Pyrazolopyrimidinone compounds
Pyrazolopyrimidine compounds are developed to modulate steroidogenic factor 1 (SF-1) activity, addressing the lack of effective treatments for SF-1-related conditions like cancer and endocrine disorders by targeting SF-1-dependent tissues, offering therapeutic benefits for various cancers and endocrine disorders.
Patent Information
- Application Number
- JP2023559737
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-03-26
- Filing Date
- 2022-03-25
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2042-03-25
AI Technical Summary
Current therapeutic options are limited for conditions regulated by steroidogenic factor 1 (SF-1), including cancer, endocrine disorders, and endometriosis, as SF-1 modulators have not been effectively developed to target these conditions.
Development of pyrazolopyrimidine compounds that act as SF-1 modulators, which can be administered to treat cancer, endocrine disorders, and endometriosis by regulating the function of SF-1-dependent tissues.
The pyrazolopyrimidine compounds effectively target and modulate SF-1 activity, providing therapeutic benefits for conditions such as adrenocortical carcinoma, ovarian cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer, melanoma, pituitary gonadotroph adenomas, sex cord-stromal tumors, endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome.
Smart Images

Figure 0007805372000001 
Figure 0007805372000002 
Figure 0007805372000003
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 166,739, filed March 26, 2021, which is incorporated herein by reference in its entirety. [Background technology]
[0002] Steroidogenic factor 1 (SF-1, NR5A1) is a transcriptional regulator of genes involved in the development and function of steroidogenic tissues. SF-1 modulators offer opportunities for novel therapeutic compounds that regulate the growth and function of SF-1-dependent tissues. Summary of the Invention
[0003] The present disclosure provides, for example, pyrazolopyrimidine compounds, uses of such compounds as medicaments in the treatment of cancer, processes for preparing such compounds, and pharmaceutical compositions comprising a compound of the present disclosure as at least one active ingredient. The present disclosure also provides uses of the compounds described herein as and / or in the manufacture of medicaments for the treatment of cancer, endocrine disorders, and endometriosis.
[0004] One embodiment is a compound of formula (I):
[0005] [ka] or a pharmaceutically acceptable salt or solvate thereof, During the ceremony, X is a bond or C1-C6 alkylene; R 1 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, -CH2C 6-10 Aryl, C 6-10 Aryl, and C 1-9 heteroaryl; C 3-8 Cycloalkyl, C 2-9Heterocycloalkyl, -CH2C 6-10 Aryl, C 6-10 Aryl, and C 1-9 Heteroaryl can have 1, 2, 3, 4, or 5 R 4 is optionally replaced by R 2 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl can have 1, 2, 3, 4, or 5 R 5 is optionally replaced by R 3 is hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, or C 3-8 is cycloalkyl, Each R 4 and each R 5 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 6 , -SR 6 , -C(O)OR 6 , -OC(O)N(R 6 )(R 7 ), -N(R 8 )C(O)N(R 6 )(R 7 ), -N(R 8 )C(O)R 9 , -N(R 8 )C(O)OR 9 , -N(R 8 )S(O)2R 9 , -C(O)R 9 , -OC(O)R 9, -C(O)N(R 6 )(R 7 ), -C(O)C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2R 9 , and -S(O)N(R 6 )(R 7 ) and C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 10 , -SR 10 , -C(O)OR 10 , -OC(O)N(R 10 )(R 11 ), -N(R 12 )C(O)N(R 10 )(R 11 ), -N(R 12 )C(O)R 13 , -N(R 12 )C(O)OR 13 , -N(R 12 )S(O)2R 13 , -C(O)R 13 , -OC(O)R 13 , -C(O)N(R 10 )(R 11 ), -C(O)C(O)N(R 10 )(R 11 ), -S(O)R 13 , -S(O)2R 13 , and -S(O)N(R 10 )(R 11 Optionally substituted with 1, 2, or 3 groups selected from R 6 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 7 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 8 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 9 are each independently 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 10 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 11 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 12 are each independently hydrogen, C 1-6 Alkyl, and C 1-6haloalkyl; R 13 are each independently 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; or a pharmaceutically acceptable salt or solvate thereof.
[0006] Another embodiment is R 1 But C 6-10 Aryl and C 1-9 heteroaryl; C 6-10 Aryl and C 1-9 Heteroaryl may contain 1, 2, 3, 4, or 5 R 4 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, optionally substituted with R 1 But 1, 2, 3, 4, or 5 R 4 C optionally replaced with 6-10 aryl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But 1, 2, 3, 4, or 5 R 4Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 1 But one, two, or three R 4 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 1 But 1, 2, 3, 4, or 5 R 4 C optionally replaced with 1-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heteroaryl. 1 But 1, 2, 3, 4, or 5 R 4 Another embodiment is a compound of formula (I) wherein R is pyridyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 3-8 cycloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But 1, 2, 3, 4, or 5 R 4Another embodiment is a compound of formula (I) wherein R is cyclohexyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 Another embodiment is a compound of formula (I) wherein R is cyclohexyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 6-10 aryl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But 1, 2, 3, 4, or 5 R 4 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 2-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heterocycloalkyl. 1 But one, two, or three R 5 Another embodiment is a compound of formula (I) wherein R is tetrahydropyranyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 5 are each independently halogen, -CN, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2N(R 6 )(R 7 ), and -OR 10 , -C(O)OR 10 , -C(O)R13 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with 1, 2, or 3 groups selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 5 are each independently halogen, C 1-6 Haloalkyl, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 6 are each independently optionally substituted with one, two, or three groups selected from hydrogen, halogen, and hydroxy; 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 10 are independently hydrogen, C 1-6 Alkyl, and C 1-6haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 is C1-C6 alkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, where X is a bond. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, where X is C1-C6 alkylene.
[0007] Another embodiment is a pharmaceutical composition comprising a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, and at least one pharmaceutically acceptable excipient.
[0008] Another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenomas, and sex cord-stromal tumors. Another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, wherein the cancer is adrenocortical carcinoma.
[0009] Another embodiment is a method of treating an endocrine disorder in a mammal in need of such treatment, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a method of treating an endocrine disorder in a mammal in need of such treatment, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, wherein the endocrine disorder is selected from endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome.
[0010] Another embodiment is a method of treating endometriosis in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. DETAILED DESCRIPTION OF THE INVENTION
[0011] Steroidogenic factor 1 (SF-1, NR5A1) is a transcriptional regulator of genes involved in the development and function of steroidogenic tissues. Postnatally, SF-1 is expressed in the adrenal cortex and gonads, in pituitary gonadotropes, in the ventromedial nucleus of the hypothalamus (VMH), and in splenic blood vessels.
[0012] Targeted deletion of the SF-1 gene in mice results in severe adrenal insufficiency, adrenal and gonadal underdevelopment, and postnatal lethality. In humans, partial loss-of-function mutations in SF-1 are associated with impaired sexual development and severe adrenal insufficiency.
[0013] SF-1 plays an important role in steroid hormone synthesis by regulating the transcription of steroidogenic genes, including StAR, Cyp11a1, Cyp17, CYP21, Cyp11b1, Cyp11b2, and 3β-Hsd. The transcriptional activity of SF-1 can be stimulated by adrenocorticotropic hormone (ACTH) binding to the melanocortin 2 receptor (MC2R) in the adrenal cortex.
[0014] The SF-1 protein has a modular domain structure composed of an N-terminal zinc finger DNA-binding domain (DBD), a ligand-binding domain (LBD), a C-terminal AF-2 activation domain, and an intervening hinge region. SF-1 also contains a 30-amino acid extension of the DBD that mediates binding to a specific DNA recognition motif. Unlike most other nuclear receptor transcription factors, SF-1 interacts with its DNA recognition motif as a monomer. SF-1 activity is regulated by phosphoinositides and other phospholipids that bind to a large hydrophobic pocket within the SF-1 LBD.
[0015] SF-1 is highly expressed in ectopic endometrial lesions, with mRNA levels at least 1000-fold higher and protein levels approximately 5-fold higher than those in normal endometrium. SF-1 expression is also closely correlated with aromatase expression in endometrial cyst tissue, suggesting that SF-1 is a key regulator of intracrine estrogen biosynthesis.
[0016] Genomic, clinical, and pathological studies have implicated SF-1 as a key transcriptional regulator in the pathogenesis of adrenocortical carcinoma (ACC). Higher levels of tumor SF-1 expression have been correlated with a higher risk of death in adult ACC. In pediatric ACC, SF-1 is overexpressed at the protein and / or chromosomal level in approximately 90% of cases. SF-1 is also highly expressed in sex cord-stromal tumors (e.g., Sertoli cell tumors) and ectopically expressed in a subset of ovarian serous carcinomas, head and neck cancers, and widespread endometriosis.
[0017] Postnatal deletion of SF-1 in the VMH leads to high-fat diet-induced obesity due to impaired thermogenesis and blunted leptin signaling, suggesting that SF-1 is a key regulator of energy metabolism.
[0018] Additionally, SF-1 antagonists may block pituitary gonadotrope release or suppress the production of adrenal steroids, including cortisol and adrenal androgens. Potential indications include hormone-dependent prostate cancer, endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome, among other diseases of endocrine dysfunction.
[0019] SF-1 antagonists may be promising avenues for new therapeutic compounds.
[0020] As used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural unless the context clearly dictates otherwise. Thus, for example, a reference to "an agent" includes a plurality of such agents, and a reference to "the cell" includes a reference to one or more cells (or cells), and equivalents thereof known to those of skill in the art. When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulas, all combinations and subcombinations of ranges and specific embodiments therein are intended to be encompassed. When referring to a number or range of numbers, the term "about" means that the referenced number or range of numbers is an approximation within experimental variation (or within statistical experimental error), such that the number or range of numbers may vary from 1% to 15% of the stated number or range of numbers. The term "comprising" (and related words such as "comprise," "comprises," "having," or "including") is not intended to exclude that in other particular embodiments, an embodiment, such as any composition, method, or process described herein, may "consist of" or "consist essentially of" the recited features.
[0021] definition As used in this specification and the appended claims, the following terms have the meanings indicated below, unless specified to the contrary.
[0022] As used herein, C1-C x is C1-C2, C1-C3...C1-C x Includes C1-C x refers to the number of carbon atoms that make up the moiety designated by this term (excluding optional substituents).
[0023] "Amino" refers to the -NH2 radical.
[0024] "Cyano" refers to the -CN radical.
[0025] "Nitro" refers to the -NO2 radical.
[0026] "Oxa" refers to the -O- radical.
[0027] "Oxo" refers to the =O radical.
[0028] "Thioxo" refers to the =S radical.
[0029] "Imino" refers to the =NH radical.
[0030] "Oximo" refers to the =N-OH radical.
[0031] An "alkyl" or "alkylene" has 1 to 18 carbon atoms (e.g., C1-C 18 In one embodiment, alkyl refers to a hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, without unsaturation, that is, a straight or branched chain. In one embodiment, alkyl refers to a hydrocarbon chain radical consisting of 3 to 18 carbon atoms (e.g., C3-C 18 In some embodiments, alkyl includes 1 to 15 carbon atoms (e.g., C1-C 15 In some embodiments, alkyl includes 1 to 12 carbon atoms (e.g., C1-C 12In some embodiments, an alkyl contains 1 to 8 carbon atoms (e.g., C1-C8 alkyl). In other embodiments, an alkyl contains 1 to 6 carbon atoms (e.g., C1-C6 alkyl). In other embodiments, an alkyl contains 1 to 5 carbon atoms (e.g., C1-C5 alkyl). In other embodiments, an alkyl contains 1 to 4 carbon atoms (e.g., C1-C4 alkyl). In other embodiments, an alkyl contains 1 to 3 carbon atoms (e.g., C1-C3 alkyl). In other embodiments, an alkyl contains 1 to 2 carbon atoms (e.g., C1-C2 alkyl). In other embodiments, an alkyl contains 1 carbon atom (e.g., C1 alkyl). In other embodiments, an alkyl contains 5 to 15 carbon atoms (e.g., C5-C 15 In other embodiments, the alkyl contains 5 to 8 carbon atoms (e.g., C5-C8 alkyl). In other embodiments, the alkyl contains 2 to 5 carbon atoms (e.g., C2-C5 alkyl). In other embodiments, the alkyl contains 3 to 5 carbon atoms (e.g., C3-C5 alkyl). In other embodiments, the alkyl group is selected from methyl, ethyl, 1-propyl (n-propyl), 1-methylethyl (iso-propyl), 1-butyl (n-butyl), 1-methylpropyl (sec-butyl), 2-methylpropyl (iso-butyl), 1,1-dimethylethyl (tert-butyl), and 1-pentyl (n-pentyl). The alkyl is attached to the remainder of the molecule by a single bond. Unless otherwise specified in the specification, an alkyl group may contain the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, -OR a , -SR a , -OC(O)-R f , -N(R a )2, -C(O)R a , -C(O)OR a , -C(O)N(R a )2, -N(Ra)C(O)OR f , -OC(O)-NR a R f , -N(Ra)S(O) t R f (t is 1 or 2), -S(O) t ORa (t is 1 or 2), -S(O) t R f (t is 1 or 2), and -S(O) t N(R a )2 (where t is 1 or 2), optionally replaced by one or more of R a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R f are each independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0032] "Alkoxy" refers to a radical attached through an oxygen atom of the formula --O-alkyl, where alkyl is an alkyl chain as defined above.
[0033] "Alkenyl" refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon double bond, and having from 2 to 18 carbon atoms. In certain embodiments, an alkenyl contains from 3 to 18 carbon atoms. In certain embodiments, an alkenyl contains from 3 to 12 carbon atoms. In certain embodiments, an alkenyl contains from 6 to 12 carbon atoms. In certain embodiments, an alkenyl contains from 6 to 10 carbon atoms. In certain embodiments, an alkenyl contains from 8 to 10 carbon atoms. In certain embodiments, an alkenyl contains from 2 to 8 carbon atoms. In other embodiments, an alkenyl contains from 2 to 4 carbon atoms. An alkenyl is attached to the remainder of the molecule by a single bond, and examples include ethenyl (i.e., vinyl), prop-1-enyl (i.e., allyl), but-1-enyl, pent-1-enyl, and penta-1,4-dienyl. Unless stated otherwise in the specification, alkenyl groups may include any of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, -OR a , -SR a , -OC(O)-R f , -N(Ra )2, -C(O)R a , -C(O)OR a , -C(O)N(R a )2, -N(R a )C(O)OR f , -OC(O)-NR a R f , -N(R a )S(O) t R f (t is 1 or 2), -S(O) t OR a (t is 1 or 2), -S(O) t R f (t is 1 or 2), and -S(O) t N(R a )2 (where t is 1 or 2), optionally replaced by one or more of R a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R f are each independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0034] "Alkynyl" refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon triple bond, and having from 2 to 18 carbon atoms. In certain embodiments, an alkynyl contains from 3 to 18 carbon atoms. In certain embodiments, an alkynyl contains from 3 to 12 carbon atoms. In certain embodiments, an alkynyl contains from 6 to 12 carbon atoms. In certain embodiments, an alkynyl contains from 6 to 10 carbon atoms. In certain embodiments, an alkynyl contains from 8 to 10 carbon atoms. In certain embodiments, an alkynyl contains from 2 to 8 carbon atoms. In other embodiments, an alkynyl has from 2 to 4 carbon atoms. An alkynyl is attached to the remainder of the molecule by a single bond and is, for example, ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like. Unless otherwise specified in the specification, an alkynyl group may be selected from the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, -OR, -O- ... a , -SR a , -OC(O)-R f , -N(R a )2, -C(O)R a , -C(O)OR a , -C(O)N(R a )2, -N(R a )C(O)OR f , -OC(O)-NR a R f , -N(R a )S(O) t R f (t is 1 or 2), -S(O) t OR a (t is 1 or 2), -S(O) t R f (t is 1 or 2), and -S(O) t N(R a )2 (where t is 1 or 2), optionally replaced by one or more of R a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R fare each independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0035] "Aryl" refers to a radical derived from a monocyclic or polycyclic aromatic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon atoms of 6 to 18 carbon atoms, and at least one of the rings in the ring system is fully unsaturated, i.e., contains a cyclic delocalized (4n+2) π-electron system according to Hückel's theory. Ring systems from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin, and naphthalene. Unless otherwise specified in this specification, the term "aryl," or the prefix "ar" (such as in "aralkyl"), refers to any group including alkyl, alkenyl, alkynyl, halo, haloalkyl, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a , -R b -OC(O)-R a , -R b -OC(O)-OR a , -R b -OC(O)-N(R a )2, -R b -N(R a )2, -R b -C(O)R a , -R b -C(O)OR a , -R b -C(O)N(R a )2, -R b -OR c -C(O)N(R a )2, -R b -N(R a )C(O)OR a , -R b -N(R a )C(O)R a , -R b-N(R a )S(O) t R a (t is 1 or 2), -R b -S(O) t OR a (t is 1 or 2), -R b -S(O) t R a (t is 1 or 2), and -R b -S(O) t N(R a )2, where t is 1 or 2; a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R b are each independently a direct bond or a linear or branched alkylene or alkenylene chain; R c is a straight or branched alkylene or alkenylene chain.
[0036] "Alkoxy" refers to a radical attached through an oxygen atom of the formula --O-aryl, where aryl is as defined above.
[0037] "Aralkyl" is R c is an alkylene chain as defined above, for example methylene or ethylene, c -aryl. The alkylene chain part of the aralkyl radical is optionally substituted as described above for an alkylene chain. The aryl part of the aralkyl radical is optionally substituted as described above for an aryl group.
[0038] "Aralkyloxy" refers to a radical attached through an oxygen atom of the formula -O-aralkyl, where aralkyl is as defined above.
[0039] "Aralkenyl" is Rd is an alkenylene chain as defined above, d -aryl radical. The aryl part of the aralkenyl radical is optionally substituted as described above for an aryl group. The alkenylene chain part of the aralkenyl radical is optionally substituted as described above for an alkenylene group.
[0040] "Aralkynyl" is R e is an alkynylene chain as defined above, e -aryl radical. The aryl part of the aralkynyl radical is optionally substituted as described above for an aryl group. The alkynylene chain part of the aralkynyl radical is optionally substituted as described above for an alkynylene chain.
