Glutamate decarboxylase mutants and their use in the production of gamma-aminobutyric acid

Abstract

The present invention provides a glutamate decarboxylase mutant and its use in the production of γ-aminobutyric acid, as well as an improved recombinant Corynebacterium glutamicum and a biosensor capable of responding to γ-aminobutyric acid.

Description

[Technical Field]

[0001] The present invention relates to a glutamic acid decarboxylase mutant and its use in the production of γ-aminobutyric acid, and belongs to the technical fields of genetic engineering and enzyme engineering. [Background technology]

[0002] γ-Aminobutyric acid (GABA) is a four-carbon non-protein amino acid found widely in nature, from microorganisms to plants and animals. It has functions such as preventing and treating insomnia, lowering blood pressure, anxiolytic, sedative, analgesic, and diuretic, and can be used to treat various neurological disorders. GABA has also attracted attention as a precursor for synthesizing 2-pyrrolidone and the biodegradable material polyamide nylon 4, and its applications are expanding into industrial fields.

[0003] There are many methods for synthesizing GABA, including chemical synthesis, enzyme catalysis or whole-cell biocatalysis, and microbial fermentation. Compared to chemical synthesis, GABA biosynthesis has many advantages, including simple workup steps, mild reaction conditions, high product yield, high product selectivity, and low environmental pollution. The primary pathway for GABA biosynthesis is the irreversible decarboxylation of L-glutamate catalyzed by glutamate decarboxylase (GAD). Glutamate decarboxylase (GAD) can catalyze the conversion of glutamate (Glu) to GABA using pyridoxal phosphate (PLP) as a cofactor, making it a key enzyme for GABA production. Several domestic and international publications have already reported the production of GABA by Corynebacterium glutamicum. In 2011, researchers were the first to report that the expression of glutamate decarboxylase from Lactobacillus brevis Lb85 in Corynebacterium glutamicum enabled the production of low but detectable levels of GABA. It has also been reported that exogenous expression of GadB in Escherichia coli W3110 enabled recombinant Corynebacterium glutamicum to produce 12.37 g / L of GABA through an optimized fermentation process. Zhang et al. developed an effective direct biosynthetic pathway using glucose based on recombinant Corynebacterium glutamicum, eliminating the need for the addition of expensive PLP cofactor. After 70 hours of fermentation using a two-stage pH control scheme, GABA production reached 70.6 g / L.

[0004] Glutamate decarboxylase catalyzes the production of GABA from glutamate, a reaction that consumes protons and can increase the pH of the environment. Many glutamate decarboxylases exhibit optimal activity in the pH range of 4-5, with activity declining rapidly above pH 6 and becoming nearly inactive at pH 7. While some studies have reported mutants that enhance activity at neutral pH, current research has not shown that the optimal pH of glutamate decarboxylase mutants has changed, and most cannot enhance enzyme activity at pH higher than 6, remaining nearly inactive at pH 7.0.

[0005] Currently, all commercial GABA production is achieved using glutamate as a precursor, either through whole-cell or enzymatic catalysis. However, direct glucose fermentation offers cost advantages. Glutamate biosynthesis requires a neutral pH of 7.0, whereas GAD has an optimum pH of 4–5, at which it is nearly inactivated. Therefore, direct fermentation of GABA generally employs a two-stage fermentation method. In the first stage, glutamate is produced under neutral pH conditions (around pH 7). In the second stage, GABA is produced under acidic pH conditions (around pH 5). Compared to direct fermentation for GABA production using a single stage, the two-stage method requires longer fermentation times, lower yields, and increased costs. Among common industrial chassis strains, Corynebacterium glutamicum is generally regarded as safe (GRAS) compared to Escherichia coli, and the GABA produced by this method can be used in food applications. Corynebacterium glutamicum is also an excellent glutamate producer, and glutamate is the direct precursor of GABA, making it a promising strain for mass production of GABA. In summary, the current whole-cell and enzyme-catalyzed methods using glutamate as a substrate, or two-stage fermentation, are more expensive than one-stage direct fermentation. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention overcomes the drawbacks of conventional glutamic acid decarboxylases, such as the inapplicability of their pH values ​​to one-step GABA production, and the high costs, low production yields, and complex processes involved in producing GABA using whole-cell catalysis, enzyme catalysis, and two-step methods. It provides a GABA biosensor, a GAD enzyme mutant obtained by directed evolution using the biosensor, and a Corynebacterium glutamicum strain capable of producing γ-aminobutyric acid from glucose in one step at pH 7.0. [Means for solving the problem]

[0007] The present invention provides a GABA biosensor, comprising: Promoter P gabTDP , P gabR , a reporter gene, gabR gene; gabTDP , P gabR The P, reporter gene, and gabR gene are located on the same vector or the same genomic DNA to constitute the biosensor; gabTDP regulates the expression of a reporter gene; gabR and P gabTDP has a GABA-GabR conjugate binding site sequence and regulates the expression of a reporter gene; gabTDP and Promoter P gabR The transcription direction of the GABA gene is opposite to that of the GABA gene.

[0008] In one embodiment, the reporter gene is a fluorescent protein gene, including, but not limited to, green fluorescent protein (GFP) and red fluorescent protein (mCherry).

[0009] In one embodiment, the promoter P gabTDP The nucleotide sequence encoding the promoter P is shown in SEQ ID NO. gabR The nucleotide sequence encoding the gabR gene is shown in SEQ ID NO. 7, and the sequence of the GABA-gabR conjugate binding site is shown in SEQ ID NO. 8.

[0010] The present invention also provides use of the biosensor in the selective breeding of γ-aminobutyric acid-producing bacterial strains.

[0011] The present invention also provides glutamic acid decarboxylase mutants based on the glutamic acid decarboxylase shown in SEQ ID NO. 3, wherein at least one mutation has been generated at the following sites: (1) Mutation of aspartic acid at position 38 to asparagine (2) Mutation of isoleucine at position 89 to valine (3) Mutation of aspartic acid at position 92 to asparagine (4) Mutation of glutamic acid at position 93 to glutamine (5) Mutation of aspartic acid at position 118 to asparagine (6) Mutation of serine at position 153 to threonine or alanine (7) Mutation of aspartic acid at position 202 to asparagine (8) Proline to Threonine at position 268 (9) Mutation of glutamic acid at position 294 to arginine (10) Mutation of aspartic acid at position 301 to asparagine (11) Phenylanine at position 355 to tyrosine (12) Mutation of aspartic acid at position 371 to asparagine (13) Mutation of aspartic acid at position 432 to asparagine (14) Mutation of histidine at position 435 to glutamine (15) Mutation of leucine at position 451 to a stop codon (16) Mutation of lysine 457 to a stop codon (17) Mutation of tyrosine at position 461 to a stop codon

[0012] In one embodiment, the mutant is based on SEQ ID NO. 3, with phenylalanine at position 355 mutated to leucine and leucine at position 451 mutated to a stop codon.

[0013] In one embodiment, the mutant has a Thr 120 to Asparagine mutation, a Leucine 436 to Valine mutation, and a Leucine 451 to a stop codon.

[0014] In one embodiment, the mutant has threonine at position 120 mutated to valine, leucine at position 436 mutated to asparagine, and leucine at position 451 mutated to a stop codon.

[0015] In one embodiment, the mutant has threonine at position 120 mutated to alanine, leucine at position 436 mutated to serine, and leucine at position 451 mutated to a stop codon.

