Detection method and primer set for Dickeya dadantii
A novel primer set for PCR amplifies the 3' untranslated region of the transposon transferase gene in Dickeya dadantii, addressing low sensitivity issues in existing methods, enabling highly sensitive and cost-effective detection and quantification of the bacterium in plant and culture media.
Patent Information
- Application Number
- JP2025146733
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-09-04
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-09-04
AI Technical Summary
Existing PCR methods for detecting Dickeya dadantii suffer from low sensitivity, making it difficult to accurately identify the bacterium in plant samples.
A novel primer set comprising specific base sequences, including a first primer with adenine and cytosine at certain positions and a second primer with guanine at a specific position, is used for PCR to amplify the 3' untranslated region of the transposon transferase gene in Dickeya dadantii, enabling high-sensitivity detection.
The primer set allows for highly sensitive detection of Dickeya dadantii, with a detection limit approximately 10 to 1000 times lower than previous methods, and can be used in conventional and real-time PCR, facilitating accurate identification and quantification of the bacterium in plant and culture media.
Smart Images

Figure 0007807127000008 
Figure 0007807127000009 
Figure 0007807127000010
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method and a primer set for detecting Dickeya dadantii. [Background technology]
[0002] Dickeya dadantii is a multi-pathogenic bacterium that causes various plant diseases, such as bacterial stem and root rot of sweet potato, acute withering of peach, and acute decline of apple.
[0003] For example, Non-Patent Document 1 discloses the base sequences of primers capable of detecting Dickeya dadantii DNA.
[0004] By subjecting primers having the base sequences disclosed in Non-Patent Document 1 to conventional PCR or real-time PCR, the coding region of an unknown protein in Dickeya dadantii can be amplified, and the pathogen can be detected. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Wu X, Luo J, Sun G, Yi J, Li B, An Q (2019) Detection of stem and root rot pathogen of sweet potato based on conserved signature genes specific to Dickeya dadantii. Acta Phytopathologica Sinica 49(5):688-698. (10.13926 / j.cnki.apps.000298) Summary of the Invention [Problem to be solved by the invention]
[0006] However, PCR using the primers of Non-Patent Document 1 has a problem in that the detection sensitivity for Dickeya dadantii is low.
[0007] The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a novel technique that enables Dickeya dadantii to be detected with high sensitivity. [Means for solving the problem]
[0008] In order to solve the above problems, one aspect of the present invention includes the following aspects. [1] A primer set comprising: a first primer consisting of a base sequence of 18 to 34 consecutive bases in the base sequence shown in SEQ ID NO: 1 and containing an adenine and a cytosine located at the 21st and 22nd positions from the 5' end of the base sequence shown in SEQ ID NO: 1; and a second primer consisting of a base sequence of 18 to 34 consecutive bases in the base sequence shown in SEQ ID NO: 2 and containing a guanine located at the 17th position from the 5' end of the base sequence shown in SEQ ID NO: 2.
[0009] [2] The primer set according to [1], wherein the first primer consists of a base sequence of 22 to 26 consecutive bases in the base sequence shown in SEQ ID NO: 3, and the second primer consists of a base sequence of 22 to 26 consecutive bases in the base sequence shown in SEQ ID NO: 4.
[0010] [3] The primer set according to [1] or [2], wherein the first primer consists of the base sequence shown in SEQ ID NO: 5, and the second primer consists of the base sequence shown in SEQ ID NO: 6.
[0011] [4] A method for detecting Dickeya dadantii, comprising a step of carrying out PCR using DNA contained in a sample as a template and the primer set according to any one of [1] to [3].
[0012] [5] The method for detecting Dickeya dadantii according to [4], wherein the DNA is extracted from a plant or DNA extracted from a culture medium for cultivating the plant.
[0013] [6] The method for detecting Dickeya dadantii according to [5], wherein the plant is a sweet potato, a potato, an apple, a pear, a peach, a banana, a mango, corn, or Brassica rapa.
[0014] [7] The method for detecting Dickeya dadantii according to any one of [4] to [6], comprising a step of electrophoresing the reaction solution after the PCR, wherein the PCR is conventional PCR. [Effects of the Invention]
[0015] According to the present invention, a novel technique capable of detecting Dickeya dadantii with high sensitivity can be provided. [Brief explanation of the drawings]
[0016] [Figure 1] Figure 1 is an electrophoresis image showing the results of PCR using a pair of designed primers, a first primer consisting of the base sequence shown in SEQ ID NO: 5 and a second primer consisting of the base sequence shown in SEQ ID NO: 6. [Figure 2] FIG. 2 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to sweet potato, and then performing conventional PCR using the extracted DNA as a template and the primers described in Non-Patent Document 1. [Figure 3] FIG. 3 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to soil and then performing conventional PCR using the extracted DNA as a template and the primers described in Non-Patent Document 1. [Figure 4]FIG. 4 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to sweet potato, and then performing conventional PCR using the extracted DNA as a template and the first and second primers. [Figure 5] FIG. 5 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to soil and then performing conventional PCR using the extracted DNA as a template and the first and second primers. [Figure 6] FIG. 6 is an electrophoresis image showing the results of conventional PCR carried out using DNA extracted from purely cultured Dickeya dadantii as a template and the primers described in Non-Patent Document 1. [Figure 7] FIG. 7 is an electrophoresis image showing the results of conventional PCR using DNA extracted from purely cultured Dickeya dadantii as a template and the first and second primers. [Figure 8] Figure 8 shows the melt curve and standard curve obtained when Dickeya dadantii was added to sweet potato and real-time PCR was performed using the extracted DNA as a template and the first and second primers. [Figure 9] Figure 9 shows the melt curve and standard curve obtained when Dickeya dadantii was added to soil and real-time PCR was performed using the extracted DNA as a template and the first and second primers. [Figure 10] FIG. 10 shows the melt curve and standard curve obtained as a result of performing real-time PCR using DNA extracted from purely cultured Dickeya dadantii as a template and the first and second primers. [Figure 11]FIG. 11 is an electrophoresis image showing the results of conventional PCR performed on a crude sample of sweet potato tuberous root to which a Dickeya dadantii fungal suspension had been added, which was then heated and crushed, using the first and second primers. [Figure 12] FIG. 12 is an electrophoresis image showing the results of conventional PCR performed on a crude sample of sweet potato stem to which a Dickeya dadantii fungal suspension had been added, which was then heated and crushed, using the first and second primers. [Figure 13] FIG. 13 is an electrophoretic image showing the results of conventional PCR performed on DNA extracted from multiple strains of Dickeya dadantii and related species using the primers described in Non-Patent Document 1. [Figure 14] FIG. 14 is an electrophoresis image showing the results of conventional PCR performed on DNA extracted from multiple strains of Dickeya dadantii and related species, using the first and second primers. [Figure 15] FIG. 15 is an electrophoresis image showing the results of multiplex PCR using the first and second primers and the third and fourth primers. DETAILED DESCRIPTION OF THE INVENTION
[0017] As used herein, the term "comprise" means that it may contain components other than the target component. The term "consist of" means that it does not contain components other than the target component. As used herein, the term "comprise" encompasses both embodiments that "consist of" and embodiments that "consist essentially of." The term "consist essentially of" means that it does not contain components other than the target component in a manner that performs a special function (such as a manner that completely loses the effect of the invention).