[0041] "Cycloalkyl" refers to a stable, non-aromatic, monocyclic or polycyclic radical, consisting solely of carbon and hydrogen atoms, including fused or bridged ring systems, having from 3 to 15 carbon atoms. In certain embodiments, cycloalkyls contain from 3 to 10 carbon atoms. In other embodiments, cycloalkyls contain from 5 to 7 carbon atoms. A cycloalkyl is attached to the remainder of the molecule by a single bond. A cycloalkyl can be saturated (i.e., containing only one C-C bond) or partially unsaturated (i.e., containing one or more double or triple bonds). Examples of monocyclic cycloalkyls include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In certain embodiments, a cycloalkyl contains from 3 to 8 carbon atoms (e.g., C3-C8 cycloalkyl). In other embodiments, a cycloalkyl contains from 3 to 7 carbon atoms (e.g., C3-C7 cycloalkyl). In other embodiments, a cycloalkyl contains from 3 to 6 carbon atoms (e.g., C3-C6 cycloalkyl). In other embodiments, cycloalkyl contains 3 to 5 carbon atoms (e.g., C3-C5 cycloalkyl). In other embodiments, cycloalkyl contains 3 to 4 carbon atoms (e.g., C3-C4 cycloalkyl). Partially unsaturated cycloalkyls are also referred to as "cycloalkenyls." Examples of monocyclic cycloalkenyls include, for example, cyclopentenyl, cyclohexenyl, cycloheptenyl, and cyclooctenyl. Examples of polycyclic cycloalkyl radicals include, for example, adamantyl, norbornyl (i.e., bicyclo[2.2.1]heptanyl), norbornenyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Unless otherwise defined in this specification, the term “cycloalkyl” includes any of the following: alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thioxo, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, —R b -OR a , -R b -OC(O)-R a , -R b-OC(O)-OR a , -R b -OC(O)-N(R a )2, -R b -N(R a )2, -R b -C(O)R a , -R b -C(O)OR a , -R b -C(O)N(R a )2, -R b -OR c -C(O)N(R a )2, -R b -N(R a )C(O)OR a , -R b -N(R a )C(O)R a , -R b -N(R a )S(O) t R a (t is 1 or 2), -R b -S(O) t OR a (t is 1 or 2), -R b -S(O) t R a (t is 1 or 2), and -R b -S(O) t N(R a )2, where t is 1 or 2; a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R b are each independently a direct bond or a linear or branched alkylene or alkenylene chain; R c is a straight or branched alkylene or alkenylene chain.
[0042] "Halo" or "halogen" refers to a bromo, chloro, fluoro, or iodo substituent.
[0043] "Haloalkyl" refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above.
[0044] "Haloalkoxy" refers to an alkoxy radical, as defined above, that is substituted by one or more halo radicals, as defined above.
[0045] "Fluoroalkyl" refers to an alkyl radical as defined above that is substituted by one or more fluoro radicals as defined above, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, 2,2,2-trifluoroethyl, 1-fluoromethyl-2-fluoroethyl, etc. The alkyl portion of the fluoroalkyl radical is optionally substituted as defined above for an alkyl group.
[0046] "Heterocycloalkyl" refers to a stable 3- to 18-membered non-aromatic ring radical containing 2 to 12 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise specified specifically in the specification, a heterocycloalkyl is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, optionally including fused, spirocyclic, or bridged ring systems. The heteroatoms in a heterocycloalkyl are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocycloalkyl radical is partially or fully saturated. In some embodiments, a heterocycloalkyl is attached to the remainder of the molecule by any atom of the ring. Examples of such heterocycloalkyls include, but are not limited to, dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Unless otherwise defined in this specification, the term “heterocycloalkyl” includes any of the following: alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thioxo, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, —R b -OR a , -R b -OC(O)-R a , -R b -OC(O)-OR a , -R b -OC(O)-N(R a )2, -R b -N(R a )2, -R b -C(O)R a , -Rb -C(O)OR a , -R b -C(O)N(R a )2, -R b -OR c -C(O)N(R a )2, -R b -N(R a )C(O)OR a , -R b -N(R a )C(O)R a , -R b -N(R a )S(O) t R a (t is 1 or 2), -R b -S(O) t OR a (t is 1 or 2), -R b -S(O) t R a (t is 1 or 2), and -R b -S(O) t N(R a )2, where t is 1 or 2; a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R b are each independently a direct bond or a linear or branched alkylene or alkenylene chain; R c is a straight or branched alkylene or alkenylene chain.
[0047] "Heteroaryl" refers to a radical derived from a 3- to 18-membered aromatic ring radical containing 1 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen, and sulfur. As used herein, a heteroaryl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system in which at least one ring in the ring system is fully unsaturated, i.e., contains a cyclic delocalized (4n+2) π-electron system according to Hückel theory. Heteroaryl includes fused or bridged ring systems. Heteroatoms in a heteroaryl radical are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. A heteroaryl is attached to the remainder of the molecule through any atom of the ring. Unless otherwise defined herein, the term “heteroaryl” includes any of the following: alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thioxo, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, —R b -OR a , -R b -OC(O)-R a , -R b -OC(O)-OR a , -R b -OC(O)-N(R a )2, -R b -N(R a )2, -R b -C(O)R a , -R b -C(O)OR a , -R b -C(O)N(R a )2, -R b -OR c -C(O)N(R a )2, -R b -N(R a )C(O)OR a , -R b -N(R a )C(O)R a , -R b -N(R a )S(O) t R a (t is 1 or 2), -Rb -S(O) t OR a (t is 1 or 2), -R b -S(O) t R a (t is 1 or 2), and -R b -S(O) t N(R a )2 (t is 1 or 2), and R a are each independently hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl; R b are each independently a direct bond or a linear or branched alkylene or alkenylene chain; R c is a straight or branched alkylene or alkenylene chain.
[0048] "N-heteroaryl" refers to a heteroaryl radical, as defined above, containing at least one nitrogen, and the point of attachment of the heteroaryl radical to the rest of the molecule is through a nitrogen atom in the heteroaryl radical. The N-heteroaryl radical is optionally substituted as described above for heteroaryl radicals.
[0049] "C-heteroaryl" refers to a heteroaryl radical as defined above, where the point of attachment of the heteroaryl radical to the rest of the molecule is through a carbon atom in the heteroaryl radical. The C-heteroaryl radical is optionally substituted as described above for heteroaryl radicals.
[0050] "Heteroaryloxy" refers to a radical attached through an oxygen atom of the formula --O-heteroaryl, where heteroaryl is as defined above.
[0051] "Heteroarylalkyl" refers to R cis an alkylene chain as defined above, c - refers to a radical of heteroaryl. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally attached to the alkyl radical at the nitrogen atom. The alkylene chain of the heteroarylalkyl radical is optionally substituted as defined above for an alkylene chain. The heteroaryl portion of the heteroarylalkyl radical is optionally substituted as defined above for a heteroaryl group.
[0052] "Heteroarylalkoxy" refers to R c is an alkylene chain as defined above, c -refers to a radical bonded through the oxygen atom of a heteroaryl. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally bonded to the alkyl radical at the nitrogen atom. The alkylene chain of the heteroarylalkoxy radical is optionally substituted as defined above for an alkylene chain. The heteroaryl portion of the heteroarylalkoxy radical is optionally substituted as defined above for a heteroaryl group.
[0053] In some embodiments, the compounds disclosed herein contain one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric forms defined in terms of absolute stereochemistry as (R) or (S). Unless otherwise specified, all stereoisomeric forms of the compounds disclosed herein are intended to be contemplated by the present disclosure. When a compound described herein contains an alkene double bond, and unless otherwise specified, the present disclosure is intended to include both E and Z geometric isomers (e.g., cis or trans). Similarly, all possible isomers, as well as racemic and optically pure forms thereof, and all tautomers, are intended to be included. The term "geometric isomer" refers to E or Z geometric isomers (e.g., cis or trans) of the alkene double bond. The term "positional isomer" refers to structural isomers around a central ring, such as ortho, meta, and para isomers around a benzene ring.
[0054] "Tautomer" refers to a molecule capable of proton transfer from one atom of the molecule to another atom of the same molecule. In certain embodiments, the compounds presented herein exist as tautomers. In situations where tautomerization is possible, a chemical equilibrium of tautomers exists. The exact ratio of tautomers depends on various factors, including physical conditions, temperature, solvent, and pH. Some examples of tautomeric equilibrium include:
[0055] [ka] Examples include:
[0056] "Optional" or "optionally" means that the described event or circumstance may or may not occur, and that the statement includes instances in which the event or circumstance occurs and instances in which it does not occur. For example, "optionally substituted aryl" means that the aryl radical is substituted or unsubstituted, and that the statement includes both substituted and unsubstituted aryl radicals.
[0057] "Pharmaceutically acceptable salt" includes both acid and base addition salts.
[0058] "Pharmaceutically acceptable acid addition salts" refer to salts that retain the biological effectiveness and properties of the free base, but are not biologically or otherwise undesirable, and are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, hydroiodic acid, hydrofluoric acid, phosphorous acid, etc. Also included are salts formed with organic acids such as aliphatic monocarboxylic and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, alkanediol acids, aromatic acids, and aliphatic and aromatic sulfonic acids, such as acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, etc. Thus, exemplary salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, trifluoroacetates, propionates, caprylates, isobutyrates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, malates, tartrates, methanesulfonates, and the like. Additionally, salts of amino acids such as arginate, gluconate, galacturonate, and the like are contemplated (see, e.g., Berge SM et al., "Pharmaceutical Salts," Journal of Pharmaceutical Science, 66:1-19 (1997)). Acid addition salts of basic compounds are prepared by contacting the free base form with a sufficient amount of the desired acid to produce the salt.
[0059] A "pharmaceutically acceptable base addition salt" refers to a salt that retains the biological effectiveness and properties of the free acid, which salt is not biologically or otherwise undesirable. These salts are prepared by adding an inorganic or organic base to the free acid. In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, N,N-dibenzylethylenediamine, chloroprocaine, hydrabamine, choline, betaine, ethylenediamine, ethylenedianiline, N-methylglucamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. See Berge et al., supra.
[0060] The term "subject" or "patient" includes mammals. Examples of mammals include, but are not limited to, members of any of the following mammalian classes: humans, non-human primates such as chimpanzees, other apes, and monkey species; farm animals such as cows, horses, sheep, goats, and pigs; domestic animals such as rabbits, dogs, and cats; and laboratory animals, including rodents such as rats, mice, and guinea pigs. In one embodiment, the mammal is a human.
[0061] As used herein, "treatment," "treating," "palliating," or "ameliorating" are used interchangeably herein. These terms refer to an approach to obtaining a beneficial or desired result, including, but not limited to, therapeutic benefit and / or prophylactic benefit. "Therapeutic benefit" refers to the eradication or amelioration of the underlying disease being treated. Furthermore, therapeutic benefit is achieved by the eradication or alleviation of one or more physiological symptoms associated with the underlying disease, such that the patient observes improvement despite still suffering from the underlying disease. In prophylactic benefit, the composition is administered to a patient who is at risk of developing a particular disease or who reports one or more physiological symptoms of the disease, even if the disease has not been diagnosed.
[0062] compound The compounds of formula (I) described herein are SF-1 modulators. In some embodiments, the compounds of formula (I) described herein are SF-1 antagonists. In some embodiments, the compounds of formula (I) described herein and compositions comprising these compounds are SF-1 antagonists useful for treating cancer.
[0063] Some embodiments are of formula (I):
[0064] [ka] or a pharmaceutically acceptable salt or solvate thereof, During the ceremony, X is a bond or C1-C6 alkylene; R 1 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, -CH2C 6-10 Aryl, C 6-10 Aryl, and C 1-9 heteroaryl; C 3-8Cycloalkyl, C 2-9 Heterocycloalkyl, -CH2C 6-10 Aryl, C 6-10 Aryl, and C 1-9 Heteroaryl can have 1, 2, 3, 4, or 5 R 4 is optionally replaced by R 2 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl can have 1, 2, 3, 4, or 5 R 5 is optionally replaced by R 3 is hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, or C 3-8 is cycloalkyl, Each R 4 and each R 5 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 6 , -SR 6 , -C(O)OR 6 , -OC(O)N(R 6 )(R 7 ), -N(R 8 )C(O)N(R 6 )(R 7 ), -N(R 8 )C(O)R 9 , -N(R 8 )C(O)OR 9 , -N(R 8 )S(O)2R 9 , -C(O)R 9, -OC(O)R 9 , -C(O)N(R 6 )(R 7 ), -C(O)C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2R 9 , and -S(O)N(R 6 )(R 7 ) and C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 10 , -SR 10 , -C(O)OR 10 , -OC(O)N(R 10 )(R 11 ), -N(R 12 )C(O)N(R 10 )(R 11 ), -N(R 12 )C(O)R 13 , -N(R 12 )C(O)OR 13 , -N(R 12 )S(O)2R 13 , -C(O)R 13 , -OC(O)R 13 , -C(O)N(R 10 )(R 11 ), -C(O)C(O)N(R 10 )(R 11 ), -S(O)R 13 , -S(O)2R 13 , and -S(O)N(R 10 )(R 11Optionally substituted with 1, 2, or 3 groups selected from R 6 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 7 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 8 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 9 are each independently 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 10 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; R 11 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 12 are each independently hydrogen, C 1-6Alkyl, and C 1-6 haloalkyl; R 13 are each independently 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl; C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 Heteroaryl is substituted with halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; or a pharmaceutically acceptable salt or solvate thereof.
[0065] Another embodiment is R 1 But 1, 2, 3, 4, or 5 R 4 C optionally replaced with 6-10 aryl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But 1, 2, 3, 4, or 5 R 4 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 1 But one, two, or three R 4 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 1But one, two, or three R 4 and R is phenyl optionally substituted with 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 and R is phenyl optionally substituted with 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 and R is phenyl optionally substituted with 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one, two, or three R 4 and R is phenyl optionally substituted with 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 and R is phenyl optionally substituted with 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 and R is phenyl optionally substituted with 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 and R is phenyl optionally substituted with 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 and R is phenyl optionally substituted with 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 and R is phenyl optionally substituted with 4 C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But one R 4 and R is phenyl optionally substituted with 4 is halogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But one R 4 and R is phenyl optionally substituted with 4 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 1 But one R 4 and R is phenyl optionally substituted with 4 -OR 6 or a pharmaceutically acceptable salt or solvate thereof.
[0066] Another embodiment is R 1 is unsubstituted phenyl, or a pharmaceutically acceptable salt or solvate thereof.
[0067] Another embodiment is R 1 But one, two, or three R 4 C optionally replaced with 1-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heteroaryl. 1 But one, two, or three R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , and -S(O)N(R 6 )(R 7 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one, two, or three R 4 C optionally replaced with 1-9 heteroaryl, and R4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one or two R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 are each independently halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, and -OR 6 or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a compound of formula (I) selected from R 1But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 is halogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 1 But one R 4 C optionally replaced with 1-9 heteroaryl, and R 4 -OR 6 or a pharmaceutically acceptable salt or solvate thereof. In some embodiments of the compounds of formula (I) described herein, R 1 is C 1-9 Heteroaryl, C 1-9 The heteroaryl is pyridyl.
[0068] Another embodiment is R 1 But unsubstituted C 1-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heteroaryl. 1 is unsubstituted pyridyl, or a pharmaceutically acceptable salt or solvate thereof.
[0069] Another embodiment is R 1 But one, two, or three R 4 optionally substituted with -CH2C 6-10aryl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But one, two, or three R 4 Another embodiment is a compound of formula (I) wherein R is benzyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 1 is unsubstituted benzyl, or a pharmaceutically acceptable salt or solvate thereof.
[0070] Another embodiment is R 1 But one, two, or three R 4 C optionally replaced with 2-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heterocycloalkyl. 1 But unsubstituted C 2-9 A compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein: R is heterocycloalkyl;
[0071] Another embodiment is R 1 But one, two, or three R 4 C optionally replaced with 3-8 cycloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 But unsubstituted C 3-8 A compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein: R is cycloalkyl;
[0072] Another embodiment is R 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 3-8 cycloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But 1, 2, 3, 4, or 5 R 4Another embodiment is a compound of formula (I) wherein R is cyclohexyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 Another embodiment is a compound of formula (I) wherein R is cyclohexyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 and R is cyclohexyl optionally substituted with 5 are each independently halogen, -CN, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2N(R 6 )(R 7 ), and -OR 10 , -C(O)OR 10 , -C(O)R 13 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with 1, 2, or 3 groups selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 and R is cyclohexyl optionally substituted with 5 are each independently halogen, C 1-6 Haloalkyl, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 and R is cyclohexyl optionally substituted with 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one or two R 5 and R is cyclohexyl optionally substituted with 5 are each independently a halogen, -OR 6 , and halogen, -OR 6 , and , -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 C optionally substituted with one group selected from alkyl 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 and R is cyclohexyl optionally substituted with 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is cyclohexyl substituted with R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 Another embodiment is a compound of formula (I) wherein R 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 and R 6 is optionally substituted with hydrogen and one, two, or three groups selected from halogen and hydroxy 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 and R 6 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 and R 6 C substituted with 1, 2, or 3 halogens 1-6Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 and R 6 is substituted with one hydroxyl C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is cyclohexyl substituted with R 5 -OR 6 and R 6 But unsubstituted C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is cyclohexyl substituted with R 5 But, -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is cyclohexyl substituted with R 5 But, -OR 10 , -C(O)OR 10 , and -C(O)N(R 10 )(R 11 Optionally substituted with one group selected from 1-6 alkyl, and R 10 But hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5is cyclohexyl substituted with R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is cyclohexyl substituted with R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is cyclohexyl substituted with R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is cyclohexyl substituted with R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 is unsubstituted cyclohexyl, or a pharmaceutically acceptable salt or solvate thereof.