[0016] In one embodiment, the mutant has threonine at position 120 mutated to leucine, leucine at position 436 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0017] In one embodiment, the mutant has an isoleucine to asparagine mutation at position 89, a phenylalanine to leucine mutation at position 355, an aspartic acid to leucine mutation at position 432, and a leucine to a stop codon at position 451.

[0018] In one embodiment, the mutant has an isoleucine at position 89 mutated to methionine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to alanine, and a leucine at position 451 mutated to a stop codon.

[0019] In one embodiment, the mutant has an isoleucine at position 89 mutated to glutamine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to valine, and a leucine at position 451 mutated to a stop codon.

[0020] In one embodiment, the mutant has an isoleucine at position 89 mutated to a valine, a phenylalanine at position 355 mutated to a tyrosine, an aspartic acid at position 432 mutated to an asparagine, and a leucine at position 451 mutated to a stop codon.

[0021] In one embodiment, the mutant has an isoleucine at position 89 mutated to leucine, a phenylalanine at position 355 mutated to valine, an aspartic acid at position 432 mutated to leucine, and a leucine at position 451 mutated to a stop codon.

[0022] In one embodiment, the mutant has an isoleucine at position 89 mutated to a tyrosine, a proline at position 268 mutated to a serine, a phenylalanine at position 355 mutated to a glutamine, an aspartic acid at position 432 mutated to a glutamine, a histidine at position 435 mutated to an alanine, and a leucine at position 451 mutated to a stop codon.

[0023] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0024] In one embodiment, the mutant has an isoleucine at position 89 mutated to serine, a proline at position 268 mutated to asparagine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to leucine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0025] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, a proline at position 268 mutated to methionine, a phenylalanine at position 355 mutated to alanine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to leucine, and a leucine at position 451 mutated to a stop codon.

[0026] In one embodiment, the mutant has an isoleucine at position 89 mutated to proline, a proline at position 268 mutated to glutamic acid, a phenylalanine at position 355 mutated to serine, an aspartic acid at position 432 mutated to tyrosine, a histidine at position 435 mutated to asparagine, and a leucine at position 451 mutated to a stop codon.

[0027] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, an aspartic acid at position 92 mutated to leucine, a proline at position 268 mutated to serine, a phenylalanine at position 355 mutated to serine, an aspartic acid at position 432 mutated to histidine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0028] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to asparagine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0029] In one embodiment, the mutant has an isoleucine at position 89 mutated to methionine, an aspartic acid at position 92 mutated to methionine, a proline at position 268 mutated to leucine, a phenylalanine at position 355 mutated to alanine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to valine, and a leucine at position 451 mutated to a stop codon.

[0030] In one embodiment, the mutant has isoleucine at position 89 mutated to serine, aspartic acid at position 92 mutated to tyrosine, proline at position 268 mutated to proline, phenylalanine at position 355 mutated to glutamine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to leucine, and leucine at position 451 mutated to a stop codon.

[0031] In one embodiment, the mutant has an isoleucine at position 89 mutated to leucine, an aspartic acid at position 92 mutated to leucine, a proline at position 268 mutated to glutamine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to glutamine, a histidine at position 435 mutated to tyrosine, and a leucine at position 451 mutated to a stop codon.

[0032] In one embodiment, the mutant has isoleucine at position 89 mutated to alanine, aspartic acid at position 92 mutated to glutamine, proline at position 268 mutated to asparagine, phenylalanine at position 355 mutated to leucine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to alanine, and leucine at position 451 mutated to a stop codon.

[0033] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, a serine at position 153 mutated to alanine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0034] In one embodiment, the mutant has an isoleucine at position 89 mutated to methionine, a serine at position 153 mutated to alanine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to tyrosine, a histidine at position 435 mutated to asparagine, and a leucine at position 451 mutated to a stop codon.

[0035] In one embodiment, the mutant has an isoleucine at position 89 mutated to tyrosine, a serine at position 153 mutated to methionine, a proline at position 268 mutated to glutamine, a phenylalanine at position 355 mutated to alanine, an aspartic acid at position 432 mutated to glutamine, a histidine at position 435 mutated to tyrosine, and a leucine at position 451 mutated to a stop codon.

[0036] In one embodiment, the mutant has isoleucine at position 89 mutated to serine, aspartic acid at position 92 mutated to proline, serine at position 153 mutated to glutamine, proline at position 268 mutated to valine, phenylalanine at position 355 mutated to proline, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to leucine, and leucine at position 451 mutated to a stop codon.

[0037] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to asparagine, a serine at position 153 mutated to alanine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0038] In one embodiment, the mutant has isoleucine at position 89 mutated to valine, aspartic acid at position 92 mutated to serine, serine at position 153 mutated to proline, proline at position 268 mutated to methionine, phenylalanine at position 355 mutated to leucine, aspartic acid at position 432 mutated to glutamine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0039] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to alanine, a serine at position 153 mutated to asparagine, a proline at position 268 mutated to alanine, a phenylalanine at position 355 mutated to glutamine, an aspartic acid at position 432 mutated to proline, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0040] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, an aspartic acid at position 92 mutated to methionine, a serine at position 153 mutated to glutamine, a proline at position 268 mutated to serine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to valine, a histidine at position 435 mutated to alanine, and a leucine at position 451 mutated to a stop codon.

[0041] In one embodiment, the mutant has an isoleucine at position 89 mutated to tyrosine, an aspartic acid at position 92 mutated to asparagine, a serine at position 153 mutated to tyrosine, a proline at position 268 mutated to leucine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to serine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0042] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to proline, a serine at position 153 mutated to leucine, a proline at position 268 mutated to glutamine, a phenylalanine at position 355 mutated to leucine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to asparagine, and a leucine at position 451 mutated to a stop codon.

[0043] In one embodiment, the mutant has isoleucine at position 89 mutated to proline, aspartic acid at position 92 mutated to tyrosine, serine at position 153 mutated to glutamine, proline at position 268 mutated to glutamine, phenylalanine at position 355 mutated to tyrosine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to methionine, and leucine at position 451 mutated to a stop codon.

[0044] In one embodiment, the mutant has isoleucine at position 89 mutated to alanine, aspartic acid at position 92 mutated to asparagine, serine at position 153 mutated to alanine, proline at position 268 mutated to threonine, phenylalanine at position 355 mutated to glutamine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to glutamine, and leucine at position 451 mutated to a stop codon.

[0045] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, an aspartic acid at position 92 mutated to glutamine, a serine at position 153 mutated to leucine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to alanine, and a leucine at position 451 mutated to a stop codon.

[0046] In one embodiment, the mutant has an isoleucine at position 89 mutated to tyrosine, an aspartic acid at position 92 mutated to tyrosine, a serine at position 153 mutated to glutamine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to valine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to serine, and a leucine at position 451 mutated to a stop codon.

[0047] In one embodiment, the mutant has an isoleucine at position 89 mutated to leucine, an aspartic acid at position 92 mutated to proline, a serine at position 153 mutated to asparagine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to proline, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0048] In one embodiment, the mutant has isoleucine at position 89 mutated to alanine, aspartic acid at position 92 mutated to alanine, serine at position 153 mutated to alanine, proline at position 268 mutated to threonine, phenylalanine at position 355 mutated to methionine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0049] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to valine, a serine at position 153 mutated to threonine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to glutamine, and a leucine at position 451 mutated to a stop codon.

