Gene therapy treatment

AAV vectors are used to deliver functional AP-4 proteins to neurons, addressing the lack of treatment for AP-4-HSP by restoring brain function and halting symptom progression.

JP7805306B2Active Publication Date: 2026-01-23UNIV OF SHEFFIELD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022554889
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-03-26
Filing Date
2021-04-09
Publication Date
2026-01-23
Estimated Expiration
2041-04-09

AI Technical Summary

Technical Problem

There is no disease-modifying treatment for AP-4-associated hereditary spastic paraplegia (AP-4-HSP), a rare genetic disorder causing spasticity, intellectual disability, and other severe symptoms, and existing gene delivery methods like retroviral or lentiviral vectors pose risks of immune response and genomic integration.

Method used

Development of adeno-associated virus (AAV) vectors encoding AP-4 complex subunits for targeted expression in mammalian neurons to replace dysfunctional AP-4 protein, using modified AAV vectors to deliver functional AP-4 proteins and restore normal brain function.

Benefits of technology

The AAV vectors effectively replace dysfunctional AP-4 proteins, potentially halting the progression of AP-4-HSP symptoms by restoring normal brain function and autophagosome formation, offering a safe and effective treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007805306000016
    Figure 0007805306000016
  • Figure 0007805306000017
    Figure 0007805306000017
  • Figure 0007805306000018
    Figure 0007805306000018
Patent Text Reader

Abstract

The present disclosure relates to transcription cassettes comprising nucleic acid molecules comprising nucleotide sequences encoding AP-4 subunits, vectors comprising the transcription cassettes, pharmaceutical compositions comprising the vectors, and vectors or compositions for use in treating AP-4-hereditary spastic paraplegia.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to a transcription cassette comprising a nucleic acid molecule comprising a nucleotide sequence encoding at least one subunit of heterotetrameric adaptor protein complex 4 (AP-4), a vector comprising the transcription cassette, a pharmaceutical composition comprising the vector, and a vector or composition for use in treating AP-4 hereditary spastic paraplegia. [Background technology]

[0002] Hereditary spastic paraplegia (HSP) is a rare group of inherited, progressive, spastic disorders of the lower limbs, with an overall prevalence of 0.5 to 5.5 per 100,000 people. In younger patients, HSP is often characterized by leg weakness and spasticity (stiffness), which can lead to further complications later in life and may require the use of a cane, walker, or wheelchair. There are various genotypes of HSP, including autosomal dominant, autosomal recessive, X-linked, and maternally inherited (mitochondrial) forms, with the most common autosomal dominant form affecting 75 to 80% of HSP patients. Various diagnostic methods for distinguishing between mutations in genes involved in different forms of HSP, such as autosomal recessive HSP (AR-HSP) caused by mutations in the genes KIAA1840 (US10519503) or ZFYVE26 (US2017152562), or autosomal dominant HSP caused by mutations in SPG3A, are disclosed in CN1958605.

[0003] AP-4-associated hereditary spastic paraplegia (AP-4-HSP), sometimes known as AP-4 deficiency syndrome or adaptor protein complex 4 (AP-4) deficiency, is caused by loss-of-function mutations in any one of four genes encoding protein subunits of the AP-4 adaptor complex

[10] . AP-4-HSP is autosomal recessive in nature. AP-4-HSP, caused by mutations in the AP4B1 gene, is sometimes referred to as spastic paraplegia type 47 (SPG47) or hereditary spastic paraplegia type 47 (HSP47), and results in a significant decrease in AP4B1 protein levels [2]. AP-4-HSP can also be caused by mutations in three other AP-4 subunits. Mutations in AP4M1 cause AP-4-HSP, sometimes called SPG50 or HSP50; mutations in AP4E1 cause AP-4-HSP, sometimes called SPG51 or HSP51; and mutations in AP4S1 cause AP-4-HSP, sometimes called SPG52 or HSP51. The characteristics of AP-4-HSP are very similar regardless of the gene in which the causative mutation occurs. Onset of AP-4-HSP usually occurs in early childhood and results in spasticity, moderate to severe intellectual disability, speech impairment or absence, cerebellar myelopathy, seizures, shyness, and, in severe cases, quadriplegia.

[11] AP-4-HSP has been characterized in 199 children worldwide to date. [1] While the incidence is most likely underreported, AP-4-HSP is progressive and there is no disease-modifying treatment. Therefore, there is a need to develop new treatments to improve patient outcomes for patients with AP-4-HSP.

[0004] AP4B1 is one component of the AP-4 heterotetramer (Figure 1A). The complete AP-4 complex consists of two large adaptins (epsilon-type subunit AP4E1 and beta-type subunit AP4B1), a medium-sized adaptin (mu-type subunit AP4M1), and a small adaptin (sigma-type AP4S1). The AP-4 complex forms a non-clathrin-associated coat on vesicles departing the trans-Golgi network (TGN) and may be involved in targeting proteins from the TGN to the endosomal-lysosomal system (Figure 1B). It is also involved in protein sorting to the basolateral membrane in epithelial cells and the proper asymmetric localization of proteins in neurons. AP-4-positive TGN-derived vesicles are essential for the correct spatial formation of autophagosomes, and therefore, loss of the AP-4 complex may prevent autophagosome formation in distal axons. Thus, the AP-4 complex is key to normal brain function.

[0005] Adeno-associated virus (AAV) vectors are known in the art and offer various advantages over retroviral or lentiviral vectors, including a mild immune response, the ability to infect a wide range of cells, and the ability to store the desired DNA extrachromosomally within cells without integrating into the genome, potentially disrupting or knocking out other genes. AAV contains a single-stranded DNA genome of approximately 4.8 kilobases (kb), containing three genes with coding sequences flanked by inverted repeats required for genome replication and packaging. The use of AAV and modified AAV vectors is known in the art and is disclosed in WO2019 / 032898, WO2020041498, or WO2019 / 028306. AAV vectors have completed various Phase I and Phase II clinical trials for gene delivery in approved therapies for the treatment of cystic fibrosis and congestive heart failure, as well as spinal muscular atrophy.

[0006] We disclose expression vectors comprising AP-4 nucleic acid molecules operably linked to expression control sequences adapted for expression in mammalian neurons, e.g., motor neurons, and the use of modified expression vectors to deliver and functionally replace dysfunctional AP-4 protein in the prevention or treatment of conditions associated with HSPs. This disclosure relates to the development of modified vectors, e.g., AAV vectors, comprising nucleic acid molecules encoding proteins of the AP-4 complex. Summary of the Invention

[0007] According to an aspect of the present invention, there is provided an isolated nucleic acid molecule comprising a transcription cassette comprising a promoter adapted for expression in a mammalian neuron, the cassette further comprising a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

[0008] In a preferred embodiment of the invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 1 (AP4B1), or a polymorphic sequence variant; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule, the complementary strand of which hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 1 (AP4B1), and which encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 (AP4B1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue as set forth in iv), and wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

[0009] The hybridization of nucleic acid molecules occurs when two complementary nucleic acid molecules undergo a certain amount of hydrogen bonding with each other.The stringency of hybridization can vary depending on the environmental conditions surrounding nucleic acid, the nature of hybridization method, and the composition and length of the nucleic acid molecules used.Calculation of the hybridization conditions required to achieve a certain degree of stringency is discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001), and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). m is the temperature at which 50% of a given strand of a nucleic acid molecule hybridizes to its complementary strand. The following is an exemplary, non-limiting set of hybridization conditions:

[0010] Very high stringency (allowing sequences sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to hybridize) Hybridization: 5xSSC, 65℃ for 16 hours 2 washes: 2xSSC, 15 min each at room temperature (RT) Wash twice: 0.5xSSC, 20 min each at 65°C

[0011] high stringency (allowing sequences sharing at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% identity to hybridize); Hybridization: 5x-6x SSC, 65-70°C for 16-20 hours Wash twice: 2x SSC, 5-20 min each at RT Wash twice: 1xSSC, 30 minutes each at 55-70°C

[0012] low stringency (allowing sequences sharing at least 50%, 55%, 60%, 65%, 70%, or 75% identity to hybridize); Hybridization: 6xSSC, RT-55°C for 16-20 hours Wash at least twice: 2x-3x SSC, 20-30 min each at RT-55°C.

[0013] In a preferred embodiment of the invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 3 (AP4E1), or a polymorphic sequence variant; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence of SEQ ID NO: 3 (AP4E1) under stringent hybridization conditions, and which encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4 (AP4E1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue as set forth in iv), and wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

[0014] In a preferred embodiment of the invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 5 (AP4M1), or a polymorphic sequence variant; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule, the complementary strand of which hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 5 (AP4M1), and which encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 (AP4M1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue as set forth in iv), and wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

[0015] In a preferred embodiment of the invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence, wherein the nucleotide sequence is i) the nucleotide sequence set forth in SEQ ID NO: 7 (AP4S1), or a polymorphic sequence variant; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule, the complementary strand of which hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 7 (AP4S1), and which encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 8 (AP4S1); a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by the addition, deletion, or substitution of at least one amino acid residue as set forth in iv), and wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

[0016] In a preferred embodiment of the invention, the cassette is adapted for expression in motor neurons.