[0073] Another embodiment is R 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 6-10 aryl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But 1, 2, 3, 4, or 5 R 4Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 Another embodiment is a compound of formula (I) wherein R is phenyl optionally substituted with R, or a pharmaceutically acceptable salt or solvate thereof. 2 But one, two, or three R 5 and R is phenyl optionally substituted with 5 are each independently halogen, -CN, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2N(R 6 )(R 7 ), and -OR 10 , -C(O)OR 10 , -C(O)R 13 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with 1, 2, or 3 groups selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 and R is phenyl optionally substituted with 5 are each independently halogen, C 1-6 Haloalkyl, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with one group selected from1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 and R is phenyl optionally substituted with 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one or two R 5 and R is phenyl optionally substituted with 5 are each independently a halogen, -OR 6 , and halogen, -OR 6 , and , -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 C optionally substituted with one group selected from alkyl 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 and R is phenyl optionally substituted with 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is phenyl substituted with R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is phenyl substituted with R 5 -OR 6 Another embodiment is a compound of formula (I) wherein R 2 But one R 5 is phenyl substituted with R 5 -OR 6 and R 6 is optionally substituted with hydrogen and one, two, or three groups selected from halogen and hydroxy 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 is phenyl substituted with R 5 -OR 6 and R 6 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is phenyl substituted with R 5 -OR 6 and R 6 C substituted with 1, 2, or 3 halogens 1-6Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is phenyl substituted with R 5 -OR 6 and R 6 is substituted with one hydroxyl C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is phenyl substituted with R 5 -OR 6 and R 6 But unsubstituted C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is phenyl substituted with R 5 But, -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is phenyl substituted with R 5 But, -OR 10 , -C(O)OR 10 , and -C(O)N(R 10 )(R 11 Optionally substituted with one group selected from 1-6 alkyl, and R 10 But hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is phenyl substituted with R5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is phenyl substituted with R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 is phenyl substituted with R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 is phenyl substituted with R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 is unsubstituted phenyl, or a pharmaceutically acceptable salt or solvate thereof.
[0074] Another embodiment is R 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 2-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heterocycloalkyl. 2 But 1, 2, 3, 4, or 5 R 5 C optionally replaced with 2-9Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heterocycloalkyl. 2 But one, two, or three R 5 C optionally replaced with 2-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heterocycloalkyl. 2 But one, two, or three R 5 C optionally replaced with 2-9 heterocycloalkyl, and R 5 are each independently halogen, -CN, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2N(R 6 )(R 7 ), and -OR 10 , -C(O)OR 10 , -C(O)R 13 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with 1, 2, or 3 groups selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 C optionally replaced with 2-9 heterocycloalkyl, and R 5 are each independently halogen, C 1-6 Haloalkyl, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R10 )(R 11 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 C optionally replaced with 2-9 heterocycloalkyl, and R 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one or two R 5 C optionally replaced with 2-9 heterocycloalkyl, and R 5 are each independently a halogen, -OR 6 , and halogen, -OR 6 , and , -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 C optionally substituted with one group selected from alkyl 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C optionally replaced with 2-9 heterocycloalkyl, and R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10)(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 Another embodiment is a compound of formula (I) wherein R 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 and R 6 is optionally substituted with hydrogen and one, two, or three groups selected from halogen and hydroxy 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 and R 6 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 and R 6 C substituted with 1, 2, or 3 halogens 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 and R 6 is substituted with one hydroxyl C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 and R 6 But unsubstituted C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But, -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But, -OR 10 , -C(O)OR 10 , and -C(O)N(R 10 )(R11 Optionally substituted with one group selected from 1-6 alkyl, and R 10 But hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But unsubstituted C2-9 In some embodiments of the compounds of formula (I) described herein, R is a heterocycloalkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 is C 2-9 Heterocycloalkyl, C 2-9 Heterocycloalkyl is tetrahydropyranyl.
[0075] Another embodiment is R 2 But one, two, or three R 5 C optionally replaced with 1-9 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is heteroaryl. 2 But one, two, or three R 5 C optionally replaced with 1-9 heteroaryl, and R 5 are each independently halogen, -CN, C 1-6 Haloalkyl, -OR 6 , -C(O)OR 6 , -C(O)R 9 , -C(O)N(R 6 )(R 7 ), -S(O)R 9 , -S(O)2N(R 6 )(R 7 ), and -OR 10 , -C(O)OR 10 , -C(O)R 13 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with 1, 2, or 3 groups selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 C optionally replaced with 1-9 heteroaryl, and R 5 are each independently halogen, C1-6 Haloalkyl, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O)R 13 , and -S(O)N(R 10 )(R 11 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one, two, or three R 5 C optionally replaced with 1-9 heteroaryl, and R 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one or two R 5 C optionally replaced with 1-9 heteroaryl, and R 5 are each independently a halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 optionally substituted with one group selected from alkyl, halogen, -OR 6 and C 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R5 C optionally replaced with 1-9 heteroaryl, and R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C optionally replaced with 1-9 heteroaryl, and R 5 But halogen, -OR 6 , and -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5 C replaced with 2-9 heterocycloalkyl, and R 5 -OR 6 Another embodiment is a compound of formula (I) wherein R 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 -OR 6 and R 6 is optionally substituted with hydrogen and one, two, or three groups selected from halogen and hydroxy 1-6 Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R is selected from alkyl. 2 But one R 5C replaced with 1-9 heteroaryl, and R 5 -OR 6 and R 6 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 -OR 6 and R 6 C substituted with 1, 2, or 3 halogens 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 -OR 6 and R 6 is substituted with one hydroxyl C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 -OR 6 and R 6 But unsubstituted C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 But, -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), and -S(O)R 13 C optionally substituted with one group selected from 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R5 C replaced with 1-9 heteroaryl, and R 5 But, -OR 10 , -C(O)OR 10 , and -C(O)N(R 10 )(R 11 Optionally substituted with one group selected from 1-6 alkyl, and R 10 But hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 But, -OR 10 C replaced by 1-6 alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 But -C(O)OR 10 C replaced by 1-6 alkyl, and R 10 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 But one R 5 C replaced with 1-9 heteroaryl, and R 5 But -C(O)OR 10 C replaced by 1-6alkyl, and R 10 C 1-6 Another embodiment is a compound of formula (I) wherein R is alkyl, or a pharmaceutically acceptable salt or solvate thereof. 2 But unsubstituted C 1-9 A compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein:
[0076] Another embodiment is R 10 are independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl, or a pharmaceutically acceptable salt or solvate thereof.
[0077] Another embodiment is R 3 is hydrogen. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 is C1-C6 alkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 is C1-C6 haloalkyl. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 But unsubstituted C 3-8 A compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein: R is cycloalkyl;
[0078] Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein X is a bond. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein X is C1-C6 alkylene. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein X is -C(CH3)2-. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein X is -C(H)(CH3)-. Another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt or solvate thereof, wherein X is -CH2- alkylene.
[0079] Further embodiments provided herein include combinations of one or more of the specific embodiments described above.
[0080] Some embodiments include:
[0081] [ka]
[0082] [ka]
[0083] [ka] or a pharmaceutically acceptable salt or solvate thereof.
[0084] Preparation of compounds The compounds used in the reactions described herein are made according to organic synthesis techniques known to those skilled in the art, beginning with commercially available chemicals and / or compounds described in the chemical literature."Commercially available chemicals" include Acros Organics (Geel, Belgium), Aldrich Chemical (Milwaukee, Wisconsin, including Sigma Chemical and Fluka), Apin Chemicals Ltd. (Milton Park, UK), Ark Pharm, Inc. (Libertyville, Illinois), Avocado Research (Lancashire, UK), BDH Inc. (Toronto, Canada), Bionet (Cornwall, UK), Chemservice Inc. (West Chester, Pennsylvania), Combi-blocks (San Diego, California), Crescent Chemical Co. (Hauppauge, New York), eMolecules (San Diego, California), Fisher Scientific Co. (Pittsburgh, Pennsylvania), Fisons Chemicals (Lancashire, UK), Frontier Scientific (Logan, Utah), ICN Biomedicals, Inc. (Costa Mesa, California), Key Organics (Cornwall, UK), Lancaster Synthesis (Windham, New Hampshire), Matrix Scientific (Columbia, South Carolina), Maybridge Chemical Co. Ltd. (Cornwall, England), Parish Chemical Co. (Orem, Utah), Pfaltz & Bauer, Inc. (Waterbury, Connecticut), Polyorganix (Houston, Texas), Pierce Chemical Co. (Rockford, Illinois), Riedel de Haen AG (Hannover, Germany), Ryan Scientific, Inc. (Mount Pleasant, South Carolina), Spectrum Chemicals (Gardena, California), Sundia Meditech (Shanghai, China), TCI America (Portland, Oregon), Trans World Chemicals, Inc. (Rockville, Maryland), and WuXi (Shanghai, China).
[0085] Suitable reference books and articles detailing the synthesis of reactants useful in preparing the compounds described herein or providing references to articles describing such preparations include, for example, "Synthetic Organic Chemistry," John Wiley & Sons, Inc., New York; "Organic Functional Group Preparations," by S.R. Sandler et al., 2nd Ed., Academic Press, New York, 1983; "Modern Synthetic Reactions," by H.O. House, 2nd Ed., W.A. Benjamin, Inc., Menlo Park, Calif., 1972; "Heterocyclic Chemistry," by T.L.G. Gilchrist, 2nd Ed., John Wiley & Sons, New York, 1992; and "Advanced Organic Chemistry: Reactions, Mechanisms and Structure," by J. March, 4th Ed., Wiley-Interscience, New York, 1992. Other suitable reference books and articles that detail the synthesis of reactants useful in preparing the compounds described herein or provide references to articles describing this preparation include, for example, "Organic Synthesis: Concepts, Methods, Starting Materials" by Fuhrhop, J. and Penzlin G., Second, Revised and Enlarged Edition (1994) John Wiley & Sons, ISBN: 3 527-29074-5; "Organic Chemistry, An Intermediate Text" by Hoffman, RV (1996) Oxford University Press, ISBN 0-19-509618-5; Larock, RC"Comprehensive Organic Transformations: A Guide to Functional Group Preparations," 2nd Edition (1999), Wiley-VCH, ISBN: 0-471-19031-4; "Advanced Organic Chemistry: Reactions, Mechanisms, and Structure," 4th Edition (1992), John Wiley & Sons, ISBN: 0-471-60180-2; "Modern Carbonyl Chemistry," 2000, Wiley-VCH, ISBN: 3-527-29871-1, by Otera, J. (editor); "Patai's 1992 Guide to the Chemistry of Functional Groups," 1992, Interscience, ISBN: 0-471-93022-9; "Organic Chemistry," 7th Edition (2000), John Solomons, TWG Wiley & Sons, ISBN: 0-471-19095-0; "Intermediate Organic Chemistry" 2nd Edition (1993) by Stowell, JC, Wiley-Interscience, ISBN: 0-471-57456-2; "Industrial Organic Chemicals: Starting Materials and Intermediates: An Ullmann's Encyclopedia" (1999) John Wiley & Sons, ISBN: 3-527-29645-X, in 8 volumes; "Organic Reactions" (1942-2000) John Wiley & Sons, in over 55 volumes; and "Chemistry of Functional Groups" John Wiley & Sons, in 73 volumes.
[0086] Specific reactants and similar reactants are also identified by an index of known chemical products prepared by the Chemical Abstract Service of the American Chemical Society, which is available in most public and university libraries as well as through online databases (American Chemical Society, Washington, D.C.). Chemicals that are known but not commercially available in catalogs are optionally prepared by specialized chemical synthesis laboratories, where many of the standard chemical supply facilities (e.g., those listed above) offer specialized chemical synthesis services. A reference regarding the preparation and selection of pharmaceutical salts of the compounds described herein is "Handbook of Pharmaceutical Salts" by P.H. Stahl & C.G. Wermuth, Verlag Helvetica Chimica Acta, Zurich, 2002.
[0087] Further forms of the compounds disclosed herein Isomers Additionally, in some embodiments, the compounds described herein exist as geometric isomers. In some embodiments, the compounds described herein possess one or more double bonds. The compounds presented herein include cis, trans, syn, anti, entgegen (E), and zusammen (Z) isomers, as well as all corresponding mixtures thereof. In some circumstances, the compounds exist as tautomers. The compounds described herein include all possible tautomers in the formulas described herein. In some circumstances, the compounds described herein possess one or more asymmetric centers, with each center existing in either the R or S configuration. The compounds described herein include all diastereomeric, enantiomeric, and epimeric forms, as well as all corresponding mixtures thereof. In further embodiments of the compounds and methods provided herein, mixtures of enantiomers and / or diastereomers obtained by a single preparative step, combination, or interconversion are useful for the applications described herein. In some embodiments, the compounds described herein are prepared as optically pure enantiomers by chiral chromatographic resolution of a racemic mixture. In some embodiments, the compounds described herein are prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds, separating the diastereomers, and recovering the optically pure individual enantiomers. In some embodiments, separable complexes are preferred (e.g., crystalline diastereomeric salts). In some embodiments, diastereomers have distinct physical properties (e.g., melting points, boiling points, solubility, reactivity, etc.) and are separated by exploiting these dissimilarities. In some embodiments, diastereomers are separated by chiral chromatography or, preferably, by separation / resolution techniques based on differences in solubility. In some embodiments, the optically pure enantiomers are subsequently recovered along with the resolving agent by any practical means that does not result in racemization.
[0088] labeled compound In some embodiments, the compounds described herein exist in their isotopically labeled form. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically labeled compounds. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically labeled compounds as pharmaceutical compositions. Thus, in some embodiments, the compounds disclosed herein include isotopically labeled compounds, which are identical to those listed herein, but in which one or more atoms have been replaced with an atom having an atomic mass or mass number different from that normally found in nature. Examples of isotopes incorporated into the compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, and chloride, respectively. 2 H, 3 H, 13 C. 14 C. 15 N, 18 O. 17 O. 31 P, 32 P, 35 S, 18 F, and 36 Cl, etc. Compounds described herein, and pharmaceutically acceptable salts, esters, solvates, hydrates, or derivatives thereof, that contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of the present invention. Certain isotopically labeled compounds, e.g., 3 H and 14 Incorporation of radioactive isotopes such as 1C is useful for drug and / or substrate tissue distribution assays. Tritiated isotopes, i.e. 3 H, and carbon-14 isotopes, i.e. 14 C are particularly preferred for their ease of preparation and detectability. 2Substitution with heavy isotopes, such as H, offers certain therapeutic advantages due to greater metabolic stability, for example, increased half-life in vivo and reduced dosage requirements. In some embodiments, isotopically labeled compounds, and pharmaceutically acceptable salts, esters, solvates, hydrates, or derivatives thereof, are prepared by any suitable method.
[0089] In some embodiments, the compounds described herein are labeled by other means, including but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
[0090] Pharmaceutically acceptable salts In some embodiments, the compounds described herein are present as their pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts as pharmaceutical compositions.
[0091] In some embodiments, the compounds described herein possess acidic or basic groups and therefore react with any of a number of inorganic or organic bases to form pharmaceutically acceptable salts. In some embodiments, these salts are prepared during the final isolation and purification of the compounds described herein, or in situ by separately reacting the purified compounds in free form with a suitable acid or base and isolating the formed salt.
[0092] solvate In some embodiments, the compounds described herein exist as solvates. Some embodiments are methods of treating diseases by administering such solvates. Further described herein are methods of treating diseases by administering such solvates as pharmaceutical compositions.
[0093] Solvates contain either stoichiometric or non-stoichiometric amounts of solvent, and in some embodiments, are formed during the crystallization process using pharmaceutically acceptable solvents such as water or ethanol. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is alcohol. Solvates of the compounds described herein are conveniently prepared or formed during the processes described herein. By way of example only, hydrates of the compounds described herein are conveniently prepared by recrystallization from an aqueous / organic solvent mixture using organic solvents, including, but not limited to, dioxane, tetrahydrofuran, or MeOH. In addition, the compounds provided herein optionally exist in solvated as well as unsolvated forms. In general, solvated forms are considered equivalent to unsolvated forms for the purposes of the compounds and methods provided herein.
[0094] Pharmaceutical Composition In certain embodiments, the compounds of formula (I) described herein are administered as pure chemicals. In some embodiments, the compounds of formula (I) described herein are combined with a pharmaceutically suitable or acceptable carrier (also referred to herein as a pharmaceutically suitable (or acceptable) excipient, a physiologically suitable (or acceptable) excipient, or a physiologically suitable (or acceptable) carrier) selected based on the chosen route of administration and standard pharmaceutical practice, for example, as described in Remington: The Science and Practice of Pharmacy (Gennaro, 21st Ed. Mack Pub. Co., Easton, PA (2005)).
[0095] Thus, provided herein are pharmaceutical compositions comprising at least one compound of formula (I) as described herein, or a stereoisomer, pharmaceutically acceptable salt, hydrate, solvate, or N-oxide thereof, in association with one or more pharmaceutically acceptable carriers. A carrier (or excipient) is acceptable or suitable if it is compatible with the other ingredients of the composition and not deleterious to the recipient (i.e., subject) of the composition.
[0096] One embodiment provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound of formula (I), or a pharmaceutically acceptable salt thereof.
[0097] Another embodiment provides a pharmaceutical composition consisting essentially of a pharmaceutically acceptable excipient and a compound of formula (I), or a pharmaceutically acceptable salt thereof.
[0098] In certain embodiments, the compounds of formula (I) described herein are substantially pure in that they contain less than about 5%, or less than about 1%, or less than about 0.1% of other small organic molecules, such as contaminating intermediates or by-products that arise, for example, during one or more of the steps of the synthetic method.
[0099] In certain embodiments, the compounds of formula (I) described herein are formulated for oral, rectal, topical, buccal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous), vaginal, ocular, or aerosol administration, although the most suitable form of administration in any given case will depend on the extent and severity of the disease being treated and the nature of the particular compound used. For example, the disclosed compositions are formulated as a unit dose and / or formulated for oral or subcutaneous administration.
[0100] Exemplary pharmaceutical compositions are used in the form of pharmaceutical preparations, for example, in solid, semi-solid, or liquid form, containing one or more of the compounds of the present disclosure as an active ingredient in a mixture with an organic or inorganic carrier or excipient suitable for external administration, enteral administration, or parenteral administration. In some embodiments, the active ingredient is compounded with a pharmaceutically acceptable carrier, which is usually non-toxic, for example, tablets, pellets, capsules, suppositories, solutions, emulsions, suspensions, and any other form suitable for use. The active compound is included in the pharmaceutical composition in an amount sufficient to produce the desired effect on the process or condition of a disease.
[0101] In some embodiments for preparing solid compositions such as tablets, the primary active ingredient is mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, calcium phosphate, or gums, and other pharmaceutical diluents, such as water, to form a solid preformulated composition containing a homogeneous mixture of a compound of the present disclosure or a non-toxic, pharmaceutically acceptable salt thereof. When these preformulated compositions are referred to as homogeneous, it is intended that the active ingredient be evenly dispersed throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills, and capsules.