[0050] In one embodiment, the mutant has isoleucine at position 89 mutated to glutamine, aspartic acid at position 92 mutated to glutamine, serine at position 153 mutated to asparagine, proline at position 268 mutated to asparagine, phenylalanine at position 355 mutated to methionine, aspartic acid at position 432 mutated to glutamine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0051] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, an aspartic acid at position 92 mutated to asparagine, a serine at position 153 mutated to glutamine, a proline at position 268 mutated to tyrosine, a phenylalanine at position 355 mutated to valine, an aspartic acid at position 432 mutated to leucine, a histidine at position 435 mutated to asparagine, and a leucine at position 451 mutated to a stop codon.

[0052] In one embodiment, the mutant has isoleucine at position 89 mutated to leucine, aspartic acid at position 92 mutated to serine, serine at position 153 mutated to leucine, proline at position 268 mutated to leucine, phenylalanine at position 355 mutated to glutamine, aspartic acid at position 432 mutated to tyrosine, histidine at position 435 mutated to methionine, and leucine at position 451 mutated to a stop codon.

[0053] In one embodiment, the mutant has an isoleucine at position 89 mutated to tyrosine, an aspartic acid at position 92 mutated to asparagine, a serine at position 153 mutated to tyrosine, a proline at position 268 mutated to glutamine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to valine, a histidine at position 435 mutated to tyrosine, and a leucine at position 451 mutated to a stop codon.

[0054] In one embodiment, the mutant has an isoleucine at position 89 mutated to proline, an aspartic acid at position 92 mutated to methionine, a serine at position 153 mutated to valine, a proline at position 268 mutated to asparagine, a phenylalanine at position 355 mutated to serine, an aspartic acid at position 432 mutated to proline, a histidine at position 435 mutated to leucine, and a leucine at position 451 mutated to a stop codon.

[0055] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to asparagine, a serine at position 153 mutated to proline, a proline at position 268 mutated to methionine, a phenylalanine at position 355 mutated to tyrosine, an aspartic acid at position 432 mutated to methionine, a histidine at position 435 mutated to alanine, and a leucine at position 451 mutated to a stop codon.

[0056] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to valine, a serine at position 153 mutated to alanine, a proline at position 268 mutated to threonine, a phenylalanine at position 355 mutated to proline, an aspartic acid at position 432 mutated to serine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0057] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to tyrosine, a serine at position 153 mutated to alanine, a proline at position 268 mutated to tyrosine, a phenylalanine at position 355 mutated to leucine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to valine, and a leucine at position 451 mutated to a stop codon.

[0058] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to leucine, a serine at position 153 mutated to serine, a proline at position 268 mutated to valine, a phenylalanine at position 355 mutated to glutamine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to valine, and a leucine at position 451 mutated to a stop codon.

[0059] In one embodiment, the mutant has an isoleucine at position 89 mutated to valine, an aspartic acid at position 92 mutated to glutamine, a serine at position 153 mutated to leucine, a proline at position 268 mutated to proline, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to leucine, a histidine at position 435 mutated to leucine, and a leucine at position 451 mutated to a stop codon.

[0060] In one embodiment, the mutant has isoleucine at position 89 mutated to glutamine, glutamic acid at position 93 mutated to asparagine, serine at position 153 mutated to asparagine, proline at position 268 mutated to methionine, aspartic acid at position 301 mutated to alanine, phenylalanine at position 355 mutated to tyrosine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to asparagine, and leucine at position 451 mutated to a stop codon.

[0061] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, a glutamic acid at position 93 mutated to methionine, a serine at position 153 mutated to glutamine, a proline at position 268 mutated to alanine, an aspartic acid at position 301 mutated to serine, a phenylalanine at position 355 mutated to glutamine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to tyrosine, and a leucine at position 451 mutated to a stop codon.

[0062] In one embodiment, the mutant has an isoleucine at position 89 mutated to proline, a glutamic acid at position 93 mutated to serine, a serine at position 153 mutated to tyrosine, a proline at position 268 mutated to serine, an aspartic acid at position 301 mutated to methionine, a phenylalanine at position 355 mutated to serine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0063] In one embodiment, the mutant has isoleucine at position 89 mutated to alanine, glutamic acid at position 93 mutated to alanine, serine at position 153 mutated to methionine, proline at position 268 mutated to asparagine, aspartic acid at position 301 mutated to serine, phenylalanine at position 355 mutated to methionine, aspartic acid at position 432 mutated to serine, histidine at position 435 mutated to methionine, and leucine at position 451 mutated to a stop codon.

[0064] In one embodiment, the mutant has isoleucine at position 89 mutated to methionine, glutamic acid at position 93 mutated to tyrosine, serine at position 153 mutated to alanine, proline at position 268 mutated to glutamine, aspartic acid at position 301 mutated to glutamine, phenylalanine at position 355 mutated to alanine, aspartic acid at position 432 mutated to valine, histidine at position 435 mutated to serine, and leucine at position 451 mutated to a stop codon.

[0065] In one embodiment, the mutant has isoleucine at position 89 mutated to valine, glutamic acid at position 93 mutated to glutamine, serine at position 153 mutated to threonine, proline at position 268 mutated to threonine, aspartic acid at position 301 mutated to asparagine, phenylalanine at position 355 mutated to tyrosine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to glutamine, and leucine at position 451 mutated to a stop codon.

[0066] In one embodiment, the mutant has an isoleucine at position 89 mutated to asparagine, a glutamic acid at position 93 mutated to glutamine, a serine at position 153 mutated to leucine, a proline at position 268 mutated to asparagine, an aspartic acid at position 301 mutated to serine, a phenylalanine at position 355 mutated to asparagine, an aspartic acid at position 432 mutated to alanine, a histidine at position 435 mutated to serine, and a leucine at position 451 mutated to a stop codon.

[0067] In one embodiment, the mutant has isoleucine at position 89 mutated to glutamine, glutamic acid at position 93 mutated to asparagine, serine at position 153 mutated to glutamine, proline at position 268 mutated to glutamine, aspartic acid at position 301 mutated to glutamine, phenylalanine at position 355 mutated to asparagine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to proline, and leucine at position 451 mutated to a stop codon.

[0068] In one embodiment, the mutant has isoleucine at position 89 mutated to proline, glutamic acid at position 93 mutated to leucine, serine at position 153 mutated to asparagine, proline at position 268 mutated to leucine, aspartic acid at position 301 mutated to tyrosine, phenylalanine at position 355 mutated to methionine, aspartic acid at position 432 mutated to glutamine, histidine at position 435 mutated to methionine, and leucine at position 451 mutated to a stop codon.

[0069] In one embodiment, the mutant has isoleucine at position 89 mutated to methionine, glutamic acid at position 93 mutated to tyrosine, serine at position 153 mutated to alanine, proline at position 268 mutated to tyrosine, aspartic acid at position 301 mutated to methionine, phenylalanine at position 355 mutated to valine, aspartic acid at position 432 mutated to tyrosine, histidine at position 435 mutated to glutamine, and leucine at position 451 mutated to a stop codon.

