge) linking two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, A) α-L-methyleneoxy (4'-CH2-O-2') LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'-(CH2)2-O-2') LNA, (D) aminooxy (4'-CH2-ON(R)-2') LNA, and (E) oxyamino (4'-CH2-N(R)-O-2') LNA.

[0069] As used herein, an LNA compound refers to a compound having at least one bridge between the 4' and 2' sugar positions, each of which has the structure -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x -, and -N(R1)-; wherein x is 0, 1, or 2; n is 1, 2, 3, or 4; and each of R1 and R2 is independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each of J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 These include, but are not limited to, compounds in which the hydroxyl group is an aminoalkyl, or a protecting group.

[0070] An example of a 4'-2' bridge group that fits the definition of LNA is a group of the formula: -[C(R1)(R2)] n -, -[C(R1)(R2)] n Additionally, other bridging groups that fall within the definition of LNA include, but are not limited to, one of: -O-, -C(R1R2)-N(R1)-O-, or -C(R1R2)-ON(R1)-. Additionally, other bridging groups that fall within the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2-N(R1)-O-2'-bridges, where each of R1 and R2 is independently H, a protecting group, or a C1-C 12 It is alkyl.

[0071] Included in the definition of LNA according to the present invention are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a bridge to form a bicyclic sugar moiety. The bridge may be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom (the term methyleneoxy(4'-CH2-O-2') LNA is used). Furthermore, for bicyclic sugar moieties with an ethylene bridging group at this position, the term ethyleneoxy(4'-CH2CH2-O-2') LNA is used. The isomer of methyleneoxy(4'-CH2-O-2') LNA, α-L-methyleneoxy(4'-CH2-O-2'), also falls within the definition of LNA as used herein.

[0072] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated modulation in the splicing of the target nucleic acid.

[0073] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0074] As used herein, "increasing the amount of activity" refers to more transcriptional expression, more accurate splicing and / or higher activity resulting in expression of full-length mature mRNA and / or protein compared to transcriptional expression or activity in an untreated or control sample.

[0075] As used herein, a "mismatch" or "non-complementary nucleobase" refers to an instance where a nucleobase of a first nucleic acid is unable to pair with the corresponding nucleobase of a second or target nucleic acid.

[0076] As used herein, "linked nucleosides" are nucleosides that are joined in a contiguous sequence through internucleoside linkages (i.e., there are no additional nucleosides between the linked nucleosides).

[0077] As used herein, a "modified internucleoside linkage" refers to a substitution of or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside linkage). A "phosphorothioate linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0078] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. "Unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0079] As used herein, "modified nucleoside" refers to a nucleoside that independently has a modified sugar moiety and / or a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides that lack a nucleobase.

[0080] As used herein, "modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0081] As used herein, "modified sugar" or "modified sugar moiety" means a modified furanosyl sugar moiety or a modified sugar moiety having a moiety other than a furanosyl moiety that allows for attachment of a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group within an oligonucleotide.

[0082] As used herein, "monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0083] As used herein, "motif" means a pattern of unmodified and modified nucleosides within an antisense compound.

[0084] As used herein, "natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0085] As used herein, "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0086] As used herein, "non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise participate in hybridization.

[0087] As used herein, " nucleic acid " refers to a molecule that is composed of mononucleotides.Nucleic acid includes but is not limited to ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), short hairpin RNA (shRNA) and microRNA (miRNA).

[0088] As used herein, "nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0089] As used herein, "nucleobase complementarity" refers to a nucleobase that can form base pairs with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to the nucleobase of an antisense compound that can form base pairs with the nucleobase of its target nucleic acid. For example, if the nucleobase at a specific position of an antisense compound can hydrogen bond with the nucleobase at a specific position of a target nucleic acid, the hydrogen bond position between the oligonucleotide and the target nucleic acid is considered to be complementary in this nucleobase pair.

[0090] As used herein, "nucleobase sequence" means the order of contiguous nucleobases, regardless of any sugar, linkage, and / or nucleobase modifications.

[0091] As used herein, "nucleoside" means a nucleobase linked to a sugar. The term "nucleoside" also includes "modified nucleosides" that independently have modified sugar moieties and / or modified nucleobases.

[0092] As used herein, "nucleoside mimetic" includes structures used to replace sugars or sugars and bases, but does not necessarily include linkages at one or more positions in an oligomeric compound. For example, a nucleoside mimetic may have a morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetic, such as a non-furanose sugar unit. Nucleotide mimics include structures used to replace nucleosides and linkages at one or more positions in an oligomeric compound, such as a peptide nucleic acid, or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkages). Sugar surrogate overlaps slightly with the broader term nucleoside mimetic, but is intended to refer to the replacement of only the sugar unit (furanose ring). The tetrahydropyranyl ring presented herein illustrates an example of a sugar surrogate in which the furanose sugar group is replaced with a tetrahydropyranyl ring system. "Mimetic" refers to a group that is substituted for the sugar, nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0093] As used herein, "nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0094] As used herein, "oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits that is capable of hybridizing to at least some region of a nucleic acid molecule.

[0095] As used herein, "oligonucleotide" means a polymer of linked nucleosides, each of which, independently of one another, can be modified or unmodified.

[0096] Modification A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of a nucleoside is usually a heterocyclic base moiety. A nucleotide is a nucleoside that further contains a phosphate group covalently linked to the sugar portion of the nucleoside. In nucleosides containing a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed by covalently linking adjacent nucleosides to each other to form linear polymeric oligonucleotides. In oligonucleotide structures, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0097] Modifications to antisense compounds include substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over natural forms because of desirable properties, such as enhanced cellular uptake, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

[0098] Chemically modified nucleosides can also be employed to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Thus, shorter antisense compounds with such chemically modified nucleosides can often be used with comparable results.

[0099] Modified internucleoside linkages The naturally occurring internucleoside linkage in RNA and DNA is a 3' to 5' phosphodiester bond. Antisense compounds having one or more modified, i.e., non-naturally occurring, internucleoside linkages are frequently selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as enhanced cellular uptake, increased affinity for the target nucleic acid, and increased stability in the presence of nucleases.

[0100] The oligonucleotide with modified internucleoside bond comprises the internucleoside bond that holds phosphorus atom and the internucleoside bond that does not have phosphorus atom.Representative internucleoside bond that contains phosphorus includes, but is not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate and phosphorothioate.The method of preparing phosphorus-containing bond and non-phosphorus-containing bond is well known.

[0101] In certain embodiments, the antisense compound targeted to STMN2 nucleic acid comprises one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are scattered throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compound targeted to STMN2 nucleic acid comprises at least one phosphodiester linkage and at least one phosphorothioate linkage.

[0102] Modified sugar moieties Antisense compounds can optionally contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides may confer enhanced nuclease stability, enhanced binding affinity, or some other beneficial biological property to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs), and replacement of a ribosyl ring oxygen atom with S, N(R), or C(R1)(R2), where R, R1, and R2 are each independently H, C1-C2. 12alkyl, or protecting groups), and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (see PCT International Application No. 2008 / 101157, published August 21, 2008, for other disclosed 5',2'-bissubstituted nucleosides), or replacement of the ribosyl ring oxygen atom with S or CF2 with additional substitution at the 2' position (see U.S. Patent Application Publication No. 2005-0130923, published June 16, 2005), or alternatively, 5' substitution of BNA (see PCT International Application No. 2007 / 134181, published November 22, 2007, where LNA is substituted, for example, with a 5'-methyl or 5'-vinyl group).

[0103] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or 5), 4'-S, 2'-F, 2'-OCH, 2'-OCHCH, 2'-OCHCHF, and 2'-O(CH)OCH substituents. Substituents at the 2' position include allyl, amino, azido, thio, O-allyl, O-Ci ... 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n )-(However, R l , R m , and R n each independently represents H or a substituted or unsubstituted C1-C 10 It may also be selected from the group consisting of alkyl.

[0104] Additional examples of modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'MOE), 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4'-bridged nucleic acids (cEt) (4'-CH(CH)-O-2'), S-constrained ethyl (S-cEt) 2'-4'-bridged nucleic acids, 4'-CH-O-CH-2', 4'-CH-N(R)-2', 4'-CH(CHOCH)-O-2' ("constrained MOE" or "cMOE"), hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0105] As used herein, " bicyclic nucleoside " refers to a modified nucleoside that comprises a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides that comprise a bridge between 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense compounds provided herein comprise one or more bicyclic nucleosides that comprise a bridge between 4' and 2'. Examples of such 4' and 2' bridged bicyclic nucleosides include those of the formula: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2', and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see U.S. Pat. No. 7,399,845, issued July 15, 2008); 4'-C(CH3)(CH3)-O-2' (and analogs thereof, see U.S. Pat. No. 7,399,845, issued July 15, 2008). 4'-CH-N(OCH)-2' (and analogs thereof, see International Patent Application Publication No. WO 2009 / 006478, published January 8, 2009); 4'-CH-N(OCH)-2' (and analogs thereof, see International Patent Application Publication No. WO 2008 / 150729, published December 11, 2008); 4'-CH-ON(CH)-2' (see U.S. Patent Application Publication No. 2004-0171570, published September 2, 2004); 4'-CH-N(R)-O-2' (where R is H), C1-C 12alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C-(=CH2)-2' (and analogs thereof, see International Application Publication No. WO 2008 / 154401, published Dec. 8, 2008).

[0106] Further reports relating to bicyclic nucleosides can also be found in the published literature (e.g., Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26)). 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication Nos. 2008-0039618; 2009-0012281; U.S. Patent Serial Nos. 60 / 989,574; 61 / 026,995; 61 (See PCT Publication Nos. WO 1994 / 014226; WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; and WO 2009 / 006478). Each of the above bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published March 25, 1999 as WO 99 / 14226).

[0107] In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside includes, but is not limited to, compounds having at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, provided that such bridge is -[C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S)-, -O-, -Si(Ra )2-, -S(=O) x - and -N(R a )-, independently containing 1 or 2 to 4 linking groups independently selected from; however: x is 0, 1, or 2; n is 1, 2, 3, or 4; R a and R b each independently represents H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and Each of J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0108] In certain embodiments, the bridge of the bicyclic sugar moiety is —[C(R a )(R b )] n -,-[-[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O-, or -C(R a R b In certain embodiments, the bridges are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R is independently H, a protecting group, or a C1-C 12 alkyl, and each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 It is aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1).

[0109] In certain embodiments, bicyclic nucleosides are further defined by their isomeric configuration. For example, nucleosides comprising a 4'-2' methylene-oxy bridge can be in α-L configuration or β-D configuration. Previously, α-L-methyleneoxy (4'-CH2-O-2') BNAs have been incorporated into antisense oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0110] In certain embodiments, bicyclic nucleosides include, but are not limited to, α-L-methyleneoxy (4'-CH2-O-2') BNAs, β-D-methyleneoxy (4'-CH2-O-2') BNAs, ethyleneoxy (4'-(CH2)2-O-2') BNAs, aminooxy (4'-CH2-ON(R)-2') BNAs, oxyamino (4'-CH2-N(R)-O-2') BNAs, methyl(methyleneoxy) (4'-CH(CH3)-O-2') BNAs, methylene-thio (4'-CH2-S-2') BNAs, methylene-amino (4'-CH2-N(R)-2') BNAs, methyl carbocyclic (4'-CH2-CH(CH3)-2') BNAs, and propylene carbocyclic (4'-(CH2)3-2') BNAs.

[0111] In some embodiments, the present disclosure provides methods for treating, ameliorating, or preventing a neurological disease (e.g., but not limited to, ALS, FTD, or ALS with FTD), or a disorder characterized by symptoms associated with a neurological disease, condition, or disorder (e.g., but not limited to, ALS, FTD, or ALS with FTD), including administering to a patient a pharmaceutically acceptable composition, e.g., a pharmaceutically acceptable formulation, comprising an inhibitor of one or more STMN2 transcripts containing a cryptic exon. The inhibitor of STMN2 transcripts containing a cryptic exon can increase, restore, or stabilize STMN2 activity, e.g., STMN2 activity, and / or the level of STMN2 expression, e.g., the level of STMN2 mRNA and / or protein expression.

[0112] The present disclosure also provides pharmaceutical compositions comprising an inhibitor of an STMN2 transcript containing a cryptic exon, as disclosed herein, formulated with one or more pharmaceutically or cosmetically acceptable excipients. Such formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), or intralesional, transmucosal (e.g., buccal, intravaginal, and rectal) administration, or for topical use, e.g., as part of a composition suitable for topical application to the skin and / or mucosa, e.g., a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor, or tincture. However, the most suitable form of administration in any given case will depend on the extent and severity of the condition being treated and the nature of the specific inhibitor of an STMN2 transcript containing a cryptic exon being used.

[0113] The present disclosure also provides a pharmaceutical composition comprising an inhibitor of an STMN2 transcript containing a cryptic exon, or a pharmaceutically acceptable salt thereof (e.g., an STMN2 AON containing the nucleobase sequence of any of SEQ ID NOs: 1-446, 894-918, 945-1390, or 1392-1432).

[0114] The present disclosure also provides methods that involve the use of pharmaceutical compositions comprising an inhibitor of a cryptic exon-containing STMN2 transcript (e.g., an STMN2 AON of any one of SEQ ID NOS: 1-446, 894-918, 945-1390, or 1392-1432) as disclosed herein, formulated with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising an inhibitor of a cryptic exon-containing STMN2 transcript and one or more pharmaceutically acceptable excipients, as described above. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), intralesional, transmucosal (e.g., buccal, intravaginal, and rectal) administration, or topical use. The most suitable mode of administration in any given case will depend on the clinical symptoms, complications, or biochemical manifestations of the condition, disorder, disease, or state being sought to be prevented in the subject; and / or the nature of the particular compound and / or composition being used.

[0115] Inhibitors of STMN2 transcripts containing cryptic exons In certain embodiments, STMN2 levels (e.g., STMN2 mRNA or full-length STMN2 protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity) can be increased, restored, or stabilized using compounds or compositions that target STMN2 gene products (e.g., STMN2 pre-mRNA) containing cryptic exons.

[0116] In some embodiments, the inhibitor of an STMN2 transcript containing a cryptic exon may be, but is not limited to, a nucleotide-based inhibitor of STMN2 (e.g., STMN2 shRNA, STMN2 siRNA, STMN2 PNA, STMN2 LNA, 2'-O-methyl (2'OMe) STMN2 antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl) (2'MOE) STMN2 AON, or STMN2 morpholino oligomer (e.g., phosphorodiamidate morpholino (PMO))), or a composition comprising such a compound. In some embodiments, the inhibitor of STMN2 is selected from the group consisting of 2'OMe (e.g., an STMN2 AON comprising one or more 2'OMe-modified sugars), MOE (e.g., an STMN2 AON comprising one or more MOE-modified sugars (e.g., 2'-MOE)), PNA (e.g., an STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds, or a carbonyl methylene bond as a repeating unit instead of the sugar-phosphate backbone), LNA (e.g., an STMN2 AON comprising one or more locked ribose and which may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an STMN2 AON comprising one or more cET sugars), cMOE (e.g., an STMN2 AON comprising one or more cMOE sugars), morpholino oligomers (e.g., an STMN2 AON comprising a backbone containing one or more PMOs), and the like. AON), deoxy-2'-fluoronucleoside (e.g., an STMN2 AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., an STMN2 AON comprising one or more ENA-modified sugars), HNA (e.g., an STMN2 AON comprising one or more HNA-modified sugars), or tcDNA (e.g., an STMN2 AON comprising one or more tcDNA-modified sugars).In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorodiamidate morpholino (PMO) linkages ("morpholino linkages"), peptide nucleic acid (PNA) linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorodiamidate morpholino (PMO) (morpholino) linkages, and PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0117] STMN2 antisense therapeutic agent Antisense therapeutic agents are a class of nucleic acid-based compounds that can be used to regulate STMN2 mRNA or STMN2 transcripts (e.g., STMN2 pre-mRNA containing cryptic exons). Antisense therapeutic agents can be single- or double-stranded deoxyribonucleic acid (DNA)-based, ribonucleic acid (RNA)-based, or DNA / RNA chemical analog compounds. Generally, antisense therapeutic agents are designed to contain a nucleobase sequence that is complementary or nearly complementary to the mRNA or pre-mRNA sequence transcribed from a given gene to facilitate binding between the antisense therapeutic agent and the pre-mRNA or mRNA. In certain embodiments, antisense therapeutic agents act by binding to the mRNA or pre-mRNA, thereby inhibiting protein translation, altering the splicing of the pre-mRNA to mature mRNA (e.g., by preventing the binding of appropriate proteins, such as splicing activator proteins), and / or causing mRNA destruction. In certain embodiments, the sequence of the antisense therapeutic nucleobase is complementary to a portion of the sense sequence of the targeted gene or mRNA. In certain embodiments, the STMN2 antisense therapeutics described herein are oligonucleotide-based compounds containing an oligonucleotide sequence complementary to the pre-mRNA sense or a portion thereof. In certain embodiments, the STMN2 antisense therapeutics described herein may be nucleotide chemical analog-based compounds. Synthetic oligonucleotides as therapeutic agents have evolved into a wide range of applications across multiple modalities. These applications include ribozymes, small interfering RNA (siRNA), microRNA, aptamers, non-coding RNA, splicing regulation, targeting toxic repeats, gene editing, and immunomodulation. The STMN2 oligonucleotides (STMN2 AONs) disclosed herein target STMN2 transcripts (e.g., STMN2 pre-mRNA (e.g., SEQ ID NO: 944)) to prevent aberrant or mis-splicing.