[0102] In solid dosage forms for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules), the subject compositions may comprise one or more pharmaceutically acceptable carriers, such as sodium citrate or calcium phosphate, and / or (1) fillers or extenders, such as starch, cellulose, microcrystalline cellulose, silicified microcrystalline cellulose, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethylcellulose, hypromellose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) humectants, such as glycerol; (4) crospovidone, croscarmellose sodium; The composition may be mixed with any of the following: (1) disintegrating agents such as sorbitol, sodium starch glycolate, agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (2) solution retardants such as paraffin; (3) absorption enhancers such as quaternary ammonium compounds; (4) humectants such as docusate sodium, cetyl alcohol, and glycerol monostearate; (5) absorbents such as kaolin or bentonite clay; (6) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof; and (7) colorants. For capsules, tablets, and pills, in some embodiments, the composition also contains a buffering agent. In some embodiments, solid compositions of a similar type are also utilized as fillers in soft-filled and hard-filled gelatin capsules, using excipients such as lactose or milk sugar, as well as high molecular weight polyethylene glycols.
[0103] In some embodiments, tablets are made by compression or molding, optionally with one or more accessory ingredients. In some embodiments, compressed tablets are prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surface active agents, or dispersing agents. In some embodiments, molded tablets are made by molding in a suitable machine a mixture of the subject composition moistened with an inert liquid diluent. In some embodiments, tablets and other solid dosage forms such as dragees, capsules, pills, and granules are scored or prepared with coatings and shells, such as enteric coatings and other coatings.
[0104] Compositions for inhalation or inhalation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents, or mixtures thereof, and powders.Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs.In some embodiments, liquid dosage forms contain, in addition to the subject composition, inert diluents such as water or other solvents, solubilizers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (optionally cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and mixtures thereof.
[0105] In some embodiments, the suspension contains, in addition to the subject composition, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth gum, and mixtures thereof.
[0106] In some embodiments, formulations for rectal or vaginal administration are presented as suppositories, prepared by mixing the subject compositions with one or more suitable non-irritating excipients or carriers, including, for example, cocoa butter, polyethylene glycol, a suppository wax, or a salicylate, which are solid at room temperature but liquid at body temperature and will melt in the body cavity to release the active agent(s).
[0107] Dosage forms for transdermal administration of the subject compositions include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. In some embodiments, the active ingredient is admixed under sterile conditions with a pharmaceutically acceptable carrier, and any preservatives, buffers, or propellants, as desired.
[0108] In some embodiments, ointments, pastes, creams, and gels contain, in addition to the subject composition, excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth gum, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof.
[0109] In some embodiments, powders and sprays contain, in addition to the subject composition, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures of these substances. In some embodiments, sprays additionally contain conventional propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
[0110] In some embodiments, the compounds described herein are formulated as eye drops for ocular administration.
[0111] Alternatively, the compositions and compounds disclosed herein may be administered by aerosol. This administration is achieved by preparing an aqueous aerosol solution, liposomal preparation, or solid microparticles containing the compound. In some embodiments, a non-aqueous (e.g., fluorocarbon propellant) suspension is used. In some embodiments, a sonic nebulizer is used to minimize shearing of the agent, which could result in degradation of the compound contained in the composition. Typically, aqueous aerosol solutions are made by formulating an aqueous solution or suspension of the composition with conventional pharmaceutically acceptable carriers and stabilizers. Carriers and stabilizers vary depending on the requirements of the particular composition, but typically include non-ionic surfactants (Tween, Pluronic, or polyethylene glycol), sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars, or sugar alcohols. Aerosols are generally prepared from isotonic solutions.
[0112] Pharmaceutical compositions suitable for parenteral administration include the subject composition in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders to be reconstituted into sterile injectable solutions or dispersions immediately before use, in some embodiments containing antioxidants, buffers, bacteriostats, solutes that render the formulation isotonic with the blood of the intended recipient, suspending agents, or thickening agents.
[0113] Examples of suitable aqueous and non-aqueous carriers used in pharmaceutical compositions include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate and cyclodextrin. Proper fluidity is maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
[0114] Also contemplated is an enteral pharmaceutical formulation comprising the compound of the present disclosure, an enteral material, and a pharmaceutically acceptable carrier or excipient thereof. The enteral material refers to a polymer that is substantially insoluble in the acidic environment of the stomach, but significantly soluble in intestinal fluids at a specific pH. The small intestine is the portion of the gastrointestinal tract (intestine) between the stomach and the large intestine, and includes the duodenum, jejunum, and ileum. The pH of the duodenum is about 5.5, the pH of the jejunum is about 6.5, and the pH of the distal ileum is about 7.5. Thus, the enteral material will not dissolve until the pH is, for example, about 5.0, about 5.2, about 5.4, about 5.6, about 5.8, about 6.0, about 6.2, about 6.4, about 6.6, about 6.8, about 7.0, about 7.2, about 7.4, about 7.6, about 7.8, about 8.0, about 8.2, about 8.4, about 8.6, about 8.8, about 9.0, about 9.2, about 9.4, about 9.6, about 9.8, or about 10.0. Exemplary enteral materials include cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate trimellitate, hydroxypropyl methylcellulose succinate, cellulose acetate succinate, cellulose acetate hexahydrophthalate, cellulose propionate phthalate, cellulose acetate maleate, cellulose acetate butyrate, cellulose acetate propionate, copolymers of methyl methacrylate and methyl methacrylate, copolymers of methyl acrylate, methyl methacrylate and methacrylic acid, copolymers of methyl vinyl ether and maleic anhydride (Gantrez ES series), ethyl methacrylate-methyl methacrylate-chlorotrimethylammonium ethyl acrylate copolymer, zein, shellac, and copal collofolium (copal collophorium), as well as several commercially available enteral dispersion systems (e.g., Eudragit L30D55, Eudragit FS30D, Eudragit L100, Eudragit S100, Kollicoat EMM30D, Estacryl 30D, Coateric, and Aquateric).The solubility of each of the above materials is known or can be readily determined in vitro.
[0115] The dosage of the compositions comprising at least one compound of formula (I) described herein will vary depending on the condition of the patient (e.g., human), i.e., the stage of the disease, general health, age, and other factors.
[0116] The pharmaceutical composition is administered in a manner appropriate for the disease to be treated (or prevented). The appropriate dose, as well as the appropriate duration and frequency of administration, will be determined by factors such as the patient's condition, the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provides the composition in an amount sufficient to bring about a therapeutic and / or preventive benefit (e.g., improved clinical outcome), such as a more frequent complete or partial remission, a longer disease-free and / or overall survival rate, or a reduction in the severity of symptoms. The optimal dose is generally determined using experimental models and / or clinical trials. In some embodiments, the optimal dose depends on the patient's body type, weight, or blood volume.
[0117] method Some embodiments are a method for treating cancer in a patient in need of cancer treatment, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are a method for treating cancer in a patient in need of cancer treatment, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenoma, and sex cord-stromal tumor. Some embodiments are a method for treating endometriosis in a patient in need of endometriosis treatment, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating ovarian cancer in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating head and neck cancer in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating endometrial cancer in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating hormone-dependent prostate cancer in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods of treating non-small cell lung cancer (NSCLC) in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof.Some embodiments are methods for treating melanoma in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating pituitary gonadotroph adenoma in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods for treating sex cord-stromal tumor in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) described herein, or a pharmaceutically acceptable salt or solvate thereof. In some embodiments, the sex cord-stromal tumor is a Leydig cell tumor.
[0118] Some embodiments are methods for treating an endocrine disorder in a mammal in need of such treatment, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Another embodiment is a method for treating an endocrine disorder in a mammal in need of such treatment, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof, wherein the endocrine disorder is selected from endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome. Some embodiments are methods for treating endogenous Cushing's syndrome in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods of treating congenital adrenal hyperplasia in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof. Some embodiments are methods of treating polycystic ovary syndrome in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof.
[0119] Some embodiments are methods of treating endometrioma or endometriosis in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt or solvate thereof.
[0120] In certain embodiments, the compound of the disclosure utilized in one or more of the aforementioned methods is one of the generic, partially generic, or specific compounds described herein, such as a compound of formula (I).
[0121] The compounds of the present disclosure are administered to patients (animals and humans) in need of such treatment in dosages that provide optimal pharmaceutical efficacy. The dosage required for any particular application will vary from patient to patient, depending not only on the specific compound or composition selected, but also on the route of administration, the nature of the disease being treated, the age and condition of the patient, any concurrent medications or special diets the patient is following, and other factors, and the appropriate dosage is ultimately at the discretion of the attending physician. In the clinical indications and treatment of the above-mentioned diseases, contemplated compounds disclosed herein are administered orally, subcutaneously, topically, parenterally, by inhalation spray, or rectally in unit dosage formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, and vehicles. Parenteral administration includes intravenous, subcutaneous, or intramuscular injection or infusion techniques.
[0122] The following examples are provided merely as illustrations of various embodiments and should not be construed as limiting the invention in any way. [Example]
[0123] List of abbreviations As used above, and throughout the description of the present invention, the following abbreviations, unless otherwise specified, shall be understood to have the following meanings: ACN Acetonitrile Bn Benzyl BOC or Boc tert-butylcarbamate DCC dichloroethane (ClCH2CH2Cl) DCM N,N'-dicyclohexylcarbodiimide DIPEA N,N-Diisopropylethylamine DMAP 4-(N,N-dimethylamino)pyridine DMF Dimethylformamide DMA N,N-dimethylacetamide DMSO dimethyl sulfoxide equiv equivalent EDCI 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide Et Ethyl EtOH ethanol EtOAc ethyl acetate HF Hydrofluoric Acid HMDS Bis(trimethylsilyl)amine HPLC High Pressure Liquid Chromatography Me methyl MeOH Methanol MMTr 4-Methoxytrityl MMTrCl 4-Methoxytrityl Chloride MS mass spectroscopy NMM N-methylmorpholine NMR nuclear magnetic resonance TBHP tert-butyl hydroperoxide TEA Triethylamine TFA trifluoroacetic acid THF tetrahydrofuran TLC thin layer chromatography TBDMSCl tert-butyldimethylsilyl chloride TMSCl Trimethylsilyl chloride TMSOTf Trimethylsilyl trifluoromethanesulfonate
[0124] chemical synthesis Unless otherwise noted, reagents and solvents were used as received from commercial suppliers. Anhydrous solvents and oven-dried glassware were used in synthetic variants sensitive to moisture and / or oxygen. Yields were not optimized. Reaction times are approximate and not optimized. Column chromatography and thin-layer chromatography (TLC) were performed on silica gel unless otherwise noted. Spectra are provided in ppm (δ) and coupling constants (J) are reported in Hertz. In proton spectra, the solvent peak was used as the reference peak.
[0125] Example 1: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10)
[0126] [ka]
[0127] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (50 g, 292.2 mmol) in DMF (500 mL) was added KCO (80.6 g, 584.4 mmol) followed by methyl iodide (20.0 mL, 321.4 mmol) at room temperature, and the reaction mixture was stirred at the same temperature for 16 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated to give the crude product. The crude product was purified by silica gel column chromatography to give methyl 1-methyl-4-nitro-1H-pyrazole-5-carboxylate (2) (15.0 g, 27%) as a colorless liquid. 1 H NMR(400MHz,CDCl3):δ 8.01(s,1H),4.03(s,6H);MS(ESI)m / z 186.17[M+H] + .
[0128] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (2) (2 × 7.5 g, 40.54 mmol) in MeOH (75 mL) was added 10% Pd / C (3 g), and the reaction mixture was stirred under an atmosphere of hydrogen (balloon pressure) at room temperature for 16 h. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give methyl 4-amino-1H-pyrazole-5-carboxylate (3) (12.2 g, 97%). 1 H NMR(400MHz,DMSO):δ 7.00(s,1H),4.98(brs,2H),3.89(s,3H),3.79(s,3H);MS(ESI)m / z 156.07[M+H] + .
[0129] To a stirred solution of methyl 4-amino-1H-pyrazole-5-carboxylate 3 (12.2 g, 78.70 mmol) in n-butanol (122 mL) was added DIPEA (72.5 mL, 393.50 mmol) and formamidine acetate 4 (9.80 g, 94.45 mmol) at room temperature, and the reaction was stirred at 110 °C for 16 h. The reaction mixture was cooled to room temperature, and the precipitated solid was filtered off. The solid was triturated with diethyl ether to give 1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one 5 (10.0 g, 84%) as an off-white solid. 1 H NMR(400MHz,DMSO-d6):δ 7.95(s,1H),δ 7.80(s,1H),δ 4.18(s,3H);MS(ESI)m / z 151.09[M+H] + .
[0130] To a stirred solution of 1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (4) (10.0 g, 66.66 mmol) in DMF (200 mL) was added NBS (15.41 g, 86.58 mmol) at room temperature, and the reaction mixture was stirred at 80 °C for 16 h. The reaction mixture was cooled to room temperature and quenched with cold water. The precipitated solid was filtered off. The solid was dried under vacuum to give 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (5) (11.0 g, 72%) as an off-white solid. 1 H NMR(400MHz,DMSO-d6):δ 12.49(brs,1H),7.92(s,1H),δ 4.18(s,3H);MS(ESI)m / z 229.06[M+H] + .
[0131] To a stirred solution of 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (5) (11.0 g, 48.24 mmol) in DMF (220 mL) was added KCO (13.25 g, 96.06 mmol) and tert-butyl 2-bromoacetate (6) (8.24 mL, 57.64 mmol) at 0 °C and stirred at room temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 1 L). The organic layer was dried over anhydrous NaSO, filtered, and concentrated to give the crude material, which was purified by flash column chromatography to give tert-butyl 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (12.0 g, 72%) as a white solid. 1 H NMR(400MHz,CDCl3):δ 7.79(s,1H),4.61(s,2H),4.28(s,3H),1.49(s,9H);MS(ESI)m / z 343.22[M+H] + .
[0132] To a degassed (argon) solution of tert-butyl 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (5.0 g, 14.619 mmol) in dioxane (100 mL), CsCO (14.24 g, 43.71 mmol), Pd(dba) (1.32 g, 1.45 mmol), Xantphos (843 mg, 1.45 mmol), and 4-(trifluoromethyl)aniline (8) (2.35 g, 14.619 mmol) were added in a pressure vessel at room temperature. The solution was again degassed for 15 min, and the reaction mixture was warmed to 100 °C for 5 h. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with ethyl acetate. The filtrate was concentrated under reduced pressure to give a crude product, which was purified by silica gel column chromatography to give tert-butyl 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (9) (4.8 g, 77%) as a brown solid. 1 H NMR(400MHz,DMSO-d6):δ 9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.4Hz,2H),4.74(s,2H),4.13(s,3H),1.44(s,9H);MS(ESI)m / z 424.4[M+H] + .
[0133] To a stirred solution of tert-butyl 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (9) (4.8 g, 11.34 mmol) in DCM (25 mL) was added 4N HCl in dioxane (50 mL) at 0° C. and stirred at room temperature for 16 h. The solvent was evaporated under reduced pressure, triturated with ethyl acetate, and dried under reduced pressure to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (4.8 g) as a pale yellow solid. 1 H NMR(400MHz,DMSO-d6):δ 9.45(s,1H),8.17(s,1H),7.72(d,J=8.8Hz,2H),7.57(d,J=8.4Hz,2H),4.77(s,2H),4.13(s,3H),3.56(s,1H);MS(ESI)m / z 368.30[M+H] + .
[0134] Example 2: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (11)
[0135] [ka]
[0136] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, 3-fluoro-4-methoxyaniline (126 mg, 0.89 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to give N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (11) (106 mg, 26%) as an off-white solid. MS(ESI) m / z 491.56 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.48(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.60-7.50(m,3H),7.27(d ,J=8.8Hz,1H),7.14(t,J=9.2Hz,1H),4.86(s,2H),4.13(s,3H),3.80(s,3H),1.44(s,6H).
[0137] Example 3: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(4-(2-(methylsulfonyl)propan-2-yl)phenyl)acetamide (12)
[0138] [ka]
[0139] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.4 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 4-(2-(methylsulfonyl)propan-2-yl)aniline (2) (208 mg, 0.98 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(4-(2-(methylsulfonyl)propan-2-yl)phenyl)acetamide (12) (110 mg, 23%) as an off-white solid. MS(ESI) m / z 563.43 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.58(s,1H),9.47(s,1H),8.17(s,1H),7.74(s,1H),7.72(s,1H),7.65-7.53(m,6H),4.89(s,2H),4.13(s,3H),2.65(s,3H),1.73(s,6H).
[0140] Example 4: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(tetrahydro-2H-pyran-4-yl)acetamide (13)
[0141] [ka]
[0142] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.4 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, tetrahydro-2H-pyran-4-amine (99 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(tetrahydro-2H-pyran-4-yl)acetamide (13) (120 mg, 32%) as an off-white solid. MS(ESI) m / z 465.44 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.66(s,2H),4.12( s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J=6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H).
[0143] Example 5: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((tetrahydro-2H-pyran-4-yl)methyl)acetamide (14)
[0144] [ka]
[0145] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.817 mmol) in DMF (5 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.56 mL, 3.26 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (tetrahydro-2H-pyran-4-yl)methanamine (112 mg, 0.98 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((tetrahydro-2H-pyran-4-yl)methyl)acetamide (14) (130 mg, 34%) as a pale yellow solid. MS(ESI) m / z 465.44 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.66(s,2H),4.12( s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J=6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H).
[0146] Example 6: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(2-(tetrahydro-2H-pyran-4-yl)propan-2-yl)acetamide (15)
[0147] [ka]
[0148] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (150 mg, 0.40 mmol) in DMF (3 mL) was added HATU (230 mg, 0.61 mmol) and DIPEA (0.24 mL, 1.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(tetrahydro-2H-pyran-4-yl)propan-2-amine (179 mg, 0.48 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(2-(tetrahydro-2H-pyran-4-yl)propan-2-yl)acetamide (15) (60 mg, 29%) as an off-white solid. MS(ESI) m / z 493.56 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.05(s,1H),7.83(s,1H),7.71(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.63(s,2H),4.12 (s,3H),4.00-3.90(m,2H),3.30-3.15(m,2H),2.20-2.05(m,1H),1.60-1.50(m,2H),1.40-1.10(m,8H).