[0070] In one embodiment, the mutant has isoleucine at position 89 mutated to alanine, glutamic acid at position 93 mutated to methionine, serine at position 153 mutated to serine, proline at position 268 mutated to valine, aspartic acid at position 301 mutated to proline, phenylalanine at position 355 mutated to alanine, aspartic acid at position 432 mutated to leucine, histidine at position 435 mutated to asparagine, and leucine at position 451 mutated to a stop codon.

[0071] In one embodiment, the mutant has an isoleucine at position 89 mutated to serine, a glutamic acid at position 93 mutated to alanine, a serine at position 153 mutated to proline, a proline at position 268 mutated to methionine, an aspartic acid at position 301 mutated to valine, a phenylalanine at position 355 mutated to proline, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to proline, and a leucine at position 451 mutated to a stop codon.

[0072] In one embodiment, the mutant has an isoleucine at position 89 mutated to leucine, a glutamic acid at position 93 mutated to serine, a valine at position 153 mutated to proline, a proline at position 268 mutated to serine, an aspartic acid at position 301 mutated to proline, a phenylalanine at position 355 mutated to glutamine, an aspartic acid at position 432 mutated to asparagine, a histidine at position 435 mutated to alanine, and a leucine at position 451 mutated to a stop codon.

[0073] In one embodiment, the mutant has isoleucine at position 89 mutated to glutamine, glutamic acid at position 93 mutated to asparagine, serine at position 153 mutated to leucine, proline at position 268 mutated to alanine, aspartic acid at position 301 mutated to alanine, phenylalanine at position 355 mutated to tyrosine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to methionine, and leucine at position 451 mutated to a stop codon.

[0074] In one embodiment, the mutant has isoleucine at position 89 mutated to leucine, glutamic acid at position 93 mutated to glutamine, serine at position 153 mutated to threonine, proline at position 268 mutated to threonine, aspartic acid at position 301 mutated to methionine, phenylalanine at position 355 mutated to leucine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0075] In one embodiment, the mutant has isoleucine at position 89 mutated to valine, glutamic acid at position 93 mutated to proline, serine at position 153 mutated to methionine, proline at position 268 mutated to threonine, aspartic acid at position 301 mutated to asparagine, phenylalanine at position 355 mutated to leucine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to glutamine, and leucine at position 451 mutated to a stop codon.

[0076] In one embodiment, the mutant has isoleucine at position 89 mutated to methionine, glutamic acid at position 93 mutated to glutamine, serine at position 153 mutated to threonine, proline at position 268 mutated to valine, aspartic acid at position 301 mutated to serine, phenylalanine at position 355 mutated to tyrosine, aspartic acid at position 432 mutated to asparagine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0077] In one embodiment, the mutant has aspartic acid at position 38 mutated to asparagine, isoleucine at position 89 mutated to valine, aspartic acid at position 92 mutated to asparagine, glutamic acid at position 93 mutated to asparagine, serine at position 153 mutated to threonine, aspartic acid at position 202 mutated to glutamine, proline at position 268 mutated to threonine, glutamic acid at position 294 mutated to serine, aspartic acid at position 301 mutated to glutamine, phenylalanine at position 355 mutated to valine, aspartic acid at position 432 mutated to glutamine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0078] In one embodiment, the mutant has aspartic acid at position 38 mutated to asparagine, isoleucine at position 89 mutated to serine, aspartic acid at position 92 mutated to tyrosine, glutamic acid at position 93 mutated to glutamine, serine at position 153 mutated to asparagine, aspartic acid at position 202 mutated to proline, proline at position 268 mutated to valine, glutamic acid at position 294 mutated to asparagine, aspartic acid at position 301 mutated to alanine, phenylalanine at position 355 mutated to glutamine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to serine, and leucine at position 451 mutated to a stop codon.

[0079] In one embodiment, the mutant has aspartic acid at position 38 mutated to valine, isoleucine at position 89 mutated to alanine, aspartic acid at position 92 mutated to glutamine, glutamic acid at position 93 mutated to proline, serine at position 153 mutated to serine, aspartic acid at position 202 mutated to serine, proline at position 268 mutated to asparagine, glutamic acid at position 294 mutated to tyrosine, aspartic acid at position 301 mutated to serine, phenylalanine at position 355 mutated to alanine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to serine, and leucine at position 451 mutated to a stop codon.

[0080] In one embodiment, the mutant has aspartic acid at position 38 mutated to glutamine, isoleucine at position 89 mutated to glutamine, aspartic acid at position 92 mutated to serine, glutamic acid at position 93 mutated to valine, serine at position 153 mutated to asparagine, aspartic acid at position 202 mutated to glutamine, proline at position 268 mutated to asparagine, glutamic acid at position 294 mutated to alanine, aspartic acid at position 301 mutated to glutamine, phenylalanine at position 355 mutated to glutamine, aspartic acid at position 432 mutated to serine, histidine at position 435 mutated to leucine, and leucine at position 451 mutated to a stop codon.

[0081] In one embodiment, the mutant has aspartic acid at position 38 mutated to serine, isoleucine at position 89 mutated to methionine, aspartic acid at position 92 mutated to leucine, glutamic acid at position 93 mutated to methionine, serine at position 153 mutated to leucine, aspartic acid at position 202 mutated to methionine, proline at position 268 mutated to serine, glutamic acid at position 294 mutated to proline, aspartic acid at position 301 mutated to methionine, phenylalanine at position 355 mutated to asparagine, aspartic acid at position 432 mutated to methionine, histidine at position 435 mutated to tyrosine, and leucine at position 451 mutated to a stop codon.

[0082] In one embodiment, the mutant has aspartic acid at position 38 mutated to methionine, isoleucine at position 89 mutated to alanine, aspartic acid at position 92 mutated to glutamine, glutamic acid at position 93 mutated to valine, serine at position 153 mutated to methionine, aspartic acid at position 202 mutated to serine, proline at position 268 mutated to valine, glutamic acid at position 294 mutated to leucine, aspartic acid at position 301 mutated to valine, phenylalanine at position 355 mutated to alanine, aspartic acid at position 432 mutated to valine, histidine at position 435 mutated to valine, and leucine at position 451 mutated to a stop codon.

[0083] In one embodiment, the variant is based on SEQ ID NO. 3, with the following mutations: aspartic acid at position 38 is mutated to asparagine, isoleucine at position 89 is mutated to valine, aspartic acid at position 92 is mutated to asparagine, glutamic acid at position 93 is mutated to glutamine, serine at position 153 is mutated to threonine, aspartic acid at position 202 is mutated to asparagine, proline at position 268 is mutated to threonine, glutamic acid at position 294 is mutated to arginine, aspartic acid at position 301 is mutated to asparagine, phenylalanine at position 355 is mutated to tyrosine, aspartic acid at position 432 is mutated to asparagine, histidine at position 435 is mutated to glutamine, and leucine at position 451 is mutated to a stop codon; and the amino acid sequence is the same as that of SEQ ID NO. It is obtained as the mutant D38N / I89V / D92N / / E93Q / S153T / D202N / P268T / E294R / D301N / F355Y / D432N / H435Q / L451* shown in NO. 4.

[0084] The present invention also provides a gene encoding the mutant.

[0085] In one embodiment, the nucleotide sequence encoding the mutant D38N / I89V / D92N / / E93Q / S153T / D202N / P268T / E294R / D301N / F355Y / D432N / H435Q / L451* is set forth in SEQ ID NO.2.

[0086] The present invention also provides an expression vector carrying the gene.