[0118] Antisense oligonucleotides (AONs) are short oligonucleotide-based sequences that contain an oligonucleotide sequence complementary to a target RNA sequence. In certain embodiments, AONs are 8 to 50 nucleotides in length, e.g., 8, 10, 15, 20, 25, 30, 35, 40, 45, or 45 nucleotides in length. In certain embodiments, AONs are 25 nucleotides in length. In certain embodiments, AONs may contain chemically modified nucleosides (e.g., 2'-O-methylated nucleosides or 2'-O-(2-methoxyethyl) nucleosides (2'-O-methoxyethyl ribonucleosides (2'-MOE))) as well as modified internucleoside linkages (e.g., phosphorothioate linkages). In certain embodiments, the STMN2 AONs described herein contain an oligonucleotide sequence complementary to an STMN2 RNA sequence. In certain embodiments, the STMN2 AONs described herein may contain chemically modified nucleosides and modified internucleoside linkages (eg, phosphorothioate linkages).

[0119] Peptide nucleic acids (PNAs) are artificially synthesized short polymers with a structure that mimics DNA or RNA. PNAs contain a backbone composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In certain embodiments, the STMN2 PNAs described herein can be used as antisense therapeutic agents that bind with high specificity to the STMN2 RNA sequence and increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0120] Locked nucleic acids (LNAs) are oligonucleotide sequences containing one or more modified RNA nucleotides (in which the ribose moiety is modified with an extra bridge linking the 2' oxygen and 4' carbon). LNAs are believed to have a higher Tm than similar oligonucleotide sequences. In certain embodiments, the STMN2 LNAs described herein can be used as antisense therapeutic agents that bind to STMN2 RNA sequences with high specificity and inhibit premature polyadenylation of STMN2 pre-mRNA, and increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0121] Morpholino oligomers are oligonucleotide compounds containing DNA bases linked to a methylenemorpholine ring backbone linked through phosphorodiamidate groups. In certain embodiments, the morpholino oligomers of the present invention can be designed to bind to a specific STMN2 pre-mRNA sequence of interest, thereby suppressing premature polyadenylation of the pre-mRNA and increasing, repairing, and / or stabilizing STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity). In certain embodiments, the STMN2 morpholino oligomers described herein can be used as antisense therapeutic agents that bind to STMN2 pre-mRNA sequences with high specificity, suppress premature polyadenylation of STMN2 pre-mRNA, and increase, repair, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity). In certain embodiments, the STMN2 morpholino oligomers described herein can be used to bind to the STMN2 pre-mRNA sequence to alter the splicing of the STMN2 pre-mRNA and the expression of the STMN2 gene, as well as to increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0122] In some embodiments, the STMN2 antisense therapeutic is selected from the group consisting of 2'OMe (e.g., an STMN2 AON comprising one or more 2'OMe-modified sugars), MOE (e.g., an STMN2 AON comprising one or more MOE-modified sugars (e.g., 2'-MOE)), PNA (e.g., an STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkages as repeating units instead of the sugar-phosphate backbone), LNA (e.g., an STMN2 AON comprising one or more locked ribose and which may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an STMN2 AON comprising one or more cET sugars), cMOE (e.g., an STMN2 AON comprising one or more cMOE sugars), morpholino oligomers (e.g., an STMN2 AON comprising a backbone containing one or more PMOs), and the like. AON), deoxy-2'-fluoronucleoside (e.g., an STMN2 AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., an STMN2 AON comprising one or more ENA-modified sugars), HNA (e.g., an STMN2 AON comprising one or more HNA-modified sugars), or tcDNA (e.g., an STMN2 AON comprising one or more tcDNA-modified sugars). In some embodiments, the STMN2 AON comprises one or more phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, morpholino, PNA linkages, or any combination of phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, morpholino, and PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0123] STMN2 antisense oligonucleotide In certain embodiments, as disclosed herein, an STMN2 antisense oligonucleotide can be an oligonucleotide sequence 5 to 100 nucleotides in length, e.g., 10 to 40 nucleotides in length, e.g., 14 to 40 nucleotides in length, 10 to 30 nucleotides in length, e.g., 14 to 30 nucleotides in length, e.g., 14 to 25 or 15 to 22 nucleotides in length, or 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In certain embodiments, the AON is 25 nucleotides in length. In certain embodiments, the STMN2 antisense oligonucleotides (AONs) described herein are synthetic short oligonucleotide sequences complementary to an STMN2 transcript (e.g., pre-mRNA), a portion of an STMN2 transcript, or an STMN2 gene sequence.

[0124] In some embodiments, the STMN2 AON comprises a nucleobase sequence that is 80%, 85%, 90%, 95%, or 100% complementary to an STMN2 transcript (e.g., STMN2 pre-mRNA) containing a cryptic exon. In some embodiments, the nucleobase sequence of the STMN2 antisense oligonucleotide is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that are 80%, 85%, 90%, 95%, or 100% complementary to an equal length portion of nucleobases present in a portion of the STMN2 transcript containing the cryptic exon. AON binding specificity can be assessed by measuring parameters such as dissociation constants, melting temperatures (Tm), or other criteria, such as changes in protein or RNA expression levels, or other assays that measure STMN2 activity or expression.

[0125] In some embodiments, the STMN2 AON may comprise a non-duplex oligonucleotide. In some embodiments, the STMN2 AON may comprise a duplex consisting of two oligonucleotides, where the first oligonucleotide comprises a nucleobase sequence that is completely or nearly completely complementary to the STMN2 pre-mRNA sequence, and the second oligonucleotide comprises a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0126] In some embodiments, the STMN2 AON can target an STMN2 pre-mRNA containing a cryptic exon produced by the STMN2 gene of one or more species. For example, the STMN2 AON can target an STMN2 pre-mRNA containing a cryptic exon of a mammalian STMN2 gene, such as a human (i.e., Homo sapiens) STMN2 gene. In certain embodiments, the STMN2 AON targets a human STMN2 pre-mRNA containing a cryptic exon. In some embodiments, the STMN2 AON comprises a nucleobase sequence that is complementary to a nucleobase sequence or a portion thereof of an STMN2 gene or STMN2 pre-mRNA containing a cryptic exon.

[0127] The STMN2 AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below:

[0128] [Table 1-1]

[0129] [Table 1-2]

[0130] [Table 1-3]

[0131] Table 1-4

[0132] Table 1-5

[0133] Table 1-6

[0134] Table 1-7

[0135] Table 1-8

[0136] Table 1-9

[0137] Table 1-10

[0138] Table 1-11

[0139] Table 1-12

[0140] Table 1-13

[0141] Table 1-14

[0142] Table 1-15

[0143] Table 1-16

[0144] Table 1-17

[0145] Table 1-18

[0146] Table 1-19

[0147] Table 1-20

[0148] Table 1-21

[0149] Table 1-22

[0150] Table 1-23

[0151] Table 1-24

[0152] * At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkylphosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothiate linkage, a phosphorodiamidate (e.g., including a phosphorodiamidate morpholino (PMO), a 3' aminoribose, or a 5' aminoribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0153] Table 2 below identifies additional STMN2 AON sequences:

[0154] [Table 2-1]

[0155] [Table 2-2]

[0156] [Table 2-3]

[0157] [Table 2-4]

[0158] [Table 2-5]

[0159] [Table 2-6]

[0160] [Table 2-7]

[0161] [Table 2-8]

[0162] [Table 2-9]

[0163] [Table 2-10]

[0164] [Table 2-11]

[0165] [Table 2-12]

[0166] Table 3 below identifies representative STMN2 AON sequences:

[0167] [Table 3-1]

[0168] [Table 3-2]

[0169] In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in Table 3 are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. For example, in some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (SEQ ID NO: 31) oligonucleotides are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID NO: 177) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID NO: 181) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (SEQ ID NO: 197) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID NO: 203) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID NO: 209) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID NO: 215) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID NO: 237) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (SEQ ID NO: 252) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID NO: 380) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID NO: 385) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID NO: 395) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (SEQ ID NO: 400) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (SEQ ID NO: 169) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (SEQ ID NO: 170) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (SEQ ID NO: 171) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (SEQ ID NO: 172) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (SEQ ID NO: 249) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0170] In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in Table 3 are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. For example, in some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (SEQ ID NO: 31) oligonucleotides are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID NO: 177) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID NO: 181) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (SEQ ID NO: 197) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID NO: 203) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID NO: 209) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID NO: 215) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID NO: 237) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (SEQ ID NO: 252) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID NO: 380) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID NO: 385) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID NO: 395) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (SEQ ID NO: 400) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (SEQ ID NO: 169) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (SEQ ID NO: 170) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (SEQ ID NO: 171) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (SEQ ID NO: 172) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and some or none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (SEQ ID NO: 249) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and no or some of the "C's" are replaced with 5-MeC.

[0171] Table 4 below identifies additional representative STMN2 AON sequences:

[0172] [Table 4]

[0173] Full-length STMN2 transcript As described herein, the present disclosure provides a method for restoring expression of full-length STMN2 transcripts in cells, comprising exposing or contacting the cells with an inhibitor of STMN2 transcripts containing cryptic exons, which can sterically block the splicing machinery, sterically mimic TDP43 binding, and / or suppress premature polyadenylation of STMN2 pre-mRNA, and increase, restore, and / or stabilize the level of full-length STMN2 transcripts.

[0174] In various embodiments, the full-length STMN2 transcript comprises the sequence having accession number NM_001199214.2, identified below as SEQ ID NO:1433.

[0175] [ka]

[0176] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence having accession number NP_001186143.1, identified below as SEQ ID NO: 1434.

[0177] [ka]

[0178] In various embodiments, the full-length STMN2 transcript comprises the sequence having accession number NM_007029.4, identified below as SEQ ID NO: 1435.

[0179] [ka]

[0180] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence having accession number NP_008960.2, identified below as SEQ ID NO: 1436.

[0181] [ka]

[0182] In various embodiments, the full-length STMN2 transcript comprises the sequence having accession number XM_005251142.2, identified below as SEQ ID NO: 1437.

[0183] [ka]

[0184] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence having accession number XP_005251199, identified below as SEQ ID NO: 1438.

[0185] [ka]

[0186] STMN2 transcripts with cryptic exons In one embodiment, the STMN2 transcript having a cryptic exon may comprise the sequence presented as SEQ ID NO:944.

[0187] [ka]

[0188] In one embodiment, the STMN2 transcript having cryptic exons may comprise a pre-mRNA STMN2 transcript. In one embodiment, the STMN2 transcript having cryptic exons may comprise the sequence presented as SEQ ID NO: 1391.

[0189] [ka]

[0190]

change

[0191]

change

[0192]

change

[0193]

change

[0194]

change

[0195]

change

[0196]

change

[0197]

change

[0198]

change

[0199]

change

[0200] [ka]

[0201] [ka]

[0202] [ka]

[0203] [ka]

[0204] [ka]

[0205] [ka]

[0206] [ka]

[0207] [ka]

[0208] [ka]

[0209] The STMN2 cryptic exon sequence within the STMN2 transcript is presented as SEQ ID NO:447.

[0210] [ka]

[0211] In various embodiments, the STMN2 transcript having a cryptic exon shares 90-100% identity with SEQ ID NO: 944. In various embodiments, the STMN2 transcript having a cryptic exon shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 944.

[0212] STMN2 antisense oligonucleotides targeting several portions of the STMN2 transcript In various embodiments, the STMN2 AON disclosed herein targets specific portions of the STMN2 transcript, including cryptic exons. SEQ ID NO: 944, as set forth above, describes an example of an STMN2 transcript that includes cryptic exons. In some embodiments, the STMN2 transcript that includes cryptic exons may share at least 80%, 85%, 90%, 95%, or 100% identity with the nucleobase sequence of SEQ ID NO: 944.

[0213] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, wherein the specific portion of the STMN2 transcript is 10 nucleobases in length. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, wherein the specific portion of the STMN2 transcript is 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases in length.

[0214] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, wherein the specific portion of the STMN2 transcript comprises any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of SEQ ID NO:944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript comprising any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript comprising any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript comprising any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript comprising any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of SEQ ID NO: 944.

[0215] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, wherein the specific portion of the STMN2 transcript consists of any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of SEQ ID NO:944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript consisting of any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript consisting of any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript consisting of any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of SEQ ID NO: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript, the specific portion of the STMN2 transcript consisting of any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of SEQ ID NO: 944.

[0216] In various embodiments, the STMN2 AON is selected from the group consisting of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 188-219, 189-220, 190-221, 191-222, 192-223, 193-224, 194-225, 195-226, 196-227, 197-228, 198-229, 199-230, 199-231, 199-232, 199-233, 200-201, 201-202, 201-203, 201-204, 201-205, 202-203, 203-204, 204-205, 205-206, 206-207, 207-218, 208-209, 210-211, 211-212, 212-213, 213-214, 214-215, 215-216, 216-217, 218-22 In various embodiments, the STMN2 sequence comprises a sequence of nucleobases comprising a portion of at least 10 contiguous nucleobases that is complementary to an isometric portion of nucleobases within any one of STMN2, 249-269, 249-271, 252-272, 252-274, or 243-261. AON is a sequence of SEQ ID NO: 944, positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, and a sequence of nucleobases comprising a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is complementary to an isometric portion of nucleobases contained in any one of 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261.

[0217] In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 contiguous nucleobases that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to SEQ ID NO:944 or to an equal-length portion of a transcript having at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to SEQ ID NO:944 or to a 19-50 contiguous nucleobase portion of SEQ ID NO:944, provided that at least one nucleoside linkage of the linked nucleoside is a non-natural linkage. In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to SEQ ID NO:944 or to an equal-length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NO:944 or to a 19-50 consecutive nucleobase portion of SEQ ID NO:944, provided that at least one nucleoside linkage of the linked nucleoside is a non-natural linkage.

[0218] In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 consecutive nucleobases, including a portion of at least 10 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an isometric portion of any one of SEQ ID NOs: 1-446, SEQ ID NOs: 894-918, SEQ ID NOs: 945-1390, or SEQ ID NOs: 1392-1432. In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 consecutive nucleobases, including a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an isometric portion of any one of SEQ ID NOs: 1-446, SEQ ID NOs: 894-918, SEQ ID NOs: 945-1390, or SEQ ID NOs: 1392-1432.

[0219] In various embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 118 and linked nucleosides having a sequence of at least 19 contiguous nucleobases, including a portion of at least 10 contiguous nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an isometric portion of any one of 1, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, provided that at least one nucleoside linkage of the linked nucleoside is a non-natural linkage. In various embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1353, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1370, and linked nucleosides having a sequence of at least 19 consecutive nucleobases, including a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an isometric portion of any one of 329, 1334, 1339, or 1344, provided that at least one nucleoside bond of the linked nucleoside is a non-natural bond.

[0220] In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 consecutive nucleobases, provided that the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432. In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleobases, provided that the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432.