[0149] Example 7: Synthesis of (R)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (16)
[0150] [ka]
[0151] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (259 mg, 0.70 mmol) in DMF (5 mL) was added HATU (307 mg, 0.81 mmol) and DIPEA (209 mg, 1.62 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. (R)-1-(tetrahydro-2H-pyran-4-yl)ethan-1-amine (70 mg, 0.54 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated and the crude material was purified by preparative HPLC to give (R)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (16) (45 mg, 17%) as a white solid. MS(ESI) m / z 479.63 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.12(d,J=8.8Hz,1H),8.08(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H),4.12(s,3H) ,3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J=6.80Hz,3H).
[0152] Example 8: Synthesis of (S)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (17)
[0153] [ka]
[0154] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (259 mg, 0.70 mmol) in DMF (5 mL) was added HATU (307 mg, 0.81 mmol) and DIPEA (209 mg, 1.62 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. (S)-1-(tetrahydro-2H-pyran-4-yl)ethan-1-amine (70 mg, 0.54 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated and the residue was purified by preparative HPLC to give (S)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (17) (110 mg, 42%) as a white solid. MS(ESI) m / z 479.63 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.12(d,J=8.8Hz,1H),8.08(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H),4.12(s,3H) ,3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J=6.80Hz,3H).
[0155] Example 9: Synthesis of N-(2-methyl-4-(2-(methylsulfonyl)propan-2-yl)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (18)
[0156] [ka]
[0157] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (500 mg, 1.36 mmol) in DMF (3 mL) was added HATU (776 mg, 2.04 mmol) and DIPEA (0.75 mL, 4.08 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-methyl-4-(2-(methylsulfonyl)propan-2-yl)aniline (371 mg, 1.63 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give N-(2-methyl-4-(2-(methylsulfonyl)propan-2-yl)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (18) (97 mg, 12%) as an off-white solid. MS(ESI) m / z 577.47 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.82(s,1H),9.45(s,1H),8.17(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J=8.4Hz,2H), 7.55-7.35(m,3H),4.95(s,2H),4.14(s,3H),2.68(s,3H),2.29(s,3H),1.73(s,6H).
[0158] Example 10: Synthesis of 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propanoic acid (19)
[0159] [ka]
[0160] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenyl)-2-methylpropanoic acid (175 mg, 0.98 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propanoic acid (19) (90 mg, 20%) as an off-white solid. MS(ESI) m / z 529.46 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 12.40-12.30(br s,1H),10.45(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J=8.4Hz,2H),7.60 -7.50(m,4H),7.31(d,J=8.4Hz,1H),4.88(s,2H),4.13(s,3H),1.44(s,6H).
[0161] Example 11: Synthesis of N-(4-(2-hydroxy-2-methylpropoxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (20)
[0162] [ka]
[0163] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) was added HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 1-(4-aminophenoxy)-2-methylpropan-2-ol (177 mg, 0.98 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to give N-(4-(2-hydroxy-2-methylpropoxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (20) (160 mg, 36%) as a gray solid. MS(ESI) m / z 531.65 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H),7.48(d,J=8. 8Hz, 2H), 6.90 (d, J=9.20Hz, 2H), 4.87 (s, 2H), 4.59 (s, 1H), 4.13 (s, 3H), 3.69 (s, 2H), 1.18 (s, 6H).
[0164] Example 12: Synthesis of 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propanamide (21)
[0165] [ka]
[0166] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenyl)-2-methylpropanamide (196 mg, 1.11 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propanamide (21) (75 mg, 17%) as an off-white solid. MS(ESI) m / z 526.33 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.42(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H) ,7.51(d,J=8.4Hz,2H),6.83(d,J=4.4Hz,2H),4.87(s,2H),4.13(s,2H),1.41(s,6H).
[0167] Example 13 Synthesis of N-((1S,4r)-4-((S)-2-hydroxypropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (22) and N-((1R,4r)-4-((R)-2-hydroxypropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (23)
[0168] [ka]
[0169] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (250 mg, 0.70 mmol) in DMF (3 mL), HATU (400 mg, 1.05 mmol) and DIPEA (290 mg, 2.10 mmol) were added at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, 1-(((1r,4r)-4-aminocyclohexyl)oxy)propan-2-ol (142 mg, 0.83 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered off and dried to give N-((trans)-4-(2-hydroxypropoxy)cyclohexyl)-2-(4-oxo-8-((5-(trifluoromethyl)pyridin-2-yl)amino)quinazolin-3(4H)-yl)acetamide (22 and 23) (320 mg) as an off-white solid. Chiral SFC separation of the enantiomers gave 22 (64 mg, 9%) and 23 (63 mg, 9%). 22 Peak-1: MS (ESI) m / z 523.51 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.20(d,J=7.6Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.62(s,2H),4.47(s,1H),4.12(s,3H),3.7 0-3.60(brs,1H),3.60-3.50(brs,1H),3.30-3.10(m,3H),2.11-1.90(m,2H),1.90-1.80(m,2H),1.30-1.15(m,4H),1.01(d,J=6.0Hz,3H). 23 Peak-2: MS (ESI) m / z 523.51 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.21(d,J=7.6Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7 .56(d,J=8.4Hz,2H),4.63(s,2H),4.48(s,1H),4.12(s,3H),3.70-3.60.
[0170] Example 14: Synthesis of N-((trans)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (24)
[0171] [ka]
[0172] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 1-(((trans)-4-aminocyclohexyl)oxy)-2-methylpropan-2-ol (166 mg, 0.88 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give N-((trans)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (24) (75 mg, 25%) as an off-white solid. MS(ESI) m / z 537.36 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.20(d,J=7.2Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),4.63(s,2H),4.20(s,1H),4.12 (s,3H),4.54(brs,1H),3.23-3.21(m,1H),3.14(s,2H),1.97-1.93(m,2H),1.83-1.79(m,2H),1.25-1.20(m,4H),1.05(s,6H).
[0173] Example 15 Synthesis of (R)—N-(4-((1-hydroxypropan-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (25) and (S)—N-(4-((1-hydroxypropan-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (26)
[0174] [ka]
[0175] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenoxy)propan-1-ol (185 mg, 1.11 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative SFC to give (R)—N-(4-((1-hydroxypropan-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (25) (85 mg, 22%) and (S)—N-(4-((1-hydroxypropan-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (26) (77 mg, 20%) as off-white solids. 25 Peak-1: MS (ESI) m / z 517.45 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H),7.47(d,J=8.4Hz,2H),6.89(d,J=9.2Hz,2H) ,4.85(s,2H),4.82(t,J=5.6Hz,1H),4.36-4.32(m,1H),4.13(s,3H),3.55-3.50(m,1H),3.45-3.40(m,1H),1.17(d,J=6.0Hz,3H). 26 Peak-2: MS (ESI) m / z 517.45 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H),7.47(d,J=9.2Hz,2H),6.89(d,J=8.8Hz,2H) ,4.85(s,2H),4.81(t,J=5.6Hz,1H),4.36-4.32(m,1H),4.13(s,3H),3.55-3.49(m,1H),3.45-3.40(m,1H),1.17(d,J=6.0Hz,3H).
[0176] Example 16: Synthesis of N-((trans)-4-(1-hydroxy-2-methylpropan-2-yl)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (27)
[0177] [ka]
[0178] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, 2-((trans)-4-aminocyclohexyl)-2-methylpropan-1-ol (150 mg, 0.88 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give N-((trans)-4-(1-hydroxy-2-methylpropan-2-yl)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (27) (110 mg, 28%) as an off-white solid. MS(ESI) m / z 519.40 [MH] - ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.17(d,J=7.6Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H),4.40(t,J=5.6Hz,1H ),4.13(s,3H),4.46-3.42(m,1H),3.13(d,J=5.2Hz,2H),1.86-1.83(m,2H),1.71-1.68(m,2H),1.23-0.98(m,4H),0.73(s,6H).
[0179] Example 17: N-((trans)-4-hydroxycyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (28)
[0180] [ka]
[0181] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (250 mg, 0.68 mmol) in DMF (5 mL) was added HATU (387 mg, 1.02 mmol) and DIPEA (0.53 mL, 3.06 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (trans)-4-aminocyclohexan-1-ol (93 mg, 0.816 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give N-((trans)-4-hydroxycyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (28) (95 mg, 30%) as an off-white solid. MS(ESI) m / z 465.35 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.16(d,J=7.6Hz,1H),8.06(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H) ,4.62(s,2H),4.52(d,J=4.4Hz,1H),3.49-3.36(m,2H),1.82-1.76(m,4H),1.23-1.17(m,4H).
[0182] Example 18: N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (32)
[0183] [ka]
[0184] To a stirred solution of trans-4-aminocyclohexan-1-ol (5 g, 33 mmol) in acetonitrile (100 mL) at 0 °C, K2CO3 (18 g, 132 mmol) was added, followed by benzyl bromide (8.2 g, 69 mmol), and the reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a Celite pad, and the filtrate was evaporated under reduced pressure. The resulting solid was washed with n-pentane to give trans-4-(dibenzylamino)cyclohexan-1-ol (29) (8 g, 82%) as a white solid, which was used in the next step without further purification. MS (ESI) m / z 296.36 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 7.38-7.24(m,8H),7.23-7.14(m,2H),4.41(d,J=4.2Hz,1H),3.55(s,4H),2 .45-2.28(m,1H),1.90-1.70(m,4H),1.50-1.30(m,2H),1.10-0.90(m,2H).
[0185] To a stirred solution of trans-4-(dibenzylamino)cyclohexan-1-ol (29) (2 g, 6 mmol) in acetonitrile (50 mL) was added CuI (0.258 g, 1.3 mmol) at room temperature. The temperature of the reaction mixture was warmed to 45 °C, and 2,2-difluoro-2-(fluorosulfonyl)acetic acid (2.4 g, 13 mmol) was added. The reaction mixture was then stirred at the same temperature for 1 h. 2,2-Difluoro-2-(fluorosulfonyl)acetic acid (2.4 g, 13 mmol) was added again, and stirring was continued for another 1 h. The reaction mixture was then cooled to room temperature and filtered through a Celite pad. The filtrate was evaporated, and the residue was dissolved in EtOAc and washed with saturated aqueous NaHCO3 followed by water. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated to give the crude compound, which was purified by flash column chromatography on 100-200 silica using 5% EtOAc in hexane as solvent to give trans-N,N-dibenzyl-4-(difluoromethoxy)cyclohexan-1-amine (30) (1.8 g, 86%) as a white solid. MS (ESI) m / z 346.39 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 7.38-7.26(m,8H),7.23-7.15(m,2H),6.65(t,J=77.2Hz,1H),4.05-3.90(m,1H),3.56(s,4H),2.48 -2.35(m,1H),1.97(d,J=10.4Hz,2H),1.82(d,J=11.6Hz,2H),1.55-1.42(m,2H),1.30-1.15(m,2H).
[0186] To a stirred solution of trans-N,N-dibenzyl-4-(difluoromethoxy)cyclohexan-1-amine (30) (0.9 g, 2.6 mmol) in EtOH (10 mL) was added 20% Pd(OH) / C (0.6 g), and the reaction mixture was stirred under an atmosphere of hydrogen (50 PSI) for 16 h. The reaction mixture was passed through a Celite pad, and the filtrate was concentrated to give trans-4-(difluoromethoxy)cyclohexanamine (31) (350 mg, 81%) as a colorless oil, which was used in the next step without further purification. MS (ESI) m / z 166.37 [M+H] + .
[0187] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (4.8 g, 13.07 mmol) in THF (48 mL) was added DIPEA (7.23 mL, 39.23 mmol), EDC.HCl (3.74 g, 19.61 mmol), and HOBT (2.64 g, 19.61 mmol) at 0 °C, and the reaction mixture was stirred at room temperature for 15 min. Then (1r,4r)-4-(difluoromethoxy)cyclohexan-1-amine (31) (2.16 g, 13.07 mmol) was added, and the reaction was stirred at room temperature for 12 h. After completion of the reaction by TLC, the reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 200 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated to give the crude product, which was purified by flash column chromatography on 100-200 silica using 90% EtOAc in hexane as solvent to give N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (32) (3.5 g, 57%) as an off-white solid. MS (ESI) m / z 515.61 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.23(d,J=7.2Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),6.69(t,J=76.6Hz,1H),4.63 (s,2H),4.12-4.03(m,4H),3.57-3.55(m,1H),1.96-1.94(m,2H),1.85-1.82(m,2H),1.49-1.41(m,2H),1.34-1.32(m,2H).
[0188] Example 19: Synthesis of N-((1s,4s)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (36)
[0189] [ka]
[0190] To a stirred solution of (1s,4s)-4-aminocyclohexan-1-ol (5 g, 33.11 mmol) in acetonitrile (100 mL) was added K2CO3 (19.2 g, 139.07 mmol) followed by benzyl bromide (17 g, 99.33 mmol) at ice temperature, and the reaction mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was stirred with petroleum ether and filtered to give (1s,4s)-4-(dibenzylamino)cyclohexan-1-ol (33) (7 g, 72.16%) as a white solid. MS (ESI) m / z 296.27 [M+H] + .
[0191] To a stirred solution of (1s,4s)-4-(dibenzylamino)cyclohexan-1-ol (33) (4.4 g, 14.91 mmol) in acetonitrile (45 mL) was added CuI (566 mg, 2.98 mmol), and the reaction mixture was warmed to 45 °C. 2,2-Difluoro-2-(fluorosulfonyl)acetic acid (9.29 g, 52.20 mmol) was then added and stirred for 2 h. The reaction mixture was slowly quenched with aqueous NaHCO and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column chromatography to give (1s,4s)-N,N-dibenzyl-4-(difluoromethoxy)cyclohexan-1-amine (34) (3.2 g, 62%) as a white solid. MS (ESI) m / z 346.70 [M+H] + .
[0192] To a stirred solution of (1s,4s)-N,N-dibenzyl-4-(difluoromethoxy)cyclohexan-1-amine (34) (2 g, 5.79 mmol) in EtOH (10 mL) was added 10% Pd / C (8 g), and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 psi) for 16 h. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give (1s,4s)-4-(difluoromethoxy)cyclohexan-1-amine (35) (0.45 g, 47%). MS (ESI) m / z 166.12 [M+H] - .
[0193] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.82 mmol) in DMF (3 mL) was added HATU (465 mg, 1.23 mmol) and DIPEA (0.43 mL, 2.45 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 15 min. (1s,4s)-4-(Difluoromethoxy)cyclohexan-1-amine (35) (150 mg, 0.89 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated and the crude material was purified by silica gel column followed by preparative SFC to give N-((1s,4s)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (36) (51 mg, 12%) as an off-white solid. MS(ESI) m / z 515.20 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.27(d,J=8.00Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.71(t,J=72. 8Hz,1H),4.65(s,2H),4.30-4.20(m,1H),4.12(s,3H),3.70-3.60(m,1H),1.90-1.80(m,2H),1.70-1.50(m,6H).
[0194] Example 20: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl)acetamide (39)
[0195] [ka]
[0196] To a stirred solution of (1r,4r)-4-(dibenzylamino)cyclohexan-1-ol (29) (2 g, 6.77 mmol) in dioxane (20 mL), KO t Bu (4.0 g, 33.89 mmol) was added followed by 4-(bromomethyl)tetrahydro-2H-pyran (6.0 mL, 40.67 mmol) at ice temperature, and the reaction mixture was stirred at 120 °C for 16 h. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column to give (1r,4r)-N,N-dibenzyl-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexan-1-amine (37) (750 mg, crude). MS (ESI) m / z 394.54 [M+H] + .
[0197] To a stirred solution of methyl(1r,4r)-N,N-dibenzyl-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexan-1-amine (37) (750 mg, 1.91 mmol) in EtOH (2 mL) was added 10% Pd / C (2 g), and the reaction mixture was stirred under an atmosphere of hydrogen (70 psi) at room temperature for 16 hours. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give (1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexan-1-amine (38) (390 mg, crude).
[0198] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (350 mg, 0.95 mmol) in DMF (5 mL) was added HATU (720 mg, 1.90 mmol) and DIPEA (0.52 mL, 2.86 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, (1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexan-1-amine (38) (406 mg, 1.90 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The combined organic layers were evaporated, and the residue was passed through a silica column (60-120 mesh) followed by purification by RP preparative HPLC to give 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl)acetamide (39) (40 mg, 5% yield) as an off-white solid. MS(ESI) m / z 563.61 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.20(d,J=7.80Hz,1H),8.07(s,1H),7.72(d,J=8.40Hz,2H),7.56(d,J=8.40Hz,2H),4.62(s,2H),4.12(s,3H),3.80-3.70(m, 2H),3.60-3.50(m,1H),3.30-3.20(m,5H),2.00-1.90(m,2H),1.90-1 .80(m,2H),1.80-1.65(m,1H),1.60-1.50(m,2H),1.30-1.10(m,6H).
[0199] Example 21 Synthesis of N-((1S,3S)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide and N-((1R,3R)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (43 and 44)
[0200] [ka]
[0201] To a stirred solution of (trans)-3-aminocyclohexan-1-ol hydrochloride (6 g, 52.17 mmol) in acetonitrile (60 mL) was added K2CO3 (30.28 g, 219.13 mmol) followed by benzyl bromide (26.76 g, 156.52 mmol) at ice temperature, and the reaction mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated to give the crude product. The resulting brown crude product was stirred with petroleum ether and filtered to give (trans)-3-(dibenzylamino)cyclohexan-1-ol (40) (6.5 g, 42% yield) as a brown solid. MS (ESI) m / z 296.43 [M+H] - .
[0202] To a stirred solution of (trans)-3-(dibenzylamino)cyclohexan-1-ol (40) (4 g, 13.55 mmol) in acetonitrile (40 mL) was added CuI (515 mg, 2.71 mmol), and the reaction mixture was warmed to 45 °C. 2,2-Difluoro-2-(fluorosulfonyl)acetic acid (8.44 g, 47.45 mmol) was then added and stirred for 2 h. The reaction mixture was slowly quenched with aqueous NaHCO and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column chromatography to give N,N-dibenzyl-3-(difluoromethoxy)cyclohexan-1-amine (41) (3 g, 65% yield) as a gummy material. MS (ESI) m / z 346.28 [M+H] - .
[0203] To a stirred solution of N,N-dibenzyl-3-(difluoromethoxy)cyclohexane-1-amine (41) (1.5 g, 4.34 mmol) in EtOH (22 mL) was added 10% Pd / C (6 g), and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 psi) for 16 h. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give 3-(difluoromethoxy)cyclohexane-1-amine (42) (0.450 g, 63% yield). MS (ESI) m / z 166.08 [M+H] - .