[0087] In one embodiment, the expression vector includes, but is not limited to, pCES, pJC1, and pAN6 plasmids. The pCES plasmid is disclosed in the article "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum," and the pJC1 and pAN6 plasmids are disclosed in the article "Regulation of γ-aminobutyrate (GABA) utilization in Corynebacterium glutamicum by the PucR-type transcriptional regulator GabR and by alternative nitrogen and carbon sources."

[0088] The present invention also provides recombinant microbial cells that express the glutamic acid decarboxylase mutants.

[0089] In one embodiment, the recombinant microbial cell is a bacterial or fungal host cell.

[0090] In one embodiment, the recombinant microorganism is a recombinant Corynebacterium glutamicum, and the host Corynebacterium glutamicum includes, but is not limited to, ATCC 13032 and ATCC 13869.

[0091] The present invention also provides a GAD enzyme mutant having high activity under pH 7.0 conditions, and Corynebacterium glutamicum capable of producing γ-aminobutyric acid in a one-step method using glucose.

[0092] The present invention provides a recombinant Corynebacterium glutamicum for producing GABA in a one-step process, wherein the recombinant Corynebacterium glutamicum expresses the glutamic acid decarboxylase and has at least one of the following improvements: (1) Knockout or deletion of the serine / threonine protein kinase gene pknG (2) knocking out or deleting the aminotransferase gene bioA and overexpressing phosphoenolpyruvate carboxylase and glutamate dehydrogenase; (3) knocking out or deleting the transport protein gene gabP and overexpressing pyruvate carboxylase (4) Knockout or deletion of the phosphoenolpyruvate carboxykinase gene pck and overexpression of pyridoxal kinase. (5) Expression of the citrate synthase gene gltA is controlled by the promoter P gltA To augment with (6) Knock out or delete the oxaloacetate decarboxylase gene odx. (7) Expressing the ketoglutarate dehydrogenase gene odhA in a weak RBS (8) Knock out or delete the lactate dehydrogenase gene (ldh) and overexpress isocitrate dehydrogenase. (9) The lactate dehydrogenase 2 gene lldD was knocked out or deleted, and the expression of the glutamate dehydrogenase gene gdh was controlled by the promoter P tuf To enhance with.

[0093] In one embodiment, the recombinant Corynebacterium glutamicum has undergone any of the improvements (1) to (9): (1) The serine / threonine kinase gene pknG is knocked out or deleted, and the amino acid sequence encoded by the serine / threonine kinase gene pknG is shown in Genbank accession number: BAC00145.1. (2) The aminotransferase gene bioA is knocked out or deleted, and phosphoenolpyruvate carboxylase and glutamate dehydrogenase are overexpressed. The amino acid sequence encoded by the aminotransferase gene bioA is shown in Genbank accession number BAB99997.1, the amino acid sequence of the phosphoenolpyruvate carboxylase is shown in Genbank accession number BAB98892.1, and the amino acid sequence of the glutamate dehydrogenase is shown in Genbank accession number BAB99472.1. (3) The transport protein gene gabP is knocked out or deleted, and pyruvate carboxylase is overexpressed. The amino acid sequence encoded by the transport protein gene gabP is shown in Genbank accession number BAB97874.1, and the amino acid sequence of pyruvate carboxylase is shown in Genbank accession number BAB98082.1. (4) The phosphoenolpyruvate carboxykinase gene pck is knocked out or deleted, and pyridoxal kinase is overexpressed. The amino acid sequence encoded by the phosphoenolpyruvate carboxykinase gene pck is shown in GenBank accession number: BAC00257.1, and the amino acid sequence of the pyridoxal kinase is shown in GenBank accession number: WP_003641112.1. (5) Expression of the citrate synthase gene gltA is controlled by the promoter P gltA and the promoter P gltA The nucleotide sequence of is shown in SEQ ID NO. 6, and the amino acid sequence encoded by the citrate synthase gene gltA is shown in Genbank accession number: BAB98222.1. (6) The oxaloacetate decarboxylase gene odx is knocked out or deleted, and the amino acid sequence encoded by the oxaloacetate decarboxylase gene odx is shown in Genbank accession number: BAB98683.1. (7) The ketoglutarate dehydrogenase gene odhA is expressed with a weak RBS, the sequence of which is CTCACCCACGAGTTCAATAACTAGG, and the amino acid sequence encoded by the ketoglutarate dehydrogenase gene odhA is shown in Genbank accession number: BAB98522.1. (8) The lactate dehydrogenase gene ldh is knocked out or deleted, and isocitrate dehydrogenase is overexpressed. The amino acid sequence encoded by the lactate dehydrogenase gene ldh is shown in GenBank accession number: BAC00305.1, and the amino acid sequence of the isocitrate dehydrogenase is shown in GenBank accession number: BAB98057.1. (9) The lactate dehydrogenase 2 gene lldD was knocked out or deleted, and the expression of the glutamate dehydrogenase gene gdh was controlled by the promoter P tuf and the promoter P tuf The nucleotide sequence of the amplified nucleotide sequence is shown in SEQ ID NO. 5, the amino acid sequence encoded by the lactate dehydrogenase 2 gene lldD is shown in Genbank accession number: BAC00312.1, and the amino acid sequence of the glutamate dehydrogenase is shown in Genbank accession number: BAB99472.1.

[0094] The present invention also provides a method for producing γ-aminobutyric acid in a single step using the recombinant Corynebacterium glutamicum, which comprises inoculating the recombinant Corynebacterium glutamicum into a fermentation medium and fermenting for at least 40 hours.

[0095] In one embodiment, the fermentation medium contains a carbon source that is a monosaccharide, polysaccharide, or mixture thereof that can be utilized by Corynebacterium glutamicum, including, but not limited to, glucose, fructose, sucrose, molasses, etc.

[0096] In one embodiment, the method does not add glutamic acid or glutamate as a production precursor, and therefore, γ-aminobutyric acid can be produced by fermenting the recombinant Corynebacterium glutamicum directly from a carbon source containing glucose in one step without collecting the bacterial cells after growth and transforming them. During the fermentation process, the pH is controlled to 7.0±0.5, and fermentation is carried out using the recombinant Corynebacterium glutamicum. The fermentation temperature is controlled to 28-30°C, and the fermentation is carried out for at least 40 hours.

[0097] In one embodiment, the fermentation medium contains 100 g / L glucose, 12 g / L ammonium sulfate, 0.87 g / L magnesium sulfate, 3 ml / L corn syrup, 0.4 ml / L phosphoric acid, 0.53 g / L potassium chloride, 120 mg / L ferrous sulfate, 120 mg / L manganese sulfate, 42 mg / L nicotinamide, 6.3 mg / L calcium pantothenate, 16.3 mg / L microbial B, and 0.05 mg / L biotin.

[0098] In one embodiment, the fermentation process also controls the pH at 7.0±0.2.

[0099] In one embodiment, the fermentation temperature is also controlled at 30° C. and dissolved oxygen at 30%.