[0018] In addition, in this specification, a numerical range expressed using "to" means a range that includes the numerical values before and after "to" as the lower and upper limits.
[0019] A method for detecting Dickeya dadantii and a primer set according to a preferred embodiment of the present invention will be described in detail below, although the present invention is not limited to the following embodiment.
[0020] [Detection method for Dickeya dadantii] A method for detecting Dickeya dadantii according to a preferred embodiment of the present invention includes a step (A) of performing PCR (Polymerase Chain Reaction) using DNA contained in a sample (i.e., a test specimen) as a template and a primer set comprising a first primer and a second primer.
[0021] The first primer is a forward primer consisting of a base sequence of 18 to 34 consecutive bases from the base sequence shown in SEQ ID NO: 1, and containing an adenine and a cytosine located at the 21st and 22nd positions from the 5' end of the base sequence shown in SEQ ID NO: 1. SEQ ID NO: 1: CCGCGTATATGGACGCTCCCACATTTGCAATCTGTTT
[0022] The second primer is a reverse primer consisting of a base sequence of 18 to 34 consecutive bases from the base sequence shown in SEQ ID NO:2, and containing a guanine at the 17th position from the 5' end of the base sequence shown in SEQ ID NO:2. SEQ ID NO: 2: GTTCTGAAAAGTGCAAGGTGTAATCACAGTAATGGCAAAACAGG
[0023] The base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 are the base sequences of the 3' untranslated region located downstream of a region (CDS) predicted to encode a transposon transferase belonging to the ISEch3 family in the Dickeya dadantii genome.
[0024] When the sample contains genomic DNA of Dickeya dadantii, PCR is carried out in step (A), resulting in amplification of the 3' untranslated region to which the first and second primers anneal.
[0025] The size of the amplification product obtained in step (A) varies depending on the base sequences of the first and second primers, but is approximately 195 to 230 bp (approximately 190 to 235 bp, taking into account the possibility of intraspecies variation).
[0026] In contrast, if the sample does not contain Dickeya dadantii genomic DNA, no amplification product of the above size will be obtained, and therefore, the presence or absence of Dickeya dadantii in the sample can be easily determined from the presence or absence of an amplification product of the above size.
[0027] The detection method of this embodiment may further include a step (B) of electrophoresing the PCR reaction solution obtained after carrying out PCR in step (A). By electrophoresing the PCR reaction solution, it is possible to easily and inexpensively determine whether or not an amplification product of the above size has been obtained in the PCR of step (A).
[0028] The type of electrophoresis used in step (B) is not particularly limited, and examples thereof include agarose gel electrophoresis and polyacrylamide gel electrophoresis, with agarose gel electrophoresis being preferred. When agarose gel electrophoresis is performed, the agarose concentration is not particularly limited, and may be, for example, 2 w / v % or 3 w / v %.
[0029] The origin of the DNA subjected to step (A) is not particularly limited, and it may be, for example, DNA extracted from a plant or DNA extracted from the medium in which the plant is grown.
[0030] That is, the sample containing DNA to be subjected to step (A) may be, for example, a DNA extract from a plant or a DNA extract from a culture medium in which a plant is grown, or may be a sample obtained by purifying this DNA extract to remove one or more impurities other than DNA (for example, proteins, etc.). According to the detection method of this embodiment, Dickeya dadantii can be detected with high sensitivity even when a crude sample (crude extract) obtained by simply heating and / or crushing a plant is used as the DNA-containing sample to be subjected to step (A).
[0031] Examples of media for extracting DNA include soil commonly used in farms, rock wool media, coconut shell media, etc., but are not limited to these as long as they contain Dickeya dadantii. The media may be media in which the plant is being cultivated, has been cultivated, or is to be cultivated.
[0032] The detection method of this embodiment may further include step (C) of extracting DNA from the plant or the culture medium in which the plant is grown, prior to step (A). In this case, a sample containing the DNA extracted in step (C) (preferably a purified sample) is subjected to PCR in step (A).
[0033] As a result, if an amplification product of the above size is obtained, it is confirmed that Dickeya dadantii was present in the plant or culture medium from which DNA was extracted in step (C), and if an amplification product of the above size is not obtained, it is confirmed that Dickeya dadantii was not present in the plant or culture medium from which DNA was extracted in step (C), or that the amount was so small that it was below the detection limit.
[0034] The method for extracting DNA from the plant or culture medium in step (C) is not particularly limited, but examples include homogenizing plant tissue or fibrous material in soil, followed by the phenol method, or subjecting the homogenized material to a commercially available DNA extraction kit.
