Methods and compositions for enhancing functional myelin production

Abstract

To provide methods for generating cells that enhance functional myelin production.SOLUTION: The methods include genetically modifying a cell such that: (i) an endogenous PLP1 gene is modified to decrease its ability to inhibit myelin production; (ii) an endogenous PLP1 genetic regulatory element is modified to decrease its ability to promote PLP1 expression; (iii) an endogenous PLP1 genetic regulatory element is modified to increase its ability to inhibit PLP1 expression; or (iv) an endogenous PLP1 gene product or a PLP1 regulatory element gene product that promotes PLP1 expression is modified to decrease the PLP1 expression level; where the cell produces functional myelin.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to the filing dates of U.S. Provisional Patent Application No. 62 / 431,787, filed December 8, 2016, and U.S. Provisional Patent Application No. 62 / 542,660, filed August 8, 2017, the entire contents of each of which are incorporated herein by reference. [Background technology]

[0002] Myelin-related disorders affect millions of people and impose a heavy burden of morbidity and mortality on affected individuals and their families. Leukodystrophies are inherited myelin-related disorders that collectively affect 1 in 7,500 newborns in the United States. These disorders lack disease-modifying therapies and inevitably result in significant morbidity and mortality during childhood and adolescence. Several common leukodystrophies have known genetic mutations that result in inappropriate myelination (myelin wrapping) of nerve axons by oligodendrocytes in the central nervous system (CNS).

[0003] Pelizaeus-Merzbach disease (PMD) is a particularly severe leukodystrophy that causes significant cognitive and motor deficits by 4 months of age and death in childhood or early adolescence. In more extreme cases, patients experience symptoms within 2 weeks of birth, never learn to walk or talk, and succumb to the disease before age 10. Summary of the Invention [Problem to be solved by the invention]

[0004] Unfortunately, the pathological processes underlying many of these disorders remain poorly understood, and few disease-modifying therapies exist. Thus, there is a pressing need for therapies for disorders affecting central nervous system myelin. [Means for solving the problem]

[0005]

[0005] Embodiments described herein relate to compositions and methods for treating myelin-related disorders using gene therapy or genome manipulation.

[0006] Thus, in one aspect, the present invention provides a method for generating cells that enhance functional myelin production, comprising the step of genetically modifying a cell so that: (i) the endogenous PLP1 gene has been modified to reduce its ability to inhibit myelin production; (ii) the endogenous PLP1 gene regulatory element has been modified to reduce its ability to promote PLP1 expression; (iii) the endogenous PLP1 gene regulatory element has been modified to increase its ability to inhibit PLP1 expression; or (iv) the endogenous PLP1 gene product, or the PLP1 regulatory element gene product that promotes PLP1 expression, has been modified to reduce PLP1 expression levels, wherein the cell produces functional myelin or is a precursor cell that produces or differentiates into a cell that produces functional myelin.

[0006]

[0007] In some embodiments, the resulting cells enhance myelin production by reducing PLP1-associated toxicity in the cells. In certain embodiments, modifying the endogenous PLP1 gene or PLP1 gene regulatory elements alleviates PLP1-associated cellular stress in the cells.

[0007]

[0008] In some embodiments, the modification of the endogenous PLP1 gene involves reducing expression of the endogenous PLP1 gene or inhibiting (e.g., through nonsense-mediated decay) of the PLP1 transcript. It is also possible to include the introduction of mutations that result in degradation.

[0008]

[0009] In certain embodiments, the endogenous PLP1 gene or endogenous PLP1 gene regulatory element comprises a point mutation, and said modification of the endogenous PLP1 gene or endogenous PLP1 gene regulatory element comprises correcting the point mutation to a wild-type sequence.

[0009]

[0010] In certain embodiments, the endogenous PLP1 gene regulatory element is a PLP1 enhancer or promoter.

[0011] In some embodiments, genetic modification of endogenous PLP1 gene regulatory elements can include the introduction of small insertions or deletions (indels) that alter the activity of the PLP1 gene regulatory elements, or larger exonic deletions of PLP1.