[0100] The present invention also provides use of the glutamic acid decarboxylase mutant, the Corynebacterium glutamicum, or the method in the production of a γ-aminobutyric acid-containing product. [Effects of the Invention]

[0101] The beneficial effects are: (1) The GABA biosensor constructed in this invention is the first GABA biosensor constructed in a prokaryote, and its fluorescent signal becomes stronger as the GABA concentration increases, which is advantageous for the efficient selection and cultivation of GABA-producing strains. (2) The glutamic acid decarboxylase mutant provided by the present invention has significantly improved activity at pH 6.0 to 7.5, and has a high specific enzyme activity of 10.29 U / mg at pH 7.0. (3) The present invention constructs a Corynebacterium glutamicum chassis cell useful for the production of gamma-aminobutyric acid. By overexpressing a glutamic acid decarboxylase (GAD) mutant, the recombinant Corynebacterium glutamicum produces GABA by one-step fermentation from glucose at pH 7.0, increasing the GABA production to 114 g / L, the highest level reported to date. Furthermore, the production cost of GABA is significantly reduced, making it lower than that of glutamic acid. [Brief explanation of the drawings]

[0102] [Figure 1] The construction of a biosensor. [Figure 2] GABA metabolism and synthesis pathways and the genes involved: GAD: glutamate decarboxylase, GabT: gamma-aminobutyrate aminotransferase, GabD: succinic semialdehyde dehydrogenase, GabP: GABA-specific transport protein, ODHC: alpha-ketoglutarate dehydrogenase complex, PknG: serine / threonine kinase, PEPC: phosphoenolpyruvate carboxylase, PC: pyruvate carboxylase, GDH: glutamate dehydrogenase. [Figure 3] This is the production amount when the bacteria of each generation are modified to produce GABA in a shake flask. [Figure 4] A method for directed evolution of glutamic acid decarboxylase. [Figure 5] This shows the construction of a GAD mutation library and the results of a selection test using a flow cytometer (FACS). [Figure 6] Assay of specific enzyme activity of wild-type glutamic acid decarboxylase and mutant GAD MUT12. [Figure 7] GABA is produced by fermentation in a one-step process using engineered bacteria expressing FF10-expressing glutamic acid decarboxylase mutant (a) or FF10-expressing wild-type glutamic acid decarboxylase (b). DETAILED DESCRIPTION OF THE INVENTION

[0103] Culture medium: CGXII medium: glucose 50 g / L, (NH4)2SO4 20 g / L, urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, biotin 0.2 mg / L, trace element solution 1 ml / L, pH adjusted to 7.0 with KOH. The trace element solution contains FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, and NiCl·6H2O 20 mg / L. Fermentation medium: glucose 100g / L, ammonium sulfate 12g / L, magnesium sulfate 0.87g / L, corn syrup 3ml / L, phosphoric acid 0.4ml / L, potassium chloride 0.53g / L, ferrous sulfate 120mg / L, manganese sulfate 120mg / L, nicotinamide 42mg / L, calcium pantothenate 6.3mg / L, microbial B 16.3mg / L, biotin 0.5mg / L.

[0104] Detection method: Measurement of glutamate decarboxylase: GABA content was detected by high-performance liquid chromatography (see the paper "Regulation of γ-aminobutyrate (GABA) utilization in Corynebacterium glutamicum by the PucR-type transcriptional regulator GabR and by alternative nitrogen and carbon sources," published in 2020, for the method). The enzyme activity of glutamate decarboxylase was calculated from the GABA content. The amount of enzyme required to produce 1 μM of GABA per minute was defined as 1 enzyme activity unit (U). Specific enzyme activity represents the amount of glutamate decarboxylase U per mg of protein.

[0105] Example 1 Construction of a GABA biosensor Design of GABA biosensor: As shown in Figure 1, promoter P gabTDP , P gabR , a reporter gene, and a gabR gene. gabTDP , P gabR The reporter gene and the gabR gene are located on the same vector or genome, constituting the biosensor. gabTDP regulates the expression of a reporter gene, gabR and P gabTDP has a GABA-GabR conjugate binding site sequence and regulates the expression of a reporter gene; gabTDP and Promoter P gabR The transcription direction of the promoter P gabTDP The nucleotide sequence encoding the promoter P is shown in SEQ ID NO. gabR The nucleotide sequence encoding the gabR gene (cg0565) is shown in SEQ ID NO. 7, and the sequence of the GABA-gabR conjugate binding site is shown in SEQ ID NO. 8. The working principle of the GABA biosensor: GABA binds to the regulatory protein GabR, and the formed conjugate binds to the site shown in SEQ ID NO. 8, thereby activating the promoter P gabTDP The gabTDP promoter initiates transcription and regulates the expression of the reporter gene. For example, when GABA is produced in the growth environment of the strain, the gabTDP promoter initiates transcription, producing green fluorescent protein. gabTDP can regulate the expression of green fluorescent protein with various intensities in response to various concentrations of GABA, and strains with high GABA production can be screened by detecting the fluorescence. Genomic construction of a GABA biosensor: Promoter P gabRThe gabR gene (cg0565) is located on the Corynebacterium glutamicum genome. Using the Pk18mobsacB plasmid as a backbone and the Corynebacterium glutamicum genome as a template, 1000 bp upstream and downstream homologous arms of the gabTD gene were cloned separately to construct a ΔgabTD knockout frame along with the sfgfp gene. The knockout frame and the Pk18mobsacB backbone were ligated using the Gibson method to construct the Pk18mobsacB-ΔgabTD::sfgfp plasmid. Pk18mobsacB-ΔgabTD::sfgfp was then transformed into E. coli DH5α competent cells. The correct plasmid was designated Pk18mobsacB-ΔgabTD::sfgfp. The Pk18mobsacB-ΔgabTD::sfgfp plasmid was transformed into competent Corynebacterium glutamicum ATCC 13032. A second round of recombination was performed by first selecting for kanamycin resistance and then for sucrose resistance. Colony PCR confirmed that sfgfp had replaced gabTD, resulting in the construction of a recombinant Corynebacterium glutamicum containing the GABA biosensor, designated FF1.