[0221] In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 consecutive nucleobases, provided that the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432. In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 20, 21, 22, 23, 24, or 25 consecutive nucleobases, provided that the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to an equal-length portion of any one of SEQ ID NOs: 894-918 or 1392-1432.

[0222] In various embodiments, the oligonucleotide comprises linked nucleosides having a sequence of at least 19 consecutive nucleobases, wherein the sequence of nucleobases comprises a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that shares at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to a portion of any one of SEQ ID NOs:894-918 or 1392-1432.

[0223] In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 172-197, 172-198, 172-199, 173-194, 174-195, 175-196, 176-197, 177-198, 178-199, 179-200, 180-201, 181-202, 182-203, 183-204, 184-205, 185-206, 186-207, 187-208, 188-209, 189-201, 190-201, 191-202, 192-203, 193-204, 194-205, 195-206, 196-207, 197-208, 198-209, 199-2010, 199-2011, 2010-2012, 2010-2013, 2010-2014, 2010-2015, 20 and a portion of at least 10 consecutive nucleobases that is at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an isometric portion of nucleobases contained in any one of 3-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300. In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 198-222, 199-230, 199-231, 200-232, 201-202, 202-203, 203-204, 204-205, 205-206, 206-207, 207-210, 208-211, 209-212, 213-214, 215-216, 217-218, 218-219, 219-221, 220-222, 221-223, 222-224, 223-225, 224-226, 225-228, 226-229, 227-229, 228-231, 229-232, 230-233, 231-234, 232-235, 233-236, 234-237, 235 It comprises a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an isometric portion of nucleobases contained in any one of 237-261, 249-273, 252-276, or 276-300.

[0224] In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 172-197, 172-198, 172-199, 173-194, 174-195, 175-196, 176-197, 177-198, 178-199, 179-200, 180-201, 181-202, 182-203, 183-204, 184-205, 185-206, 186-207, 187-208, 188-209, 189-201, 190-201, 191-202, 192-203, 193-204, 194-205, 195-206, 196-207, 197-208, 198-209, 199-2010, 199-2011, 2010-2012, 2010-2013, 2010-2014, 2010-2015, 20 and a portion of at least 10 consecutive nucleobases that is at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an isometric portion of nucleobases contained in any one of 3-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300. In various embodiments, the sequence of nucleobases is selected from the group consisting of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 198-222, 199-230, 199-231, 200-232, 201-202, 202-203, 203-204, 204-205, 205-206, 206-207, 207-210, 208-211, 209-212, 213-214, 215-216, 217-218, 218-219, 219-221, 220-222, 221-223, 222-224, 223-225, 224-226, 225-228, 226-229, 227-229, 228-231, 229-232, 230-233, 231-234, 232-235, 233-236, 234-237, 235 It comprises a portion of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that is at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to an isometric portion of nucleobases contained in any one of 237-261, 249-273, 252-276, or 276-300.

[0225] In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of SEQ ID NO:944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an equal length portion of nucleobases contained within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of SEQ ID NO: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an equal length portion of nucleobases contained within any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of SEQ ID NO:944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of SEQ ID NO: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to an isometric portion of nucleobases contained within any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of SEQ ID NO: 944.

[0226] STMN2 antisense oligonucleotide variants In various embodiments, STMN2 AONs include different variants, hereinafter referred to as STMN2 AON variants. STMN2 AON variants can be oligonucleotide sequences between 5 and 100 nucleotides in length, e.g., between 10 and 40 nucleotides in length, e.g., between 14 and 40 nucleotides in length, between 10 and 30 nucleotides in length, e.g., between 14 and 30 nucleotides in length, e.g., between 16 and 28 nucleotides in length, e.g., between 19 and 23 nucleotides in length, e.g., between 21 and 23 nucleotides in length, e.g., or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. STMN2 AON variants can be oligonucleotide sequences complementary to a portion of the STMN2 pre-mRNA sequence or the STMN2 gene sequence.

[0227] In various embodiments, an STMN2 AON variant represents a modified version of a corresponding STMN2 AON comprising a nucleobase sequence selected from any one of SEQ ID NOs: 1-446 or 945-1390. In some embodiments, an STMN2 AON variant comprises a nucleobase sequence representing a shortened version of the nucleobase sequence of an STMN2 AON selected from any one of SEQ ID NOs: 1-446 or 945-1390. As an example, if an STMN2 AON comprises a 25-mer (e.g., 25 nucleotides in length), the variant (e.g., an STMN2 variant) can comprise a shorter version (e.g., a 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, 20-mer, 21-mer, 22-mer, 23-mer, or 24-mer) of the 25-mer STMN2 AON. In one embodiment, the nucleobase sequence of the STMN2 AON variant differs from the corresponding nucleobase sequence of the STMN2 AON in that 1, 2, 3, 4, 5, or 6 nucleotides have been removed from either or both of the 3' and 5' ends of the nucleobase sequence of the STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 23mer in which two nucleotides have been removed from either the 3' or 5' end of the 25mer contained in the STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 23mer in which one nucleotide has been removed from each of the 3' and 5' ends of the 25mer contained in the STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 21mer in which two nucleotides have been removed from each of the 3' and 5' ends of the 25mer contained in the STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 21-mer in which four nucleotides have been removed from the 3' or 5' end of the 25-mer contained in the STMN2 AON, or a 19-mer in which three nucleotides have been removed from each of the 3' and 5' ends of the 25-mer contained in the STMN2 AON.In one embodiment, the corresponding STMN2 AON variant may comprise a 19-mer in which 6 nucleotides have been removed from the 3' or 5' end of the 25-mer contained in the STMN2 AON.

[0228] Exemplary sequences of STMN2 AON variants are shown in Table 3 below. The exemplary STMN2 AON variants are each associated with an identifier that describes the differences between the STMN2 AON variant and the corresponding STMN2 AON. By way of example, the STMN2 AON variant comprises SEQ ID NO: 894 and is identified using the identifier: QSN-144-1 / 5-1 / 3. This first portion of the identifier "QSN-144" indicates that the STMN2 AON variant is a modified version of the QSN-144 STMN2 AON, which comprises SEQ ID NO: 144. Furthermore, the second portion of the identifier, comprising the numerical indicator "1 / 5-1 / 3," indicates that one nucleotide has been removed from each of the 5' and 3' ends of the sequence of nucleobases comprised in the QSN-144 STMN2 AON (e.g., one nucleotide has been removed from each of the 3' and 5' ends of SEQ ID NO: 144). As another example, the STMN2 AON variant comprises SEQ ID NO: 895 and is identified as QSN-144-2 / 3. This STMN2 AON variant is a modified version of the QSN-144 STMN2 AON. The numerical indicator "2 / 3" indicates that two nucleotides have been removed from the 3' end of the nucleobase sequence of the QSN-144 STMN2 AON (e.g., two bases have been removed from the 3' end of SEQ ID NO: 144).

[0229] In some embodiments, an STMN2 AON variant differs from a corresponding STMN2 AON in that one or more internucleoside linkages of the STMN2 AON variant are phosphodiester linkages. In such embodiments, the length of the STMN2 AON variant can be the same length as the corresponding STMN2 AON (e.g., 25 nucleotides in length). In some embodiments, the phosphodiester internucleoside linkages link 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides.

[0230] In some embodiments, phosphodiester internucleoside linkages link nucleotides located at either or both of the 3' or 5' termini, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides at either or both of the 3' or 5' termini are linked via phosphodiester internucleoside linkages.

[0231] In some embodiments, phosphodiester internucleoside linkages link nucleotides located within a sequence of nucleobases. For example, within a 25-mer STMN2 AON variant, consecutive nucleotides between positions 6 and 15 can be linked via phosphodiester internucleoside linkages. In some embodiments, consecutive nucleotides between any one of positions 7 and 15, 8 and 14, or 9 and 13 are linked via phosphodiester internucleoside linkages.

[0232] Table 5 below identifies variants of the STMN2 AON sequence:

[0233] [Table 5-1]

[0234] [Table 5-2]

[0235] Table 6 below identifies additional variants of the STMN2 AON sequence:

[0236] [Table 6-1]

[0237] [Table 6-2]

[0238] Performance of STMN2 antisense oligonucleotides and variants Generally, STMN2 AONs and STMN2 AON variants can target STMN2 transcripts with cryptic exons to increase, repair, rescue, or stabilize the expression level of STMN2 mRNA, which can be translated to produce a functional STMN2 protein (e.g., full-length STMN2). In various embodiments, STMN2 AONs and STMN2 AON variants can exhibit at least a 60%, 70%, 80%, or 90% increase in full-length STMN2 protein. In various embodiments, STMN2 AONs and STMN2 AON variants can exhibit at least a 100%, 200%, 300%, or 400% increase in full-length STMN2 protein. In some embodiments, the percentage increase in full-length STMN2 protein is compared to the decrease in full-length STMN2 protein level achieved using TDP43 antisense oligonucleotides. For example, TDP43 antisense oligonucleotides can be used to deplete full-length STMN2 protein, followed by increasing full-length STMN2 protein using STMN2 AONs or STMN2 AON variants.

[0239] In some embodiments, STMN2 AON and STMN2 AON variants reduce the level of STMN2 transcripts with hidden exons.In various embodiments, STMN2 AON and STMN2 AON variants can reduce the level of STMN2 transcripts with hidden exons by at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%.In some embodiments, the percentage (%) reduction in hidden exon level is compared with the increase in hidden exon level achieved by using TDP43 antisense oligonucleotides.For example, TDP43 antisense oligonucleotides can be used to increase hidden exon level, and then STMN2 AON or STMN2 AON variants can be used to reduce hidden exon level.

[0240] In some embodiments, STMN2 AONs and STMN2 AON variants can exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length STMN2 protein. In some embodiments, percent rescue of full-length STMN2 refers to the percent full-length STMN2 after depletion with a TDP43 antisense oligonucleotide and treatment with an STMN2 AON or STMN2 AON variant, compared to a negative control (e.g., cells that were not depleted or treated, or cells treated with vehicle solution).

[0241] In some embodiments, STMN2 AONs and AON variants exhibit 50% to 100% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 60% to 100% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 70% to 100% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 80% to 100% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 90% to 100% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 60% to 90% rescue of full-length STMN2. In some embodiments, STMN2 AONs and AON variants exhibit 50% to 80% rescue of full-length STMN2, hi some embodiments, STMN2 AONs and AON variants exhibit 60% to 80% rescue of full-length STMN2.

[0242] In certain embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 31) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 31) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 31) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (SEQ ID NO: 31) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0243] In certain embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0244] In certain embodiments, the QSN-41 STMN2 AON (SEQ ID NO: 41) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-41 STMN2 AON (SEQ ID NO: 41) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-41 STMN2 AON (SEQ ID NO: 41) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-41 STMN2 AON (SEQ ID NO: 41) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0245] In certain embodiments, the QSN-46 STMN2 AON (SEQ ID NO: 46) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-46 STMN2 AON (SEQ ID NO: 46) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-46 STMN2 AON (SEQ ID NO: 46) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-46 STMN2 AON (SEQ ID NO: 46) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0246] In certain embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0247] In certain embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 144) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 144) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 144) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0248] In certain embodiments, the QSN-146 STMN2 AON (SEQ ID NO: 146) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-146 STMN2 AON (SEQ ID NO: 146) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-146 STMN2 AON (SEQ ID NO: 146) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-146 STMN2 AON (SEQ ID NO: 146) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0249] In certain embodiments, the QSN-150 STMN2 AON (SEQ ID NO: 150) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-150 STMN2 AON (SEQ ID NO: 150) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-150 STMN2 AON (SEQ ID NO: 150) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-150 STMN2 AON (SEQ ID NO: 150) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0250] In certain embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 169) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 169) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 169) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (SEQ ID NO: 169) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0251] In certain embodiments, the QSN-170 STMN2 AON (SEQ ID NO: 170) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-170 STMN2 AON (SEQ ID NO: 170) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-170 STMN2 AON (SEQ ID NO: 170) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (SEQ ID NO: 170) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0252] In certain embodiments, the QSN-171 STMN2 AON (SEQ ID NO: 171) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-171 STMN2 AON (SEQ ID NO: 171) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-171 STMN2 AON (SEQ ID NO: 171) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (SEQ ID NO: 171) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0253] In certain embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 172) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 172) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 172) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (SEQ ID NO: 172) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0254] In certain embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 173) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 173) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 173) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0255] In certain embodiments, the QSN-177 STMN2 AON (SEQ ID NO: 177) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-177 STMN2 AON (SEQ ID NO: 177) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-177 STMN2 AON (SEQ ID NO: 177) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID NO: 177) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID NO: 177) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, with each "C" substituted with 5-MeC. In certain embodiments, the QSN-181 STMN2 AON (SEQ ID NO: 181) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-181 STMN2 AON (SEQ ID NO: 181) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-181 STMN2 AON (SEQ ID NO: 181) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID NO: 181) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID NO: 181) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0256] In certain embodiments, the QSN-185 STMN2 AON (SEQ ID NO: 185) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-185 STMN2 AON (SEQ ID NO: 185) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-185 STMN2 AON (SEQ ID NO: 185) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In certain embodiments, the QSN-197 STMN2 AON (SEQ ID NO: 197) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-197 STMN2 AON (SEQ ID NO: 197) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-197 STMN2 AON (SEQ ID NO: 197) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (SEQ ID NO: 197) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (SEQ ID NO: 197) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0257] In certain embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 203) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 203) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 203) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID NO: 203) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID NO: 203) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is substituted with 5-MeC. In certain embodiments, the QSN-209 STMN2 AON (SEQ ID NO: 209) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-209 STMN2 AON (SEQ ID NO: 209) exhibits 60-90% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID NO: 209) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In certain embodiments, the QSN-209 STMN2 AON (SEQ ID NO: 209) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID NO: 209) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0258] In certain embodiments, the QSN-215 STMN2 AON (SEQ ID NO: 215) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-215 STMN2 AON (SEQ ID NO: 215) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-215 STMN2 AON (SEQ ID NO: 215) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID NO: 215) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID NO: 215) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, the QSN-237 STMN2 AON (SEQ ID NO: 237) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-237 STMN2 AON (SEQ ID NO: 237) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-237 STMN2 AON (SEQ ID NO: 237) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID NO: 237) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID NO: 237) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0259] In certain embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 244) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 244) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 244) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0260] In certain embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (SEQ ID NO: 249) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0261] In certain embodiments, the QSN-252 STMN2 AON (SEQ ID NO: 252) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-252 STMN2 AON (SEQ ID NO: 252) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-252 STMN2 AON (SEQ ID NO: 252) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (SEQ ID NO: 252) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (SEQ ID NO: 252) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0262] In certain embodiments, the QSN-380 STMN2 AON (SEQ ID NO: 380) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-380 STMN2 AON (SEQ ID NO: 380) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-380 STMN2 AON (SEQ ID NO: 380) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID NO: 380) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID NO: 380) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, the QSN-385 STMN2 AON (SEQ ID NO: 385) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-385 STMN2 AON (SEQ ID NO: 385) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-385 STMN2 AON (SEQ ID NO: 385) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID NO: 385) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID NO: 385) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0263] In certain embodiments, the QSN-390 STMN2 AON (SEQ ID NO: 390) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-390 STMN2 AON (SEQ ID NO: 390) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-390 STMN2 AON (SEQ ID NO: 390) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, the QSN-395 STMN2 AON (SEQ ID NO: 395) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-395 STMN2 AON (SEQ ID NO: 395) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-395 STMN2 AON (SEQ ID NO: 395) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID NO: 395) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID NO: 395) oligonucleotide are phosphorothioate linkages and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In certain embodiments, the QSN-400 STMN2 AON (SEQ ID NO: 400) exhibits 50-80% rescue of full-length STMN2. In certain embodiments, the QSN-400 STMN2 AON (SEQ ID NO: 400) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, the QSN-400 STMN2 AON (SEQ ID NO: 400) exhibits 70-100% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (SEQ ID NO: 400) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (SEQ ID NO: 400) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0264] In certain embodiments, QSN-144-1 / 5-1 / 3 (SEQ ID NO: 894) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-1 / 5-1 / 3 (SEQ ID NO: 894) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-1 / 5-1 / 3 (SEQ ID NO: 894) exhibits 50-60% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 3 (SEQ ID NO: 895) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 3 (SEQ ID NO: 895) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 3 (SEQ ID NO: 895) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 3 STMN2 AON (SEQ ID NO: 895) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0265] In certain embodiments, QSN-144-2 / 5 (SEQ ID NO: 896) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 5 (SEQ ID NO: 896) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 5 (SEQ ID NO: 896) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 5 (SEQ ID NO: 896) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0266] In certain embodiments, QSN-144-2 / 5-2 / 3 (SEQ ID NO: 897) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 5-2 / 3 (SEQ ID NO: 897) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-2 / 5-2 / 3 (SEQ ID NO: 897) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 5-2 / 3 STMN2 AON (SEQ ID NO: 897) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0267] In certain embodiments, QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0268] In certain embodiments, QSN-144-4 / 3 (SEQ ID NO: 899) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-4 / 3 (SEQ ID NO: 899) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-4 / 3 (SEQ ID NO: 899) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-4 / 3 STMN2 AON (SEQ ID NO: 899) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0269] In certain embodiments, QSN-144-4 / 5 (SEQ ID NO: 900) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-4 / 5 (SEQ ID NO: 900) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-4 / 5 (SEQ ID NO: 900) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-4 / 5 (SEQ ID NO: 900) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0270] In certain embodiments, QSN-173-2 / 3 (SEQ ID NO: 901) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 3 (SEQ ID NO: 901) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 3 (SEQ ID NO: 901) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 3 STMN2 AON (SEQ ID NO: 901) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0271] In certain embodiments, QSN-173-2 / 5 (SEQ ID NO: 902) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 5 (SEQ ID NO: 902) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 5 (SEQ ID NO: 902) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 5 (SEQ ID NO: 902) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0272] In certain embodiments, QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0273] In certain embodiments, QSN-173-4 / 3 (SEQ ID NO: 904) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-4 / 3 (SEQ ID NO: 904) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-4 / 3 (SEQ ID NO: 904) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-4 / 3 (SEQ ID NO: 904) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0274] In certain embodiments, QSN-173-4 / 5 (SEQ ID NO: 905) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-4 / 5 (SEQ ID NO: 905) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-4 / 5 (SEQ ID NO: 905) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-4 / 5 (SEQ ID NO: 905) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0275] In certain embodiments, QSN-173-6 / 3 (SEQ ID NO: 906) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-6 / 3 (SEQ ID NO: 906) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-6 / 3 (SEQ ID NO: 906) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-6 / 3 (SEQ ID NO: 906) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0276] In certain embodiments, QSN-173-6 / 5 (SEQ ID NO: 907) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-6 / 5 (SEQ ID NO: 907) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-6 / 5 (SEQ ID NO: 907) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-6 / 5 (SEQ ID NO: 907) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0277] In certain embodiments, QSN-185-2 / 5 (SEQ ID NO: 908) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-2 / 5 (SEQ ID NO: 908) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-2 / 5 (SEQ ID NO: 908) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-2 / 5 (SEQ ID NO: 908) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0278] In certain embodiments, QSN-185-4 / 3 (SEQ ID NO: 909) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-4 / 3 (SEQ ID NO: 909) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-4 / 3 (SEQ ID NO: 909) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-4 / 3 (SEQ ID NO: 909) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0279] In certain embodiments, QSN-185-4 / 5 (SEQ ID NO: 910) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-4 / 5 (SEQ ID NO: 910) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-4 / 5 (SEQ ID NO: 910) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-4 / 5 (SEQ ID NO: 910) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0280] In certain embodiments, QSN-185-6 / 5 (SEQ ID NO: 911) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-6 / 5 (SEQ ID NO: 911) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-6 / 5 (SEQ ID NO: 911) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-6 / 5 (SEQ ID NO: 911) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0281] In certain embodiments, QSN-237-2 / 3 (SEQ ID NO: 912) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-2 / 3 (SEQ ID NO: 912) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-2 / 3 (SEQ ID NO: 912) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 3 (SEQ ID NO: 912) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0282] In certain embodiments, QSN-237-2 / 5 (SEQ ID NO: 913) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-2 / 5 (SEQ ID NO: 913) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-2 / 5 (SEQ ID NO: 913) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 5 (SEQ ID NO: 913) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0283] In certain embodiments, QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) exhibits 30-100% rescue of full-length STMN2. In other embodiments, QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0284] In certain embodiments, QSN-237-4 / 3 (SEQ ID NO: 915) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-4 / 3 (SEQ ID NO: 915) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-4 / 3 (SEQ ID NO: 915) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-4 / 3 (SEQ ID NO: 915) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0285] In certain embodiments, QSN-237-4 / 5 (SEQ ID NO: 916) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-4 / 5 (SEQ ID NO: 916) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-4 / 5 (SEQ ID NO: 916) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-4 / 5 (SEQ ID NO: 916) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0286] In certain embodiments, QSN-237-6 / 3 (SEQ ID NO: 917) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-6 / 3 (SEQ ID NO: 917) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-6 / 3 (SEQ ID NO: 917) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-6 / 3 (SEQ ID NO: 917) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0287] In certain embodiments, QSN-237-6 / 5 (SEQ ID NO: 918) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-6 / 5 (SEQ ID NO: 918) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-6 / 5 (SEQ ID NO: 918) exhibits 50-60% rescue of full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-6 / 5 (SEQ ID NO: 918) oligonucleotide are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside.