[0017] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1 or a polymorphic sequence variant thereof.

[0018] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2, or a polymorphic sequence variant thereof.

[0019] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 3 or a polymorphic sequence variant thereof.

[0020] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4, or a polymorphic sequence variant thereof.

[0021] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 5 or a polymorphic sequence variant thereof.

[0022] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:6, or a polymorphic sequence variant thereof.

[0023] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 7 or a polymorphic sequence variant thereof.

[0024] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8, or a polymorphic sequence variant thereof.

[0025] The polypeptides disclosed herein may differ in amino acid sequence by one or more substitutions, additions, deletions, or truncations, which may be present in any combination. Preferred variants include those that differ from the reference polypeptide by conservative amino acid substitutions. Such substitutions replace a given amino acid with another amino acid of similar characteristics. The following non-limiting list of amino acids is considered to be conservative substitutions (similar): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine; d) arginine and lysine; e) isoleucine, leucine, methionine, and valine; and f) phenylalanine, tyrosine, and tryptophan. Most preferred are variants that retain or enhance the same biological function and activity as the original reference polypeptide from which they are altered. In one embodiment, the polypeptide has at least 70% identity, even more preferably at least 75% identity, even more preferably at least 80%, 85%, 90%, 95% identity, and at least 99% identity to the full-length amino acid or nucleotide sequences exemplified herein.

[0026] In a preferred embodiment of the invention, the promoter is a constitutive promoter.

[0027] In alternative embodiments of the invention, the promoter is a regulated promoter, for example an inducible or cell-specific promoter.

[0028] In a preferred embodiment of the present invention, the promoter is selected from the group consisting of neuron- and glial-specific promoters including the chicken beta-actin (CBA) promoter, chicken beta-actin hybrid promoter (CBh), CAG promoter, synapsin 1, Hb9, MeP229, and GFAP promoter sequences, and AP-4 subunit-specific promoter regions including AP4B1, AP4E1, AP4M1, and AP4S1.

[0029] In a preferred embodiment of the invention, the promoter sequence comprises a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO:27, or a nucleotide sequence that is a polymorphic sequence variant of SEQ ID NO:27.

[0030] In an alternative embodiment of the invention, the promoter sequence comprises a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO:30, or a nucleotide sequence that is a polymorphic sequence variant of SEQ ID NO:30.

[0031] According to a further aspect of the present invention, Transcription cassettes are provided that comprise a first nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:27, or a nucleotide sequence that is a polymorphic sequence variant of SEQ ID NO:27, wherein the nucleic acid molecule is operably linked to a second nucleic acid molecule that is a transcription promoter and comprises a nucleotide sequence that encodes a polypeptide, wherein the first nucleic acid molecule regulates transcription of the second nucleic acid molecule.

[0032] In a preferred embodiment of the invention, the first nucleic acid molecule comprising a promoter comprises or consists of the nucleotide sequence set forth in SEQ ID NO:27.

[0033] In an alternative embodiment of the invention, the first nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO:30, or a nucleotide sequence that is a polymorphic sequence variant of SEQ ID NO:30.

[0034] In a preferred embodiment of the invention, the second nucleic acid molecule comprises a nucleotide sequence encoding at least one polypeptide of the AP-4 complex.

[0035] In a preferred embodiment of the invention, the second nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 1 or a polymorphic sequence variant thereof.

[0036] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2, or a polymorphic sequence variant thereof.

[0037] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 3 or a polymorphic sequence variant thereof.

[0038] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4, or a polymorphic sequence variant thereof.

[0039] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 5 or a polymorphic sequence variant thereof.

[0040] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:6, or a polymorphic sequence variant thereof.

[0041] In a preferred embodiment of the invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 7 or a polymorphic sequence variant thereof.

[0042] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:8, or a polymorphic sequence variant thereof.

[0043] The terms "promoter" or "transcription promoter" are art-recognized and include the following characteristics, which for clarity are provided by way of example only and not limitation: Enhancer elements are cis-acting nucleic acid sequences often found 5' to the transcription start site of a gene (enhancers can also be found 3' to a gene sequence or even located within intron sequences). Enhancers function to increase the transcription rate of a gene to which they are linked. Enhancer activity is responsive to trans-acting transcription factors (polypeptides) that have been shown to specifically bind to enhancer elements. Transcription factor binding / activity (see, "Eukaryotic Transcription Factors," by David S. Latchman, Academic Press Ltd, San Diego) responds to several physiological / environmental cues and can be constitutive or regulatable and cell / tissue-specific. Promoter elements also include so-called TATA boxes and RNA polymerase initiation selection (RIS) sequences, which function to select the transcription start site. These sequences also bind polypeptides that function, inter alia, to facilitate transcription initiation selection by RNA polymerase.

[0044] As used herein, a first nucleic acid comprising a promoter sequence and a second nucleotide sequence encoding a polypeptide are said to be "operably" linked when they are covalently linked in such a manner as to place expression or transcription of the second nucleic acid molecule under the control of the first nucleic acid molecule comprising the regulatory sequences. If it is desired that the coding sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of the promoter in the 5' regulatory sequences results in transcription of the coding sequence and production of mRNA. Thus, a promoter region would be operably linked to a coding sequence if the promoter region is capable of effecting transcription of that DNA sequence such that the resulting transcript is translated into the desired protein or polypeptide.

[0045] According to a further aspect of the present invention there is provided an expression vector comprising a transcription cassette according to the present invention.

[0046] Viruses are commonly used as vectors for the delivery of exogenous genes. Commonly employed vectors include recombinant modified enveloped or non-enveloped DNA and RNA viruses, such as baculoviridiae, parvoviridiae, picornoviridiae, herpesviridiae, poxviridae, adenoviridiae, picornaviridiae, or retroviridae, such as lentiviruses. Chimeric vectors that utilize advantageous elements of each parent vector's properties can also be employed (see, e.g., Feng, et al. (1997) Nature Biotechnology 15:866-870). Such viral vectors can be wild-type or modified by recombinant DNA technology to be replication-deficient, conditionally replicating, or replication-competent. Conditionally replicating viral vectors are used to achieve selective expression in specific cell types while avoiding harmful broad-spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell, and SJ (1994) Eur. J. of Cancer 30A(8):1165-1171.

[0047] Preferred vectors are derived from the adenovirus, adeno-associated virus, or retrovirus genomes.

[0048] In a preferred embodiment of the invention, the expression vector is a viral-based expression vector.

[0049] In a preferred embodiment of the invention, the viral-based vector is an adeno-associated virus [AAV].

[0050] In a preferred embodiment, the viral-based vector is selected from the group consisting of: AAV2, AAV3, AAV6, AAV13, AAV1, AAV4, AAV5, AAV6, AAV9, and rhAAV10.

[0051] In a preferred embodiment of the invention, the viral-based vector is AAV9.

[0052] In a preferred embodiment of the invention, the AAV vector is based on a single-stranded AAV virus.

[0053] In an alternative embodiment of the invention, the AAV vector is based on a self-complementary AAV virus.

[0054] Naturally occurring AAV serotypes typically contain a single-stranded genome that replicates during natural infection to form a double-stranded AAV viral genome. This is the rate-limiting step in AAV replication and expression. Recombinant forms of AAV are referred to as self-complementary AAV, which contain both sense and antisense genomic strands adapted for immediate expression and replication.

[0055] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 19 (AP4B1).

[0056] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 20 (AP4B1).

[0057] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 21 (AP4S1).

[0058] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 22 (AP4S1).

[0059] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 23 (AP4E1).

[0060] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 24 (AP4E1).

[0061] In a preferred embodiment of the invention, the viral-based vector further comprises SEQ ID NO:25 or 26.

[0062] In an alternative preferred embodiment of the present invention, the viral-based vector is a lentiviral vector.

[0063] According to a further aspect of the present invention there is provided a pharmaceutical composition comprising an expression vector according to the present invention and an excipient or carrier.

[0064] The expression vector compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and auxiliary therapeutic agents. The expression vector compositions of the present invention can be administered by any conventional route, including injection, or by gradual infusion over time.

[0065] The expression vector compositions of the present invention are administered in effective amounts. An "effective amount" is the amount of expression vector that, alone or together with further doses, produces the desired response. When treating a disease, the desired response is to inhibit the progression of the disease. This may involve only temporarily slowing the progression of the disease, but more preferably, permanently halting the progression of the disease. This can be monitored by routine methods. Such amounts will, of course, depend on individual patient parameters, including the specific condition being treated, the severity of the condition, age, physical condition, size, and weight, duration of treatment, the nature of concomitant therapy (if any), the specific route of administration, and similar factors within the knowledge and expertise of the medical practitioner. These factors are well known to those of skill in the art and can be addressed with only routine experimentation. It is generally preferred to use the maximum dose of each component or combination thereof, i.e., the highest safe dose according to sound medical judgment. However, those skilled in the art will understand that a patient may insist on a lower or tolerated dose for medical, psychological, or virtually any other reason.