[0035] According to the detection method of this embodiment using the first primer and the second primer, it is possible to detect dadantii contained in DNA samples extracted from plants, as well as dadantii contained in DNA extracted from culture media such as soil.
[0036] When the detection method includes step (C) and DNA is extracted from a plant, the DNA may be extracted from the root, stem, leaf, or other part, but preferably from a part adjacent to the part where disease symptoms appear. Furthermore, whether the detection method includes or does not include step (C), when the DNA subjected to step (A) is DNA extracted from a plant, it is preferable that the DNA is DNA extracted from a part of the plant adjacent to a part where disease symptoms are present, but the part from which the DNA is extracted is not particularly limited.
[0037] Symptoms of Dickeya dadantii in plants include, but are not limited to, soft rot and sap leakage.
[0038] Plants that may contain Dickeya dadantii DNA, i.e., plants that can be infected by Dickeya dadantii, include sweet potato, potato, apple, pear, peach, banana, mango, corn, and Brassica rapa, which includes Chinese cabbage, turnip, komatsuna, bok choy, and mizuna.
[0039] In step (A), PCR may be performed using, for example, DNA extracted from any of these plants that can be infected with Dickeya dadantii or DNA extracted from the culture medium in which any of these plants are grown as a template. However, the type of plant in step (A) is not particularly limited.
[0040] Examples of plant diseases caused by infection with Dickeya dadantii include the following diseases: Bacterial stem and root rot of sweet potato Bacterial apple canker (acute apple decline) Bacterial canker disease of pears (rusty canker disease of pears) Bacterial peach canker (acute peach blight) Mango bacterial blight
[0041] The detection method of this embodiment can be used, for example, to identify the causative fungus in plants that have died or are showing symptoms such as soft rot, or to evaluate the contamination level (suitability evaluation) of a field for sowing or planting.
[0042] As an example of a situation in which the causative bacterium can be identified using the detection method of this embodiment, when the occurrence of the above-mentioned disease is suspected, DNA extracted from a plant or DNA extracted from a culture medium in which the plant is grown is subjected to step (A) to determine whether the disease is caused by Dickeya dadantii. For example, when DNA extracted from a sweet potato or the soil in which a sweet potato is grown (or was grown) is subjected to step (A), this detection method can also be considered as a method for detecting bacterial stem and root rot of sweet potato.
[0043] In the PCR of step (A), the first and second primers each anneal to two loci with identical base sequences among the numerous regions (more precisely, their 3' untranslated regions) encoding transposon transferases present on the genome of dadantii, thereby enabling amplification from these two loci. In this way, the ability to amplify DNA from two loci on the genome allows for highly sensitive detection of Dickeya dadantii (its genome).
[0044] As will be described in detail later in the Examples, the detection method of this embodiment using the first and second primers enables detection of the Dickeya dadantii genome with a sensitivity approximately 10 to 1000 times higher than that of the detection method disclosed in Non-Patent Document 1 (in other words, the detection limit is approximately 10 to 1000 times lower).
[0045] In addition, the first primer and the second primer can be used for both conventional PCR and real-time PCR. Therefore, the PCR in step (A) may be conventional PCR or real-time PCR. When real-time PCR is performed in step (A), the above-mentioned step (B) is not necessary.
[0046] Because real-time PCR is possible in step (A), the detection method of this embodiment also makes it possible to quantify Dickeya dadantii in plants or culture media (evaluate the bacterial density). For example, by quantifying the bacterial density of Dickeya dadantii in culture media such as soil, the risk of Dickeya dadantii causing plant disease can be evaluated. In this specification, "conventional PCR" refers to PCR that repeats three steps: thermal denaturation of DNA, primer annealing, and DNA strand elongation, and does not involve real-time measurement of fluorescence intensity during the reaction.
[0047] On the other hand, the following document A discloses primers that can detect Dickeya dadantii by real-time PCR. Document A: Van der Wolf. et al., Development and evaluation of Taqman assays for the differentiation of Dickeya (sub) species. European Journal of Plant Pathology, 138, 695-709, 2014.
[0048] However, the primers disclosed in the above-mentioned documents are expensive locked nucleic acid (LNA) primers, which poses a problem of increased costs for detecting Dickeya dadantii.
[0049] In contrast, the first and second primers according to the detection method of this embodiment are not LNA primers, and therefore Dickeya dadantii can be detected inexpensively.
[0050] (1st primer, 2nd primer) As described above, the first primer contains an adenine and a cytosine located at the 21st and 22nd positions from the 5' end of the base sequence shown in SEQ ID NO: 1. The inclusion of this AC in the first primer prevents the detection of closely related species other than Dickeya dadantii and enables specific detection of Dickeya dadantii.
[0051] Furthermore, the base on the 5' side of one of the regions of the base sequence shown in SEQ ID NO: 1 in the Dickeya dadantii genome is guanine. The absence of this guanine in the first primer prevents a situation in which amplification is not possible in some strains due to intraspecific variation, and enables DNA amplification in a wide range of Dickeya dadantii strains, making the detection method of this embodiment highly versatile.
[0052] As described above, the second primer contains a guanine at the 17th position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 2. The inclusion of this guanine in the second primer prevents the detection of closely related species other than Dickeya dadantii, enabling specific detection of Dickeya dadantii.