[0288] In certain embodiments, QSN-173-po3 (SEQ ID NO: 1417) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-po3 (SEQ ID NO: 1417) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-po3 (SEQ ID NO: 1417) exhibits 50-60% rescue of full-length STMN2. In certain embodiments, QSN-173-po5 (SEQ ID NO: 1418) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-po5 (SEQ ID NO: 1418) exhibits 40-80% rescue of full-length STMN2. In a specific embodiment, QSN-173-po5 (SEQ ID NO: 1418) exhibits 50-60% rescue of full-length STMN2.

[0289] In certain embodiments, QSN-144-po3 (SEQ ID NO: 1419) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-po3 (SEQ ID NO: 1419) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-po3 (SEQ ID NO: 1419) exhibits 50-60% rescue of full-length STMN2. In certain embodiments, QSN-144-po5 (SEQ ID NO: 1420) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-po5 (SEQ ID NO: 1420) exhibits 40-80% rescue of full-length STMN2. In a specific embodiment, QSN-144-po5 (SEQ ID NO: 1420) exhibits 50-60% rescue of full-length STMN2.

[0290] In certain embodiments, QSN-185-po3 (SEQ ID NO: 1421) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-po3 (SEQ ID NO: 1421) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-po3 (SEQ ID NO: 1421) exhibits 50-60% rescue of full-length STMN2. In certain embodiments, QSN-185-po5 (SEQ ID NO: 1422) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-po5 (SEQ ID NO: 1422) exhibits 40-80% rescue of full-length STMN2. In a specific embodiment, QSN-185-po5 (SEQ ID NO: 1422) exhibits 50-60% rescue of full-length STMN2.

[0291] In certain embodiments, QSN-237-po3 (SEQ ID NO: 1423) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-po3 (SEQ ID NO: 1423) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-po3 (SEQ ID NO: 1423) exhibits 50-60% rescue of full-length STMN2. In certain embodiments, QSN-237-po5 (SEQ ID NO: 1424) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-po5 (SEQ ID NO: 1424) exhibits 40-80% rescue of full-length STMN2. In a specific embodiment, QSN-237-po5 (SEQ ID NO: 1424) exhibits 50-60% rescue of full-length STMN2.

[0292] Additional chemically modified STMN2 antisense oligonucleotides The STMN2 AON described herein may contain chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracil, uracine, uridine, 2'-O-(2-methoxyethyl) modified nucleosides, such as 2'-O-(2-methoxyethyl) guanosine, 2'-O-(2-methoxyethyl) adenosine, 2'-O-(2-methoxyethyl) cytosine, and 2'-O-(2-methoxyethyl) thymidine. In certain embodiments, a combination of mixed modalities, such as STMN2 peptide nucleic acid (PNA) and STMN2 locked nucleic acid (LNA), is used. Chemically modified nucleosides also include, but are not limited to, locked nucleic acid (LNA), 2'-MOE, 2'-O-methyl, 2'-fluoro, and 2'-fluoro-β-D-arabinonucleotides (FANA), and fluorocyclohexenyl nucleic acid (F-CeNA) variants. Chemically modified nucleosides that can be included in the STMN2 AONs described herein are described in Johannes and Lucchino (2018), "Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs," Nucleic Acid Ther. 28(3): 178-93; Rettig and Behlke (2012), "Progress toward in vivo use of siRNAs-II," Mol Ther 20:483-512; and Khvorova and Watts (2017), "The chemical evolution of oligonucleotide therapies of clinical utility," Nat Biotechnol., 35(3):238-48, the contents of each of which are incorporated herein by reference.

[0293] The STMN2 AONs described herein may contain chemical modifications that promote stabilization of the terminal 5' phosphate of an oligonucleotide and phosphatase-resistant analogs of the 5' phosphate. Chemical modifications that promote stabilization of the terminal 5' phosphate of an oligonucleotide or that are phosphatase-resistant analogs of the 5' phosphate include, but are not limited to, 5'-methyl phosphonate, 5'-methylene phosphonate, 5'-methylene phosphonate analogs, 5'-E-vinyl phosphonate (5'-E-VP), 5'-phosphorothioate, and 5'-C-methyl analogs. Chemical modifications that promote stabilization of the terminal 5' phosphate of an AON and phosphatase-resistant analogs of the 5' phosphate are described in Khvorova and Watts (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3):238-48, the contents of which are incorporated herein by reference.

[0294] In some embodiments described herein, the STMN2 AON described herein may include chemically modified nucleosides, such as 2'O-methylribonucleosides, such as 2'O-methylcytidine, 2'O-methylguanosine, 2'O-methyluridine, and / or 2'O-methyladenosine. The STMN2 AON described herein may include one or more chemically modified bases, including 5-methylpyrimidines, such as 5-methylcytosine, and / or 5-methylpurines, such as 5-methylguanine. The chemically modified bases may further include pseudouridine or 5'-methoxyuridine. The STMN2 AON described herein may include any of the following chemically modified nucleosides: 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methylthymidine, 5-methylcytidine, 5-methyluridine, and / or 5-methyl-2'-deoxycytidine.

[0295] The STMN2 AONs described herein can include a phosphate backbone in which one or more of the oligonucleoside linkages are phosphate linkages. The STMN2 AONs described herein may comprise modified oligonucleotide backbones, provided that one or more of the nucleoside linkages of the nucleobase sequence are selected from the group consisting of phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoramidothiate linkages, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate linkages, thiophosphoramidate linkages, thionoalkylphosphonate linkages, thionoalkylphosphotriester linkages, thiophosphate linkages, selenophosphate linkages, and boranophosphate linkages. In some embodiments of the STMN2 AONs described herein, at least one internucleoside linkage in the nucleobase sequence is a phosphorothioate linkage. For example, in some embodiments of the STMN2 AONs described herein, one, two, three, or more internucleoside linkages in the nucleobase sequence are phosphorothioate linkages. In preferred embodiments of the STMN2 AONs described herein, all internucleoside linkages in the nucleobase sequence are phosphorothioate linkages. Thus, in some embodiments, all of the nucleotide linkages in the STMN2 AONs of any of SEQ ID NOS: 1-446, 894-918, 945-1390, or 1392-1432 are phosphorothioate linkages. In some embodiments, in the STMN2 AON of any of SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or 1392 to 1432, one or more of the nucleotide linkages is a phosphorothioate linkage.

[0296] In some embodiments, it is contemplated that the disclosed STMN2 AONs may optionally have at least one modified nucleobase, e.g., 5-methylcytosine, and / or at least one methylphosphonate nucleotide, e.g., at only the 5' or 3' end, or at both the 5' and 3' ends, or positioned along the oligonucleotide sequence. In some embodiments, all internucleoside linkages of the disclosed STMN2 AON oligonucleotides are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0297] The STMN2 AON may optionally contain at least one modified sugar. For example, the sugar moiety of at least one nucleotide constituting the oligonucleotide is ribose, in which the 2'-OH group may be replaced with any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (wherein R is alkyl or aryl and R' is alkylene). Examples of modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'MOE), 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4' bridged nucleic acids (cEt), S-cEt, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0298] In some embodiments, the STMN2 AON is selected from the group consisting of 2'OMe (e.g., an STMN2 AON comprising one or more 2'OMe-modified sugars), MOE (e.g., an STMN2 AON comprising one or more MOE-modified sugars (e.g., 2'-MOE)), PNA (e.g., an STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds, or a carbonyl methylene bond as a repeating unit instead of the sugar-phosphate backbone), LNA (e.g., an STMN2 AON comprising one or more locked riboses and which may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an STMN2 AON comprising one or more cET sugars), cMOE (e.g., an STMN2 AON comprising one or more cMOE sugars), morpholino oligomers (e.g., an STMN2 AON comprising a backbone comprising one or more PMOs). AON), deoxy-2'-fluoronucleoside (e.g., an STMN2 AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., an STMN2 AON comprising one or more ENA-modified sugars), HNA (e.g., an STMN2 AON comprising one or more HNA-modified sugars), or tcDNA (e.g., an STMN2 AON comprising one or more tcDNA-modified sugars). In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, and PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0299] Motor neuron disease Motor neuron diseases are a group of diseases characterized by the loss of motor neuron function, which synchronizes voluntary muscle movements with the brain.Motor neuron diseases can affect upper and / or lower motor neurons and can be sporadic or familial in origin.Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.

[0300] Symptoms of motor neuron disease include muscle breakdown or weakness, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, limb stiffness, difficulty breathing, salivation, and complete loss of muscle control, including basic functions such as breathing, swallowing, feeding, speaking, and limb movement. These symptoms may also be accompanied by depression, memory loss, difficulty planning, language deficits, behavioral changes, difficulty assessing spatial relationships, and / or personality changes.

[0301] Motor neuron disease can be evaluated and diagnosed by skilled clinicians, such as neurologists, using a variety of tools and tests. For example, the presence of motor neuron disease or the risk of developing it can be evaluated or diagnosed using blood and urine tests (e.g., tests to assay for the presence of creatine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction studies (NCS), spinal tap, lumbar puncture, and / or muscle biopsy. Motor neuron disease can be diagnosed with the aid of physical and / or neurological examinations to evaluate motor and sensory abilities, nerve function, hearing and speech, vision, coordination and balance, mental status, and mood or behavior changes.

[0302] Amyotrophic lateral sclerosis ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in the atrophy of both upper and lower motor neurons. Symptoms of ALS include weakness and wasting of bulbar muscles, generalized and bilateral loss of strength, spasticity, muscle spasms, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43.

[0303] ALS is most common in men over 40 years of age, but can also occur in women and children. The risk of ALS is also higher in individuals who smoke, are exposed to chemicals such as lead, or have served in the military. Most cases of ALS are sporadic, with only about 10% of cases being familial. Causes of ALS include sporadic or inherited genetic mutations, high levels of glutamate, and protein mishandling. Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.

[0304] frontotemporal dementia Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. It has an earlier average age of onset than Alzheimer's disease, at 40 years of age. Symptoms of FTD include extreme changes in behavior and personality, speech and language problems, and movement-related symptoms such as tremor, rigidity, muscle spasms, weakness, and difficulty swallowing. Subtypes of FTD include behavioral variant frontotemporal dementia (bvFTD), which is characterized by personality and behavioral changes, and primary progressive aphasia (PPA), which affects language skills, speech, writing, and comprehension. FTD is associated with the accumulation of tau protein (Pick bodies) and altered TDP43 function. Approximately 30% of FTD cases are familial, with no known risk factors other than a family history of the disease. Genetic mutations associated with FTD include mutations in the genes C9orf72, progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1, and TBP.

[0305] Amyotrophic lateral sclerosis with frontotemporal dementia Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the most common cause of familial forms of ALS and / or FTD. Additionally, mutations in TBK1, VCP, SQSTMI, UBQLN2, and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic personality changes, muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and / or FUS proteins in the cytoplasm. TBK1 mutations are associated with ALS, FTD, and ALS with FTD.