[0066] The expression vector composition used in the aforementioned method is preferably sterile and contains an effective amount of the expression vector according to the present invention to produce the desired response in a unit of weight or volume suitable for administration to a patient. The dose of the vector administered to a subject can be selected according to different parameters, particularly according to the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the response in the subject is insufficient with the initial dose applied, a higher dose (or an effectively higher dose via a different, more localized delivery route) can be adopted, as long as the patient's tolerance allows. Other protocols for administering vector compositions, differing in dosage, injection schedule, injection site, administration mode, and the like, will be known to those skilled in the art. Administration (e.g., for testing or veterinary therapeutic purposes) is carried out under substantially the same conditions as those described above. As used herein, a subject is a mammal, preferably a human, and includes non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents.

[0067] When administered, the expression vector compositions of the present invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term "pharmaceutically acceptable" refers to a non-toxic material that does not interfere with the effectiveness of the biological activity of the active agent. Such preparations may routinely contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents (e.g., those typically used in the treatment of a particular disease indication). When used in medicine, salts should be pharmaceutically acceptable; however, non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts can also be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.

[0068] Pharmaceutical compositions containing the expression vectors of the present invention include acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt. Suitable buffering agents may be included. The pharmaceutical compositions may also optionally contain suitable preservatives such as benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0069] The expression vector composition may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the active agent into association with the vector, which constitutes one or more accessory ingredients. Preparations may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally-acceptable diluents or solvents, for example, as solutions in 1,3-butanediol. Possible solvents that may be employed include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, and other administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0070] According to a further aspect of the invention there is provided an expression vector according to the invention for use as a medicament.

[0071] According to a further aspect of the invention there is provided an expression vector according to the invention for use in the treatment of AP-4 hereditary spastic paraplegia.

[0072] In a preferred embodiment of the invention, the AP-4-HSP is SPG47.

[0073] In a preferred embodiment of the invention, the AP-4-HSP is SPG50.

[0074] In a preferred embodiment of the invention, the AP-4-HSP is SPG51.

[0075] In a preferred embodiment of the invention, the AP-4-HSP is SPG52.

[0076] Spastic paraplegia (SPG) is used synonymously with hereditary spastic paraplegia (HSP), thus SPG47 is HSP47, SPG50 is HSP50, SPG51 is HSP51, and SPG52 is HSP52.

[0077] According to a further aspect of the invention there is provided a cell transfected with an expression vector according to the invention.

[0078] In a preferred embodiment of the invention, the cell is a neuron.

[0079] In a preferred embodiment of the invention, the neuron is a motor neuron.

[0080] According to a further aspect of the present invention, there is provided a method for treating or preventing AP-4 hereditary spastic paraplegia, comprising administering a therapeutically effective amount of an expression vector according to the present invention to prevent and / or treat hereditary spastic paraplegia.

[0081] In a preferred method of the present invention, the AP-4-HSP is spastic paraplegia type 47 (SPG47).

[0082] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 50 (SPG50).

[0083] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 51 (SPG51).

[0084] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 52 (SPG52).

[0085] According to a further aspect of the present invention there is provided a diagnostic method for genotyping a subject to determine whether the subject has a mutation in one or more AP-4 gene sequences, comprising: i) obtaining a biological sample from a subject to be tested and extracting nucleic acid from the biological sample; ii) sequencing the nucleic acid to obtain the nucleotide sequence of AP4B1, AP4E1, AP4M1, or AP4S1 in the subject; iii) comparing the obtained genomic sequence with a normal matched control nucleotide sequence to identify nucleotide sequence differences; and iv) determining whether the test sample contains a modification in the AP-4 gene sequence and whether the modification is associated with hereditary spastic paraplegia.

[0086] In a preferred method of the invention, the method further comprises the administration of at least one expression vector according to the invention for preventing or treating a type of AP-4 hereditary spastic paraplegia.

[0087] In a preferred embodiment of the invention, the AP-4-HSP is selected from the group consisting of SPG 47, SPG 50, SPG 51, and SPG 52. In a preferred method of the invention, the genomic sequence comprises SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, or a polymorphic sequence variant thereof.

[0088] Throughout the description and claims of this specification, the words "comprise" and "contain," as well as variations of those words, such as "comprising" and "comprises," mean "including, but not limited to," and are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. "Consisting essentially of" means having the essential integers, but including integers that do not materially affect the function of the essential integers.

[0089] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating singularity as well as plurality, unless the context otherwise requires.

[0090] It should be understood that any feature, integer, property, compound, chemical moiety, or group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless incompatible therewith. [Brief explanation of the drawings]

[0091] Embodiments of the present invention will now be described, by way of example only, with reference to the following figures:

[0092] [Figure 1] AP4 complex and function: (A) Diagram of the AP4 heterotetramer complex, consisting of large beta- and epsilon-type adaptins (β4 and ε4, designated AP4B1 and AP4E1), medium-sized mu-type adaptin (APμ4, designated AP4M1), and small sigma-adaptin (APσ4, designated AP4S1). (B) Diagram of AP4 complex function. 1) AP4 heterotetramers are recruited to the trans-Golgi network (TGN), which in turn recruits their cargo proteins, including ATG9. 2) Clatherin-negative vesicles emerge from the TGN. 3) AP4 complexes are shed from the vesicles and recycled back to the TGN for further vesicle formation. 4) The remaining vesicles are bound by kinesin motor proteins and transported anterogradely along microtubules to the cell periphery or distal neural compartments. 5) ATG9 vesicles assemble to promote autophagosome formation. [Figure 2]Design and validation of gene therapy vectors for AP4B1 gene replacement. (A) Schematic diagram of the designed and pre-transfected AAV and LV. (B) Representative Western blots of control (WT) or AP4B1-knockout (KO) HeLa cell lysates after transfection with plasmids expressing GFP (+GFP) or hAP4B1 (+AAV-hAP4B1). Expression of hAP4B1 in the KO cell line rescues the loss of AP4B1 protein expression. Restoration of AP4B1 expression also restores AP4E1 subunit protein expression to WT levels. (C) Validation of AAV-expressed V5-tagged AP4B1 in AP4B1- / - HeLa cells. (D) Non-transgenic rat cortical neurons stained with primary antibodies for the cortical neuron markers MAP2 (red channel) and V5 (green channel) after 10 days of treatment with either 300,000 vg / cell AAV9-V5_hAP4B1. (E) Representative Western blots of both non-diseased control fibroblasts (Ctrl) and SPG47 patient fibroblasts untreated (UT) and treated with increasing amounts of LV-V5_hAP4B1, showing restoration of hAP4B1 expression in the patient mutant (left of dashed line). Representative Western blots of non-transgenic rat cortical neurons treated with 400,000 vg / cell AAV9 viral vectors: AAV9-V5_SPG47(hAP4B1), AAV9-SPG47(hAP4B1), AAV9-GFP, and non-transduced cells. [Figure 3]Use of ATG9A as a readout to evaluate the efficacy of AP4B1 gene replacement. (A) Diagram of ATG9A mislocalization to the trans-Golgi network (TGN) in a CRISPR-generated Hela knockout cell model. (B) Mislocalization of ATG9A in AP4B1- / - Hela cells is restored after transfection with an AAV9 construct encoding AP4B1. Representative Western blots of LV-transduced patient cells show restoration of hAP4B1 expression and detection of the V5 tag (C), quantified in (D). Transduced patient cells also show restoration of ATG9A expression (E), quantified in (F). Data are presented as mean ± standard error of the mean (SEM), n = 3. Data were analyzed by one-way ANOVA followed by Dunnett's post hoc multiple comparison test relative to control. Stars indicate p ≤ 0.05 (*), p < 0.0001 (****), ns = not significant. (G) Lentiviral vector (LV)-mediated correction of ATG9A mislocalization in primary fibroblasts from SPG47 patient. SPG47 patient cells marked with a white asterisk show recovery of mislocalized ATG9A after treatment with LV-V5_hAP4B1. [Figure 4](A) Quantification of mouse Ap4b1 (pink) and human AP4B1 (green) mRNA by RT-qPCR in brain tissue 4 weeks after intracisternal injection of AAV9_CBh_hAP4B1 (UT-naive, n = 3; AAV_CBh_hAP4B1, n = 5). (B) Quantification of viral genome copy number by qPCR in various CNS and peripheral tissues 4 weeks after intracisternal injection of 2 × 10 vg of AAV9_CBh_hAP4B1 viral vector (UT-naive, n = 3; AAV_CBh_hAP4B1, n = 5). (C) Pilot safety in vivo study in wild-type mice. Body weight and rotarod measurements of wild-type mice 4 weeks after intracisternal injection of 2 × 10 vg of AAV_CBh_hAP4B1 or AAV_CBh_GFP viral vector. The number of groups, N, is indicated in parentheses. (D and E) Pilot safety in vivo study in wild-type mice. Body weight and rotarod measurements of wild-type mice 6 months after intracisternal injection of 2 × 10 vg of AAV_CBh_hAP4B1 or AAV_CBh_GFP viral vectors. N = 8 (UT), 10 (hAP4B1 / GFP). [Figure 5]Characterization of the Ap4b1- / - mouse model. (A) Histograms showing rotarod assessment of wild-type (WT) and Ap4b1-knockout (Ap4b1- / -) mice, displayed as the latency to fall in seconds at various times. Data are presented as mean ± standard error of the mean (SEM), n = 16 per group, except for Ap4b1(- / -) at day 242, where n = 15. Data were analyzed by Student's t-test relative to WT. Stars indicate p ≤ 0.05 (*), p < 0.01 (**). (B) Open-field behavioral assessment of Ap4b1-knockout (Ap4b1- / -) compared to wild-type (WT) mice at 6, 9, and 12 months of age. Data are presented as mean ± standard error of the mean (SEM), where n is variable for all groups and time points as the study progresses. Data were analyzed by one-way ANOVA, where each group was compared to the other groups, followed by Tukey's post-hoc multiple comparison test. Stars indicate p≦0.05 (*). (C) Forepaw base of support measured by CatWalk assessment at 3 and 6 months of age. Data analyzed by two-way ANOVA with Sidak's post-hoc multiple comparison test. Asterisks indicate p<0.01 (**), p<0.001 (***). (D) Gait analysis [Figure 6] (A) Images demonstrating the hugging phenotype observed in Ap4b1(- / -) mice with their hindlimbs drawn medially toward the midline. (B) Histogram showing the presence of the hugging phenotype in wild-type (WT) and Ap4b1-knockout (Ap4b1- / -) mice at different time points. Data are presented as the number of mice in each group that exhibit or do not exhibit the hugging phenotype after tail suspension. The percentage of mice in each group that are positive for hindlimb hugging is shown above. n = 16 per group, except for Ap4b1(- / -) mice at day 270, where n = 15. [Figure 7]Coronal MRI images show reduced corpus callosum thickness in Ap4b1-ko (Ap4b1- / -) mice compared to wild-type mice (A). Thickness in μm is quantified in (B). Preliminary data are presented as mean ± SD. Measurements are from four slices per mouse taken in corresponding brain regions. Representative images from H&E-stained coronal brain sections confirm the MRI findings (C). Measurements of corpus callosum thickness are from multiple slices per mouse taken in corresponding brain regions. Thickness in μm is quantified in (D). Data are presented as mean ± SD. Scale bar = 1 mm; 250 μm. Images and analysis were performed using NanoZoomer Digital Pathology software (Hamamatsu). [Figure 8] The status of the AP4 complex in AP4B1 knockout mice, including ATG9A and AP4E1 protein levels, was assessed in brains collected from homozygous Ap4b1- / - (HZ) and wild-type (WT) mice. Increased ATG9A levels were observed in Ap4b1- / - compared to WT mice, a phenotype also observed in human cell models, including human patient fibroblasts and iPSC-derived neurons. Another important observation was the depletion of AP4E1 units in AP4b1- / - compared to WT mice. The same observation has been reported in a cell model system, SPG47, containing human cells isolated from AP4 patients. [Figure 9] Weight gain in AAV9-hAP4B1-treated Ap4b1- / - mice. Group averages for untreated wild-type mice (black), untreated AP4b1- / - mice (blue), and Ap4B1- / - mice treated with intracisternal injection of 5 x 1013 gc / kg AAV9-hAP4B1 on postnatal day 1 (red). Females and males are plotted separately. [Figure 10] AAV9-hAP4B1 therapeutic response by hug assay. Cohorts ranging from n=6 to n=15. Either wild-type or Ap4b1- / - knockout mice were assessed for hug reflex at 2, 3, and 9 months of age, and the positivity rate for hugs is plotted (red). Low dose = 2 x 1013 gc / kg, high dose = 5 x 1013 gc / kg. [Figure 11] Effect of cisternal administration of AAV9-hAP4B1 on latency in the rotarod test. Group means for untreated wild-type mice (black), untreated AP4b1- / - mice (blue), and AP4B1- / - mice treated with intracisternal injection of 5 x 1013 gc / kg AAV9-hAP4B1 on postnatal day 1 (red). Females and males are plotted separately. [Figure 12] AP4 complex status in AP4B1 knockout mice. AP4E1 protein levels were restored in spinal cord (A) and heart (B) collected from homozygous Ap4b1- / - (HZ) and wild-type (WT) mice. [Figure 13] The AP4B1 endogenous promoter sequence and primers are described. [Figure 14] GFP expression in HeLa cells under the control of MeP229, AP4, and hSyn promoters. The term "mock" refers to a control without GFP expression. As shown, expression under all three promoters was detected. Experiments were performed using three replicates for each sample. Data are presented as mean ± SD. [Figure 15] Annotated sequence showing TSS positions (uppercase) and minimal promoter regions (underlined). GC-Box regions frequently found in promoters and regulatory sequences are shown in bold. PolII chip-seq target regions (italics) are also highlighted.

[0093] Materials and Methods Ethics Statement All animal in vivo experiments were approved by the University of Sheffield Ethical Review Sub-Committee and the UK Animal Procedures Committee (London, UK) and were carried out in accordance with the Animals (Scientific Procedures) Act 1986 under Project Licence 40 / 3739. C57BL / 6J-Ap4b1 em5Lutzy / J mice and non-transgenic C57BL / 6J mice were maintained in a controlled facility on a 12-h dark / 12-h light cycle (on at 7 AM / off at 7 PM) with free access to food and water. The ARRIVE guidelines were followed in reporting this study.

[0094] Viral vector construction The original pAAV2 vector backbone was published by Laughlin et al. (1983). The CBh promoter contains a hybrid intron region. 4 was amplified by PCR from the pTRS-KS-CBh-eGFP plasmid provided by Dr. S. Gray and cloned into the MluI and EcoRI sites of the pAAV_CMV_MCS construct after removal of the CMV promoter by restriction digestion. The full-length hAP4B1 cDNA was kindly provided by Dr. J. Hirst. 5 The hAP4B1 cDNA sequence was transferred into pAAV-CBh-MCS by PCR amplification and ligation from the pLXIN-SPG47 plasmid provided by Dr. K. de Vos. The hAP4B1 cDNA sequence was cloned between the SalI and HindIII sites of the pAAV_CBh_MCS plasmid. A separate epitope-tagged construct (pAAV_CBh_V5-hAP4B1) was created to enable detection of hAP4B1 protein expression by ICC. A linkerless N-terminal V5 epitope tag was inserted immediately downstream of the hAP4B1 Kozak sequence by Q5-mediated site-directed mutagenesis using a sequential primer strategy designed for large inserts. To investigate gene transfer in human fibroblast cell lines, the V5-hAP4B1 transgene sequence was subcloned into the pLenti_PGK_MCS_Vos lentiviral backbone (provided by Dr. K. de Vos) downstream of the PGK promoter by restriction digestion (SalI / NotI, XhoI / NotI).

[0095] pCMV3-AP4S1 was purchased from Sino Biological. Full-length human untagged AP4S1 was transferred to pAAV_CBh_MCS by PCR amplification from pCMV3-AP4S1, introducing AgeI and XbaI restriction sites onto the 5' and 3' ends of hAP4S1, respectively. The hAP4S1 cDNA product was then cloned between the AgeI and XbaI sites of the pAAV_CBh_MCS plasmid.

[0096] In addition to the construct using the strong constitutive CBh promoter to drive gene expression, three additional putative expression vectors were generated containing weaker promoters hypothesized to express the hAP4B1 transgene at levels closer to those found endogenously. The promoters were MeP229 (derived from a core fragment of the endogenous Mecp2 gene promoter and amplified by PCR from the pSJG-MeP229-GFP plasmid received as a gift from Dr. S. Gray), hSyn (the neuron-specific human synapsin 1 gene promoter cloned by restriction digestion-ligation from scAAV-SYN1-GFP, a construct originally published by Lukashchuk and colleagues), and hSyn (the neuron-specific human synapsin 1 gene promoter cloned by restriction digestion-ligation from the scAAV-SYN1-GFP construct). 6 ), and AP4B1_endo (a putative endogenous promoter containing a region approximately 600 bp upstream of the hAP4B1 gene transcription start site. This region was identified in silico as a potential promoter region due to its genomic location, the presence of a CpG island, and the presence of a CCCTC-binding factor (CTCF)-binding region, a known transcriptional activator. 7 ) All three promoters were cloned into pAAV_MCS_KanR between the MluI and EcoRI sites by restriction ligation. AP4B1_endo was amplified by PCR from human genomic DNA extracted from HEK293 cells.

[0097] To serve as a negative control for the V5-tagged hAP4B1 construct, only the V5 epitope was PCR amplified from the pCIneo_V5-N vector (a gift from Dr. K. de Vos) and cloned into the XbaI site of pAAV_CBh_MCS. The eGFP transgene from pTRS-KS-CBh-GFP was cloned into the pAAV_CBh_MCS vector by restriction digestion between the AgeI / BamHI sites to generate the GFP expression control vector (pAAV_CBh_eGFP).