[0053] The first primer preferably consists of a base sequence of 22 to 26 consecutive bases from the base sequence shown in SEQ ID NO: 3, and the second primer preferably consists of a base sequence of 22 to 26 consecutive bases from the base sequence shown in SEQ ID NO: 4. SEQ ID NO: 3: CGCGTATATGGACGCTCCCACATTTGCA SEQ ID NO: 4: AAGTGCAAGGTTGTAATCACAGTAATGGC
[0054] The first primer more preferably consists of a 23 to 25 contiguous base sequence within the base sequence shown in SEQ ID NO: 7, and may consist of a 24 contiguous base sequence within the base sequence shown in SEQ ID NO: 7. The second primer more preferably consists of a 23 to 25 contiguous base sequence within the base sequence shown in SEQ ID NO: 8, and may consist of a 24 contiguous base sequence within the base sequence shown in SEQ ID NO: 8. SEQ ID NO: 7: GCGTATATGGACGCTCCCACATTTGC SEQ ID NO: 8: AGTGCAAGGTGTAATCACAGTAATGG
[0055] The first primer particularly preferably consists of the base sequence shown in SEQ ID NO:5, and the second primer particularly preferably consists of the base sequence shown in SEQ ID NO:6. SEQ ID NO: 5: CGTATATGGACGCTCCCACATTTG SEQ ID NO: 6: GTGCAAGGTTGTAATCACAGTAATG
[0056] When the first primer consists of the nucleotide sequence shown in SEQ ID NO: 5 and the second primer consists of the nucleotide sequence shown in SEQ ID NO: 6, the first primer and the second primer each bind to the two loci shown in Table 1 below in the reference genome ASM304978v1 (genome accession number registered with the U.S. National Center for Biotechnology Information). Both loci have the same nucleotide sequence. Table 1 shows the base positions counted from the 5' end of the reference genome.
[0057] [Table 1]
[0058] When the first primer consists of the nucleotide sequence shown in SEQ ID NO: 5 and the second primer consists of the nucleotide sequence shown in SEQ ID NO: 6, the amplified region is a part of the 3' untranslated region located 47 to 263 bases downstream from the CDS of a transposon transferase belonging to the ISEch3 family. That is, when the first primer consists of the nucleotide sequence shown in SEQ ID NO: 5 and the second primer consists of the nucleotide sequence shown in SEQ ID NO: 6, the amplified product is approximately 217 bp in size, although there may be intraspecies variation.
[0059] In the PCR in step (A), various conditions such as the temperature and time for DNA thermal denaturation, primer annealing, and DNA chain extension reaction, as well as the composition of the reaction solution, can be appropriately determined by those skilled in the art. For example, PCR may be performed under the conditions described in the Examples below.
[0060] The primer set used in step (A) may further include, in addition to the first and second primers, a primer for detecting another pathogenic bacterium and / or pathogenic virus, as long as the primer does not inhibit the detection of Dickeya dadantii by the first and second primers.
[0061] For example, in sweet potato, in addition to the above-mentioned bacterial stem and root rot disease, root rot disease caused by the filamentous fungus Diaporthe destruens is also known to cause serious damage. Therefore, the primer set used in step (A) may also include primers capable of detecting the filamentous fungus Diaporthe destruens. An example of a primer capable of detecting the filamentous fungus Diaporthe destruens is a primer consisting of the following base sequence described in Japanese Patent Application No. 2024-7929. FW:GGCCTGCCCCCTTAAAAA (third primer, SEQ ID NO: 9) RV:CTTGTTTTTATAGTGTATCTCTGAGC (fourth primer, SEQ ID NO: 10)
[0062] If PCR is performed using the third and fourth primers and an amplification product of approximately 260 bp in size is obtained, it is confirmed that Diaporthe destruens DNA was present in the sample.If an amplification product of that size is not obtained, it is confirmed that Diaporthe destruens DNA was not present in the sample or was present in such small amounts that it was below the detection limit.
[0063] Even when PCR is performed with the first and second primers and the third and fourth primers contained in a single reaction space, it is possible to detect sweet potato bacterial stem and root rot and sweet potato base rot while suppressing the formation of non-specific amplification products other than the desired amplification product.
[0064] Therefore, it is also possible to use these primers to perform multiplex PCR in step (A). In this case, the DNA subjected to step (A) may be DNA extracted from sweet potato itself, or may be DNA extracted from a culture medium such as soil.
[0065] The method for detecting Dickeya dadantii using a primer set including the first primer, the second primer, and the third primer and the fourth primer can also be considered as a method for detecting sweet potato bacterial stem and root rot and sweet potato base rot.
[0066] [Primer set] A primer set according to another preferred embodiment of the present invention includes a first primer and a second primer, which are the same as the first primer and the second primer described in detail in the embodiment of the "Method for detecting Dickeya dadantii."
[0067] The primer set of this embodiment can be used, for example, to detect Dickeya dadantii, to detect genomic DNA of Dickeya dadantii, and / or to detect bacterial stem and root rot of sweet potato.
[0068] By using the primer set of this embodiment in PCR, Dickeya dadantii can be detected with high sensitivity, specificity, and at low cost.
[0069] The present invention is not limited to the above-described embodiments, and various modifications are possible within the scope of the invention described in the claims, and it goes without saying that these modifications are also included within the scope of the present invention. [Example]
[0070] The present invention will be described below with reference to examples, but the present invention is not limited to these examples.
[0071] Materials and Methods <Material> (Solid medium) Agar (Fujifilm Wako Pure Chemical Industries) was added to 1 / 10 concentration of tryptic soy broth (TSB) medium (MERCK) to a final concentration of 1.5% (w / v), autoclaved, and dispensed into 90 mm Petri dishes to obtain solid medium.
[0072] (liquid medium) 5 mL of equal-volume (undiluted) tryptic soy broth (TSB) medium (MERCK) was dispensed into 18 mm diameter test tubes, and the liquid medium was autoclaved with a silicone stopper.
[0073] <Strain> Dickeya dadantii strain 7F was isolated from sweet potato in Kagoshima Prefecture. The Dickeya dadantii strain MJ-KN3 was isolated from sweet potatoes in Miyazaki Prefecture.
[0074] The strains shown in Table 2 below were used in PCR experiments on Dickeya dadantii and its related species. The six-digit numbers shown in Table 2 are MAFF numbers (strain distribution numbers at the National Agriculture and Food Research Organization Genetic Resource Center). Since the classification of some of the strains in Table 2 by the Genetic Resource Center is presumed to differ from the actual species, the results of separate identification by the inventors are shown.