[0106] Example 2 Construction of chassis cells for an engineered strain of Corynebacterium glutamicum that produces γ-aminobutyric acid Figure 2 shows the synthetic and metabolic pathways of GABA. We knocked out the metabolic pathway and several branching pathways, and increased the expression of several key genes in the synthetic pathway to construct a Corynebacterium glutamicum capable of synthesizing γ-aminobutyric acid. Specifically, we performed the following steps: (1) The recombinant plasmid pK18-ΔpknG was constructed to knock out the serine / threonine kinase PknG and further reduce the activity of the α-ketoglutarate dehydrogenase complex (ODHC). Then, using the Corynebacterium glutamicum genome as a template, the upstream and downstream 1000 bp homologous arms of the pknG gene were cloned and ligated with the Pk18mobsacB backbone using the Gibson method. The resulting recombinant plasmid pK18-ΔpknG was transformed into FF1 constructed in Example 1 and recombined to obtain the strain FF1 / ΔpknG, designated FF2. (2) The aminotransferase BioA was knocked out, and the expression of phosphoenolpyruvate carboxylase (PEPC) and glutamate dehydrogenase (GDH) was enhanced. That is, using the Corynebacterium glutamicum genome as a template, the upstream and downstream 1000 of the bioA gene (Genbank accession number: BAB99997.1) were transfected. The 20 bp homologous arms were cloned, respectively. The promoter-containing phosphoenolpyruvate carboxylase (pepc) gene (GenBank accession number: BAB98892.1) encoding gene and the promoter-containing glutamate dehydrogenase (gdh) gene (GenBank accession number: BAB99472.1) encoding gene were cloned between the upstream and downstream homologous arms of the bioA gene. These were then ligated with the Pk18mobsacB backbone using the Gibson method to construct the recombinant plasmid pK18-ΔbioA::pepc+gdh. The recombinant plasmid pK18-ΔbioA::pepc+gdh was transformed into competent cells of the FF2 strain and recombined to obtain the strain FF2 / ΔbioA::pepc+gdh, designated FF3. (3) Following the same scheme as above, the recombinant plasmid pK18-ΔgabP::pyc was constructed to knock out the GABA intracellular transport protein GabP (GenBank accession number: BAB97874.1) and enhance the expression of pyruvate carboxylase PYC (GenBank accession number: BAB98082.1). The recombinant plasmid pK18-ΔgabP::pyc was transformed into FF3 competent cells and recombined to obtain the strain FF3 / ΔgabP::pyc, designated FF4. (4) Following the same scheme as above, the recombinant plasmid pK18-Δpck::plk was constructed to knock out phosphoenolpyruvate carboxykinase PCK (GenBank accession number: BAC00257.1) and overexpress pyridoxal kinase plk (GenBank accession number: WP_003641112.1) to enhance the synthesis of the coenzyme PLP. The constructed recombinant plasmid pK18-Δpck::plk was transformed into FF4 competent cells to obtain the recombinant strain FF4 / Δpck::plk, which was designated FF5. (5) Following the same scheme as above, recombinant plasmid pK18-P gltA gltA was constructed and the promoter P shown in SEQ ID NO. gltA The recombinant plasmid pK18-P was constructed to enhance the expression of citrate synthase GltA (Genbank accession number: BAB98222.1) gltA gltA was transformed into FF5 competent cells and recombined to give strain FF5 P gltA We obtained gltA and named it FF6. (6) Following the same scheme as above, the recombinant plasmid pK18-Δodx::wRBSodhA, knockout oxaloacetate decarboxylase ODX (GenBank accession number: BAB98683.1), was constructed, replacing the ketoglutarate dehydrogenase gene OdhA with a weak RBS at the ODX site. The weak RBS sequence was CTCACCCACGAGTTCAATAACTAGG. The recombinant plasmid pK18-Δodx::wRBSodhA was transformed into FF6 competent cells and recombined to obtain strain FF6 Δodx::wRBSodhA, designated FF7. (7) Following the same scheme as above, the recombinant plasmid pK18-ΔodhA was constructed to knock out the ketoglutarate dehydrogenase OdhA (Genbank accession number: BAB98522.1) native to Corynebacterium glutamicum. The recombinant plasmid pK18-ΔodhA was transformed into FF7 competent cells and recombined to obtain strain FF7 ΔodhA, which was named FF8. (8) Following the same scheme as above, the recombinant plasmid pK18-Δldh::icd was constructed to knock out lactate dehydrogenase LDH (GenBank accession number: BAC00305.1) and enhance the expression of isocitrate dehydrogenase ICD (GenBank accession number: BAB98057.1). The recombinant plasmid pK18-Δldh::icd was transformed into FF8 competent cells and recombined to obtain strain FF8 Δldh::icd, which was designated FF9. (9) Following the same scheme as above, the recombinant plasmid pK18-Δlldd::P tuf gdh was constructed to knock out lactate dehydrogenase 2 LldD (Genbank accession number: BAC00312.1) and to express the promoter P shown in SEQ ID NO. tuf The expression of glutamate dehydrogenase (GDH) (Genbank accession number: BAB99472.1) was enhanced by the recombinant plasmid pK18-Δlldd::P tuf gdh was transformed into FF9 competent cells and recombined to give strain FF9 Δlldd::P tuf I got gdh and named it FF10. FF1 to FF10 were each fermented in shake flasks using CGXII medium, with the initial OD of the strain after inoculation controlled at 0.2, the fermentation temperature at 30°C, and the pH at 7.0 for 72 hours. As shown in Figure 3, the amount of GABA produced increased with each generation of improvement, and ultimately, the amount of GABA produced in FF10 reached 9.18 g / L, 17 times that of the initial FF1.

[0107] Example 3 Construction of glutamic acid decarboxylase mutants, recombinant plasmids, and recombinant bacteria We performed directed evolution of GAD using error-prone PCR, and screened for GADs active at neutral pH using the GABA biosensor constructed in Example 1. The intracellular GABA transport protein GabP was knocked out to eliminate the effect of extracellular GABA concentration on fluorescence, so that the intensity of the generated fluorescence represented the concentration of GABA produced. The directed evolution method is shown in Figure 4. Amplification primers were designed to screen for the most suitable gene sequence for glutamic acid decarboxylase. GADF: CTTGGTTGGTAGGAGTAGCATGGGATCCATGCCTCAATGGCATCCGCATCGTGA, GADR: CTACTGCCGCCAGGCAGCGGCCGCTTAATGATGAAATCCATTGTCCTATTTC Using the Bacillus megaterium CICC 10055 genome as a template, approximately 25 rounds of error-prone PCR amplification were performed to obtain a random mutation library of the wild-type glutamic acid decarboxylase gene shown in SEQ ID NO. 1. The amplified products were purified using a DNA purification kit, and then Gibson ligated the error-prone PCR amplified products with the backbone fragment of the pCES plasmid (the plasmid is described in the paper "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum") and transformed into E. coli DH5α to construct the mutant plasmids. The mutant plasmid was then transformed into Corynebacterium glutamicum FF5 containing the GABA biosensor constructed in Example 2. The FF5 strain containing the GAD mutant library was cultured in CGXII medium, suitable for GABA production, at 30°C for 30 hours. The mutant strains with the highest green fluorescence were screened using a flow cytometer (FACS) based on the green fluorescent protein signal. GABA production was then measured using high-performance liquid HPLC (HPLC). Mutants with improved enzyme activity were then identified. Gene sequences of the mutant strains were analyzed to obtain correlations between GABA production and the mutation site. The construction of the GAD mutant library and FACS screening tests are shown in Figure 5. The GAD mutant library exhibited stronger fluorescence after incubation, and these highly fluorescent mutants were obtained through selection. This demonstrates the feasibility of constructing a mutant library and selecting mutant strains with improved fluorescence.