[0204] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (400 mg, 1.08 mmol) in DMF (4 mL) was added HATU (621 mg, 1.63 mmol) and DIPEA (0.6 mL, 3.26 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 3-(Difluoromethoxy)cyclohexan-1-amine (42) (179 mg, 1.08 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated, and the residue was passed through a silica column (60-120 mesh) followed by purification by preparative SFC to give 43 (105 mg, 19% yield) and 44 (125 mg, 22% yield), both trans isomers of N-((1,3)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide with unknown absolute stereochemistry, as off-white solids. Compound 43:MS(ESI)m / z 515.23[M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.43(s,1H),8.25(d,J=8.00Hz,1H),8.07(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.69(t,J=72.8Hz,1H), 4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H). Compound 44:MS(ESI)m / z 515.23[M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.26(d,J=8.00Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.69(t,J=72.8Hz,1H), 4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H).
[0205] Example 22 Synthesis of N-((1S,3R)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide and N-((1R,3S)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (48 and 49)
[0206] [ka]
[0207] To a stirred solution of (cis)-3-aminocyclohexan-1-ol hydrochloride (6 g, 52.17 mmol) in acetonitrile (60 mL) was added K2CO3 (30.28 g, 219.13 mmol) followed by benzyl bromide (26.76 g, 156.52 mmol) at ice temperature, and the reaction mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated to give the crude product. The resulting brown crude product was stirred with petroleum ether and filtered to give (cis)-3-(dibenzylamino)cyclohexan-1-ol (45) (6.5 g, 42% yield) as a brown solid. MS (ESI) m / z 296.43 [M+H] - .
[0208] To a stirred solution of 3-(dibenzylamino)cyclohexan-1-ol (45) (4 g, 13.55 mmol) in acetonitrile (40 mL) was added CuI (515 mg, 2.71 mmol), and the reaction mixture was warmed to 45 °C. 2,2-Difluoro-2-(fluorosulfonyl)acetic acid (8.44 g, 47.45 mmol) was then added and stirred at room temperature for 2 h. The reaction mixture was quenched with aqueous NaHCO and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column chromatography to give N,N-dibenzyl-3-(difluoromethoxy)cyclohexan-1-amine (46) (3 g, 65% yield) as a gummy material. MS (ESI) m / z 346.28 [M+H] - .
[0209] To a stirred solution of N,N-dibenzyl-3-(difluoromethoxy)cyclohexane-1-amine (46) (1.5 g, 4.34 mmol) in EtOH (22 mL) was added 10% Pd / C (6 g), and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 psi) for 16 h. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give 3-(difluoromethoxy)cyclohexane-1-amine (47) (0.450 g, 63% yield). MS (ESI) m / z 166.08 [M+H] - .
[0210] To a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (400 mg, 1.08 mmol) in DMF (4 mL) was added HATU (621 mg, 1.63 mmol) and DIPEA (0.6 mL, 3.26 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 3-(Difluoromethoxy)cyclohexan-1-amine (47) (179 mg, 1.08 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated, and the residue was passed through a silica column (60-120 mesh) followed by purification by SFC to give 48 (15 mg, 3% yield) as an off-white solid, and 49 (2 mg, 1% yield), the cis isomer of N-((1,3)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide with unknown absolute stereochemistry. Compound 48:MS(ESI)m / z 515.23[M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.32(d,J=7.20Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.70(t,J=72.8Hz,1H ),4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.35-1.23(m,4H). Compound 49:MS(ESI)m / z 515.33[M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.32(d,J=8.4Hz,1H),8.08(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.80Hz,2H),6.70(t,J=76.4Hz,1H) ,4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.29-1.11(m,4H).
[0211] Example 23: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (52)
[0212] [ka]
[0213] To a stirred solution of tert-butyl 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (500 mg, 1.46 mmol) in 1,4-dioxane (15 mL) was added 5-(trifluoromethyl)pyridin-2-amine (190 mg, 1.18 mmol) and cesium carbonate (1.42 g, 4.38 mmol). The reaction was degassed with argon for 15 min, then Pd(dba) (267 mg, 0.29 mmol) and Xantphos (168 mg, 0.29 mmol) were added. The reaction mixture was again degassed with argon for 5 min. The reaction mixture was then stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica column chromatography to give tert-butyl 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (50) (200 mg, 32% yield) as a pale yellow solid. MS (ESI) m / z 425.25 [M+H] + .
[0214] To a stirred solution of tert-butyl 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (50) (200 mg, 0.47 mmol) in 1,4-dioxane (2 mL) was added 4 M HCl in dioxane (3 mL) at 0 °C, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was evaporated to give 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (51) (150 mg, 90%) as an off-white solid. MS (ESI) m / z 369.0 [M+H] + .
[0215] To a stirred solution of 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (51) (150 mg, 0.40 mmol) in DMF (3 mL) was added HATU (231 mg, 0.61 mmol) and DIPEA (0.21 mL, 1.22 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 1-(((1r,4r)-4-aminocyclohexyl)oxy)-2-methylpropan-2-ol (114 mg, 0.61 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 mL). The organic layer was evaporated and the residue was purified by preparative SFC to give N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (52) (40 mg, 10% yield) as an off-white solid. MS(ESI) m / z 538.19 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.65(s,1H),8.42(s,1H),8.20(d,J=7.2Hz,1H),8.02(s,1H),7.89(d,J=6.80Hz,1H),7.17(d,J=8.8Hz,1H),4.62(s,2H),4.20(s,1H), 4.14(s,3H),3.60-3.50(m,1H),3.30-3.20(m,1H),3.14(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).
[0216] Example 24: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (55)
[0217] [ka]
[0218] To a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (53) (1.2 g, 4.18 mmol) in DMF (15 mL) was added HATU (2.3 g, 6.27 mmol) and DIPEA (2.3 mL, 12.54 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, (1r,4r)-4-(difluoromethoxy)cyclohexan-1-amine (35) (827 mg, 5.017 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and washed with EtO to give N-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (1.0 g, 55%) as a pale yellow solid. MS (ESI) m / z 434.27 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 8.23(d,J=7.6Hz,1H),8.15(s,1H),6.69(t,J=76Hz,1H),4.62(s,2H),4.16(s,3H),4.10-4.00(m,1 H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).
[0219] To a stirred solution of N-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (400 mg, 0.921 mmol) in 1,4-dioxane (5 mL) was added 5-(trifluoromethyl)pyridin-2-amine (149 mg, 0.921 mmol) and cesium carbonate (898 mg, 2.76 mmol). The reaction was then degassed with argon for 15 min, after which Pd(dba) (53 mg, 0.09 mmol) and Xantphos (84, 0.09 mmol) were added, and the reaction mixture was again degassed with argon for 5 min. The reaction mixture was then stirred at 100 °C for 2 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica column to give N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (55) (90 mg, 19% yield) as a white solid. MS (ESI) m / z 516.50 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.70(s,1H),8.42(s,1H),8.24(d,J=7.6Hz,1H),8.02(s,1H),7.90(d,J=6.80Hz,1H),7.18(d,J=8.80Hz,1H),6.69(t,J=76Hz,1H),4.62 (s,2H),4.18(s,3H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).
[0220] Example 25: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (64)
[0221] [ka]
[0222] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g, 58.47 mmol) in MeOH (100 mL) was added 10% Pd / C (3.0 g). The reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 16 hours. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give methyl 4-amino-1H-pyrazole-5-carboxylate (56) (8 g, 97% yield) as a brown solid. 1 H NMR (400MHz, DMSO-d6): δ 12.82 (brs, 1H), 7.09 (s, 1H), 4.87 (s, 2H), 3.77 (s, 3H).
[0223] To a stirred solution of methyl 4-amino-1H-pyrazole-5-carboxylate (56) (8 g, 56.73 mmol) in n-butanol (80 mL) was added DIPEA (48.15 mL, 283.8 mmol) and formamidine acetate (6.49 g, 62.41 mmol) at room temperature, and the reaction was stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature, and the precipitated solid was filtered off. The solid was triturated with diethyl ether to give 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (57) (7.1 g, 92%) as an off-white solid. MS (ESI) m / z 137.05 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 13.10 (brs, 2H), 8.11 (s, 1H), 7.85 (s, 1H).
[0224] To a stirred solution of methyl 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (57) (5 g, 3.67 mmol) in DMF (80 mL) was added NBS (10 g, 5.51 mmol) at room temperature, and the reaction mixture was stirred at 60 °C for 12 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to give 3-bromo-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (58) (5.5 g, 64%) as an off-white solid. MS (ESI) m / z 216.97 [M+2] + .
[0225] To a stirred solution of 3-bromo-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (58) (3 g, 14.31 mmol) in DMF (30 mL) was added pTSA (134 mg, 0.7 mmol) followed by DHP (6.05 g, 70.42 mmol) at room temperature, and the reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was cooled to room temperature, quenched with cold water, and extracted with EtOAc (3 x 50 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography to give 3-bromo-1-(tetrahydro-2H-pyran-2-yl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (59) (2.6 g, 61%) as an off-white solid. MS(ESI)m / z 298.95[M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 8.98(s,1H),6.13(dd,J=10.4,2.0Hz,1H),3.93(d,J=12.8Hz,1H),3.64-3.58(m,1H),2.49-2.24(m,1H),2.02-1.91(m,2H),1.70-1.55(m,4H).
[0226] To a stirred solution of 3-bromo-1-(tetrahydro-2H-pyran-2-yl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (59) (2.6 g, 8.69 mmol) in DMF (30 mL) was added KCO (3.6 g, 26.03 mmol) followed by 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (2.83 g, 13.04 mmol) at room temperature, and the reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography on 100-200 silica using 70% EtOAc in hexane as solvent to give 2-(3-bromo-7-oxo-1-(tetrahydro-2H-pyran-2-yl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (61) (1.5 g, 30% yield) as an off-white solid. MS (ESI) m / z 482.01 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 8.31(s,1H),7.53(dd,J=13.6,2.4Hz,1H),7.27-7.20(m,1H),7.14(t,J=9.8Hz,1H),6.11(dd,J=10.4,2.0Hz,1H),4. 88(s,2H),4.0-3.90(m,1H),3.80(s,3H),3.62-3.56(m,1H),2.32-2.24(m,1H),2.01-1.92(m,2H),1.70-1.50(m,3H).
[0227] To a degassed (argon) solution of 2-(3-bromo-7-oxo-1-(tetrahydro-2H-pyran-2-yl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (61) (200 mg, 0.417 mmol) in toluene (6 mL) was added CsCO (406 mg, 1.25 mmol), Pd(dba) (38 mg, 0.04 mmol), Xantphos (24 mg, 0.041 mmol), and 5-(trifluoromethyl)pyridin-2-amine (101 mg, 0.626 mmol) at room temperature. The solution was again degassed for 15 min, and the mixture was heated in a microwave oven at 130 °C for 1.5 h. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure to give the crude material, which was purified by preparative HPLC to give N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (62) (50 mg, 24%) as a pale yellow solid. MS (ESI) m / z 562.14 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.56(brs,1H),9.80(brs,1H),8.45(s,1H),8.19(s,1H),7.95(dd,J=8.8,2.4Hz ,1H),7.55(dd,J=13.2,2Hz,1H),7.26(d,J=8.8Hz,2H),7.15(t,J=9.2Hz,1H),6.1 2(dd,J=8,2Hz,1H),4.87(s,2H),3.95(d,J=7.6Hz,1H),3.80(s,3H),3.63-3.56(m ,1H),2.39-2.31(m,1H),2.03-1.93(m,2H),1.72-1.56(m,1H),1.55-1.53(m,2H).
[0228] To a stirred solution of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (62) (45 mg, 0.08 mmol) in DCM (2 mL) was added 4 N HCl / dioxane (2 mL) at 0° C. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was concentrated, and the residue was purified by preparative HPLC to give N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (63) (12 mg, 31% yield) as an off-white solid. MS (ESI) m / z 478.05 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 13.92(brs,1H),10.49(s,1H),9.77(brs,1H),8.44(s,1H),8.09(s,1H),7.90(d,J=8.8Hz,1H), 7.55(dd,J=13.2,2Hz,1H),7.26(d,J=9.2Hz,1H),7.21-7.12(m,2H),4.86(s,2H),3.80(s,3H).
[0229] To a stirred solution of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (63) (50 mg, 0.104 mmol) in DMF (2 mL) was added CsCO (68 mg, 0.209 mmol) followed by methyl iodide (18 mg, 0.125 mmol) at room temperature. The reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water (50 mL) and extracted with EtOAc (2 x 25 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by preparative HPLC to give N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (64) (10 mg, 14%) as a white solid. MS(ESI) m / z 492.09 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.60(s,1H),9.68(s,1H),8.50(brs,2H),8.43(s,1H),8.10(s,1H),7.90(d,J=8.8Hz,1H),7.55( d,J=13.6Hz,1H),7.27(d,J=8.8Hz,1H),7.19-7.12(m,2H),4.85(s,2H),4.15(s,3H),3.80(s,3H).
[0230] Example 26: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (65)
[0231] [ka]
[0232] To a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (300 mg, 0.69 mmol) in 1,4-dioxane (5 mL) was added 6-(trifluoromethyl)pyridin-3-amine (111 mg, 0.69 mmol) and cesium carbonate (673 mg, 2.07 mmol). The reaction was degassed with argon for 15 min, then Pd(dba) (63 mg, 0.06 mmol) and Xantphos (39 mg, 0.06 mmol) were added, and the reaction mixture was again degassed with argon for 5 min. The reaction mixture was then stirred at 100 °C for 2 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated to give the crude product, which was purified by SFC to give N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (65) (100 mg, 28% yield) as a light brown solid. MS (ESI) m / z 516.50 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.80(s,1H),8.89(s,1H),8.30-8.20(m,2H),8.10(s,1H),7.76(d,J=8.80Hz,1H),6.69(t,J=76Hz,1H),4.64(s,2H),4.30 (s,3H),4.10-4.00(m,1H),3.65-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).
[0233] Example 27: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (68)
[0234] [ka]
[0235] To a stirred solution of tert-butyl 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (500 mg, 1.46 mmol) in 1,4-dioxane (15 mL) was added 6-(trifluoromethyl)pyridin-3-amine (284 mg, 1.75 mmol) and cesium carbonate (1.42 g, 4.38 mmol). The reaction was degassed with argon for 15 min, and then Pd(dba) (133 mg, 0.14 mmol) and Xantphos (84 mg, 0.14 mmol) were added. The reaction mixture was again degassed with argon for 5 min, and then the reaction mixture was stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica column chromatography to give tert-butyl 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (66) (600 mg, 70% yield) as a pale yellow solid. MS (ESI) m / z 425.4 [M+H] + .
[0236] To a stirred solution of tert-butyl 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (66) (600 mg, 1.45 mmol) in 1,4-dioxane (2 mL) was added 4 M HCl in dioxane (10 mL) at 0 °C. The reaction mixture was stirred at room temperature for 16 h. Evaporation of the reaction mixture gave 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (67) (500 mg, 90% yield) as a pale yellow solid. MS (ESI) m / z 369.33 [M+H] + .
[0237] To a stirred solution of 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (67) (300 mg, 0.81 mmol) in DMF (10 mL) was added HATU (464 mg, 1.22 mmol) and DIPEA (0.31 mL, 2.44 mmol) at 0 °C. The reaction mixture was stirred at the same temperature for 5 minutes. 1-(((1r,4r)-4-aminocyclohexyl)oxy)-2-methylpropan-2-ol (182 mg, 0.97 mmol) was added, and the reaction was stirred at room temperature for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 mL). The combined organic layers were evaporated, and the residue was purified by preparative HPLC to give N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (68) (120 mg, 27% yield) as an off-white solid. MS (ESI) m / z 538.15 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 9.80(s,1H),8.89(s,1H),8.21(d,J=7.2Hz,2H),8.09(s,1H),7.76(d,J=8.80Hz,1H),4.63(s,2H),4.20(s,1H),4.13(s,3H) ),3.60-3.50(m,1H),3.30-3.20(m,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).
[0238] Example 28: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (70)
[0239] [ka]
[0240] To a stirred solution of 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (5) (2 g, 8.70 mmol) in DMF (30 mL) was added KCO (3.6 g, 26.03 mmol) followed by 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (2.83 g, 13.04 mmol) at room temperature. The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography to give 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (2.91 g, 81% yield) as a pale yellow solid. MS(ESI) m / z 412.20 [M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 10.49(brs,1H),8.31(s,1H),7.53(dd,J=9.6,2.4Hz,1H),7.25(1H,J=10.0Hz,1H),7.13(t,J=9.2Hz,1H),4.85(s,2H),4.17(s,3H),3.80(s,3H).
[0241] To a solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (343 mg, 0.82 mmol) in dioxane (10 mL) under degassed argon, CsCO (812 mg, 2.50 mmol), Pd(dba) (76 mg, 0.08 mmol), Xantphos (48 mg, 0.082 mmol), and 4-isopropoxyaniline (186 mg, 1.34 mmol) were added at room temperature. The reaction mixture was again degassed for 15 minutes, and then heated at 100 °C for 16 hours. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to give N-(3-fluoro-4-methoxyphenyl)-2-(3-((4-isopropoxyphenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (70) (30 mg, 8%) as an off-white solid. MS(ESI) m / z 481.50 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.47(s,1H),8.66(s,1H),8.10(s,1H),7.58-7.53(m,4H),7.27(d,J=8.8Hz,1H),7.14(t,J=9.2Hz,1H) ,6.82(d,J=8.8Hz,2H),4.85(s,2H),4.48-4.44(m,1H),4.07(s,3H),3.80(s,3H),1.23(d,J=6.0Hz,6H).
[0242] Example 29: Synthesis of 2-(3-((4-chlorophenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (71)
[0243] [ka]
[0244] To a solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (343 mg, 0.82 mmol) in dioxane (10 mL) under degassed argon, CsCO (812 mg, 2.5 mmol), Pd(dba) (76 mg, 0.08 mmol), Xantphos (48 mg, 0.082 mmol), and 4-chloroaniline (160 mg, 1.34 mmol) were added at room temperature. The reaction mixture was again degassed for 15 minutes, and the mixture was heated at 100 °C for 16 hours. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to give 2-(3-((4-chlorophenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (71) (50 mg, 13%) as an off-white solid. MS(ESI) m / z 455.26 [MH] - ; 1 H NMR(400MHz,DMSO-d6):δ 10.47(s,1H),9.12(s,1H),8.13(s,1H),7.64(dd,J=9.2,2.4Hz,2H),7.54(dd,J=13.6,2.4H z,1H),7.28(d,J=9.2Hz,3H),7.14(t,J=9.2Hz,1H),4.85(s,2H),4.10(s,3H),3.80(s,3H).