[0098] Initial Safety Study - Cisternal Delivery of Viral Gene Therapy Constructs in P1 Mice

[0099] Postnatal day 1 (P1) wild-type C57Bl / 6J mice were anesthetized with isoflurane. Induction occurred in a chamber at 5% isoflurane and 3 L O2 / min. Anesthesia was maintained via a mask at 1-2% isoflurane and 0.3 L O2 / min for approximately 5 minutes during injection. The cisterna magna was localized using a Wee-Sight transilluminator vein finder (Phillips). Viral vectors (pAAV_CBh_hAP4B1 and pAAV_CBh_eGFP) were injected directly into the cisterna magna of P1 mice (n = 15 per group) using a stereotaxic apparatus containing a 33-gauge Hamilton syringe with an automated perfusion pump. The solution was administered at a flow rate of 1 μL per minute, and the maximum volume of administered solution was 5 μL per animal. Animals were each administered a total of 5 × 10 10 The experimental schedule proceeded as follows: Day 1 - Postnatal Day 0, birth day (P0) - Footpad tattoos were applied for identification purposes. Day 2 - Postnatal day 1 (P1) - Injection of up to 5 μL of viral vector or vehicle solution into the cisterna magna under isoflurane anesthesia. On day 29 (or day 170)—postnatal day 28 (P28) or P168 (6 months post-injection)—animals were perfused under terminal anesthesia, and tissue samples were collected for analysis.

[0100] Cisternal delivery of viral gene therapy constructs in P1 mice as proof of concept

[0101] Endogenous Ap4b1 (KO C57BL / 6J-Ap4b1) was expressed after injection via the cisterna magna. em5Lutzy A study was conducted to evaluate the ability of our therapeutic viral vector (pAAV_CBh_hAP4B1) to mediate transgene expression in the central nervous system (CNS) of transgenic mice lacking the human AP4B1 (SPG47) gene. Mice were injected via the cisterna magna as in the previously described safety study. Two viral vectors were used: AAV9 expressing a full-length copy of the human AP4B1 (SPG47) gene, and AAV9 expressing a V5 tag with no additional coding sequence as a viral control. Mice receiving the AAV9-hAP4B1 viral vector were administered two different doses (2 × 10 10 low doses of vector genomes, and 4 x 10 10 mice receiving AAV9-V5 were injected with a high dose (4 × 10 vector genomes), whereas mice receiving AAV9-V5 were injected with a high dose (4 × 10 10 Two additional groups were injected: untreated KO C57BL / 6J-Ap4b1 mice and untreated KO C57BL / 6J-Ap4b1 mice. em5Lutzy / J and untreated WT C57BL / 6J-Ap4b1 em5Lutzy / J were included in the study. Phenotypic reversal was assessed by improvement in behavioral parameters, described in detail below, in treated mice compared to untreated mice.

[0102] Genotyping and colony maintenance C57BL / 6J-Ap4b1 em5Lutzy / J mice were generated by Jackson Labs using CRISPR-Cas9-mediated deletion of a 76 bp region within exon 1 of the mouse Ap4b1 gene. Deletion of this region generated a frameshift mutation and a truncated mRNA transcript. WT sequence (deletion in lowercase): TTGGCGACGATGCCATAccttggctctgaggacgtggtgaaggaactgaagaaggctctgtgtaaccctcatattcaggctgataggctgcgcTACCGGAATGTCATCCAGCGAGTTATTAGGTATCACCAACCTACCATAGAA (SEQ ID NO: 9).

[0103] Mouse genotyping was performed based on a protocol optimized by Charles River Laboratories. Mouse genotyping was performed on genomic DNA extracted from tail or ear tissue by adding 20 μl of QuickExtract™ DNA extraction solution (Lucigen) and incubating in a thermocycler at 65°C for 15 minutes, followed by 98°C for 2 minutes. Genotyping PCR was performed in separate 20 μl volume reactions for the WT and KO alleles. Reactions consisted of 5 μl of 5x FIREPol® Master Mix Ready to Load with 7.5 mM MgCl2 (Solis Biodyne), 500 nM each of genotyping primers: P1+P2 for wild-type allele amplification and P1+P3 for KO allele amplification (P1: 5'-TCGCCCGAGGACCCAAGAA-3' (SEQ ID NO: 10), P2: 5'-CCTATCAGCCTGAATATGAGGGTTACA-3' (SEQ ID NO: 11), P3: 5'-GCTGGATGACATTCCGGTATATG-3' (SEQ ID NO: 12)), and 1 μl of genomic DNA from the QuickExtract™ protocol. Touchdown PCR was performed according to the thermal profile shown in Table 1. Following PCR and agarose gel electrophoresis (2% agarose gel in Tris-acetate-EDTA buffer), the WT and KO allele PCR products were visualized at approximately 254 bp and 203 bp, respectively.

[0104] Heterozygous mice were bred together to produce homozygous WT (Ap4b1+ / +), KO (Ap4b1- / -), and heterozygous (Ap4b1+ / -) littermates. Table 1-C57BL / 6J-Ap4b1 em5Lutzy Touchdown PCR conditions for / J genotyping [Table 1]

[0105] RT-qPCR for analysis of AP4B1 expression in humans and mice RT-qPCR was performed using a total of 2 μl of RNA diluted to a concentration of 10 ng / l in nuclease-free water, 5 μl of 2x QuantiFast SYBR Green RT-PCR Master Mix (Qiagen®), hAP4B1 (forward: 5′-CTGGTGAACGATGAGAATGT-3′ (SEQ ID NO: 13), reverse: 5′-GACCCAGCAACTCTGTTAAA-3′ (SEQ ID NO: 14)), mAp4b1 (forward: 5′-CTGTGCTAGGCTCCCACATC-3′ (SEQ ID NO: 15), reverse: 5′-TGGCACTGGCCTTTACCATT-3′ (SEQ ID NO: 16)), and 18S (forward: 5′GTAACCCGTTGAACCCCAT 3′ (SEQ ID NO: 17), reverse: 5′CCATCCAATCGGTAGTAGCG 3′ (SEQ ID NO: 18)) primers (all at 1 M concentration), 0.1 μl of QuantiFast The RT-qPCR was performed using the RT mixture and HO to a final volume of 10 μl. Following an initial reverse transcription step at 50°C for 10 min and a denaturation step at 95°C for 5 min, the cDNA was amplified by 39 cycles of 95°C for 10 s, followed by a combined annealing / extension step at 60°C for 10 s. This was followed by one cycle at 65°C for 31 s before subsequent melting curve analysis. All RT-qPCR was performed on a Bio-Rad C1000 Touch™ thermal cycler. Bio-Rad CFX Manager software was used to analyze signal intensity, and relative gene expression values ​​were determined using the ΔΔCt method, with 18S rRNA used as the reference gene.

[0106] Open field Open field assays were performed on mice at 6, 9, and 12 months of age. The protocol was adapted from Herranz-Martin and colleagues. 8The method used was based on that performed by

[13] . Mice were placed in a translucent box measuring 60 cm x 40 cm x 25 cm. The bottom of the box was marked with permanent ink outlining a 5 x 3 grid of squares. Activity was measured as the number of grid lines crossed by each mouse over a 10-minute period. For a crossing to be recorded, all four paws of the animal had to cross a grid line. Assessments were performed under minimal lighting conditions, and the apparatus was cleaned with 70% ethanol between each animal. One run was recorded for each animal at each time point.

[0107] rotarod An Ugo Basile 7650 accelerating rotarod (set to accelerate at 3-37 rpm for 300 seconds) was used to measure motor function. Rotarod training was performed for three consecutive days with two trials per day. The test was then conducted in the late morning at intervals of once every two weeks (characterization studies) or once a month (proof-of-concept studies). For each assessment, mice were tested twice with a minimum of a 5-minute rest period between runs. The best performance, measured as the latency to fall in seconds, was used for analysis. The minimum threshold for recording rotarod activity was 3 seconds.

[0108] Gait analysis The CatWalk™ Gait Analysis System version 7.1 was used to evaluate gait parameters of Ap4b1-KO and WT mice. Mice were tested at 3, 6, 9, and 12 months of age. Mice were placed on the apparatus in complete darkness, and their gait patterns were recorded. Six unforced runs were recorded for each mouse, and three were selected for analysis. Runs to be analyzed were selected based on the absence of behavioral abnormalities, such as sniffing, exploration, and rearing, as well as if the mouse's movement was consistent and there was no significant acceleration, deceleration, or deviation from a straight line. Gait data processing was performed using Noldus software. Limbs were manually assigned, and gait parameters were automatically calculated. Parameter values ​​were transferred to GraphPad Prism for statistical analysis.

[0109] antibody The primary antibodies used in this study were mouse anti-α-tubulin (1:5000, Sigma), mouse anti-GAPDH (1:10,000, Millipore), rabbit anti-V5 (1:1000, Abcam), rabbit anti-β4 (in-house non-commercial antibody provided by J. Hirst) (1:400), rabbit anti-ATG9A (1:1000, Abcam), sheep anti-TGN46 (Bio-Rad), and anti-MAP2.