[0306] Treatment method The present disclosure contemplates, in part, treating a neurological disease (e.g., amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, e.g., chemotherapy-induced neuropathy, in a patient in need thereof, comprising administering a disclosed inhibitor of an STMN2 transcript comprising a cryptic exon, e.g., an STMN2 AON. In some embodiments, provided herein are methods of treating a neurological disease in a patient in need thereof, comprising administering a disclosed STMN2 AON. In some embodiments of the present disclosure, an effective amount of the disclosed inhibitor of an STMN2 transcript comprising a cryptic exon is used to treat a neurological disease and / or to inhibit an STMN2 AON that can be translated to produce a functional STMN2 protein, thereby increasing, restoring, or stabilizing STMN2 activity and / or function. It may be administered to a patient in need thereof to increase, restore, or stabilize mRNA expression.

[0307] In some embodiments, treating a neurological disease includes improving or reducing at least one symptom associated with the neurological disease (e.g., reducing muscle weakness in a patient with ALS). Methods of treating a neurological disease (e.g., ALS, FTD, or ALS with FTD) in a patient suffering therefrom are provided, comprising administering a disclosed inhibitor of an STMN2 transcript containing a cryptic exon, e.g., an STMN2 AON. In some embodiments, methods are provided for slowing the progression of a neurological disease, e.g., a motor neuron disease.

[0308] Provided herein is a method for treating, reducing the risk of developing, or delaying the onset of neurological disease in a subject in need thereof, comprising administering the disclosed inhibitor of STMN2 transcripts containing hidden exons, such as STMN2 AON.The method comprises, for example, treating a subject at risk of developing neurological disease; for example, administering an effective amount of the disclosed STMN2 AON to the subject.The neurological diseases that can be treated in this manner include motor neuron disease, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

[0309] Methods for preventing or treating neurological diseases (e.g., PD, ALS, FTD, and ALS with FTD) form part of the present disclosure. Such methods may comprise administering to a patient in need thereof or at risk thereof a pharmaceutical preparation comprising an STMN2 AON, e.g., an STMN2 AON disclosed herein. For example, methods for preventing or treating neurological diseases are provided, comprising administering to a patient in need thereof an STMN2 AON disclosed herein.

[0310] Patients treated using the above methods may experience, for example, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or more after administration of an inhibitor of STMN2 transcripts containing cryptic exons, an increase, restoration, or stabilization of at least about 5%, 10%, 20%, 30%, 40%, or even 50% increase, restoration, or stabilization of STMN2 mRNA expression, which can be translated to produce functional STMN2 protein and thereby increase, restore, or stabilize STMN2 activity and / or function in target cells (e.g., motor neurons). Administering such an inhibitor of STMN2 transcripts containing cryptic exons may be, for example, on at least a daily basis. Inhibitors of STMN2 transcripts containing cryptic exons may be administered orally. In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons are administered intrathecally or intracisternally. For example, in embodiments described herein, an inhibitor of STMN2 transcripts containing cryptic exons is administered intrathecally or intracisternally about every three months. The delay or improvement in clinical manifestations of neurological disease in a patient as a result of administering an inhibitor of STMN2 transcripts containing cryptic exons disclosed herein may be at least, for example, 6 months, 1 year, 18 months, or even 2 years or longer, compared to a patient not administered an inhibitor of STMN2 transcripts containing cryptic exons, such as those disclosed herein.

[0311] The inhibitors of STMN2 transcripts containing cryptic exons of the present invention, such as STMN2 AONs, can be used alone or in combination with each other, whereby at least two inhibitors of STMN2 transcripts containing cryptic exons of the present invention are used together in a single composition or as part of a treatment regimen. STMN2 oligonucleotides can be used alone or in combination with each other, whereby at least two STMN2 oligonucleotides are used together in a single composition or as part of a treatment regimen. The inhibitors of STMN2 transcripts containing cryptic exons of the present invention may also be used in combination with other drugs for treating neurological diseases or conditions.

[0312] Treatment and Evaluation As used herein, a patient refers to any animal at risk of, suffering from, or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans. In certain embodiments, the patient may be a non-human mammal, such as a cat, dog, or horse. In certain embodiments, the patient is a human. The patient may be an individual diagnosed with a high risk of developing a neurological disease, a person diagnosed with a neurological disease, a person who has previously suffered from a neurological disease, or an individual who has been evaluated for symptoms or signs of a neurological disease, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, corticobasal degeneration (CBD), and / or any sign or symptom associated with neuropathy, such as chemotherapy-induced neuropathy.

[0313] "Patient in need," as used herein, refers to a patient suffering from any symptom or manifestation of a neurological disease, a patient who may suffer from any symptom or manifestation of a neurological disease, or any patient who may benefit from the disclosed methods for treating a neurological disease. Patients in need may include patients diagnosed as being at risk for developing a neurological disease, patients who have previously suffered from a neurological disease, or patients who have previously been treated for a neurological disease.

[0314] "Effective amount," as used herein, refers to an amount of an agent sufficient to at least partially treat a condition when administered to a patient. A therapeutically effective amount will vary depending on the severity of the condition, the route of administration of the component, and the age, weight, etc., of the patient being treated. Thus, an effective amount of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon is the amount of an inhibitor of an STMN2 transcript containing a cryptic exon necessary to treat a neurological disease in a patient, such that administration of the agent prevents the neurological disease from occurring in the subject, prevents the progression of the neurological disease (e.g., prevents the onset or increase in severity of neurological symptoms, such as muscle weakness, spasms, or fasciculations), or alleviates or completely improves all associated symptoms of the neurological disease, i.e., causes regression of the disease.

[0315] The effectiveness of treatment may be assessed by means of evaluation of gross symptoms associated with a neurological disease, analysis of histology, biochemical assays, imaging methods such as magnetic resonance imaging, or other known methods. For example, the effectiveness of treatment may be assessed by analyzing changes in gross symptoms of the disease, such as muscle strength and control or other aspects of gross pathology associated with a neurological disease, following administration of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon to a patient suffering from a neurological disease.

[0316] The effectiveness of treatment can also be evaluated at the tissue or cellular level, for example, by obtaining tissue biopsy (for example, brain, spinal cord, muscle or motor neuron tissue biopsy) and evaluating gross tissue or cell morphology or staining characteristics.Biochemical assays that examine protein or RNA expression can also be used to evaluate the effectiveness of treatment.For example, the level of protein or gene product that indicates neurological disease can be evaluated in dissociated cells or non-dissociated tissues by immunocytochemistry, immunohistochemistry, Western blotting or Northern blotting, or by a method that is useful for evaluating RNA level, such as quantitative or semi-quantitative polymerase chain reaction (for example, digital PCR (dPCR, or dePCR), qPCR, etc.). Also useful biomarkers found in spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles ("CSF exosomes"), e.g., those described in Welton et al., (2017) "Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis" J Extracell Vesicles., 6(1):1-10; and Street et al., (2012) "Identification and proteomic profiling of exosomes in human cerebrospinal fluid" J Transl. Med., 10:5), urine, feces, lymph, blood, plasma, or serum (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 extracellular domain (p75 ECDThe presence or expression level of urinary neurotrophin receptor p75 extracellular domain (p75) may be assessed to assess disease status and treatment efficacy. The presence or expression level of useful biomarkers found in plasma, neuronal extracellular vesicles / exosomes may also be assessed. Additional measures of efficacy may include strength duration time constant (SDTC), short interval intracortical inhibition (SICI), muscle strength measurement, accurate test of limb isometric strength (ATLIS), compound muscle action potential (bio), and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75) may be assessed. ECD ) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predicts disease status and survival in patients with C9ORF72-associated amyotrophic lateral sclerosis (c9ALS). CSF pNFH as a prognostic biomarker for clinical trials increases the chances of successfully developing treatments for c9ALS.

[0317] In evaluating the effectiveness of treatment, a suitable control may be selected to ensure effective evaluation.For example, the symptoms evaluated in a patient with neurological disease after administration of the disclosed inhibitor of STMN2 transcripts containing hidden exons can be compared with those in the same patient before treatment or at an earlier time point during the course of treatment, or in another patient who has not been diagnosed with neurological disease.Alternatively, the results of biochemical or histological analysis of tissue after administration of the disclosed inhibitor of STMN2 transcripts containing hidden exons can be compared with the results of tissue from the same patient, or from an individual who has not been diagnosed with neurological disease, or from the same patient before administration of an inhibitor of STMN2 transcripts containing hidden exons.In addition, blood, plasma, serum, cells, urine, lymph, spinal fluid, cerebrospinal fluid, or stool samples after administration of an inhibitor of STMN2 transcripts containing hidden exons can be compared with equivalent samples from an individual who has not been diagnosed with neurological disease, or from the same patient before administration of an inhibitor of STMN2 transcripts containing hidden exons. In some embodiments, extracellular vesicles (e.g., CSF exosomes) after administration of an inhibitor of STMN2 transcripts containing cryptic exons may be compared to extracellular vesicles from an individual not diagnosed with a neurological disease or from the same patient before administration of an inhibitor of STMN2 transcripts containing cryptic exons.

[0318] Inhibition of STMN2 transcripts containing cryptic exons can be verified by direct or indirect assessment of STMN2 expression levels or activity. For example, biochemical assays measuring STMN2 protein or RNA expression can be used to assess global inhibition of STMN2 transcripts containing cryptic exons. For example, STMN2 protein levels in cells or tissues can be measured by Western blot to assess global STMN2 levels. STMN2 mRNA levels can also be measured by Northern blot or quantitative polymerase chain reaction to determine global inhibition of STMN2 transcripts containing cryptic exons. Alternatively, STMN2 protein levels or levels of another protein indicative of STMN2 signaling activity can be assessed in dissociated cells, non-dissociated tissues, extracellular vesicles (e.g., CSF exosomes), blood, serum, or feces using immunocytochemical or immunohistochemical methods.

[0319] Modulation of splicing of STMN2 transcripts, including cryptic exons, can also be used to assess parameters such as autophagy, endocytosis, protein aggregation, and useful biomarkers found in plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph, feces, or tissues (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75). ECD ) to assess the efficacy of inhibition of STMN2 transcripts containing cryptic exons. Inhibition of STMN2 transcripts containing cryptic exons may also be indirectly assessed by measuring the presence or expression levels of parameters such as autophagy, endocytosis, protein aggregation, and the presence or expression levels of physiological biomarkers, such as compound muscle action potentials (bio). Additional measurements may include strength-duration time constant (SDTC), short-interval intracortical inhibition (SICI), muscle strength measurement, accurate test of limb isometric strength (ATLIS), compound muscle action potentials, and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75ECD ) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predicts disease status and survival in c9ALS patients. CSF pNFH as a prognostic biomarker for clinical trials increases the chances of successfully developing treatments for c9ALS.

[0320] In some embodiments, the present disclosure provides a method for correcting the splicing of STMN2 transcripts having cryptic exons in cells of a patient suffering from a neurological disease, thereby restoring full-length STMN2 protein expression. The splicing of STMN2 transcripts may be corrected in any cells in which STMN2 expression or activity occurs, including cells of the nervous system (including the central nervous system, peripheral nervous system, motor neurons, brain, brainstem, frontal lobe, temporal lobe, and spinal cord), musculoskeletal system, spinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., muscle cells). Motor neurons include upper motor neurons and lower motor neurons.

[0321] Pharmaceutical Compositions and Routes of Administration The present disclosure also provides a method for treating a neurological disease through administration of a pharmaceutical composition comprising the disclosed inhibitor of an STMN2 transcript containing a cryptic exon. In another aspect, the present disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition may comprise the disclosed antisense oligonucleotide targeting an STMN2 transcript containing a cryptic exon and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutical composition" refers to a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount, in a pharmaceutically acceptable carrier, administered to a mammal, e.g., a human, for treating a neurological disease. In some embodiments, a pharmaceutical composition comprising the disclosed inhibitor of an STMN2 transcript containing a cryptic exon and a pharmaceutically acceptable carrier is contemplated herein. In another aspect, the present disclosure provides the use of the disclosed inhibitor of an STMN2 transcript containing a cryptic exon in the manufacture of a medicament for treating a neurological disease. As used herein, the term "medicament" has essentially the same meaning as the term "pharmaceutical composition."

[0322] As used herein, "pharmaceutically acceptable carrier" refers to buffers, carriers, and excipients suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio. A carrier should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonicity agents, absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment, the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the site of absorption of the encapsulated substance in the digestive system or intestine. For example, the enteric coating can include ethyl acrylate-methacrylate copolymer.

[0323] In one embodiment, the disclosed inhibitors of STMN2 transcripts containing cryptic exons, and any pharmaceutical compositions thereof, may be administered by one or several routes, including topical, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), intralesional, oral, rectal, buccal, sublingual, intravaginal, intrapulmonary, intratracheal, intranasal, transdermal, or intraduodenal. The term parenteral, as used herein, includes subcutaneous injection, intrapancreatic administration, intravenous, intracisternal, intrathecal, intramuscular, intraperitoneal, intrasternal injection, or infusion techniques. For example, the disclosed inhibitors of STMN2 transcripts containing cryptic exons may be administered subcutaneously to a subject. In another example, the disclosed inhibitors of STMN2 transcripts containing cryptic exons may be administered orally to a subject. In another example, the disclosed inhibitors of STMN2 transcripts containing cryptic exons may be administered directly to the nervous system or to specific regions or cells of the nervous system (e.g., brain, brainstem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, for example, the disclosed inhibitors of STMN2 transcripts containing cryptic exons may be administered intrathecally or intracisternally.

[0324] In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons, such as STMN2 AONs, can be encapsulated in nanoparticle coatings. Nanoparticle encapsulation is believed to prevent degradation of the AONs and enhance cellular uptake. For example, in some embodiments, inhibitors of STMN2 transcripts containing cryptic exons are encapsulated in a coating of cationic polymers, such as synthetic polymers (e.g., poly-L-lysine, polyamidoamine, poly(β-amino ester), and polyethyleneimine) or naturally occurring polymers (e.g., chitosan and protamine). In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons are encapsulated in lipid or lipid-like materials, such as cationic lipids, cationic lipid-like materials, or ionizable lipids that are positively charged only at acidic pH. For example, in some embodiments, inhibitors of STMN2 transcripts containing cryptic exons are encapsulated in lipid nanoparticles containing hydrophobic moieties, such as cholesterol and / or polyethylene glycol (PEG) lipids.

[0325] In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons, e.g., STMN2 AONs, are conjugated to a biologically active ligand. For example, in some embodiments described herein, inhibitors of STMN2 transcripts containing cryptic exons, e.g., STMN2 AONs, are conjugated to a peptide, lipid, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, antibody, or cell-penetrating peptide (e.g., transcriptional transactivator (TAT) and penetratin).

[0326] Pharmaceutical compositions containing the disclosed inhibitors of STMN2 transcripts containing cryptic exons, such as those disclosed herein, can be provided in dosage unit form and can be prepared by any suitable method. Pharmaceutical compositions should be formulated to be compatible with the intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical arts. See, for example, Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).

[0327] In some embodiments, the pharmaceutical preparation is sterile.Sterilization can be achieved, for example, by filtration through a sterile filtration membrane.If the composition is lyophilized, sterilization by filtration can be carried out before or after lyophilization and reconstitution.

[0328] Parenteral administration The pharmaceutical compositions of the present disclosure can be formulated for parenteral administration, for example, can be formulated for injection via intravenous, intracisternal, intramuscular, subcutaneous, intrathecal, intralesional, or intraperitoneal routes.The preparation of aqueous compositions, such as aqueous pharmaceutical compositions, containing the disclosed inhibitors of STMN2 transcripts containing hidden exons is known to those skilled in the art in light of the present disclosure.Typically, such compositions can be prepared as injections, either as liquid solutions or suspensions;Solid forms suitable for use in preparing solutions or suspensions by adding liquid before injection can also be prepared;Preparations can also be emulsified.

[0329] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations containing physiological saline, phosphate-buffered saline, artificial cerebrospinal fluid, sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be protected from the contaminating action of microorganisms, such as bacteria and fungi.