[0245] Example 30: Synthesis of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (77)
[0246] [ka]
[0247] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5.0 g, 29.22 mmol) in DMF (50 mL) was added KCO (12.07 g, 87.66 mmol) followed by ethyl iodide (2.58 mL, 32.14 mmol) at room temperature. The reaction mixture was stirred at the same temperature for 16 hours. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column to give methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.7 g, 29%). MS (ESI) m / z 200.07 [M+H] + . 1 H NMR (400MHz, DMSO-d6): δ 8.39(s,1H),4.75-4.70(m,1H),4.29(q,J=7.2Hz,2H),3.99(s,3H),1.38(d,J=7.2Hz,3H).
[0248] To a stirred solution of methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.8 g, 9.04 mmol) in MeOH (100 mL) was added 10% Pd / C (3.0 g). The reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 8 hours. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give methyl 4-amino-1-ethyl-1H-pyrazole-5-carboxylate (73) (1.5 g, 98% yield) as a brown solid. MS (ESI) m / z 170.2 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ 7.02(s,1H),5.00(brs,2H),4.31(q,J=7.2Hz,2H),3.80(s,3H),1.20(d,J=7.2Hz,3H).
[0249] To a stirred solution of ethyl 4-amino-1H-pyrazole-5-carboxylate (73) (1.8 g, 10.64 mmol) in n-butanol (80 mL) was added DIPEA (9.2 mL, 53.2 mmol) and formamidine acetate (1.21 g, 11.70 mmol) at room temperature. The reaction mixture was stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature, and the precipitated solid was filtered off. The solid was triturated with diethyl ether to give 1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (74) (1.2 g, 69%) as an off-white solid. MS (ESI) m / z 165.11 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 7.97 (s, 1H), 7.79 (s, 1H), 4.57 (q, J = 7.2Hz, 2H), 1.38 (d, J = 7.2Hz, 3H).
[0250] To a stirred solution of ethyl 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (74) (1.2 g, 7.31 mmol) in DMF (80 mL) was added NBS (2.86 g, 16.08 mmol) at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was cooled to room temperature and quenched with cold water. The precipitated solid was filtered off. The solid was dried under vacuum to give 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (1.0 g, 56%) as an off-white solid. MS (ESI) m / z 243.08 [M+2] + ; 1 H NMR (400MHz, DMSO-d6): δ 12.51 (s, 1H), 7.93 (s, 1H), 4.55 (q, J = 7.2Hz, 2H), 1.39 (d, J = 7.2Hz, 3H).
[0251] To a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (500 mg, 2.06 mmol) in DMF (30 mL) was added KCO (854 mg, 6.18 mmol) followed by 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (537.9 mg, 2.47 mmol) at room temperature. The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography on 100-200 silica to give 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (76) (400 mg, 46% yield) as an off-white solid. MS(ESI) m / z 424.29 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 8.24(s,1H),7.53(d,J=10.8Hz,1H),7.26(d,J=4.4Hz,1H),7.13(d,J=8.0Hz ,1H),4.86(s,2H),4.56(q,J=7.2Hz,2H),3.80(s,3H),1.39(d,J=7.2Hz,3H).
[0252] To a solution of 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (76) (330 mg, 0.777 mmol) in degassed (argon) dioxane (6 mL), CsCO (406 mg, 1.25 mmol), Pd(dba) (70.5 mg, 0.077 mmol), Xantphos (44.5 mg, 0.077 mmol), and 5-(trifluoromethyl)pyridin-2-amine (188 mg, 1.165 mmol) were added at room temperature. The solution was again degassed for 15 minutes, and the mixture was heated in a microwave oven at 100 °C for 3 hours. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure to give the crude material, which was purified by preparative HPLC to give 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (77) (103 mg, 26%) as a pale yellow solid. MS (ESI) m / z 505.31 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.47(s,1H),9.44(s,1H),8.16(s,1H),7.72(d,J=8.8Hz,2H),7.57(d,J=8.8Hz,2H),7.53(s,1H),7.27(d, J=8.8Hz,1H),7.14(t,J=9.2Hz,1H),4.81(s,2H),4.52(q,J=7.2Hz,2H),3.80(s,3H),1.39(t,J=7.2Hz,3H).
[0253] Example 31: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (80)
[0254] [ka]
[0255] To a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (600 mg, 2.46 mmol) and 2-bromo-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (78) (642 mg, 2.96 mmol) in DMF (20 mL) was added KCO (509 mg, 3.66 mmol) and stirred at room temperature for 16 h. The reaction mixture was diluted with water (10 mL) to give a solid which was filtered and washed with water to give 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (79) (300 mg, 27%) as a white solid. MS(ESI) m / z 448.48 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 8.26(d,J=7.6Hz,1H),8.15(s,1H),6.68(t,J=76.4Hz,1H),4.63(s,2H),4.50(q,J=7.6Hz,2H), 4.10-4.00(m,1H),3.60-3.50(m,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.60-1.20(s,7H).
[0256] To a stirred solution of 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (79) (500 mg, 1.12 mmol) in 1,4-dioxane (5 mL) was added 4-(trifluoromethyl)aniline (216 mg, 1.34 mmol) and cesium carbonate (1.1 g, 3.45 mmol). The reaction mixture was degassed with argon for 15 min, and then Pd(dba) (103 mg, 0.11 mmol) and Xantphos (63 mg, 0.11 mmol) were added. The reaction mixture was again degassed with argon for 5 min, and then the reaction mixture was stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated to give the crude product, which was purified by silica column chromatography to give N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (80) (120 mg, 20% yield) as a white solid. MS (ESI) m / z 529.56 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.23(d,J=7.6Hz,1H),8.08(s,1H),7.71(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),6.69(t,J=76.4Hz,1H),4.64( s,2H),4.50(q,J=7.6Hz,2H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.30(s,7H).
[0257] Example 32: Synthesis of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)acetamide (84)
[0258] [ka]
[0259] To a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (1.9 g, 7.81 mmol) in DMF (100 mL) was added KCO (2.1 g, 15.6 mmol), followed by tert-butyl bromoacetate (1.4 mL, 9.38 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography on silica (100-200) to give tert-butyl 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (81) (2.3 g, 82% yield) as an off-white solid. MS(ESI) m / z 357.42 [M+H] + ; 1 H NMR (400MHz, CDCl3): δ 8.24 (s, 1H), 4.74 (s, 2H), 4.57 (q, J=7.2Hz, 2H), 1.41 (s, 9H).
[0260] To a solution of tert-butyl 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (81) (2.3 g, 6.46 mmol) in dioxane (25 mL) under degassed argon, CsCO (6.2 g, 19.38 mmol), Pd(dba) (591 mg, 0.64 mmol), Xantphos (373 mg, 0.64 mmol), and 4-(trifluoromethyl)aniline (1.0 g, 6.46 mmol) were added at room temperature. The solution was again degassed for 15 min, and the mixture was heated in a sealed tube at 100 °C for 3 h. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give tert-butyl 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (82) (1.8 g, 64%) as a pale yellow solid. MS(ESI) m / z 438.09 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.46(s,1H),8.16(s,1H),7.72(d,J=8.4Hz,2H),7.57(d,J=8.4Hz,2H),4.74(s,2H),4.50(q,J=7.2Hz,2H),1.44(s,9H),1.38(t,J=7.2Hz,3H).
[0261] To a stirred solution of tert-butyl 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (82) (1.8 g, 4.11 mmol) in DCM (10 mL) was added a 4 M HCl solution in dioxane (10 mL) at 0 °C. The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was evaporated under reduced pressure, triturated with ether, and dried under reduced pressure to give 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (83) (1.1 g, 7.3%) as a pale yellow solid. MS (ESI) m / z 382.46 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.46(s,1H),8.17(s,1H),7.71(d,J=8.4Hz,2H),7.57(d,J=8.4Hz,2H),4.77(s,2H),4.52(q,J=7.2Hz,2H),1.40(t,J=7.2Hz,3H).
[0262] To a stirred solution of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (83) (250 mg, 0.65 mmol) in DMF (3 mL) was added HATU (374 mg, 0.98 mmol) and DIPEA (0.36 mL, 1.96 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, 2-(((1r,4r)-4-aminocyclohexyl)methoxy)propan-2-ol (147 mg, 0.78 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)acetamide (84) (39 mg, 10%) as an off-white solid. MS(ESI) m / z 551.72 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.44(s,1H),8.20(d,J=7.6Hz,1H),8.07(s,1H),7.71(d,J=8.4Hz,2H),7.56(d ,J=8.8Hz,2H),4.63(s,2H),4.51(q,J=4.4Hz,1H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.39(t,J=7.2Hz,3H),1.30-1.20(m,4H),1.05(s,6H).
[0263] Example 33: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (92)
[0264] [ka]
[0265] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g, 58.4 mmol) in DMF (100 mL) was added KCO (16.1 g, 116.9 mmol) followed by 2,2,2-trifluoroethyl trifluoromethanesulfonate (12.7 mL, 87.7 mmol) at room temperature. The reaction mixture was stirred at the same temperature for 16 hours. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column chromatography to give methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (85) (4 g, 32% yield) as a colorless liquid, and further elution afforded another isomer, methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-3-carboxylate (85a) (5 g). MS (ESI) m / z 254.14 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 9.57 (s, 1H), 5.41 (q, J = 7.20Hz, 2H), 3.98 (s, 3H).
[0266] To a stirred solution of methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (85) (3.3 g, 13.04 mmol) in MeOH (33 mL) was added 10% Pd / C (2 g), and the reaction mixture was stirred under an atmosphere of hydrogen (50 PSI) at room temperature for 16 hours. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give methyl 4-amino-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (86) (2.3 g, 82% yield). MS (ESI) m / z 224.09 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ 7.24 (s, 1H), 5.09 (q, J = 7.20Hz, 2H), 4.20 (s, 2H), 3.93 (s, 3H).
[0267] To a stirred solution of methyl 4-amino-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (86) (2.3 g, 10.31 mmol) in n-butanol (23 mL) was added DIPEA (9.5 mL, 51.56 mmol) and formamidine acetate (2.1 g, 20.62 mmol) at room temperature. The reaction mixture was stirred at 110 °C for 16 h. The reaction mixture was cooled to room temperature, and the precipitated solid was filtered off. The solid was triturated with diethyl ether to give 1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (87) (2 g, 89% yield) as an off-white solid. MS (ESI) m / z 218.04 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 12.52 (brs, 1H), 8.21 (s, 1H), 7.98 (s, 1H), 5.46 (q, J = 7.20Hz, 2H).
[0268] To a stirred solution of 1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (87) (1.6 g, 7.33 mmol) in DMF (16 mL) was added NBS (6.5 g, 36.69 mmol) at room temperature. The reaction mixture was stirred at 110 °C for 30 h. The reaction mixture was cooled to room temperature and quenched with cold water. The precipitated solid was filtered off. The solid was dried under vacuum to give 3-bromo-1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (88) (1.0 g, 46% yield) as an off-white solid. MS(ESI)m / z 297.04[M+H] - ; 1 H NMR (400MHz, DMSO-d6): δ 12.79 (brs, 1H), 8.04 (s, 1H), 5.46 (q, J = 7.20Hz, 2H).
[0269] To a stirred solution of 3-bromo-1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (88) (1.0 g, 3.3 mmol) in DMF (10 mL) was added KCO (935 g, 6.77 mmol), followed by tert-butyl bromoacetate (0.7 mL, 5.08 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography on silica (100-200) to give tert-butyl 2-(3-bromo-7-oxo-1-(2,2,2-trifluoroethyl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (89) (600 mg, 43% yield) as an off-white solid. MS(ESI) m / z 410.02 [M+H] + ;411.20.
[0270] To a solution of tert-butyl 2-(3-bromo-7-oxo-1-(2,2,2-trifluoroethyl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (89) (400 mg, 0.97 mmol) in degassed (argon) dioxane (5 mL) was added CsCO (951 g, 2.92 mmol), Pd(dba) (89 mg, 0.09 mmol), Xantphos (56 mg, 0.09 mmol), and 4-(trifluoromethyl)aniline (157 g, 0.97 mmol) at room temperature. The solution was again degassed for 15 min, and the mixture was heated in a sealed tube at 100 °C for 3 h. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give tert-butyl 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (90) (250 mg, 52% yield) as a pale yellow solid. MS (ESI) m / z 491.13 [M+H] + ;492.27.
[0271] To a stirred solution of tert-butyl 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (90) (250 mg, 0.50 mmol) in 1,4-dioxane (3 mL) was added a 4 M HCl solution in dioxane (3 mL). The reaction mixture was stirred at room temperature for 48 hours. The reaction mixture was evaporated under reduced pressure, triturated with ether, and dried under reduced pressure to give 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (91) (200 mg, 90%) as a pale yellow solid. MS(ESI)m / z 435.07[M+H] + ; 1H NMR(400MHz,DMSO-d6):δ 13.32(br s,1H),9.71(s,1H),8.30(s,1H),7.99(d,J=8.40Hz,2H),7.61(d,J=8.8Hz,2H),5.35(q,J=8.80Hz,2H),4.78(s,2H).
[0272] To a stirred solution of 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (91) (200 mg, 0.45 mmol) in DMF (3 mL) was added HATU (262 mg, 0.68 mmol) and DIPEA (0.25 mL, 1.37 mmol) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then, 2-(((1r,4r)-4-aminocyclohexyl)methoxy)propan-2-ol (103 mg, 0.55 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to give N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (92) (50 mg, 18% yield) as an off-white solid. MS(ESI) m / z 605.36 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 9.70(s,1H),8.30-8.20(m,2H),7.81(d,J=8.4Hz,2H),7.60(d,J=8.8Hz,2H),5.34(q,J=8.80Hz,2H),4.64(s,2H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.14(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).
[0273] Example 34: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-isopropyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (98)
[0274] [ka]
[0275] To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5 g, 29.22 mmol) in DMF (50 mL) was added KCO (8.04 g, 58.44 mmol) followed by 2-iodopropane (5.46 g, 32.11 mmol) at room temperature, and the reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by silica gel column chromatography to give methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g, 32%). MS (ESI) m / z 213.07 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 8.41 (s, 1H), 4.75-4.70 (m, 1H), 4.00 (s, 2H), 1.44 (d, J = 6.8Hz, 6H).
[0276] To a stirred solution of methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g, 9.38 mmol) in MeOH (20 mL) was added 10% Pd / C (1.0 g). The reaction mixture was stirred under an atmosphere of hydrogen (50 PSI) at room temperature for 8 hours. The reaction mixture was filtered through a pad of Celite, and the filtrate was concentrated to give methyl 4-amino-1-isopropyl-1H-pyrazole-5-carboxylate (94) (1.4 g, 81% yield) as a brown solid. MS (ESI) m / z 184.20 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ 7.05 (s, 1H), 5.30-5.15 (m, 1H), 4.99 (s, 2H), 3.79 (s, 3H), 1.31 (d, J = 6.8Hz, 6H).
[0277] To a stirred solution of methyl 4-amino-1-isopropyl-1H-pyrazole-5-carboxylate (94) (1.4 g, 7.64 mmol) in n-butanol (80 mL), DIPEA (6.65 mL, 38.2 mmol) and formamidine acetate (874.9 mg, 8.40 mmol) were added at room temperature. The reaction mixture was stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature, and the precipitated solid was filtered off. The solid was triturated with diethyl ether to give 1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (95) (1.0 g, 73%) as an off-white solid. MS (ESI) m / z 179.18 [M+H] + .
[0278] To a stirred solution of 1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (95) (1 g, 5.61 mmol) in DMF (10 mL) was added NBS (2.19 g, 12.34 mmol) at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was cooled to room temperature and quenched with cold water. The precipitated solid was filtered off. The solid was dried under vacuum to give 3-bromo-1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (96) (700 mg, 49%) as an off-white solid. MS (ESI) m / z 257.21 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ 12.51 (s, 1H), 7.92 (s, 1H), 5.40-5.30 (m, 1H), 4.87 (s, 2H), 1.47 (d, J = 6.8Hz, 6H).
[0279] To a stirred solution of 3-bromo-1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (96) (500 mg, 1.94 mmol) in DMF (10 mL) was added KCO (803.1 mg, 5.82 mmol) followed by 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (423 mg, 1.94 mmol) at room temperature. The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous NaSO, filtered, and concentrated. The residue was purified by flash column chromatography on 100-200 silica to give 2-(3-bromo-1-isopropyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (97) (350 mg, 41% yield) as an off-white solid. MS(ESI) m / z 438.28 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.57(brs,1H),8.24(s,1H),7.54(d,J=10.8Hz,1H),7.26(d,J=8.8Hz,1H),7.15(d ,J=8.8Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.45(d,J=6.8Hz,6H).
[0280] To a solution of 2-(3-bromo-1-isopropyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (97) (330 mg, 0.752 mmol) in degassed (argon) dioxane (6 mL), CsCO (735 mg, 2.25 mmol), Pd(dba) (68 mg, 0.075 mmol), Xantphos (43 mg, 0.075 mmol), and 5-(trifluoromethyl)pyridin-2-amine (181 mg, 1.12 mmol) were added at room temperature. The solution was again degassed for 15 minutes, and the reaction mixture was heated in a microwave oven at 100 °C for 3 hours. The reaction mixture was cooled to room temperature and filtered through a Celite pad. The Celite pad was washed with 5% MeOH in CHCl. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to give N-(3-fluoro-4-methoxyphenyl)-2-(1-isopropyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (98) (74 mg, 19%) as a pale yellow solid. MS (ESI) m / z 519.17 [M+H] + ; 1 H NMR(400MHz,DMSO-d6):δ 10.49(s,1H),9.46(s,1H),8.16(s,1H),7.70(d,J=8.8Hz,2H),7.57(d,J=8.8Hz,2H),7.53(s,1H),7.27(d ,J=8.8Hz,1H),7.14(t,J=9.2Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.47(d,J=6.8Hz,6H).