[0110] Protein extraction and Western blotting for protein expression analysis

[0111] Tissues were collected from mice under terminal anesthesia and flash-frozen in liquid nitrogen. Tissues were homogenized using a Dounce homogenizer in ice-cold RIPA buffer (50 mM Tris-HCl (pH 7.4), 1% v / v NP-40, 0.5% w / v sodium deoxycholate, 0.1% v / v SDS, 150 mM NaCl, 2 mM EDTA) containing 1x protease inhibitor cocktail (Sigma-Aldrich). Lysate protein concentration was determined using the BCA assay (Thermo Scientific Pierce™). Forty micrograms of protein lysate was denatured by heating to 100°C for 5 minutes in the presence of 4x loading buffer (10 ml of buffer containing 240 mM Tris-HCl (pH 6.8), 8% w / v SDS, 40% glycerol, 0.01% bromophenol blue, and 10% β-mercaptoethanol). Lysates intended for quantification of ATG9A protein levels were heated to 50°C because boiling leads to aggregation of ATG9A and loss of signal. The lysates were then loaded onto a 4-20% gradient mini-PROTEAN® TGX™ precast polyacrylamide gel (Bio-Rad). The gel was run at 180V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3) for approximately 50 minutes or until the dye front reached the bottom of the gel. The separated proteins were electrophoretically transferred to an Immobilon-P PVDF membrane (Millipore) presoaked in methanol. Protein transfer was performed in transfer buffer (25 mM Tris, 192 mM glycine, 5% v / v methanol) at 250 mA for 1.5 hours or at 40 mA overnight. The membrane was blocked in 5% milk / TBS-T for 1 hour. Primary antibodies were diluted in 5% milk / TBS-T or 5% BSA / TBS-T and incubated with the membrane overnight at 4°C. After primary antibody incubation, the membrane was washed three times for 15 minutes in TBS-T buffer. Secondary antibodies, anti-mouse HRP (1:3000) and anti-rabbit HRP (1:3000), were diluted in 5% milk / TBS-T and incubated with the membrane at room temperature for 2 hours.After secondary antibody incubation, the membrane was washed three times for 15 min in TBS-T buffer, followed by a final 15-min wash in PBS. Protein bands were visualized using ECL Prime Western Blotting Detection Reagent (Amersham) and a G-Box imaging system (Syngene). Densitometric analysis of the protein bands was performed using Image J software.

[0112] Western blotting was performed using the following protocol. Cell lysates were extracted as described above. 40 μg of protein was loaded per lane on a 10-well 4-12% Bis-Tris precast gel. The gel was run in 2-(N-morpholino)ethanesulfonic acid (MES) buffer and wet transferred to a nitrocellulose membrane (100 mA constant amperage overnight). The membrane was blocked for 1 hour in 5% milk / TBS-T. The primary antibody was added (anti-AP4B1 at 1:400 in 5% BSA) for 2 hours at room temperature, followed by four 15-minute washes in PBS-T. The secondary antibody was added in 5% milk / TBS-T for 30 minutes at room temperature. The membrane was washed five times for 5 minutes in PBS-T, followed by a 30-minute wash in PBS. The membrane was developed using ECL Prime Western Blotting Detection Reagent (Amersham).

[0113] cell culture Human embryonic kidney (HEK) 293T cells, HeLa-M / HeLa-AP4B1 - / - Cells (gift from Dr. J. Hirst) and human fibroblast cell lines were cultured at 37°C and 5% CO in growth medium consisting of Dulbecco's modified Eagle's medium (DMEM, Sigma) supplemented with 10% v / v fetal bovine serum (FBS, Sigma, MI, US) and 1% v / v penicillin (100 U / ml) and streptomycin (100 U / ml) (Lonza, Basel, Switzerland).

[0114] For primary cortical neuron culture, E18 non-transgenic rat embryos and E16 mouse embryos were transfected with wild-type and C57BL / 6J-Ap4b1 mice essentially as described by (Krichevsky et al., 2001). em5Lutzy C57BL / 6J-Ap4b1 mice were collected from pregnant C57BL / 6J mice. em5Lutzy C57BL / 6J / J mice and non-transgenic C57BL / 6J mice were maintained in a controlled environment under a 12-h dark / 12-h light cycle (on at 7 AM / off at 7 PM) with free access to food and water. Dissociated cortical neurons were then seeded onto poly-D-lysine (Sigma)-coated plates and maintained in Neurobasal medium (Life Technologies) supplemented with 2% B27 (Life Technologies), 0.5 mM GlutaMax (Life Technologies), 100 U / ml penicillin, and 100 μg / ml streptomycin (Lonza).

[0115] AP4B1 knockout HeLa cells (HeLa-AP4B1 - / - ) was provided by Dr. J. Hirst, and its production was 9 is described in.

[0116] AP4B1-deficient human fibroblasts from patient SPG47, heterozygous family members, and age-matched homozygous wild-type controls were kindly provided by Dr. Henry Houlden and Dr. Ivy Pin-Fang Chen.

[0117] Production of plasmid and viral constructs for off-target effect analysis The AAV2-ITR transgene transfer plasmid constructed as described above was amplified in NEB Stable e. coli cells (New England Biolabs) and purified using the Qiagen Plasmid Plus kit. The adenovirus helper gene (pHelper) and Rep-Cap gene (pAAV2 / 9) were supplied in trans and commercially obtained through the Plasmid Factory. The pseudotyped AAV9 viral vector was 6 It was produced in-house according to the protocol described in.

[0118] In vitro viral vector validation HeLa-M cells and HeLa-AP4B1 - / - Cells were transduced 24 hours after plating with the viral vector mixed with normal growth medium. Cells were incubated with the virus for 3 days before being harvested for analysis.

[0119] Fibroblasts were transduced at a multiplicity of infection (MOI) of 20 lentiviral particles per cell, and cells were harvested 72 hours after transduction.

[0120] Wild type and C57BL / 6J-Ap4b1 em5Lutzy Primary non-transgenic rat and mouse cortical neurons harvested from / J mice were transduced with 300,000 vector genomes of the viral vector 3 days after seeding. Cells were harvested 10 days after transduction for ICC and Western blot / qPCR analysis of AP4B1 / V5-AP4B1 and ATG9A expression.

[0121] Vector Map Table 2: hSYN1-hAP4B1 (SEQ ID NO: 19) A. Vector Overview [Table 2] B. Vector Components [Table 3]

[0122] Table 3: CBh-hAP4B1 (SEQ ID NO: 20) A. Vector Overview [Table 4] B. Vector Components [Table 5]

[0123] Table 4: SYN 1hAP4S1-3'UTR (SEQ ID NO: 21) A. Vector Overview [Table 6] B. Vector Components [Table 7]

[0124] Table 5: MeP229hAP4S1 (SEQ ID NO: 22) A. Vector Overview [Table 8] B. Vector Components [Table 9]

[0125] Table 6: MeP229hAP4E1 (SEQ ID NO: 23) A. Vector Overview [Table 10] B. Vector Components [Table 11]

[0126] Table 7: SYN1hAP4E1 (SEQ ID NO: 24) A. Vector Overview [Table 12] B. Vector Components [Table 13]

[0127] Example 1 The size of the human AP4B1 cDNA open reading frame (2,800 bp) means that simple gene replacement options are technically feasible and amenable to typical viral delivery approaches, such as using single-stranded adeno-associated virus (AAV) with an insertion limit of approximately 4,000 bp. We designed an AAV vector to achieve the strongest level of transgene expression (Figure 2A): 1) An expression cassette was developed with a 0.8 kb CBh promoter and a 130 bp SV40 polyA to drive the expression of human AP4B1. The CBh promoter has been reported to mediate efficient transgene expression in rodents and non-human primates. 2) a vector expressing an N-terminal V5 viral epitope-tagged human AP4B1 cDNA, enabling in vitro and in vivo detection of AP4B1 restoration in the absence of a suitable anti-AP4B1 antibody; and 3) a V5-tagged AP4B1 construct expressed from a lentiviral vector, enabling in vivo validation in cell types not efficiently transduced by AAV9 (e.g., fibroblasts). All constructs have been shown to efficiently express their viral cargo upon transfection or transduction in HeLa cells (Figure 2B, C), primary rat cortical neurons (Figure 2D), and human fibroblasts (Figure 2E), as determined by Western blotting, RT-qPCR, and immunocytochemistry. The viral constructs efficiently restored AP4B1 protein expression in both a CRISPR-generated AP4B1-knockout HeLa cell line and fibroblasts derived from SPG47 patient, which lacks endogenous AP4B1 (Figure 2B, C, E). Expression of V5-tagged AP4B1 in SPG47 patient fibroblasts also rescues both the overexpression and mislocalization of ATG9A (Fig. 3 ).