[0330] Solutions of the active compound as a free base or pharmacologically acceptable salt can be prepared in water, suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oils. Additionally, sterile fixed oils can be used as a solvent or suspending medium. Any bland fixed oil, including synthetic mono- or diglycerides, can be used for this purpose. Additionally, fatty acids, such as oleic acid, can be used in the preparation of injectable solutions. Sterile injectable preparations can also be sterile injectable solutions, suspensions, or emulsions in non-toxic parenterally acceptable diluents or solvents, such as solutions in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, USP, and isotonic sodium chloride solution. In one embodiment, the disclosed STMN2 antisense oligonucleotides may be suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) TWEEN™ 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0331] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing the basic dispersion medium and other required ingredients listed above. The sterile injectable solution of the present disclosure can be prepared by incorporating the disclosed STMN2 antisense oligonucleotide (e.g., an inhibitor of STMN2 transcripts containing hidden exons) in the required amount of an appropriate solvent with various other ingredients listed above as required, followed by filtration sterilization. For sterile powders for preparing sterile injectable solutions, the preferred method of preparation is vacuum drying and freeze-drying, which produces a powder of the active ingredient and any additional desired ingredients from the previously sterile-filtered solution. Injectable preparations can be sterilized, for example, by filtration through a bacterial-retaining filter.

[0332] The preparation of more or highly concentrated solutions for intramuscular injection is also contemplated. In this regard, the use of DMSO as a solvent is preferred, as it results in extremely rapid penetration, delivering high concentrations of the disclosed inhibitors of STMN2 transcripts containing cryptic exons to small compartments.

[0333] Suitable preservatives for use in such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, and thimerosal. Suitable buffering agents include boric acid, sodium and potassium bicarbonate, sodium and potassium borate, sodium and potassium carbonate, sodium acetate, and sodium biphosphate, in amounts sufficient to maintain the pH between about pH 6 and pH 8, e.g., between about pH 7 and pH 7.5. Suitable tonicity agents include dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, and sodium chloride, with the sodium chloride equivalent of the solution being within a range of 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, and thiourea. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282, and tyloxapol. Suitable viscosity increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethyl cellulose, hydroxymethylpropyl cellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethyl cellulose, and the like.

[0334] Oral administration In some embodiments, compositions suitable for oral delivery of the disclosed inhibitors of STMN2 transcripts containing cryptic exons are contemplated herein, e.g., tablets comprising an enteric coating, e.g., a gastro-resistant coating, such that the inhibitors of STMN2 transcripts containing cryptic exons can be delivered, e.g., to the gastrointestinal tract of a patient.

[0335] For example, a tablet for oral administration is provided that includes (e.g., at least partially formed from) granules containing a disclosed inhibitor of an STMN2 transcript containing a cryptic exon, e.g., an STMN2 antisense oligonucleotide, e.g., an STMN2 antisense oligonucleotide represented by any of SEQ ID NOS: 1-446, 894-918, 945-1390, or 1392-1432, and a pharmaceutically acceptable excipient. Such tablets may be coated with an enteric coating. Contemplated tablets may include pharmaceutically acceptable excipients, such as fillers, binders, disintegrants, and / or lubricants, as well as colorants, release agents, coating agents, sweeteners, flavoring agents, such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, as well as fragrances, preservatives, and / or antioxidants.

[0336] In some embodiments, contemplated pharmaceutical formulations include a disclosed inhibitor of STMN2 transcripts containing cryptic exons, e.g., an STMN2 antisense oligonucleotide, e.g., an STMN2 antisense oligonucleotide represented by any of SEQ ID NOs: 1-446, 894-918, 945-1390, or 1392-1432, and a pharmaceutically acceptable salt thereof, e.g., an STMN2 antisense oligonucleotide, e.g., an antisense oligonucleotide represented by any of SEQ ID NOs: 1-446, 894-918, 945-1390, or 1392-1432, and an intragranular phase comprising a pharmaceutically acceptable filler. For example, the disclosed inhibitor of STMN2 transcripts containing cryptic exons and the filler, optionally with other excipients, may be blended and formed into a granule. In some embodiments, the intragranular phase may be formed using wet granulation, for example, a liquid (e.g., water) is added to the blended inhibitor compound of STMN2 transcripts containing cryptic exons and a filler, and the combination is then dried, milled, and / or sieved to produce granules. Those skilled in the art will appreciate that other processes may be used to achieve the intragranular phase.

[0337] In some embodiments, contemplated formulations include an extragranular phase, which may include one or more pharmaceutically acceptable excipients and be blended with the intragranular phase to form the disclosed formulations.

[0338] The disclosed formulations may also include an intragranular phase comprising a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropyl methylcellulose, partially pregelatinized starch, calcium carbonate, and others, including combinations thereof.

[0339] In some embodiments, the disclosed formulations may include an intragranular phase and / or an extragranular phase that includes a binder that may generally function to hold the components of the pharmaceutical formulation together. Exemplary binders of the present disclosure may include, but are not limited to, the following: starch, sugar, cellulose or modified cellulose, such as hydroxypropyl cellulose, lactose, pregelatinized maize starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropylmethylcellulose, low-substituted hydroxypropyl cellulose, sodium carboxymethylcellulose, methylcellulose, ethylcellulose, sugar alcohols, and others, including combinations thereof.

[0340] For example, contemplated formulations comprising an intragranular and / or extragranular phase may include disintegrants, such as, but not limited to, starch, cellulose, cross-linked polyvinylpyrrolidone, sodium starch glycolate, sodium carboxymethylcellulose, alginates, corn starch, croscarmellose sodium, cross-linked carboxymethylcellulose, low-substituted hydroxypropylcellulose, acacia, and others including combinations thereof. For example, the intragranular and / or extragranular phase may include a disintegrant.

[0341] In some embodiments, contemplated formulations include an intragranular phase comprising a disclosed inhibitor of an STMN2 transcript containing a cryptic exon and an excipient selected from mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose, and sodium starch glycolate or a combination thereof, and an extragranular phase comprising one or more of microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or a mixture thereof.

[0342] In some embodiments, contemplated formulations may include a lubricant, for example, the extragranular phase may contain a lubricant, including, but not limited to, talc, silica, fat, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metal stearates, hydrogenated vegetable oils, partially hydrogenated vegetable oils, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0343] In some embodiments, the pharmaceutical preparation comprises an enteric coating. Generally, enteric coating creates a barrier for oral pharmaceuticals that controls the location where the drug is absorbed along the digestive tract. The enteric coating may comprise a polymer that degrades at different rates depending on pH. The enteric coating may comprise, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropylmethylcellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate phthalate, and cellulose acetate phthalate.

[0344] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, and Eudragit® grades. In some embodiments, the enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of the tablet by weight. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

[0345] For example, contemplated embodiments provide tablets comprising or consisting essentially of about 0.5% to about 70% by weight, e.g., about 0.5% to about 10%, or about 1% to about 20% of the disclosed STMN2 antisense oligonucleotides or pharmaceutically acceptable salts thereof. Such tablets may contain, for example, about 0.5% to about 60% by weight mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and / or about 20% to about 40% by weight microcrystalline cellulose, or about 10% to about 30% by weight microcrystalline cellulose. For example, the disclosed tablets may comprise about 30% to about 60% by weight, e.g., about 45% to about 65%, or alternatively, about 5% to about 10% by weight of the disclosed STMN2 antisense oligonucleotide, about 30% to about 50%, or alternatively, about 5% to about 15% by weight of mannitol, about 5% to about 15% by weight of microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% of hydroxypropyl methylcellulose, and an intragranular phase comprising about 0% to about 4% by weight, e.g., about 2% to about 4%, of sodium starch glycolate.

[0346] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon comprises an intragranular phase, the intragranular phase comprising the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof (e.g., a sodium salt), and a pharmaceutically acceptable filler, and the pharmaceutical tablet formulation may also comprise an extragranular phase, the extragranular phase may comprise a pharmaceutically acceptable excipient, such as a disintegrant. The extragranular phase may comprise an ingredient selected from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also comprise an enteric coating, approximately 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise 0.5% to 10% by weight of the disclosed STMN2 AON, e.g., the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight of mannitol, about 10% to 30% by weight of microcrystalline cellulose, and an enteric coating comprising ethyl acrylate-methacrylic acid copolymer.

[0347] In another example, a pharmaceutically acceptable tablet for oral use may comprise about 5 to about 10% by weight of the disclosed STMN2 AON, e.g., the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof, an intragranular phase comprising about 40% by weight of mannitol, about 8% by weight of microcrystalline cellulose, about 5% by weight of hydroxypropyl methylcellulose, and about 2% by weight of sodium starch glycolate; an extragranular phase comprising about 17% by weight of microcrystalline cellulose, about 2% by weight of sodium starch glycolate, about 0.4% by weight of magnesium stearate; and an enteric coating on the tablet comprising ethyl acrylate-methacrylic acid copolymer.

[0348] In some embodiments, the pharmaceutical composition may contain an enteric coating, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010 / 054826, incorporated herein by reference in its entirety), comprising about 13% or about 15%, 16%, 17%, or 18% by weight.

[0349] The rate at which the coating dissolves and the active ingredient is released is the dissolution rate. In embodiments, contemplated tablets may have a dissolution profile that, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in, for example, a phosphate buffer solution having a pH of 7.2, releases about 50% to about 100% of the inhibitor of STMN2 transcripts containing cryptic exons after about 120 minutes to about 240 minutes, e.g., after 180 minutes. In another embodiment, contemplated tablets may have a dissolution profile that, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in, for example, dilute HCl having a pH of 1.0, releases substantially no inhibitor of STMN2 transcripts containing cryptic exons after 120 minutes. In another embodiment, a contemplated tablet may have a dissolution profile that releases about 10% to about 30%, or about 50% or less of the inhibitor of STMN2 transcripts containing cryptic exons after 30 minutes when tested in a USP / EP Type 2 apparatus (paddles) at 100 rpm and 37°C in, for example, a phosphate buffer having a pH of 6.6.

[0350] In some embodiments, the methods provided herein may further comprise administering at least one other agent for the treatment of the diseases and disorders disclosed herein. In one embodiment, the other agent(s) contemplated may be administered in combination (e.g., sequentially or simultaneously).

[0351] Dosage and frequency of administration The dosages or amounts set forth below refer to either the oligonucleotide or a pharmaceutically acceptable salt thereof.

[0352] In some embodiments, the formulation comprises a dosage form containing at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of an inhibitor of an STMN2 transcript containing a cryptic exon, e.g., an STMN2 antisense oligonucleotide. In some embodiments, the formulation comprises a dosage form containing at least 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 70 mg to 80 mg, 80 mg to 90 mg, 90 mg to 100 mg, 100 mg to 150 mg, 150 mg to 200 mg, 200 mg to 250 mg, 250 mg to 300 mg. mg, 300 mg to 350 mg, 350 mg to 400 mg, 400 mg to 450 mg, 450 mg to 500 mg, 500 mg to 600 mg, 600 mg to 700 mg, 700 mg to 800 mg, 800 mg to 900 mg, 900 mg to 1 g, 1 mg to 50 mg, 20 mg to 40 mg, or 1 mg to 500 mg of STMN2 antisense oligonucleotide.

[0353] In some embodiments, the formulation comprises about 10 mg to about 500 mg of a dosage form comprising or consisting essentially of an inhibitor of an STMN2 transcript containing a cryptic exon, eg, an STMN2 AON. For example, formulations comprising about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed inhibitor of STMN2 transcripts containing cryptic exons are contemplated herein. In some embodiments, the formulation may contain about 40 mg, 80 mg, or 160 mg of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon. In some embodiments, the formulation may contain at least 100 μg of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of a disclosed inhibitor of an STMN2 transcript containing a cryptic exon. The amount administered will depend on variables, such as the type and severity of the disease or condition being treated, the patient's overall health and size, the in vivo efficacy of the inhibitor of an STMN2 transcript containing a cryptic exon, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased above the upper limit to rapidly achieve the desired blood or tissue level. Alternatively, the initial dosage can be less than optimal, and the dosage can be gradually increased during the course of treatment. Human dosage can be optimized, for example, in conventional Phase I dose escalation study.Dosage frequency can vary depending on factors such as route of administration, dosage and the disease being treated.Exemplary dosage frequency is once a day, once a week and once every two weeks.In some embodiments, dosage is once a day for 7 days.In some embodiments, dosing is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, dosing is once a month to once every 3 months.

[0354] Combination therapy In various embodiments, the STMN2 AON as disclosed herein can be administered in combination with one or more additional therapies. In some embodiments, the combination therapy of the disclosed oligonucleotides and one or more additional therapies can be synergistic in treating any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, corticobasal degeneration (CBD), and / or neuropathy, such as chemotherapy-induced neuropathy.

[0355] Exemplary additional therapies include riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), dual AON intrathecal agents (e.g., BIIB067, BIIB078), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers, anticonvulsants, and psychostimulants. Additional therapies may further include breathing care, physical therapy, occupational therapy, speech therapy, and nutritional support. In various embodiments, the additional therapy may be a second antisense oligonucleotide. By way of example, the second antisense oligonucleotide may target an STMN2 transcript (eg, STMN2 pre-mRNA, mature STMN2 mRNA) to modulate the expression level of full-length STMN2 protein.

[0356] In various embodiments, the disclosed oligonucleotide and one or more additional therapies can be conjugated with each other and provided in a conjugated form.Further description of the conjugates with the disclosed oligonucleotides is provided below.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided in parallel.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially.

[0357] Conjugates In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (e.g., an STMN2 oligonucleotide) and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group comprises one or more conjugate moieties and a conjugate linker linking the conjugate moieties to the oligonucleotide. The conjugate group may be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached at the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached at the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached at the 5' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0358] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.

[0359] Conjugate Group In certain embodiments, the STMN2 AON is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, intracellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group modifies (e.g., increases) the circulation time of the oligonucleotide in the bloodstream, resulting in increased concentrations of the oligonucleotide being delivered to the brain. In certain embodiments, the conjugate group modifies (e.g., increases) the residence time of the oligonucleotide in the target organ (e.g., the brain), resulting in increased residence time of the oligonucleotide improving its performance (e.g., efficacy). In certain embodiments, the conjugate group increases the delivery of the oligonucleotide to the brain through the blood-brain barrier and / or brain parenchyma (e.g., via receptor-mediated transcytosis). In certain embodiments, the conjugate group enables the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, the conjugate group confers a new property on the oligonucleotide to which it is attached, for example, a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO 2014 / 179620).

[0360] Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes. In certain embodiments, the conjugate moiety is selected from peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, antibodies (e.g., antibodies for crossing the blood-brain barrier, such as anti-transferrin receptor antibodies), or cell-penetrating peptides (e.g., transcriptional transactivator (TAT) and penetratin).

[0361] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.

[0362] Conjugate Linker The conjugate moiety is attached to the STMN2 AON through a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, a repeating unit, for example, an oligomer of ethylene glycol, a nucleoside, or an amino acid unit.

[0363] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0364] In certain embodiments, the conjugate linker, including the above-mentioned conjugate linker, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, a bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0365] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0366] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker comprises 3 linker nucleosides.

[0367] In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides include modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, linker nucleosides include an optionally protected heterocyclic base selected from purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable for the linker nucleosides to be cleaved from the oligomeric compound after the oligomeric compound reaches the target tissue. Thus, linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound through a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.

[0368] As used herein, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group that includes a conjugate linker that includes linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide with respect to the reference nucleic acid.

[0369] In certain embodiments, it is desirable for the conjugate group to be cleaved from the STMN2 AON. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Therefore, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms with one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0370] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0371] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound through a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is attached to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0372] terminal group In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, a 5'-phosphonate, and the 5'-phosphonate includes, but is not limited to, a 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0373] Diagnostic methods The present disclosure also provides a method for diagnosing a patient with a neurological disease, the method relying on detecting the level of STMN2 expression signals in one or more biological samples from the patient. As used herein, the term "STMN2 expression signal" can refer to any indication of STMN2 gene expression or gene or gene product activity. STMN2 gene products include RNA (e.g., mRNA), peptides, and proteins. Indicators of STMN2 gene expression that can be evaluated include, but are not limited to, the state of the STMN2 gene or chromatin, the interaction of the STMN2 gene with cellular components that regulate gene expression, the expression level of the STMN2 gene product (e.g., the expression level of STMN2 transcripts containing cryptic exons, the STMN2 protein expression level), or the interaction of STMN2 RNA or protein with transcriptional, translational, or post-translational processing machinery.