[0075] [Table 2]
[0076] <Method> (Cultivation of bacteria and preparation of bacterial suspension) To prepare soil and plant samples spiked with a certain amount of D. dadantii, the 7F strain was precultured as follows. First, a colony of the 7F strain grown on solid medium at 15°C was aseptically scraped off with an autoclaved toothpick, and the toothpick was transferred to liquid medium and cultured with shaking at 25°C and 120 rpm for 24 to 48 hours. Next, approximately 1 mL of the cultured liquid medium was dispensed into a 1.5 mL tube and centrifuged at 6000 × g for 1 minute. The supernatant was removed, and 1 mL of sterile distilled water was added to prepare a bacterial suspension. Then, the number of cells in the bacterial suspension was counted using a bacterial counting chamber (scale depth 0.02 mm, Erma), and the bacterial concentration was calculated based on the 10 2 ~10 10 A bacterial suspension was prepared at 100 cells / mL.
[0077] (Preparation of soil samples containing a certain amount of D. dadantii) Distilled water was added to Kumiai Nippi Engei Culture Soil No. 1 (Nihon Fertilizer) to adjust the moisture content to 20-25%, and 0.4 g (wet weight) was weighed out per sample. Then, 10 2 Add 40 μL of the bacterial suspension containing 10 cells / mL to obtain a bacterial density of 10 1 The soil was prepared in a concentration of 10 3 , 10 4 ...(omitted)...10 10 Add 40 μL of the bacterial suspension at 10 cells / mL to the plate and adjust the bacterial density to 10 2 , 10 3 ...(omitted)...10 9 A soil sample containing only the soil without the bacterial suspension was also prepared.
[0078] (DNA extraction from soil samples) DNA was extracted from 0.4 g (wet weight) of soil sample using the FastDNA SPIN Kit for Soil (MP Biomedicals) according to the instructions in the manual that came with the product.
[0079] (Preparation of plant samples containing a certain amount of D. dadantii) The sweet potato stems were from Koganesengan cultivated in a greenhouse (natural light, room temperature 15-35°C). The sweet potato tubers were from Beniazuma purchased from a farmer's market in Ibaraki Prefecture. The stem or tuberous root was chopped into tissue pieces of approximately 5 mm square, and four pieces (approximately 100 mg) were selected, weighed, and then transferred to an autoclaved mortar. Then, add 10g of 2 Add an appropriate amount of bacterial suspension containing 10 cells / mL to achieve a bacterial density of 10 1 Plant tissue pieces were prepared at 10 pieces / g. 3 , 10 4 ...(omitted)...10 10 Add an appropriate amount of bacterial suspension at 10 cells / mL to the plate and adjust the bacterial density to 10 2 , 10 3 ...(omitted)...10 9 Plant tissue pieces were prepared at a concentration of 1 / g. These plant tissue fragments were ground in a mortar and pestle. Samples of only the tissue fragments without the addition of the bacterial suspension were also prepared and ground in the same manner.
[0080] (DNA extraction from plant samples) For plant samples containing a certain amount of D. dadantii, crushed tissue fragments were used as the material. For other samples, approximately 100 mg of tissue fragments were transferred to an autoclaved mortar and crushed with a pestle. First, 400 μL of Buffer AP1 from the DNeasy Plant Mini Kit (QIAGEN) was quickly added to the mortar and pestle, followed by further grinding. DNA was then extracted according to the instructions in the manual that came with the DNeasy Plant Mini Kit (QIAGEN).
[0081] (DNA extraction from pure culture) D. dadantii 7F strain was cultured in liquid medium at 25°C and 120 rpm for 24 hours, and then 1 mL of the medium was transferred to a 1.5 mL tube and centrifuged at 6000 × g for 1 minute. The supernatant was then removed, and 400 μL of Buffer AP1 from the DNeasy Plant Mini Kit (QIAGEN) was added. DNA was then extracted according to the procedure in the manual that came with the DNeasy Plant Mini Kit (QIAGEN). After DNA extraction, the DNA concentration was quantified using a spectrophotometer (NanoDrop One, Thermo Scientific) and then diluted with sterile distilled water to prepare a dilution series with DNA concentrations of 1 fg to 100 pg / μL in 10-fold increments.
[0082] (DNA extraction from crude samples) Stems or tuberous roots (tubers) of Scutellaria baicalensis grown in a greenhouse (natural light, room temperature 15-35°C) were cut into pieces approximately 1 cm square. After weighing the cut tissue, the tissue and 5 volumes (v / w) of sterile distilled water were added to a 1.5 mL tube. Then, add 10 5 , 10 6 , 10 7 , 10 8 Add an appropriate amount of bacterial suspension containing 10 cells / mL of bacteria to 1 g of plant tissue. 4 , 10 5 , 10 6 , 10 7 The concentration was adjusted to be 1 / g. The tube was then heated at 80°C for 20 minutes, and the entire contents of the tube were transferred to an autoclaved mortar and crushed with a pestle. The crushed liquid was diluted 10, 50, 250, and 1000 times with sterile distilled water.
[0083] (DNA extraction from Dickeya dadantii related species) Colonies of each strain grown on solid medium at 15°C were aseptically scraped off with an autoclaved toothpick, transferred to liquid medium, and cultured with shaking at 28°C and 120 rpm for 24 hours. After incubation, 500 μL of the liquid medium was dispensed into a 1.5 mL tube and centrifuged at 6000 × g for 1 minute. The supernatant was removed, and the cells were resuspended in 300 μL of sterile distilled water. The tube was then heated at 100°C for 10 minutes. The tube was then centrifuged at 6000 × g for 1 minute, and 20 μL of the supernatant was transferred to a new 1.5 mL tube, followed by addition of 180 μL of sterile distilled water.
[0084] (DNA extraction of root rot fungi) To prepare a solid medium for growing root rot fungi, we added agar (Fujifilm Wako Pure Chemical Industries) to half-strength potato dextrose agar (PDA) medium (Difco) to a final concentration of 1.5% (w / v), autoclaved the mixture, and dispensed it into 90-mm Petri dishes. Diaporthe destruens MAFF246953 was cultured on the medium at 25°C for 14 days. Afterwards, mycelia on the medium surface were scraped off, and DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN).