[0128] Example 2 Intrathecal delivery of AAV9 viral vectors (AAV9-AP4B1, AAV9-V5-tagged AP4B1, or AAV9-GFP) via the cisterna magna of wild-type C57BL6 / J mice resulted in widespread transduction of multiple tissues, including the brain, as described in our previous study (Figure 4A, B). A long-term pilot safety study in wild-type mice treated with AAV9-AP4B1 showed no obvious adverse effects on body weight, motor function, or clinical observations up to 6 months of age (Figure 4C-E).

[0129] Example 3 In conjunction with the development of therapeutic viral vectors, the generation of a CRISPR-based Ap4b1-knockout (EM5 Ap4b1- / -) mouse strain was outsourced to the Jackson Laboratory and then transferred to SITraN in Sheffield for full characterization. Phenotypic characterization of the strain revealed that the EM5 Ap4b1- / - strain exhibited consistent and progressive motor deficits, as demonstrated by rotarod, open field, and CatWalk paw print tests (Figure 5A-C), as well as hugging (Figure 6). Preliminary MRI analysis revealed that the thinner corpus callosum of EM5 Ap4b1- / - mice compared to wild-type mice is a clinically relevant phenotype, as the same pathological phenotype has been reported in SPG47 patients (Figure 7A, B). This observation was confirmed by H&E staining (Figure 7C, D). Further analysis of the MRI studies is ongoing to assess other readouts such as overall size of the lateral ventricles and changes in white matter volume, phenotypes previously reported in AP4E1- / - and human AP4 cases.

[0130] The SPG47 mouse model was generated by Jackson labs (Bar Harbor, ME): C57BL / 6J-Ap4b1 em5Lutzy The C57BL / 6J / J model (stock number 031349) contains a mutant Ap4b1 gene with a 76-bp deletion in exon 1. em4LutzyThe / J model (stock number 031062) contains a 78-bp deletion plus a 1-bp deletion in exon 1 of the mouse Ap4b1 gene. Neither mutation is known to be pathogenic in humans, but they are predicted to generate a frameshift leading to an early nonsense mutation. This strain was developed using CRISPR / Cas9 technology and mutagenic oligonucleotides. A plasmid encoding a signal-guide RNA designed to introduce a 76-bp deletion within exon 1 of the Ap4b1 gene and Cas9 nuclease were introduced into cytoplasmic C57BL / 6J-derived zygotes with fully differentiated pronuclei. Correctly targeted embryos were transferred into pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further bred in C57BL / 6J mice to develop colonies. PCR genotyping allows for the identification of wild-type, heterozygous, and homozygous knockout mice.

[0131] Further characterization of the model was performed by the Azzouz laboratory at the University of Sheffield. RT-PCR and qRT-PCR showed very low levels of Ap4b1 mRNA in mutant mice, consistent with nonsense-mediated decay. Western blots showed the absence of a cross-reactive band of approximately 85 kDa that is normally expressed at various levels in the brain, muscle, spinal cord, liver, and heart of wild-type mice.

[0132] The em5lutzy strain has been investigated in more detail. While weight gain in wild-type and Ap4b1- / - female mice was similar, weight gain in male Ap4b1- / - mice was slower than in male wild-type mice, with significantly lower body weight at >6 months of age. Several behavioral assessments were performed, including gait analysis, hugging, open-field testing, and rotarod performance (Figures 5 and 6). All of these demonstrated deficits in Ap4b1- / - mice. Gait analysis showed that the hindlimb paw angle was abnormally wider in mutant mice compared to wild-type mice (Figure 5D). In hugging assays, mutant mice had a higher hugging rate at all ages compared to wild-type mice (Figure 6B). Open-field activity was comparable in wild-type and mutant mice at 6 months of age, but there was an age-dependent decrease in wild-type mice that was not present in mutant mice (Figure 5B). Rotarod testing demonstrated that the most consistent difference in latency to fall on the rotarod was approximately 15% lower at all ages tested, from 50 to 120 days of age (Figure 5A). Further characterization is underway by open-field activity monitoring, catwalk, hindlimb hugging, MRI, histopathology, ATG9A localization, and protein levels. Motor deficits are a key feature of the clinical manifestations of SPG47 / AP4B1 deficiency; therefore, these mouse phenotypes are directly relevant to human disease and are suitable markers for evaluating potential therapeutics.

[0133] Further morphological and histopathological studies of these Ap4b1- / - knockout mice are ongoing. Published studies of knockout mice for the Ap4e1 gene show a thin corpus callosum and axonal swellings in various regions of the brain and spinal cord. Immunohistochemical analysis showed that transmembrane autophagy-related protein 9A (ATG9A) is more concentrated within the trans-Golgi network (TGN) and depleted from the peripheral cytoplasm in both various neuronal types in Ap4e1- / - knockout mice. This leads to distal axonal swellings containing accumulated ER, defective autophagosomes, and axonal shortening, observable both in vitro and in vivo.

[0134] Proof of concept: Treatment of the SPG47 mouse model with intracisternal AAV9 Three studies have used young or neonatal mice and mouse C57BL / 6J-Ap4b1 em5Lutzy This was performed to evaluate the effects of intracisternal AAV9-hAP4B1 in the / J model.

[0135] cisternal injection in p1 mice Proof of concept was demonstrated in neonatal Ap4b1- / - mice. It was hypothesized that using neonatal mice would provide the greatest benefit for mitigating any onset of disease. The experimental design (1) included four cohorts of homozygous knockout mice treated with either two doses of the AAV9-HAP4B1 vector expressing the human cDNA for AP4B1, an empty vector expressing an epitope tag (AAV9-V5), or untreated. Positive controls were untreated wild-type mice.

[0136] AAV9 viral vector stocks were generated by transfecting adherent human embryonic kidney (HEK293T) cells and purifying the vector using iodixanol gradient centrifugation. Briefly, HEK293T cells were transfected with the packaging plasmid pHelper (Stratagene, Stockport, UK), pAAV2 / 9 (kindly provided by J. Wilson, University of Pennsylvania), and one of the transgene plasmids (e.g., AAV9-CBh-AP4B1) at a 2:1:1 ratio using polyethyleneimine (1 mg / ml) in serum-free Dulbecco's modified Eagle's medium. Three days after transfection, the supernatant containing the released virus was collected, treated with benzonase (10 units / ml, Sigma, Poole, UK) for 2 hours at 37°C, and concentrated to the equivalent of approximately 24 ml using an Amicon Ultra-15 Centrifugal 100K filter (Millipore, Watford, UK). Iodixanol gradients containing 15, 25, 40, and 54% iodixanol solutions in phosphate-buffered saline (PBS) / 1 mmol / L MgCl2 / 2.5 mmol / L KCl and virus solution were loaded and centrifuged at 69,000 rpm for 90 minutes at 18°C. After ultracentrifugation, virus fractions were visualized on a 10% polyacrylamide gel and stained using SYPRO Ruby (Life Technologies, Paisley, UK) according to the manufacturer's guidelines. The purest fractions (identified by the presence of three bands corresponding to VP1, VP2, and VP3) were pooled and further concentrated using an Amicon Ultra-15 Centrifugal 100K filter in a final formulation buffer consisting of PBS supplemented with 35 mmol / L NaCl. Virus titers were determined by quantitative PCR assay. Table 1. Study design for P1 mouse efficacy experiments 1 [Table 14] 1. Assessments included general observation, weight and accelerating rotarod tests every 3 weeks, and open field, hug, and catwalk tests at 3-monthly intervals.

[0137] No mortality was observed for any mice in either of these cohorts. Weight gain was assessed every 2 weeks, with a clear pattern of slower weight gain by untreated Ap4b1- / - mice of either sex compared with wild-type controls (Figure 9). Neonatal injection of high-dose AAV9-hAP4B1 restored weight gain in males to the level of wild-type mice, while it had no effect on weight gain in female mice.

[0138] Phenotype was assessed by hugging assay, in which mice with specific neurological deficits (but not wild-type mice) hug their limbs when suspended by their tails. The data (Figure 10) clearly show an age-dependent increase in hugging responses, with 83% of knockout mice exhibiting a hugging response compared with 7% of wild-type controls at 9 months of age (p<0.001, chi-square test). Treatment of knockout mice with a high dose of AAV9-hAP4B1 vector significantly reduced hugging responses at 9 months (p<0.01), although responses did not reach the level of wild-type mice (p<0.0001). In contrast, the control vector AAV9-CBH-V5 had no effect on hugging responses. Furthermore, the use of a low dose of AAV9-hAP4B1 did not show any effect; age-dependent hugging was comparable to that of untreated Ap4b1- / - mice, suggesting that the target dose was at least 5x10 13 It was suggested that the concentration was gc / kg.

[0139] Phenotypes were also assessed by accelerating rotarod (Figure 11) at 4-week intervals. As with weight gain, the data are more clearly understood when considering male and female mice separately. For male mice, there was a clear improvement in performance of high-dose AAV9-hAP4B1-treated knockouts, bringing them to a level comparable to that of age-matched wild-type mice. For female mice, knockouts showed no defects in rotarod performance and therefore likely did not respond to intracisternal AAV-hAP4B1 delivery. We note that substantial differences in performance between male and female mice are known in both wild-type mice

[12] and mouse models of neurological disorders, including GNAO1

[13] , ALS [14, 15], and Alzheimer's disease

[16] .