[0281] Example 35: SF-1 Luc assay Vector Construction: pGal4DBD_SF-1LBD was generated by cloning a polymerase chain reaction fragment encoding the ligand-binding domain (LBD) of human SF-1 (aa 198-462) in frame with the DNA-binding domain (DBD) of the yeast transcription factor Gal4 encoded by the pFA-CMV vector (Stratagene, La Jolla, CA). SF-1 (aa 198-462) was amplified from an Invitrogen expressed sequence tag clone (San Diego, CA). BamHI and XbaI sites introduced by primers GATCGGATCCCCGGAGCCTTATGCCAGCCC (forward) and GATCTCTAGATCAAGTCTGCTTGGCTTGCAGCATTTCGATGAG (reverse) were used to subclone the amplicon into pFA-CMV.
[0282] Cell culture and transient transfection conditions: Chinese hamster ovary (CHO) cells of the K1 subtype (American Type Culture Collection, Manassas, VA) were grown in T-175 flasks (Corning Life Sciences, Acton, MA) at 37°C, 5% CO2, and 95% relative humidity in Ham's F-12 medium (Gibco, Carlsbad, CA) supplemented with 10% (v / v) fetal bovine serum (Gemini Bio-products, West Sacramento, CA) and 1% (v / v) penicillin / streptomycin (Gibco). Cells were routinely cultured by splitting cells 1:10 to 1:20. The day before transfection, cells were rinsed with PBS, trypsinized with 0.25% trypsin-EDTA solution (Gibco), and then diluted to 6 × 10 6CHO-K1 cells were plated in a T-175 flask containing 20 mL of Ham's F-12 medium supplemented as described above. The cells were incubated overnight at 37°C, 5% CO2, and 95% relative humidity (RH). The next day, CHO-K1 cells were transiently co-transfected with either 250 ng of pGal4DBD_SF-1LBD plasmid or 125 ng of pGal4DBD_RORALBD in combination with 9 μg of pG5luc (Promega, Madison, WI) and 8.75 μg of empty pcDNA3.1 (Invitrogen) in 1.2 mL of Ham's F-12 medium containing 54 μL of TransIT-CHO Reagent and 9 μL of TransIT-CHO Mojo Reagent according to the manufacturer's protocol (Mirus Bioproducts, Madison, WI). The flask containing the transfected cells was then returned to the incubator at 37°C, 5% CO2, and 95% relative humidity. Four hours after transfection, 1.6 x 10 cells were cultured in supplemented Ham's F-12 medium. 5 Cells were trypsinized and suspended at a concentration of cells / ml.
[0283] Assay: Harvested cells were resuspended in culture medium and seeded into 384-well white plates (Corning Life Sciences, Acton, MA) at 8,000 cells / 50 μL / well. The 384-well plates were incubated at room temperature for 1 hour, then further incubated at 37°C, 5% CO2 for 3 hours. Test article solution was added to the 384-well plates and incubated at 37°C, 6% CO2 for 40 hours.
[0284] Cell viability was tested by a fluorescence method using resazurin. After incubating the transfected CHO cells with the test substance solution, 10 μL of 20 μmol / L resazurin solution was added to a 384-well plate. Fluorescence was then immediately measured at 615 nm with an excitation wavelength of 570 nm (readout 0 hours). After 2 hours of incubation at 37°C and 6% CO2, fluorescence was measured at 615 nm with an excitation wavelength of 570 nm again (readout 2 hours). The fluorescence count (2 hours - 0 hours) was calculated by subtracting the readout 0 hours from the readout 2 hours.
[0285] Measurement of SF-1 transcriptional activity: SF-1 transcriptional activity was detected as intracellular Luc activity using the SteadyLite Plus HTS Reporter Gene Assay System. After measuring cell viability, the culture medium in the 384-well plate was completely removed. Then, 30 μL of Luc substrate solution was added to each well and incubated at room temperature for 10 minutes. After incubation, the luminescence of each well was measured using a microplate reader.
[0286] Calculation of cell viability (%): Cell viability (%) was calculated by the following equation: Equation: Cell viability (%)=(A / B)×100 A: Average fluorescence intensity in the test substance group (2 hours - 0 hours) B: Mean fluorescence count in the vehicle group (2 hours - 0 hours)
[0287] Calculation of SF-1 transcription activity (% of control): The % of control for transcription activity was calculated by the following equation: Equation: % of control = A / B x 100 A: Luminescence counts of CHO cells transfected with GAL4-SF-1 plasmid and treated with test substances. B: Luminescence counts of vehicle-treated CHO cells transfected with GAL4-SF-1 plasmid.
[0288] EC50 Calculation: The half maximal effective concentration (EC50) was calculated by the embedded software of Collaborative Drug Discovery Inc. (CDD). The potency of the compounds is shown in Table 1:
[0289] [Table 1]
[0290] Example 36: R2C proliferation assay for SF-1 antagonists SF-1 regulates the formation and survival of progenitor cells in adult Leydig cells. We investigated the antiproliferative effects of SF-1 antagonists in the SF-1+ rat Leydig tumor cell line, R2C. Cell proliferation was measured by detecting the DNA incorporation of EdU, a fluorescently tagged nucleoside analog, after cell colonization.
[0291] method Proliferation of the rat Leydig tumor cell line R2C (ATCC® CCL-97™) was assessed using 5-ethynyl-2'-deoxyuridine (EdU), a nucleoside analogue incorporated during DNA synthesis that can be fluorescently tagged after cell establishment. Cycloheximide, a protein synthesis inhibitor, was used as a positive control for this assay.
[0292] R2C cells were maintained according to the protocol provided by the American Type Culture Collection (ATCC). For the assay, R2C cells were diluted to 1 million cells / mL in culture medium (F12 medium supplemented with 2% FBS and 1% penicillin-streptomycin), and 50 μL of the cell suspension was plated into each well of a 384-well clear-bottom plate. The assay plate was incubated at 37°C in a humidified atmosphere with 6% CO2 for 24 hours. Serially diluted SF-1 antagonists, cycloheximide, or vehicle (DMSO) were then applied to the R2C cells and incubated for 2 days in a humidified atmosphere with 37°C and 6% CO2. EdU (Invitrogen) was added to the cells at a final concentration of 5 μM and incubated for an additional 16 hours. Afterwards, the cells were fixed with 10% formalin.
[0293] The cells were then washed and permeabilized with 0.5% TritonX-100 / PBS solution for 1 hour at room temperature. EdU incorporation was detected by labeling EdU with 6-FAM azide (Lumiprobe) using a copper(I)-catalyzed click reaction between azide and alkyne. The reaction mixture consisted of 5 mM ascorbic acid, 1 mM CuSO4, and 1 μM 6-FAM azide dissolved in PBS buffer. Fluorescence signals were detected using an EnVision 2104 Multimode Plate Reader. For data normalization, the mean fluorescence of the DMSO wells was set as 100% and the mean fluorescence of the 10 μM cycloheximide wells was set as 0%. Curve fitting and EC 50 Determination of was performed using a variable slope sigmoidal dose-response analysis.
[0294] Preparation of various media and reagents Preparation of R2C medium
[0295] Preparation: Culture medium was prepared by adding 92 mL of horse serum (Invitrogen), 15.5 mL of fetal bovine serum, and 6.1 mL of a solution of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) to 500 mL of Ham's F-12 medium (Invitrogen). The medium was stored in a refrigerator (set at 4°C) and used within one month of preparation.
[0296] Preparation of R2C plating medium
[0297] Preparation: Culture medium was prepared by adding 10 mL of fetal bovine serum and 5.1 mL of a solution of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) to 500 mL of Ham's F-12 medium. The medium was stored in a refrigerator (set at 4°C) and used within one month of preparation.
[0298] Preparation of R2C daughter plate medium
[0299] Preparation: Culture medium was prepared by adding 50 mL of fetal bovine serum and 5.5 mL of a solution of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) to 500 mL of Ham's F-12 medium. The medium was stored in a refrigerator (set at 4°C) and used within one month of preparation.
[0300] Preparation of cycloheximide (positive control) solution
[0301] Preparation method: Cycloheximide was dissolved in DMSO to a concentration of 5 mmol / L. The 5 mmol / L solution was diluted 20-fold and added to R2C daughter plate medium to obtain daughter plates. The daughter plates were then added to the assay plate to obtain the final test conditions.
[0302] Preparation of test substance solutions
[0303] Preparation method: Test articles were dissolved in DMSO to a concentration of 10 mmol / L. The 10 mmol / L solution was further diluted in DMSO to a concentration of 256 μmol / L. The 10 mmol / L and / or 256 μmol / L solutions were diluted 2.5-fold into vehicle to obtain 10-point dilutions. These solutions were diluted 20-fold into R2C daughter plate medium to obtain serially diluted daughter plates of test articles. The daughter plates were then added to the assay plates to obtain the final test conditions.
[0304] Preparation of EdU seeding solution
[0305] Preparation method: EdU was dissolved in DMSO to obtain a 30 mmol / L EdU stock solution. The 30 mmol / L EdU stock solution was stored in a freezer (set at -20°C). At the time of use, 25 μL of the 30 mM EdU stock solution was added to 25 mL of R2C seeding medium to obtain the EdU seeding solution.
[0306] Preparation of 6-FAM azide solution
[0307] Preparation method: 6-FAM azide was dissolved in DMSO to a concentration of 30 mmol / L. The 30 mmol / L stock solution was further diluted to 1 mmol / L to obtain a working solution.
[0308] Preparation of 25 mL of 2x mounting mix solution
[0309] Preparation: Ascorbic acid was dissolved in PBS to a concentration of 1 mol / L. Copper(II) sulfide was dissolved in water to a concentration of 0.2 mol / L. 25 mL of 2x mounting mixture was prepared by adding 1: 24.4 mL of PBS, 2: 0.25 mL of 1 M ascorbic acid solution, 3: 0.25 mL of 0.2 M CuSO4 solution, and 4: 0.05 mL of 1 mM 6-FAM azide DMSO solution. This 2x mounting mixture was used during preparation.
[0310] Hoechst33258 staining solution
[0311] Preparation: Ascorbic acid was dissolved in PBS to a concentration of 1 mol / L. Copper(II) sulfide was dissolved in water to a concentration of 0.2 mol / L. 25 mL of 2x mounting mixture was prepared by adding 1: 24.4 mL of PBS, 2: 0.25 mL of 1 M ascorbic acid solution, 3: 0.25 mL of 0.2 M CuSO4 solution, and 4: 0.05 mL of 1 mM 6-FAM azide DMSO solution. This 2x mounting mixture was used during preparation.
[0312] Test Procedure
[0313] Incubation of R2C cells with test substances
[0314] R2C cells were routinely cultured in R2C culture medium. To analyze SF-1 antagonist inhibitory activity, R2C cells were resuspended in R2C seeding medium and seeded into 384-well black clear-bottom plates at 20,000 cells / 50 μL / well. The 384-well plates were incubated at 37°C and 6% CO2 for 24 hours to allow cells to adhere to the assay plate. Serially diluted test substance solutions, cycloheximide positive control solutions, or vehicle solutions were then added to the 384-well plates and incubated at 37°C and 6% CO2 for 2 days. 10 μL of EdU seeding solution was then dispensed into each well of the assay plate and incubated at 37°C and 6% CO2 for 2 days.
[0315] Measurement of R2C cell proliferation
[0316] R2C proliferation was measured by detecting fluorescently labeled EdU. R2C assay plates were fixed by dispensing 60 μL of 10% formalin into each well and incubated on an orbital shaker for 1 hour at room temperature. The plates were washed three times with 80 μL of PBS, and the cells were permeabilized by treating with 100 μL of PBS-0.5% Triton X-100 for 1 hour at room temperature on an orbital shaker. The plates were washed three times with 80 μL of PBS, and after the final wash, 25 μL of PBS was dispensed into each well. Then, 25 μL of 2x mounting mixture was added to each well of fixed cells, and the plates were incubated on an orbital shaker in the dark for 30 minutes at room temperature. The cells were washed three times with 80 μL of PBS, and after the final wash, 25 μL of PBS was dispensed into each well. Next, 25 μL of Hoechst 33258 staining solution was added to each well of fixed cells, and the plate was incubated for 30 minutes at room temperature on an orbital shaker in the dark. The cells were washed three times with 80 μL of PBS, and after the final wash, 50 μL of PBS was dispensed into each well. The assay plate was sealed with aluminum foil, and fluorescence was measured using an Envision microplate reader.
[0317] Calculation of R2C proliferation activity (% of control)
[0318] The % of control for proliferation activity was calculated by the following equation: Equation: % of control = 100 x (AC) / (BC) A: Fluorescence count of R2C cells treated with test substance B: Fluorescence counts of vehicle-treated R2C cells C: Fluorescence counts of R2C cells treated with 10 μM cycloheximide
[0319] EC50 Calculation: The half maximal effective concentration (EC50) was calculated by the embedded software of Collaborative Drug Discovery Inc. (CDD). The potency of the compounds is shown in Table 2:
[0320] [Table 2]
Claims
1. Formula (I): 【Chemistry 1】 or a pharmaceutically acceptable salt or solvate thereof, During the ceremony, X is a bond or C 1 -C 6 is alkylene, R 1 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, —CH 2 C 6-10 Aryl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 3-8 cycloalkyl, the C 2-9 heterocycloalkyl, the —CH 2 C 6-10 aryl, the C 6-10 aryl, and the C 1-9 Heteroaryl is one, two, three, four, or five R 4 is optionally replaced by R 2 is C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 3-8 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is one, two, three, four, or five R 5 is optionally replaced by R 3 is hydrogen, C 1 -C 6 Alkyl, C 1 -C 6 haloalkyl, or C 3-8 is cycloalkyl, Each R 4 and each R 5 are each independently a halogen, —CN, or C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, —OR 6 , -SR 6 , -C(O)OR 6 , -OC(O)N(R 6 ) (R 7 ), -N(R 8 )C(O)N(R 6 ) (R 7 ), -N(R 8 ) C(O)R 9 , -N(R 8 )C(O)OR 9 , -N(R 8 ) S (O) 2 R 9 , -C(O)R 9 , -OC(O)R 9 , -C(O)N(R 6 ) (R 7 ), -C(O)C(O)N(R 6 ) (R 7 ), -S(O)R 9 , -S(O) 2 R 9 , and -S(O) 2 N (R 6 ) (R 7 ) wherein C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 Alkynyl, the C 3-6 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is a group containing halogen, —CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, —OR 10 , -SR 10 , -C(O)OR 10 , -OC(O)N(R 10 ) (R 11 ), -N(R 12 )C(O)N(R 10 ) (R 11 ), -N(R 12 ) C(O)R 13 , -N(R 12 )C(O)OR 13 , -N(R 12 ) S (O) 2 R 13 , -C(O)R 13 , -OC(O)R 13 , -C(O)N(R 10 ) (R 11 ), -C(O)C(O)N(R 10 ) (R 11 ), -S(O)R 13 , -S(O) 2 R 13 , and -S(O) 2 N (R 10 ) (R 11 Optionally substituted with 1, 2, or 3 groups selected from R 6 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 Alkynyl, the C 3-6 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is substituted with halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with one, two, or three groups selected from heteroaryl; R 7 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 8 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 9 are each independently C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 Alkynyl, the C 3-6 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is a group containing halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with one, two, or three groups selected from heteroaryl; R 10 are each independently hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 Alkynyl, the C 3-6 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is a group containing halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with one, two, or three groups selected from heteroaryl; R 11 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 12 are each independently hydrogen, C 1-6 Alkyl, and C 1-6 haloalkyl; R 13 are each independently C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 heteroaryl, wherein C 1-6 alkyl, the C 2-6 alkenyl, the C 2-6 Alkynyl, the C 3-6 cycloalkyl, the C 2-9 Heterocycloalkyl, the C 6-10 aryl, and the C 1-9 Heteroaryl is a group containing halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, and C 1-9 optionally substituted with 1, 2, or 3 groups selected from heteroaryl; The compound, or a pharmaceutically acceptable salt or solvate thereof.
2. The R 1 But C 6-10 Aryl and C 1-9 heteroaryl, wherein C 6-10 Aryl and the C 1-9 The heteroaryl may be one, two, three, four, or five R 4 10. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, optionally substituted with:
3. The compound of claim 2, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 is phenyl optionally substituted with one, two, or three R 4 .
4. The compound of claim 3, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 4 is independently selected from halogen, C 1-6 alkyl, C 1-6 haloalkyl, and —OR 6 .
5. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 is C 3-8 cycloalkyl optionally substituted with 1, 2, 3, 4, or 5 R 5 .
6. The compound of claim 5, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 is cyclohexyl optionally substituted with one, two, or three R 5 .
7. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 is phenyl optionally substituted with one, two, or three R 5 .
8. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 5 is independently selected from halogen, C 1-6 haloalkyl, -OR 6 , and C 1-6 alkyl optionally substituted with one group selected from -OR 10 , -C(O)OR 10 , -C(O)N(R 10 )(R 11 ), -S(O) 2 R 13 , and -S(O) 2 N(R 10 )(R 11 ).
9. The compound of claim 8, wherein each R 6 is independently selected from hydrogen and C 1-6 alkyl optionally substituted with 1, 2, or 3 groups selected from halogen and hydroxy, and each R 10 is independently selected from hydrogen, C 1-6 alkyl, and C 1-6 haloalkyl, or a pharmaceutically acceptable salt or solvate thereof.
10. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 is C 1 -C 6 alkyl.
11. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein X is a bond.
12. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein X is C 1 -C 6 alkylene. 【Request Item 13】 【Chemistry 2】 【Transformation 3】 【Chemistry 4】 2. The compound of claim 1 selected from: or a pharmaceutically acceptable salt or solvate thereof.
14. A pharmaceutical composition comprising a pharmaceutically acceptable diluent, excipient, or binder and a compound according to any one of claims 1 to 13, or a pharmaceutically acceptable salt or solvate thereof.
15. Use of a compound according to any one of claims 1 to 13, or a pharmaceutically acceptable salt or solvate thereof, in the manufacture of a medicament for treating 1) cancer in a mammal, 2) an endocrine disease in a mammal, or 3) endometriosis in a mammal.
16. The use of claim 15, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenomas, and sex cord-stromal tumors.
Citation Information
Patent Citations
Heterocyclic compounds and methods of making and using them
JP2007509966A
Polymorphism of dihydropyrazolopyrimidinone derivatives as WEEL kinase inhibitors
JP2010525057A
Inhibitors of cellular metabolic processes
JP2019529529A
New TRPA1 antagonists
WO2015155306A1
Heterocyclic compounds and uses thereof
WO2019074979A1