[0085] (conventional PCR) For each sample, 1 μL of DNA extract was used as template DNA (template), and 10 μL of reaction solution was prepared with the composition shown in Table 3. KOD FX Neo (Toyobo) was used as the reagent.
[0086] [Table 3]
[0087] 10 μL of the reaction mixture was transferred to an 8-tube tube (Nippon Genetics), and PCR was carried out using a thermal cycler (Veriti200, Applied Biosystems). After PCR, the PCR products were loaded onto a 2% agarose gel (Agarose S, Nippon Gene) and electrophoresed with a DNA marker (100 bp DNA ladder, Takara) at 100 V for 25 minutes (electrophoresis apparatus: Mupid-exU, Advance). The electrophoresed gel was stained with GelRed™ (Biotium) 10000 diluted in water and photographed with a gel camera (GelDoc Go, BIORAD).
[0088] (Quantitative PCR) For each sample, 1 μL of DNA extract was used as template DNA (template), and 20 μL of reaction solution was prepared with the composition shown in Table 4. KOD qPCR Mix (Toyobo) was used as the reagent.
[0089] [Table 4]
[0090] 20 μL of the reaction mixture was transferred to a 96-well plate (MicroAmp Fast 96-well Reaction Plate, Applied Biosystems), and quantitative PCR was performed using a real-time PCR device (StepOnePlus, ThermoFisher). Analysis after quantitative PCR was performed using StepOne™ Software v2.3 (ThermoFisher).
[0091] (Multiplex PCR) For each sample, 1 μL of the DNA extract was used as template DNA (template), and 10 μL of a reaction solution was prepared having the composition shown in Table 5. The reagent used was KOD FX Neo (Toyobo).
[0092] [Table 5]
[0093] 10 μL of the reaction mixture was transferred to an 8-tube tube (Nippon Genetics), and PCR was carried out using a thermal cycler (Veriti 200, Applied Biosystems). After PCR, the PCR products were loaded onto a 3% agarose gel (Agarose X, Nippon Gene) and electrophoresed with a DNA marker (100 bp DNA ladder, Takara) at 100 V for 25 minutes (electrophoresis apparatus: Mupid-exU, Advance). The electrophoresed gel was stained with GelRed™ (Biotium) 10000 diluted in water and photographed with a gel camera (GelDoc Go, BIORAD).
[0094] [Experimental Example 1] In this experiment, we designed and selected a number of candidate primers for detecting Dickeya dadantii. Specifically, primers were searched for with reference to the Dickeya dadantii whole genome data disclosed in NCBI, and primers that satisfied the following six conditions were designed. 1. Present in more than two locations in the genome (for highly sensitive detection) 2. The sequence exists in multiple strains of dadantii (to improve versatility and certainty) 3. Sequences not included in the genomes of closely related species of the genus Dickeya 4. Sequences not included in the sweet potato genome 5. Sequence not found in other sweet potato pathogens 6. The size of the amplification product is consistent.
[0095] As a result of designing under the above conditions, primers were extracted that anneal to the gene region encoding transposon transferase or its vicinity, or to the region encoding 16S or 23S rRNA.
[0096] From these, we designed a primer that anneals to the 3' untranslated region of the gene region encoding the transposon transferase, a primer that anneals to the region encoding 16S rRNA, and a primer that anneals to the region encoding 23S rRNA, and performed conventional PCR followed by electrophoresis.
[0097] Figure 1 is an electrophoresis image showing the results of PCR performed using a pair of designed primers, a first primer (forward primer) consisting of the base sequence shown in SEQ ID NO: 5 and a second primer (reverse primer) consisting of the base sequence shown in SEQ ID NO: 6. As described above, the first and second primers anneal to the 3' untranslated region located downstream of the CDS encoding a transposon transferase belonging to the ISEch3 family.
[0098] In Figure 1, "7F" is the lane where PCR was performed using DNA extracted from Dickeya dadantii 7F as a template and electrophoresed, and "N" and "1" are the lanes where PCR was performed using DNA extracted from sweet potato as a template and electrophoresed.
[0099] As shown in Figure 1, PCR was performed using the first and second primers. In the lane where PCR was performed using Dickeya dadantii genomic DNA as a template, a band was observed at a position of approximately 220 bp (specifically, 217 bp), and no nonspecific bands were observed.
[0100] In contrast, in the lane where PCR was performed using sweet potato genomic DNA as a template, no band was observed at a position of approximately 220 bp.
[0101] These results demonstrated that Dickeya dadantii can be detected by PCR using primers 1 and 2. However, because many bands representing nonspecific amplification products were observed in electrophoresis after PCR using primers annealing to the region encoding 16S rRNA and primers annealing to the region encoding 23S rRNA, primers 1 and 2 were used as primers for detecting Dickeya dadantii. In each of the following experiments, a primer consisting of the base sequence shown in SEQ ID NO: 5 was used as the first primer, and a primer consisting of the base sequence shown in SEQ ID NO: 6 was used as the second primer.
[0102] [Experimental Example 2] In this experiment, conventional PCR was carried out using the primers described in Non-Patent Document 1, and conventional PCR was carried out using the first and second primers. The PCR programs for each conventional PCR are shown below.
[0103] <PCR using primers described in Non-Patent Document 1> KOD FX Neo Step 1: 94℃ 2 minutes Step 2: 98℃ 10 seconds Step3: 56℃ 30 seconds Step4: 68℃ 10 seconds Step5: 68℃ 7 minutes STEPs 2 to 4 were performed for 35 cycles.
[0104] <PCR using the first and second primers> KOD FX Neo Step 1: 94℃ 2 minutes Step 2: 98℃ 10 seconds Step3: 62℃ 30 seconds Step4: 68℃ 10 seconds Step5: 68℃ 7 minutes STEPs 2 to 4 were performed for 35 cycles.