[0010]

[0012] In particular embodiments, the genetic modification may include a large deletion near the start codon in exon 1 or in any of the first three exons of PLP1. In exemplary embodiments, the genetic modification may include a large deletion at the 5' end of exon 3 of PLP1.

[0011]

[0013] In other embodiments, the modification of endogenous PLP1 gene regulatory elements can include the introduction of indels or larger deletions, which alter the activity of PLP1 gene regulatory elements, such as PLP1 enhancers or promoters.In some aspects, endogenous PLP1 gene regulatory elements are modified to reduce their ability to promote PLP1 transcription.For example, the modification can include the disruption of PLP1 enhancers or promoters.

[0012]

[0014] In certain embodiments, the endogenous PLP1 gene is a deleterious, disease-causing mutant PLP1 gene.

[0015] In some embodiments, modifications of the endogenous PLP1 gene or PLP1 gene regulatory elements can be made using nucleases, which can include zinc finger nucleases (ZFNs), TALE effectors (TALENs), CRISPR / Cas systems, or NgAgo systems.

[0013]

[0016] In certain embodiments, the nuclease can include a Class 2 CRISPR / Cas system. For example, a Class 2 CRISPR / Cas system can include a Type II Cas9-based CRISPR system or a Type V Cpfl-based CRISPR system.

[0014]

[0017] In certain embodiments, the PLP1 gene is modified with a CRISPR / Cas-based nuclease at exon 1 or exon 3. In certain embodiments, the PLP1 gene is modified with a CRISPR / Cas-based nuclease at the 5' end of exon 3. In certain embodiments, the PLP1 gene is modified with a CRISPR / Cas-based nuclease by disrupting the start codon in exon 1.

[0015]

[0018] In some embodiments, modifying PLP1 gene product or PLP1 regulatory element gene product comprises delivering a gene silencing agent to the cell.In some embodiments, the gene silencing agent can comprise an RNAi construct (for example, siRNA, shRNA, or miRNA, or a construct that can be transcribed to produce these).

[0016]

[0019] In some embodiments, the gene silencing agent may include an antisense oligonucleotide (ASO).

[0020] In certain embodiments, the genetically modified cells are characterized by the expression of PLP1 in the cells (e.g., These results demonstrate enhanced myelin production (with reduced associated toxicity).

[0017]

[0021] In certain embodiments, the method comprises contacting the cell with a delivery vehicle comprising a nuclease or gene silencing agent.

[0022] In certain embodiments, the delivery vehicle is an AAV vector, an adenoviral vector, or a lentiviral vector.

[0018]

[0023] In certain embodiments, the method includes: (a) contacting a cell with a first AAV vector comprising a nucleic acid encoding a functional Type II CRISPR-Cas9 (e.g., Cas9 or Cas9 ortholog cDNA), and a second AAV vector comprising a guide RNA (sgRNA) sequence specific for a target site in the endogenous PLP1 gene or endogenous PLP1 gene regulatory element, and optionally, a third AAV vector comprising a donor nucleic acid sequence for correction or replacement of a defective or mutated portion of the endogenous PLP1 gene or endogenous PLP1 gene regulatory element. or (b) contacting the cell with a first AAV vector comprising a functional Type II CRISPR-Cas9 (e.g., Cas9 or Cas9 ortholog cDNA) and a nucleic acid encoding a guide RNA (sgRNA) encoded in cis and specific for a target site in the endogenous PLP1 gene or endogenous PLP1 gene regulatory element, and optionally a third AAV vector comprising a donor nucleic acid sequence for correction or replacement of the defective or mutated portion of the endogenous PLP1 gene or endogenous PLP1 gene regulatory element.

[0019]

[0024] In certain embodiments, the first AAV vector further comprises, optionally in the 5' to 3' direction, one or more of the following elements: i) a 5' AAV inverted terminal repeat (ITR); ii) a promoter and optional enhancer; iii) a Cas9 cDNA encoding a functional Type II CRISPR-Cas9; iv) a polyadenylation signal; and v) a 3' AAV inverted terminal repeat (ITR).