[0374] Detection of STMN2 expression signals may be achieved through in vivo, in vitro, or ex vivo methods. In a preferred embodiment, the methods of the present disclosure may be performed in vitro. Detection methods may involve detection in a patient's blood, serum, feces, tissue, cerebrospinal fluid, spinal fluid, extracellular vesicles (e.g., CSF exosomes), or cells. Detection may be achieved by measuring expression signals of STMN2 transcripts containing cryptic exons in whole tissue, tissue explants, cell cultures, dissociated cells, cell extracts, extracellular vesicles (e.g., CSF exosomes), or body fluids, including blood, spinal fluid, cerebrospinal fluid, urine, lymph, or serum. Contemplated methods of detection include assays that measure the level of expression of the STMN2 gene product, such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerase chain reaction, dPCR, the Quanterix SR-X™ Ultra-Sensitive Biomarker Detection System powered by Simoa® bead technology, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).

[0375] Additional Embodiments Disclosed herein are compounds comprising an oligonucleotide comprising a nucleobase sequence at least 90% complementary to at least 10 contiguous nucleobases of SEQ ID NO: 1391 or SEQ ID NO: 944, or a transcript comprising a sequence at least 90% identical to a 15-50 contiguous nucleobase portion of SEQ ID NO: 1391 or SEQ ID NO: 944, wherein at least one nucleoside linkage of the nucleobase sequence is a non-natural linkage. Additionally disclosed herein are oligonucleotides comprising a nucleobase sequence at least 90% complementary to at least 10 contiguous nucleobases of SEQ ID NO: 1391 or SEQ ID NO: 944, or a transcript comprising a sequence at least 90% identical to a 15-50 contiguous nucleobase portion of SEQ ID NO: 1391 or SEQ ID NO: 944, wherein at least one nucleoside linkage of the nucleobase sequence is a non-natural linkage.

[0376] In one embodiment, the oligonucleotide comprises a sequence of at least 10 contiguous nucleobases that share 90% identity with an equal-length portion of any one of SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or 1392 to 1432. In one embodiment, the oligonucleotide comprises a sequence of at least 11, 12, 13, 14, 15, 16, or 17 contiguous nucleobases that share at least 90% identity with an equal-length portion of any one of SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or 1392 to 1432. In one embodiment, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, 1339, or 1344, wherein at least one nucleoside bond of the nucleobase sequence is a non-natural bond. In one embodiment, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0377] Additionally disclosed herein is an oligonucleotide comprising a nucleobase sequence at least 90% complementary to at least 10 contiguous nucleobases of SEQ ID NO:944, or a transcript thereof comprising at least 90% identity to a 20-50 contiguous nucleobase portion thereof, wherein at least one nucleoside bond of the nucleobase sequence is unnatural. In one embodiment, the oligonucleotide comprises at least 10 contiguous nucleobases that share 90% identity with an equal-length portion of any one of SEQ ID NOs:1-446 or 894-918. In one embodiment, the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, or 17 contiguous nucleobases that share at least 90% identity with an equal-length portion of any one of SEQ ID NOs:1-446 or 894-918. In one embodiment, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside bond of the nucleobase sequence is non-naturally occurring.In one embodiment, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0378] Additionally disclosed herein is a stathmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence at least 90% complementary to a 10-nucleotide sequence of a cryptic exon-containing STMN2 transcript, the nucleotide sequence being at least 90% identical to SEQ ID NO:447 or a 20-50-nucleotide sequence thereof, wherein at least one nucleoside bond of the nucleotide sequence is a non-natural linkage. Additionally disclosed herein is a stathmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence sharing at least 90% identity with a 10-nucleotide sequence of any one of SEQ ID NOs:1-446, wherein at least one nucleoside bond of the nucleotide sequence is a non-natural linkage. In one embodiment, the nucleic acid sequence shares at least 90% identity with a 11-nucleotide, 12-nucleotide, 13-nucleotide, 14-nucleotide, 15-nucleotide, 16-nucleotide, or 17-nucleotide sequence of any one of SEQ ID NOs:1-446.

[0379] SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1154, 1155, 1156, 1157, 1158, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 12 Additionally disclosed herein is a stathmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence that shares at least 90% identity with any one of 10 consecutive nucleobase sequences of 59, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside bond of the nucleotide sequence is a non-natural bond. In one embodiment, the nucleic acid sequence is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 111 3, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0380] Modifications in general While certain compounds, compositions, and methods described herein have been described with particularity according to certain embodiments, the following examples are intended merely to illustrate the compounds described herein and are not intended to be limiting thereof. Each of the references and GenBank accession numbers, etc., described in this application are incorporated herein by reference in their entirety.

[0381] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" depending on the actual situation, these sequences may be modified using any combination of chemical modifications. Those skilled in the art will readily understand that designations such as "RNA" or "DNA" to describe modified oligonucleotides are arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (a 2'-OH instead of a single 2'-H in DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil in RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those nucleic acids with modified nucleobases. By way of further non-limiting example, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including such compounds containing RNA bases, e.g., those having the sequence "AUCGAUCG," and those having some DNA bases and some RNA bases, e.g., "AUCGATCG," as well as oligomeric compounds having other modified nucleobases, e.g., "AT m CGAUCG" ( m C refers to a cytosine base containing a methyl group at the 5-position).

[0382] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers and therefore give rise to enantiomers, diastereomers, and other stereoisomeric configurations, which may be defined in terms of absolute stereochemistry, such as (R) or (S), α or β for sugar anomers, etc., or (D) or (L) for amino acids, etc. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the indicated compound. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise specified. Similarly, unless otherwise indicated, all tautomeric forms of the compounds herein are also included. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0383] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitutions may confer novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. [Example]

[0384] The present disclosure is further illustrated by the following examples, which are provided for illustrative purposes only and should not be construed as limiting the scope or content of the disclosure in any way.

[0385] [Example 1] Initial design and selection of STMN2 antisense oligonucleotides Antisense oligonucleotides complementary to STMN2 RNA were designed and tested to identify STMN2 antisense oligonucleotides (AONs) that can act as inhibitors of STMN2 transcripts containing cryptic exons.

[0386] Figures 1A-1C depict portions of the STMN2 transcript and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. In particular, regions of the STMN2 transcript include branch points (e.g., branch points 1, 2, and 3), the 3' splice acceptor region, the ESE binding region, the TDP43 binding site, and the poly(A) region. STMN2 antisense oligonucleotides are identified according to the position of the STMN2 transcript to which they correspond. For example, Figure 1A depicts an STMN2 antisense oligonucleotide targeting positions 36-60 of the STMN2 transcript, which includes branch point 1. Similarly, a different STMN2 antisense oligonucleotide targets positions 144-178 of the STMN2 transcript, which includes branch point 3. Other STMN2 antisense oligonucleotides can be designed using any of the sequences disclosed above (e.g., SEQ ID NOs: 1-446, 894-918, 945-1390, or 1392-1432).

[0387] Generally, the length of STMN2 antisense oligonucleotide is 25 nucleotides.However, the variants of STMN2 antisense oligonucleotide with different lengths (for example, 23mer, 21mer or 19mer) are also designed.The specific STMN2 AON and AON variants that are designed and developed for testing are shown in Table 7 below.

[0388] [Table 7-1]

[0389] [Table 7-2]

[0390] [Table 7-3]

[0391] [Table 7-4]

[0392] [Table 7-5]

[0393] [Example 2] Methods for evaluating STMN2 antisense oligonucleotides STMN2 antisense oligonucleotides were evaluated in SY5Y cells and human motor neurons.In particular, the following Examples 3, 4, and 5 describe the results obtained from the evaluation of STMN2 antisense oligonucleotides in SY5Y cells.The following Examples 6 and 7 describe the results obtained from the evaluation of STMN2 antisense oligonucleotides in human motor neurons.

[0394] STMN2 antisense oligonucleotides were evaluated in SY5Y cells. Cells were plated in 6-well or 96-well plates and grown to 80% confluency. Antisense oligonucleotides (AONs) against TDP43 were transfected using RNAiMax (Thermo Fisher Scientific, Waltham, MA, USA) to express the cryptic exon, thereby preventing transcription of the full-length STMN2 (STMN2-FL) product. RNAiMax alone was used in place of vehicle treatment. Positive controls included cells treated with TDP43 siRNA alone ("siRNA TDP43") and / or TDP43 AON alone ("AON TDP43" or "TDP43 AON"). siRNA TDP43 was purchased from Horizon / Dharmacon as ON-TARGETplus Human TARDBP (23435) siRNA-SMARTpool (#L-012394-00-0005). TARDBP (23435) siRNA consists of four separate sequences: 1) Target sequence 1: GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 1439) 2) Target sequence 2: CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 1440) 3) Target sequence 3: GGGCUUCGCUACAGGAAUC (SEQ ID NO: 1441) 4) Target sequence 4: CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 1442) It contains four individual siRNAs targeting

[0395] The TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: [ka] (* = phosphorothioate, underline = DNA, others = 2'MOE RNA; each "C" is 5-MeC)

[0396] To evaluate the ability of STMN2 AONs to restore STMN2-FL, antisense oligonucleotides against STMN2 were co-incubated with TDP43 AONs in RNAiMax. After 96 hours, transcript levels (e.g., full-length STMN2 transcripts, STMN2 transcripts with cryptic exons, or TDP43 transcripts) were detected by RT-qPCR using TaqMan. Specifically, RT-qPCR was performed to detect GAPDH using Thermofisher TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was performed to detect STMN2 transcripts with cryptic exons using the following primer sequences: 1) forward primer: 5'-CTCAGTGCCTTATTCAGTCTTCTC-3' (SEQ ID NO: 1444), 2) reverse primer: 5'-TCTTCTGCCGAGTCCCATTT-3' (SEQ ID NO: 1445), and 3) probe: 5'- / 56-FAM / TCAGCGTCTGCACATCCCTACAAT / 3BHQ_1 / -3' (SEQ ID NO: 1446). RT-qPCR was performed to detect full-length STMN2 transcripts using the following primer sequences: 1) forward primer: 5'-CCACGAACTTTAGCTTCTCCA-3' (SEQ ID NO: 1447), 2) reverse primer: 5'-GCCAATTGTTTCAGCACCTG-3' (SEQ ID NO: 1448), and 3) probe: 5'- / 56-FAM / ACTTTCTTCTTTCCTCTGCAGCCTCC / 3BHQ_1 / -3' (SEQ ID NO: 1449).

[0397] RT-qPCR was performed on an Applied Biosystems® 7500 Real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. Forty-five cycles of amplification were performed at 95°C for 1 second, followed by 60°C for 20 seconds.

[0398] The STMN2-FL or STMN2 latent signal (Ct) was normalized to GAPDH (ΔCt). To visualize quantitative changes (e.g., % increase in STMN-FL), the normalized STMN2-FL signal was further normalized to the vehicle (treatment with RNAiMax alone, ΔΔCt). The relative amount of transcript level was calculated using the formula RQ=2. -ΔΔCt and used to describe the comparison of treatment conditions to normal healthy levels (1.0).

[0399] The percent decrease in expression of STMN2 with cryptic exons was calculated as:

[0400]

number

[0401]

number

[0402] STMN2 antisense oligonucleotides were also evaluated in human motor neurons for their efficacy in reducing cryptic exons and increasing STMN2 full-length transcripts. iCell Human Motor Neurons (Cellular Dynamics International) were plated at 15 × 10 in 96-well plates for RT-qPCR RNA quantification according to the manufacturer's instructions. 3 Cells / well or 3 x 10 in a 6-well plate for Western blot protein quantification 5Cells were plated at 1000kJ / well. Neurons were transfected with TDP43 AON and / or STMN2 AON using Endoporter (GeneTools, LLC.), or treated with Endoporter alone. Treatment conditions were tested in biological triplicate (qRT-PCR) or duplicate (Western blot) wells. The same TDP43 AON described above is used here to evaluate human motor neurons. The TDP43 AON is a gapmer oligonucleotide with the following sequence and chemistry: [ka] (* = phosphorothioate, underline = DNA, others = 2'MOE RNA; each "C" is 5-MeC)

[0403] After 72 hours, the antisense oligonucleotides and endoprotease inhibitors were washed away and replaced with fresh medium. After another 72 hours, RNA was collected from the 96-well plates for RT-qPCR or protein was collected from the 6-well plates for Western blot analysis. RNA was isolated, cDNA was generated, and multiplex RT-qPCR assays were performed using TaqMan probes for STMN2 cryptic exons, STMN2 full-length transcripts, and reference GAPDH quantification. The same primers for detecting GAPDH, STMN2 transcripts with cryptic exons, and full-length STMN2 as described above for SY5Y cells were applied here to perform RT-qPCR on human motor neurons. For protein quantification, the soluble portion of the protein collection was denatured, separated by SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and probed with antibodies against GAPDH (Proteintech, 60004-1-1g), TDP-43 (Proteintech, 10782-2-AP), and Stathmin-2 (ThermoFisher, PA5-23049).

[0404] STMN2 antisense oligonucleotides were tested for their ability to increase or restore full-length STMN2 mRNA levels (i.e., the mRNA from which full-length STMN2 is translated) in TDP43-silenced cells (e.g., SY5Y cells and human motor neurons). In some cases, STMN2 antisense oligonucleotides were tested for their ability to reduce STMN2 transcripts with cryptic exons. As described further below, the quantified percentage increase / recovery of STMN2-FL and / or the percentage reduction of STMN2 transcripts with cryptic exons is reported relative to the levels of STMN-FL and / or STMN2 transcripts with cryptic exons in a control group (e.g., cells treated with 500 nM TDP43 AON).

[0405] [Example 3] STMN2 antisense oligonucleotides restore full-length STMN2 and reduce STMN2 transcripts with cryptic exons in SY5Y cells Figures 1B and 1C demonstrate the effectiveness of STMN2 AONs targeting different regions of the STMN2 transcript containing hidden exons. In particular, Figure 1B depicts STMN2 AONs designed and evaluated in SY5Y cells. Figure 1C depicts STMN2 AONs designed and evaluated in human motor neurons. The STMN2 AONs represented by the solid line resulted in cells with STMN2-FL mRNA expression increased by more than 50% compared to TDP43 AON treatment alone. The STMN2 AONs represented by the dotted line resulted in cells with STMN2-FL (full-length) mRNA increased by less than 50% compared to TDP43 AON treatment alone.

[0406] Referring to Figure 2, treatment with 500 nM TDP43 AON reduced TDP43 transcripts by approximately 52% and STMN2-FL by approximately 57%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 36 increased TDP43 levels by 25% and STMN-FL levels by 55% (rescued by 67%). Treatment with 50 nM and 500 nM STMN2 AON having SEQ ID NO: 177 increased STMN-FL levels by 58% (rescued by 68%) and 53% (rescued by 66%), respectively. Treatment with 500 nM STMN2 AON having SEQ ID NO: 203 increased TDP43 levels by 15% and STMN-FL levels by 72% (rescued by 74%). Treatment with 50 nM and 500 nM STMN2 AON with SEQ ID NO: 395 increased STMN-FL levels by 49% (to 64% rescue) and 37% (to 59% rescue), respectively. The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0407] Referring to Figure 3, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with cryptic exons increased by more than 20-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 reduced the level of STMN2 transcripts with cryptic exons by 68%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 181 reduced the level of STMN2 transcripts with cryptic exons by 65%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 197 reduced the level of STMN2 transcripts with cryptic exons by 39%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 215 reduced the level of STMN2 transcripts with cryptic exons by 31%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 385 reduced the level of STMN2 transcripts with cryptic exons by 53%. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 400 reduced the level of STMN2 transcript with cryptic exons by 74%. The dotted line represents the level of expression of STMN2 with cryptic exons in response to 500 nM of TDP43 AON.

[0408] Referring to Figure 4, STMN2-FL was reduced by approximately 59% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 166% (rescued by 68%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 197 increased STMN-FL levels by 146% (rescued by 60%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0409] Referring to Figure 5A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with cryptic exons increased by more than 36-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 185 reduced the level of STMN2 transcripts with cryptic exons by 58%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcripts with cryptic exons by 87%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 380 reduced the level of STMN2 transcripts with cryptic exons by 70%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 390 reduced the level of STMN2 transcripts with cryptic exons by 58%. The dotted line represents the expression level of STMN2 with cryptic exons in response to 500 nM TDP43 AON.