[0105] FIG. 2 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to sweet potato, and then performing conventional PCR using the extracted DNA as a template and the primers described in Non-Patent Document 1. FIG. 3 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to soil and then performing conventional PCR using the extracted DNA as a template and the primers described in Non-Patent Document 1. FIG. 4 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to sweet potato, and then performing conventional PCR using the extracted DNA as a template and the first and second primers. FIG. 5 is an electrophoresis image showing the results of adding a suspension of Dickeya dadantii strain 7F to soil and then performing conventional PCR using the extracted DNA as a template and the first and second primers.
[0106] In each figure, "NC" indicates a lane where PCR was performed using DNA extracted from only sweet potato or only soil as a template, and "N" indicates a lane where PCR was performed without template DNA. Also, in each figure, lanes 1 to 9 indicate the bacterial density of the sample at 10 1 ~10 9 This is the lane where the concentration was adjusted to cells / g, DNA was extracted, and PCR was performed.
[0107] As shown in Figure 2, when Dickeya dadantii was added to sweet potato and PCR was performed using the extracted DNA as a template and the primers described in Non-Patent Document 1, 10 7 Dickeya dadantii was detected in 100 pieces / g.
[0108] Furthermore, as shown in Figure 3, when Dickeya dadantii was added to soil and PCR was performed using the extracted DNA as a template and the primers described in Non-Patent Document 1, 10 6 Dickeya dadantii was detected in 100 pieces / g.
[0109] In contrast, as shown in Figure 4, when Dickeya dadantii was added to sweet potato and PCR was performed using the extracted DNA as a template and the first and second primers, 10 4 Dickeya dadantii was detected in 100 pieces / g.
[0110] Furthermore, as shown in Figure 5, when Dickeya dadantii was added to soil and PCR was performed using the extracted DNA as a template and the first and second primers, 10 3 Dickeya dadantii was detected in 100 pieces / g.
[0111] FIG. 6 is an electrophoresis image showing the results of conventional PCR carried out using DNA extracted from purely cultured Dickeya dadantii as a template and the primers described in Non-Patent Document 1. FIG. 7 is an electrophoretic image showing the results of conventional PCR using DNA extracted from purely cultured Dickeya dadantii as a template and the first and second primers. 6 and 7 show, from right to left, the results of amplification using Dickeya dadantii DNA samples as templates, which were diluted in a 10-fold series from 100 pg / μL to 1 fg / μL.
[0112] As shown in FIG. 6, when DNA extracted from purely cultured Dickeya dadantii was used as a template and the primers described in Non-Patent Document 1 were used, a band was observed at 100 pg / μL.
[0113] In contrast, as shown in FIG. 7, when the first and second primers were used with DNA extracted from purely cultured Dickeya dadantii as a template, a band was observed at 100 fg / μL.
[0114] As described above, by using the first and second primers, it was possible to improve the sensitivity by about 1000 times compared to when the conventional primers described in Non-Patent Document 1 were used.
[0115] [Experimental Example 3] In this experiment, real-time PCR was carried out using the primers described in Non-Patent Document 1, real-time PCR was carried out using the primers described in Document A, and real-time PCR was carried out using the first primer and the second primer. The PCR program for real-time PCR using the first and second primers is shown below.
[0116] KOD SYBR qPCR Step 1: 98℃ 2 minutes Step 2: 98℃ 10 seconds Step3: 62℃ 10 seconds Step4: 68℃ 30 seconds melt curve Steps 2 to 4 were performed for 40 cycles.
[0117] Figure 8 shows the melt curve and standard curve obtained when Dickeya dadantii was added to sweet potato and real-time PCR was performed using the extracted DNA as a template and the first and second primers. Figure 9 shows the melt curve and standard curve obtained when Dickeya dadantii was added to soil and real-time PCR was performed using the extracted DNA as a template and the first and second primers. FIG. 10 shows the melt curve and standard curve obtained as a result of performing real-time PCR using DNA extracted from purely cultured Dickeya dadantii as a template and the first and second primers. The standard curves in Figures 8, 9, and 10 show the 10 4 ~10 9 pieces / g, 10 3 ~10 8 A calibration curve was drawn by plotting the results of a 10-fold dilution series of 1 fg to 10 pg / μL.
[0118] As shown in Figures 8 to 10, real-time PCR was performed using the first and second primers, and a single peak was obtained both when Dickeya dadantii was mixed with sweet potato or soil and DNA was extracted, and when DNA was extracted after pure culture. These results suggest that real-time PCR using the first and second primers enables specific detection of Dickeya dadantii without the generation of nonspecific amplification products. Furthermore, the fact that each plot is almost entirely located on the calibration curve demonstrates the excellent quantitation capabilities of the first and second primers.
[0119] Real-time PCR using the primers described in Non-Patent Document 1 and real-time PCR using the primers described in Document A were also carried out in the same manner.
[0120] (Summary of detection limit bacterial density) Table 6 below shows the detection limit bacterial density of Dickeya dadantii in conventional PCR using each primer.
[0121] [Table 6]
[0122] Table 7 below shows the detection limit bacterial density of Dickeya dadantii in real-time PCR using each primer.
[0123] [Table 7]
[0124] As shown in Table 6, it was suggested that conventional PCR using the first and second primers could detect Dickeya dadantii with approximately 1,000 times higher sensitivity than conventional PCR using the primers of Non-Patent Document 1.
[0125] Furthermore, as shown in Table 7, it was suggested that performing real-time PCR using the first and second primers enabled detection with approximately 10 to 1,000 times higher sensitivity than performing real-time PCR using the primers of Non-Patent Document 1.
[0126] Furthermore, as shown in Table 7, it was suggested that real-time PCR using the first and second primers, which are not LNA primers, can detect Dickeya dadantii with sensitivity equivalent to or approximately 10 times higher than when real-time PCR is performed using the LNA primers described in Reference A.
[0127] [Experimental Example 4] In this experiment, a crude sweet potato sample containing a Dickeya dadantii bacterial suspension was heat-sterilized, ground, and subjected to conventional PCR.