[0140] Performance was also assessed by overall activity in an open field test in a subset of mice. By this measure, there were clear differences between wild-type and knockout mice, but no effect of treatment on activity. Similar patterns were seen in both male and female cohorts.

[0141] The status of the AP4 complex was assessed by measuring AP4E1 levels (Figure 12). An important observation was that AP4b1 was significantly lower in WT mice compared to AP4E1. - / - The depletion of the AP4E1 unit of the AP4 complex in AP4B1 / - mice was observed in a cellular model system of SPG47, including human cells isolated from AP4 patients. AAV9-AP4B1 gene transfer increased AP4E1 levels in the spinal cord (Fig. 12A) and heart (Fig. 12B) of AP4B1- / - mice, suggesting restoration of the AP4 complex (Fig. 13).

[0142] CM delivery in P1 wild-type mice: a pilot safety study The purpose of this pilot study was to evaluate the biodistribution, stability of viral-mediated transgene expression, and potential adverse effects of AAV9-hAP4B1 in wild-type mice (Figure 4). One viral vector expressing a full-length copy of the human AP4B1 gene containing an N-terminal V5 viral epitope tag will be used. The viral vector was delivered directly into the cisterna magna of P1 / 2 pups using a stereotaxic apparatus containing a 33-gauge Hamilton syringe with an automated perfusion pump. 5 μL of solution was administered at 1 μL / min. Viral biodistribution, expression, body weight, and motor function (rotarod) were assessed 4 weeks and 6 months after injection. Table 8. Sequence summary [Table 15]

[0143] References 1 Harvard SPG47 registry, managed by Dr. Darius Ebrahimi-Fakhari (accessed October 2020). 2 Bauer, P. et al.Mutation in the AP4B1 Gene Cause Hereditary Spastic Paraplegia Type47(SPG47).Neurogenetics 13,73-76,doi:10.1007 / s10048-012-0314-0.(2012). 3. Laughlin, CA, Tratschin, JD, Coon, H. & Carter, BJCloning of infectious adeno-associated virus genomes in bacterial plasmids.Gene 23,65-73(1983). 4.Gray,S.J.et al.Optimizing Promoters for Recombinant Adeno-Associated Virus-Mediated Gene Expression in the Peripheral and Central Nervous System Using Self-Complementary Vectors.Hum.Gene Ther.22,1143-1153(2011). 5.Davies,A.K.et al.AP-4 vesicles contribute to spatial control of autophagy via RUSC-dependent peripheral delivery of ATG9A.Nat.Commun.9,(2018). 6.Lukashchuk,V.,Lewis,K.E.,Coldicott,I.,Grierson,A.J.& Azzouz,M.AAV9-mediated central nervous system-targeted gene delivery via cisterna magna route in mice.Mol.Ther.-Methods Clin.Dev.3,15055(2016). 7.Kim,S.,Yu,N.K.& Kaang,B.K.CTCF as a multifunctional protein in genome regulation and gene expression.Exp.Mol.Med.47,e166(2015). 8.Herranz-Martin,S.et al.Viral delivery of C9orf72 hexanucleotide repeat expansions in mice leads to repeat-length-dependent neuropathology and behavioural deficits.Dis.Model.Mech.10,859-868(2017). 9.Frazier,M.N.et al.Molecular basis for the interaction between Adaptor Protein Complex 4(AP4)β4 and its accessory protein,tepsin.Traffic 17,400-415(2016). 10.Behne R,Teinert J,Wimmer M,D’Amore A,Davies AK,Scarrott JM,Eberhardt K,Brechmann B,Chen IP,Buttermore ED,Barrett L,Dwyer S,Chen T,Hirst J,Wiesener A,Segal D,Martinuzzi A,Duarte ST,Bennett JT,Bourinaris T,Houlden H,Roubertie A,Santorelli FM,Robinson M,Azzouz M,Lipton JO,Borner GHH,Sahin M,Ebrahimi-Fakhari D.Adaptor protein complex 4 deficiency:a paradigm of childhood-onset hereditary spastic paraplegia caused by defective protein trafficking.Hum Mol Genet.2020 Jan 15;29(2):320-334.doi:10.1093 / hmg / ddz310.PMID:31915823;PMCID:PMC7001721. 11.Ebrahimi-Fakhari D,Teinert J,Behne R,Wimmer M,D'Amore A,Eberhardt K,Brechmann B,Ziegler M,Jensen DM,Nagabhyrava P,Geisel G,Carmody E,Shamshad U,Dies KA,Yuskaitis CJ,Salussohilia-FEbrami,CL D,Pearson TS,Saffari A,Ziegler A,Kolker S,Volkmann J,Wiesener A,Bearden DR,Lakhani S,Segal D,Udwadia-Hegde A,Martinuzzi A,Hirst J,Perlman S,Takiyama Y,Xiromerisiou G,Will K,Walker W,App, Gullah, R.D. N,Aksoy A,Verhelst H,Delgado MR,Kremlikova Pourova R,Sadek AA,Elkhateeb NM,Blumkin L,Brea-Fernandez AJ,Dacruz-Alvarez D,Smol T,Ghoumid J,Miguel D,Heine C,Schlump JU,Langen J,H,Baetz, H,Backharvish,HD S,Kruer MC,Lim-Melia E,Aydinli N,Alanay Y,El-Rashidy O,Nampoothiri S,Patel C,Beetz C,Bauer P,Yoon G,Guillot M,Miller SP,Bourinaris T,Houlden H,Robelin L,Anheim M,Alamri AS,Ah,Mahmood S,Habizah,Habizah P,Faghihi MA,Jansen AC,Brock S,Roubertie A,Darras BT,Agrawal PB,Santorelli FM,Gleeson J,Zaki MS,Sheikh SI,Bennett JT,Sahin M.Defining the clinical,molecular and imaging spectrum of adaptor protein complex 4-associated hereditary spastic paraplegia.Brain.2020 Oct 1;143(10):2929-2944.doi:10.1093 / brain / awz307.PMID:32979048;PMCID:PMC7780481. 12.Orsini,C.A.and B.Setlow,Sex differences in animal models of decision making.J Neurosci Res,2017.95(1-2):p.260-269. 13.Feng,H.,et al.,Mouse models of GNAO1-associated movement disorder:Allele-and sex-specific differences in phenotypes.PLoS One,2019.14(1):p.e0211066. 14.McCombe,P.A.and R.D.Henderson,Effects of gender in amyotrophic lateral sclerosis.Gend Med,2010.7(6):p.557-70. 15.Watkins,J.,et al.,Female sex mitigates motor and behavioural phenotypes in TDP-43(Q331K)knock-in mice.Sci Rep,2020.10(1):p.19220. 16.Sala Frigerio,C.,et al.,The Major Risk Factors for Alzheimer’s Disease:Age,Sex,and Genes Modulate the Microglia Response to Aβ Plaques.Cell Rep,2019.27(4):p.1293-1306.e6.

Claims

1. 1. An isolated nucleic acid molecule comprising a transcription cassette for expression in a mammalian neuron, the transcription cassette comprising: i) the nucleotide sequence set forth in SEQ ID NO: 1 (AP4B1); ii) a nucleotide sequence that is degenerate as a result of the genetic code with respect to the nucleotide sequence defined in SEQ ID NO: 1 (AP4B1); iii) a nucleotide sequence encoding a polypeptide having at least 90% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 1 (AP4B1) and which forms a complex with a polypeptide comprising an AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 (AP4B1); and v) a nucleotide sequence encoding a polypeptide comprising amino acids having at least 90% sequence identity with the full-length amino acid sequence set forth in iv) above, and which forms a complex with a polypeptide comprising an AP-4 complex; and a nucleotide sequence selected from the group consisting of: A promoter adapted for expression in mammalian motor neurons, the promoter being the chicken beta-actin hybrid promoter (CBh) or the synapsin 1 promoter. An isolated nucleic acid molecule comprising:

2. An expression vector comprising the isolated nucleic acid molecule of claim 1.

3. The expression vector of claim 2 , wherein the expression vector is a viral-based vector.

4. The expression vector of claim 3 , wherein the viral-based vector is AAV9.

5. The expression vector of claim 3 , wherein the viral-based vector is a lentiviral vector.

6. 4. The expression vector of claim 3, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 19 (AP4B1).

7. 4. The expression vector of claim 3, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO: 20 (AP4B1).

8. The expression vector of claim 3 , wherein the viral-based vector further comprises a nucleotide sequence set forth in SEQ ID NO: 25 or 26.

9. A pharmaceutical composition comprising the expression vector according to any one of claims 2 to 8 and an excipient or carrier.

10. The expression vector according to any one of claims 2 to 8 for use as a pharmaceutical.

11. 9. The expression vector of any one of claims 2 to 8 for use in the treatment of AP-4-hereditary spastic paraplegia (AP-4-HSP).

12. The expression vector according to claim 11, wherein the AP-4-HSP is SPG47.