[0410] Referring to Figure 5B, STMN2-FL was reduced by 66% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 185 increased STMN-FL levels by 209% (rescued by 71%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 347% (rescued by 118%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0411] Referring to Figure 6A, the amount of STMN2 transcripts with cryptic exons increased more than 20-fold when treated with 500 nM TDP43 AONs (two different syntheses). Treatment with 500 nM of STMN2 AONs with SEQ ID NO: 144 reduced the level of STMN2 transcripts with cryptic exons by 83-88%. Treatment with 500 nM of STMN2 AONs with SEQ ID NO: 237 reduced the level of STMN2 transcripts with cryptic exons by 92-93%. The dotted line represents the level of expression of STMN2 with cryptic exons in response to 500 nM TDP43 AONs.

[0412] Referring to Figure 6B, STMN2-FL was reduced by approximately 80% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 144 increased STMN-FL levels by 376% to 429% (rescued by 79% to 90%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 490% to 538% (rescued by 103% to 113%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0413] Referring to Figure 7A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with cryptic exons increased by more than 23-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 reduced the level of STMN2 transcripts with cryptic exons by 83%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 177 reduced the level of STMN2 transcripts with cryptic exons by 83%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 181 reduced the level of STMN2 transcripts with cryptic exons by 72%. The dotted line represents the expression level of STMN2 with cryptic exons in response to 500 nM TDP43 AON.

[0414] Referring to Figure 7B, STMN2-FL was reduced by approximately 58% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 219% (rescued by 92%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 181 increased STMN-FL levels by 188% (rescued by 79%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 185 increased STMN-FL levels by 174% (rescued by 73%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0415] Referring to Figure 8A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with cryptic exons increased by more than 20-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 197 reduced the level of STMN2 transcript with cryptic exons by 65%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcript with cryptic exons by 94%. The dotted line represents the expression level of STMN2 with cryptic exons in response to 500 nM TDP43 AON.

[0416] Referring to Figure 8B, STMN2-FL was reduced by 59% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 197 increased STMN-FL levels by 185% (rescued by 76%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 227% (rescued by 93%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 380 increased STMN-FL levels by 171% (rescued by 70%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0417] Referring to Figure 9A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with cryptic exons increased by more than 50-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 144 reduced the level of STMN2 transcripts with cryptic exons by 92%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 reduced the level of STMN2 transcripts with cryptic exons by 82%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcripts with cryptic exons by 96%. The dotted line represents the expression level of STMN2 with cryptic exons in response to 500 nM TDP43 AON.

[0418] Referring to Figure 9B, STMN2-FL was reduced by 67% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 144 increased STMN-FL levels by 235% (rescued by 87%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 232% (rescued by 86%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 243% (rescued by 90%). The dotted line represents the level of FL-STMN2 expression in response to 500 nM TDP43 AON.

[0419] Referring to Figure 10A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with cryptic exons increased by more than 65-fold. Treatment with 200 nM STMN2 AON having SEQ ID NO: 181 reduced the level of STMN2 transcript with cryptic exons by 50%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 181 reduced the level of STMN2 transcript with cryptic exons by 73%. Referring to Figure 10B, when treated with 500 nM TDP43 AON, STMN2-FL was reduced by 67%. Treatment with 50 nM STMN2 AON having SEQ ID NO: 181 increased STMN-FL levels by 215% (rescued by 71%). Treatment with 200 nM STMN2 AON having SEQ ID NO: 181 increased STMN-FL levels by 197% (rescued by 65%). Treatment with 500 nM of STMN2 AON with SEQ ID NO: 181 increased STMN-FL levels by 194% (rescued by 64%).

[0420] Referring to Figure 11A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with a cryptic exon increased by more than 26-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 185 reduced the level of STMN2 transcript with a cryptic exon by 47%. Referring to Figure 11B, when treated with 500 nM TDP43 AON, STMN2-FL decreased by 74%. Treatment with 50 nM STMN2 AON having SEQ ID NO: 185 increased STMN-FL levels by 173% (rescued by 45%). Treatment with 200 nM STMN2 AON having SEQ ID NO: 185 increased STMN-FL levels by 346% (rescued by 90%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 185 increased STMN-FL levels by 265% (rescued by 69%).

[0421] Referring to Figure 12A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with a cryptic exon increased by more than 41-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 197 reduced the level of STMN2 transcript with a cryptic exon by 51%. Referring to Figure 12B, when treated with 500 nM TDP43 AON, STMN2-FL decreased by 65%. Treatment with 20 nM STMN2 AON having SEQ ID NO: 197 increased STMN-FL levels by 186% (rescued by 65%). Treatment with 50 nM STMN2 AON having SEQ ID NO: 197 increased STMN-FL levels by 231% (rescued by 81%). Treatment with 200 nM STMN2 AON having SEQ ID NO: 197 increased STMN-FL levels by 254% (rescued by 89%). Treatment with 500 nM of STMN2 AON with SEQ ID NO: 197 increased STMN-FL levels by 269% (rescued by 94%).

[0422] Referring to Figure 13A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with a cryptic exon increased by more than 41-fold. Treatment with 500 nM STMN2 AON having SEQ ID NO: 144 reduced the level of STMN2 transcript with a cryptic exon by 93%. Referring to Figure 13B, when treated with 500 nM TDP43 AON, STMN2-FL decreased by 84%. Treatment with 50 nM STMN2 AON having SEQ ID NO: 144 increased STMN-FL levels by 175% (rescued by 28%). Treatment with 200 nM STMN2 AON having SEQ ID NO: 144 increased STMN-FL levels by 360% (rescued by 57%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 144 increased STMN-FL levels by 544% (rescued by 87%).

[0423] Referring to Figure 14A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with cryptic exons increased by more than 70-fold. Treatment with 200 nM STMN2 AON having SEQ ID NO: 173 reduced the level of STMN2 transcript with cryptic exons by 59%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 reduced the level of STMN2 transcript with cryptic exons by 70%. Referring to Figure 14B, when treated with 500 nM TDP43 AON, STMN2-FL was reduced by 62%. Treatment with 200 nM STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 100% (rescued by 76%). Treatment with 500 nM STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 158% (rescued by 98%).

[0424] Referring to Figure 15A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcript with cryptic exons increased by more than 70-fold. Treatment with 200 nM STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcript with cryptic exons by 78%. Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcript with cryptic exons by 92%. Referring to Figure 15B, when treated with 500 nM TDP43 AON, STMN2-FL was reduced by 77%. Treatment with 50 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 187% (rescued by 43%). Treatment with 200 nM STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 235% (rescued by 54%). Treatment with 500 nM of STMN2 AON with SEQ ID NO: 237 increased STMN-FL levels by 309% (rescued by 71%).

[0425] Referring to Figure 16, STMN2-FL was reduced by 44% when treated with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 173 increased STMN-FL levels by 152%. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 237 increased STMN-FL levels by 134%.

[0426] Referring to Figure 17A, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with cryptic exons increased by more than 30-fold. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 237 reduced the level of STMN2 transcripts with cryptic exons by 96%. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 912 reduced the level of STMN2 transcripts with cryptic exons by 97%. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 913 reduced the level of STMN2 transcripts with cryptic exons by 97%. Treatment with 500 nM of STMN2 AON having SEQ ID NO: 916 reduced the level of STMN2 transcripts with cryptic exons by 71%.

[0427] Referring to Figure 17B, STMN2-FL was reduced by 76% when treated with 500 nM TDP43 AON. Treatment with 500 nM STMN2 AON having SEQ ID NO: 237 increase...

Claims

1. An oligonucleotide comprising a linked nucleoside consisting of any one of the nucleic acid bases of SEQ ID NO: 31, 36, 41, 46, 55, 144, 146, 150, 169-173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 395, 400, 894-899, 901-918, 1407, 1408, 1417-1419, 1423 or 1424.

2. 2. The oligonucleotide of claim 1, (a) the oligonucleotide comprises at least one nucleoside linkage selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphate linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothiate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, or any combination(s) thereof; (b) at least 2, 3, or 4 internucleoside linkages of said oligonucleotide are phosphodiester internucleoside linkages; (c) the oligonucleotide contains at least two, three, or four modified internucleoside linkages; (i) each of the modified internucleoside linkages of the oligonucleotide is independently selected from a phosphorothioate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, or a phosphorodiamidate linkage; (ii) all internucleoside linkages of said oligonucleotide are phosphorothioate linkages, and / or (iii) the phosphorothioate internucleoside linkages are in one of the Rp or Sp configurations; (d) said oligonucleotide comprises at least one modified nucleobase; (e) the oligonucleotide comprises at least one modified sugar moiety; (f) the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides linked through phosphorothioate internucleoside linkages; and / or (g) the oligonucleotide comprises three linked nucleosides linked at the 5'-terminus through phosphorothioate internucleoside linkages and three linked nucleosides linked at the 3'-terminus through phosphorothioate internucleoside linkages; The oligonucleotide.

3. In the oligonucleotide (d), the at least one modified nucleobase is 5-methylcytosine, pseudouridine, or 5-methoxyuridine. in said oligonucleotide (e), wherein the modified sugar moiety is one of a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, a 2'-O-(2-methoxyethyl) (2'MOE), a 2'-deoxy-2'-fluoronucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a constrained ethyl 2'-4'-bridged nucleic acid (cEt), a S-cEt, a hexitol nucleic acid (HNA), and a tricyclic analog; and / or the oligonucleotide (f), wherein all nucleosides in the oligonucleotide contain a modified sugar moiety containing 2'-MOE; The oligonucleotide of claim 2.

4. In the oligonucleotide (f), all nucleosides in the oligonucleotide comprise a modified sugar moiety comprising 2'-MOE; all cytosine nucleosides in said oligonucleotide comprise the modified nucleobase 5-methylcytosine; The oligonucleotide of claim 3.

5. In the oligonucleotide (f), all nucleosides in the oligonucleotide comprise a modified sugar moiety comprising 2'-MOE; all cytosine nucleosides in said oligonucleotide comprise the modified nucleobase 5-methylcytosine; all internucleoside linkages are phosphorothioate linkages; The oligonucleotide of claim 4.

6. The oligonucleotide according to any one of claims 1 to 5, (a) the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or 400% increase in full-length STMN2 transcript or STMN2 protein; the increase is relative to levels before exposing the neurons to the oligonucleotide, or the increase in full-length STMN2 protein is measured in comparison to the decreased levels of full-length STMN2 protein achieved using a TDP43 antisense oligonucleotide; or (b) the oligonucleotide exhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length STMN2 transcript or STMN2 protein; the increase is relative to levels before exposing the neurons to the oligonucleotide; and / or the oligonucleotide exhibits at least a 50%, 60%, 70%, 80% or 90% reduction in STMN2 transcripts containing cryptic exons; The oligonucleotide.

7. A pharmaceutical composition comprising one or more of the oligonucleotides according to any one of claims 1 to 6, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

8. 8. The pharmaceutical composition of claim 7 for topical, intrathecal, intracisternal, parenteral, intralesional, oral, intrapulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, intravaginal, or intraduodenal administration.

9. 9. The pharmaceutical composition according to claim 7 or 8, (a) a method for treating a neurological disease and / or neuropathy in a patient in need thereof, the method comprising administering to the patient an oligonucleotide according to any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 7 or 8; (b) a method for restoring axonal outgrowth and / or regeneration of motor neurons, the method comprising the step of exposing said motor neurons to the oligonucleotide or pharmaceutically acceptable salt thereof according to any one of claims 1 to 6, or the pharmaceutical composition according to claim 7 or 8; or (c) A method for increasing, promoting, stabilizing or maintaining STMN2 expression and / or function in neurons, the method comprising the step of exposing the neurons to the oligonucleotide of any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 7 or 8. The pharmaceutical composition for use in

10. An ex vivo method for restoring axonal outgrowth and / or regeneration of motor neurons, an ex vivo method for increasing, promoting, stabilizing or maintaining STMN2 expression and / or function in neurons, comprising exposing the neurons to an oligonucleotide or a pharmaceutically acceptable salt thereof described in any one of claims 1 to 6, or a pharmaceutical composition described in claim 7.

11. 10. The pharmaceutical composition of claim 9, (a) the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD); or (b) the neuropathy is chemotherapy-induced neuropathy; The pharmaceutical composition.

12. 12. The pharmaceutical composition according to claim 9 or 11, (a)(i) the exposing step comprises administering the oligonucleotide to a patient identified as having a transcript containing a cryptic exon sequence of SEQ ID NO: 447; (ii) the oligonucleotide is administered topically, parenterally, intrathecally, intracisternally, orally, rectally, bucally, sublingually, intravaginally, intrapulmonary, intratracheally, intranasally, intralesionally, transdermally, or intraduodenal; (iii) a therapeutically effective amount of the oligonucleotide is administered intrathecally or intracisternally; (iv) the patient is a human; and / or (v) a patient receiving said treatment has no or only no elevated levels of neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), phosphorylated neurofilament heavy chain (pNFH), TDP-43, or p75 in the patient's plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles, blood, urine, lymph, feces, or tissues; ＥＣＤ or the pharmaceutical composition, wherein the pharmaceutical composition is identified by measuring the presence or expression level of (b) for use in a method for treating a neurological disease and / or neuropathy in a patient in need thereof, comprising administering to said patient a therapeutically effective amount of the oligonucleotide of any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 7 or 8, for treating said neurological disease; a second therapeutic agent selected from riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), dual AON intrathecal, BIIB100, levodopa / carbidopa, dopamine agonists, medroxyprogesterone, KCNQ2 / KCNQ3 openers, anticonvulsants, and psychostimulants; and / or Therapy selected from breathing care, physical therapy, occupational therapy, speech therapy, and nutritional support 20. The pharmaceutical composition for use in a method comprising administering in combination with

13. In the pharmaceutical composition (b), (i) the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD), or the neuropathy is chemotherapy-induced neuropathy; and / or (ii) a patient to be treated has no or only no elevated levels of neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), phosphorylated neurofilament heavy chain (pNFH), TDP-43, or p75 in the patient's plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles, blood, urine, lymph, feces, or tissues; ＥＣＤ and determining the presence or expression level of The pharmaceutical composition of claim 12.

14. An oligonucleotide comprising a linked nucleoside consisting of any one of the nucleobases of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169 to 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 395, 400, 894 to 899, 901 to 918, 1407, 1408, 1417 to 1419, 1423, and 1424, or a pharmaceutically acceptable salt thereof, the oligonucleotide comprises at least one nucleoside linkage selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphate linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothiate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage; and / or at least one nucleoside of said linked nucleoside is replaced with a component selected from the group consisting of 2'-O-(2-methoxyethyl)nucleoside (2'-O-methoxyethylribonucleoside (2'-MOE)), 2'-O-methylnucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acid (PNA); An oligonucleotide or a pharmaceutically acceptable salt thereof.

15. 15. The oligonucleotide of claim 14, (a) (i) at least one internucleoside linkage of said oligonucleotide is a phosphorothioate linkage; (ii) the oligonucleotide comprises three linked nucleosides linked through phosphodiester internucleoside linkages at the 5'-terminus and three linked nucleosides linked through phosphodiester internucleoside linkages at the 3'-terminus; and / or (iii) the oligonucleotide, wherein the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked through a phosphorothioate internucleoside linkage, and each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside; (b) the oligonucleotide, wherein at least one internucleoside linkage of the oligonucleotide is a phosphorothioate linkage; or (c) (i) at least one internucleoside linkage of said oligonucleotide is a phosphorothioate linkage; and / or (ii) the oligonucleotide, wherein all of the internucleoside linkages of said oligonucleotide are phosphorothioate linkages, each of the linked nucleosides of said oligonucleotide is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and further wherein said oligonucleotide comprises at least one 5-methylcytosine modified nucleobase.

16. 16. A pharmaceutical composition comprising the oligonucleotide of claim 14 or 15, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

17. The oligonucleotide or pharmaceutically acceptable salt thereof described in any one of claims 1 to 6, which has the ability to increase, restore, or stabilize the expression of STMN2 mRNA capable of translating functional STMN2 in a cell, and / or the activity and / or function of STMN2 protein.

18. A pharmaceutical comprising the oligonucleotide of any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof, for use in treating a neurological disease or disorder in a human patient by increasing, restoring, or stabilizing the expression of STMN2 mRNA capable of translating functional STMN2 and / or the activity and / or function of STMN2 protein in said human patient.

19. 7. The oligonucleotide of any one of claims 1 to 6, which contains one or more chiral centers and / or double bonds and exists as a stereoisomer selected from a geometric isomer, an enantiomer, and a diastereomer.

Images