[0128] FIG. 11 is an electrophoresis image showing the results of conventional PCR performed on a crude sample of sweet potato tuberous root to which a Dickeya dadantii fungal suspension had been added, which was then heated and crushed, using the first and second primers. FIG. 12 is an electrophoresis image showing the results of conventional PCR performed on a crude sample of sweet potato stem to which a Dickeya dadantii fungal suspension had been added, which was then heated and crushed, using the first and second primers.
[0129] As shown in Figures 11 and 12, the fungal density in the tuberous root (potato) was 10 6 From pieces / g, 10 for stems 5 Dickeya dadantii was detected at each of the samples per gram.
[0130] These results suggest that Dickeya dadantii can be detected at high concentrations by using the first and second primers, even when crude samples are used.
[0131] [Experimental Example 5] In this experiment, DNA was extracted from several Dickeya dadantii strains and related species obtained from the Genetic Resource Center, and conventional PCR was performed using the primers described in Non-Patent Document 1 or primers 1 and 2. For the list of several strains and related species, see Table 2 above.
[0132] FIG. 13 is an electrophoretic image showing the results of conventional PCR performed on DNA extracted from multiple strains of Dickeya dadantii and related species using the primers described in Non-Patent Document 1. FIG. 14 is an electrophoresis image showing the results of conventional PCR performed on DNA extracted from multiple strains of Dickeya dadantii and related species, using the first and second primers. In Figures 13 and 14, PCR products from a total of six different dadantii strains are electrophoresed in each lane labeled "dadantii."
[0133] As shown in FIG. 13, when the primers of Non-Patent Document 1 were used, many bands were confirmed in closely related species other than Dickeya dadantii. In contrast, as shown in FIG. 14, when the first and second primers were used, bands were observed in each Dickeya dadantii strain, but no bands were observed in closely related species.
[0134] These results revealed that the first and second primers are capable of detecting Dickeya dadantii more species-specifically than the primers of Non-Patent Document 1.
[0135] [Experimental Example 6] In this experiment, multiplex PCR was performed on sweet potato using the first and second primers as well as the third and fourth primers described above. The PCR program is shown below.
[0136] KOD FX Neo Step 1: 94℃ 2 minutes Step 2: 98℃ 10 seconds Step3: 60℃ 30 seconds Step4: 68℃ 20 seconds Step5: 68℃ 7 minutes STEPs 2 to 4 were performed for 35 cycles.
[0137] FIG. 15 is an electrophoresis image showing the results of multiplex PCR using the first and second primers and the third and fourth primers.
[0138] In Figure 15, the lane labeled "Base rot inoculated stem" represents an experimental system in which the tip of a sweet potato (Beniyazuma) stem was cut to a length of approximately 20 cm, a spore suspension of the F3 strain of base rot fungus was applied to the cut surface, and the plant was then potted in a greenhouse for 14 days to allow base rot to develop. Conventional PCR was then performed using DNA extracted from the plant as a template. The lane labeled "Stem infected with bacterial stem and root rot and base rot" is an experimental system in which conventional PCR was performed using DNA extracted from the stems of sweet potato (Koganesengan) infected with bacterial stem and root rot and base rot found in a field in Kagoshima Prefecture as a template. "Root rot fungus MAFF246953" is an experimental system in which conventional PCR was performed using DNA extracted from the MAFF246953 strain as a template.
[0139] As shown in FIG. 15, in the lane for "stems infected with bacterial stem and root rot and stem base rot," bands indicating the 217 bp amplification product and bands indicating the 260 bp amplification product were observed. These results demonstrated that bacterial stem and root rot and root rot can be detected simultaneously by multiplex PCR using the first and second primers and the third and fourth primers. [Industrial Applicability]
[0140] According to the present invention, Dickeya dadantii can be detected with high sensitivity by using the first and second primers, and therefore the present invention is industrially applicable.
Claims
1. a first primer consisting of a base sequence of 18 to 34 consecutive bases in the base sequence shown in SEQ ID NO: 1 and containing an adenine and a cytosine located at the 21st and 22nd positions from the 5' end of the base sequence shown in SEQ ID NO: 1; It consists of a base sequence of 18 to 34 consecutive bases in the base sequence shown in SEQ ID NO: 2, and a second primer containing a guanine at the 17th position from the 5' end of the base sequence shown in SEQ ID NO:
2.
2. the first primer consists of a base sequence of 22 to 26 consecutive bases in the base sequence shown in SEQ ID NO: 3, The primer set according to claim 1, wherein the second primer consists of a base sequence of 22 to 26 consecutive bases in the base sequence shown in SEQ ID NO:
4.
3. the first primer consists of the base sequence shown in SEQ ID NO: 5, The primer set according to claim 2 , wherein the second primer consists of the base sequence shown in SEQ ID NO:
6.
4. A method for detecting Dickeya dadantii, comprising a step of carrying out PCR using DNA contained in a sample as a template and the primer set according to any one of claims 1 to 3.
5. 5. The method for detecting Dickeya dadantii according to claim 4, wherein the DNA is extracted from a plant or a medium in which the plant is grown.
6. 6. The method for detecting Dickeya dadantii according to claim 5, wherein the plant is a sweet potato, a potato, an apple, a pear, a peach, a banana, a mango, corn, or Brassica rapa.
7. a step of electrophoresing the reaction solution after the PCR, The method for detecting Dickeya dadantii according to claim 4, wherein the PCR is conventional PCR.
Citation Information
Patent Citations
Molecular detection primer for sweet potato black rot germs and application of molecular detection primer
CN103045747A
Primer pair for detecting sweet potato stem rot pathogen as well as detection method thereof
CN108588249A
Dickeya dadantii TaqMan fluoroscent quantitative PCR detection method and application
CN109136394A
Primer combination for detecting 2 soft rot pathogens of orchids, and detection method
CN111378773A
Primer pair, kit and method for detecting and identifying Pectobacterium bacteria
CN112626241A