[0108] Example 4 Testing of glutamic acid decarboxylase mutants The recombinant Corynebacterium glutamicum containing the GAD mutant constructed in Example 3 was cultured in a shake flask containing CGXII medium supplemented with 10 g / L sodium glutamate at pH 7.0, 30°C, and with shaking for 40 hours, and then the amount of GABA produced was detected. The strain expressing wild-type GAD (GAD WT) in FF1 was used as a control. As shown in Table 1, the recombinant strain expressing wild-type glutamic acid decarboxylase produced very low amounts of GABA, while all of the mutants were able to produce more GABA under these conditions. Among them, the mutants with one or more mutations at positions 38, 51, 68, 89, 92, 93, 96, 118, 120, 121, 153, 186, 202, 206, 268, 294, 301, 355, 371, 432, 436, 451, 457, 459, 461, and 467 all produced higher GABA content than wild-type GAD. The mutant GAD MUT 128 (amino acid sequence of which is shown in SEQ ID NO: 1) with multiple mutations at positions 38, 51, 68, 89, 92, 93, 96, 118, 120, 121, 153, 186, 202, 206, 268, 294, 301, 355, 371, 432, 436, 451, 457, 459, 461, and 467 all produced higher GABA content than wild-type GAD. The strain (shown in No. 4) had a high productivity of 5.12 g / L, which was 36 times higher than that of the wild type. TIFF0007808116000001.tif230170TIFF0007808116000002.tif233170TIFF0007808116000003.tif230170TIFF0007808116000004.tif229170TIFF0007808116000005.tif235170TIFF0007808116000006.tif15170The GAD mutant GAD MUT128 was reconstructed into a pET plasmid, transformed into E. coli BL21 (DE3), and then cultured in LB medium at 37°C with shaking. 600When the pH reached 0.6–0.8, gene expression was induced by adding 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG). After 8 hours of induction at 25°C, cells were harvested by centrifugation. The harvested cells were resuspended in binding buffer (20 mM Tris-HCl [pH 7.8], 500 mM sodium chloride, and 10 mM imidazole) and then disrupted by sonication. The supernatant was collected and GAD purified by nickel affinity chromatography. The purified protein was desalted on a 5-ml HisTrap HP desalting column. The quality of the protein purification was confirmed by sodium lauryl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). Protein concentration was measured by the Bradford method using bovine serum albumin as a standard. After purification, GAD activity was measured at pH 7.0 using glutamate as a substrate and PLP as a coenzyme. The reaction was initiated by adding the enzyme and terminated by adding sodium hydride, and the corresponding GABA production was measured. As shown in Table 1 and Figure 6, the specific enzymatic activity of wild-type glutamic acid decarboxylase (GAD WT) at pH 7.0 was 0.84 U / mg, while the specific enzymatic activity of the glutamic acid decarboxylase mutant D38N / I89V / D92N / E93Q / S153T / D202N / P268T / E294R / D301N / F355Y / D432N / H435Q / L451* (GAD MUT128) constructed in the present invention was 10.29 U / mg, a 12.25-fold increase compared to the wild-type.

[0109] Example 5: γ-aminobutyric acid production by fermentation using an engineered strain of Corynebacterium glutamicum The expression vector pCES-GAD MUT12 carrying the mutant MUT128 coding sequence, obtained according to the scheme in Example 3, was transformed into the engineered strain FF10 of Corynebacterium glutamicum constructed in Example 2, and glucose was fermented to produce γ-aminobutyric acid in a one-step manner. A strain expressing wild-type glutamic acid decarboxylase (GAD WT) in strain FF10 served as a control. Strain FF10 pCES-GAD MUT12 was cultured in BHIS medium at 30°C for 24 hours to obtain seed solution. 500 mL of fermentation medium was added to a 1 L fermenter, and the fermentation tank was inoculated at a seeding rate of 10%, and the fermentation temperature was set to 30°C, the dissolved oxygen was set to 30%, and the pH was adjusted to 7.0 ± 0.2 using aqueous ammonia. Wild-type glutamic acid decarboxylase (GAD WT) was used as a control and fermented in a two-stage process. First, glutamic acid was produced in the fermentation medium at an initial pH of 7.0. After 76 hours of fermentation, the pH dropped to 5.5, and 27 g / L of GABA was produced by fermentation for up to 168 hours. As shown in Figure 7, when FF10 was used as a host and a strain expressing the glutamic acid decarboxylase mutant (GAD MUT12) was fermented for 168 hours, GABA production reached 114 g / L, more than 4.2 times that of the control strain, and is the highest level reported to date.

[0110] Although preferred embodiments of the present invention have been disclosed above, these are not intended to limit the present invention, and those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the patentable scope of the present invention is defined by the claims.

Claims

1. A glutamic acid decarboxylase mutant characterized in that it has only the following mutations in SEQ ID NO. 3: Mutation of aspartic acid at position 38 to asparagine.

2. A glutamic acid decarboxylase mutant characterized in that it has only the following mutations in SEQ ID NO. 3: a mutation of aspartic acid at position 38 to asparagine, a mutation of isoleucine at position 89 to valine, a mutation of aspartic acid at position 92 to asparagine, a mutation of glutamic acid at position 93 to asparagine, a mutation of serine at position 153 to threonine, a mutation of aspartic acid at position 202 to glutamine, a mutation of proline at position 268 to threonine, a mutation of glutamic acid at position 294 to serine, a mutation of aspartic acid at position 301 to glutamine, a mutation of phenylalanine at position 355 to valine, a mutation of aspartic acid at position 432 to glutamine, a mutation of histidine at position 435 to tyrosine, and a mutation of leucine at position 451 to a stop codon, or Mutation of aspartic acid at position 38 to asparagine, mutation of isoleucine at position 89 to valine, mutation of aspartic acid at position 92 to asparagine, mutation of glutamic acid at position 93 to glutamine, mutation of serine at position 153 to threonine, mutation of aspartic acid at position 202 to asparagine, mutation of proline at position 268 to threonine, mutation of glutamic acid at position 294 to arginine, mutation of aspartic acid at position 301 to asparagine, mutation of phenylalanine at position 355 to tyrosine, mutation of aspartic acid at position 432 to asparagine, mutation of histidine at position 435 to glutamine, and mutation of leucine at position 451 to a stop codon.

3. A gene encoding the glutamic acid decarboxylase mutant of claim 1 or 2.

4. An expression vector carrying the gene according to claim 3.

5. A recombinant microbial cell that expresses the glutamic acid decarboxylase mutant of claim 1 or 2.

6. A recombinant Corynebacterium glutamicum, characterized by expressing the glutamic acid decarboxylase mutant according to claim 1 or 2.

7. The recombinant Corynebacterium glutamicum according to claim 6, further characterized in that at least one of the following improvements has been made: (1) Knocking out or deleting the serine / threonine kinase gene pknG (2) knocking out or deleting the aminotransferase gene bioA and overexpressing phosphoenolpyruvate carboxylase and glutamate dehydrogenase; (3) Knocking out or deleting the transport protein gene gabP and overexpressing pyruvate carboxylase (4) Knocking out or deleting the phosphoenolpyruvate carboxykinase gene pck and overexpressing pyridoxal kinase (5) Expression of the citrate synthase gene gltA is controlled by the promoter P ｇｌｔＡ To augment with (6) Knocking out or deleting the oxaloacetate decarboxylase gene odx (7) Expressing the ketoglutarate dehydrogenase gene odhA with a weak RBS (8) Knocking out or deleting the lactate dehydrogenase gene ldh and overexpressing isocitrate dehydrogenase (9) The lactate dehydrogenase 2 gene lldD is knocked out or deleted, and the expression of the glutamate dehydrogenase gene gdh is controlled by the promoter P ｔｕｆ To enhance with.

8. Use of the recombinant Corynebacterium glutamicum according to claim 6 in the production of γ-aminobutyric acid.

9. 1. A method for producing γ-aminobutyric acid in a one-step process, comprising: A method for producing the recombinant Corynebacterium glutamicum of claim 7, characterized in that the recombinant Corynebacterium glutamicum is fermented in a medium for at least 40 hours.

10. The method according to claim 9, wherein the medium contains sugars that can be utilized by Corynebacterium glutamicum as a carbon source.

11. The method according to claim 9, wherein the pH is controlled to 7.0±0.2 and the fermentation temperature is controlled to 28-30°C during the fermentation process.

12. The method according to claim 10, characterized in that the pH is controlled to 7.0±0.2 and the fermentation temperature is controlled to 28 to 30°C during the fermentation process.

Images