[0020]

[0025] In certain embodiments, the promoter and optional enhancer can be a ubiquitous or constitutive promoter and optional ubiquitous or constitutive enhancer; a regulatable, inducible or derepressible promoter and optional regulatable, inducible or derepressible enhancer; a tissue-specific promoter and optional tissue-specific enhancer; a viral promoter and optional viral enhancer; a promoter active in zygotes, OPCs, NSCs, or oligodendrocytes; a viral promoter, optionally a CMV promoter, or a viral enhancer; a mammalian beta-actin promoter; a chicken beta-actin promoter; a mammalian U6 promoter; or a human U6 promoter.

[0021]

[0026] In certain embodiments, the second or third AAV vector (if present) further comprises, optionally in the 5' to 3' direction, one or more of the following elements: i) a 5' AAV ITR; ii) a promoter and optional enhancer; iii) a guide RNA sequence; iv) a stuffer or filler nucleic acid sequence; and v) a 3' AAV ITR.

[0022]

[0027] In certain embodiments, the third AAV vector (if present) further comprises one or more of the following elements, optionally in the 5' to 3' direction: i) a 5' AAV ITR; ii) a 5' slice acceptor site; iii) a donor nucleic acid sequence; iv) a polyadenylation signal; and v) an AAV 3' ITR.

[0023]

[0028] In certain embodiments, the first, second, and / or third AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV17, AAV18, AAV19, AAV20, AAV21, AAV22, AAV2 It comprises a VP1, VP2, or VP3 capsid selected from any serotype of AV9, AAV10, AAV11, or mixtures, variants, or derivatives thereof.

[0024]

[0029] In certain embodiments, the 5' AAV ITRs are selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or chimeras or fusions thereof, or the 3' AAV ITR is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 , AAV7, AAV8, AAV9, AAV10, AAV11, or any one of their chimeras or fusions.

[0025]

[0030] In certain embodiments, the cells are contacted in vitro, in vivo, or ex vivo.

[0031] Another aspect of the invention provides a composition comprising a first and second AAV vector (and optionally a third AAV vector) of any of the embodiments described herein.

[0026]

[0032] Another aspect of the present invention provides a pharmaceutical composition comprising a composition described herein.

[0033] Another aspect of the invention provides genetically modified cells, which can be: (i) cells in which the endogenous PLP1 gene has been modified to decrease its ability to inhibit myelin production; (ii) cells in which the endogenous PLP1 gene regulatory element has been modified to decrease its ability to promote PLP1 expression; (iii) cells in which the endogenous PLP1 gene regulatory element has been modified to increase its ability to inhibit PLP1 expression; or (iv) cells in which the endogenous PLP1 gene product or the PLP1 regulatory element gene product that promotes PLP1 expression has been modified to decrease PLP1 expression levels, wherein the cells produce functional myelin or are progenitor cells that produce or differentiate into cells that produce functional myelin.

[0027]

[0034] In certain embodiments, the cells are selected from neural stem cells (NSCs), oligodendrocyte progenitor cells (OPCs), neuronal cells, and glial cells such as oligodendrocytes, astrocytes, ependymal cells, or microglial cells, preferably NSCs, OPCs, and oligodendrocytes, more preferably NSCs or OPCs.

[0028]

[0035] Yet another aspect of the present invention relates to genetically modified cells derived from or differentiated from cells that have been genetically modified such that: (i) the endogenous PLP1 gene has been modified to reduce its ability to inhibit myelin production; (ii) the endogenous PLP1 gene regulatory element has been modified to reduce its ability to promote PLP1 expression; (iii) the endogenous PLP1 gene regulatory element has been modified to increase its ability to inhibit PLP1 expression; or (iv) the endogenous PLP1 gene product or the PLP1 regulatory element gene product that promotes PLP1 expression has been modified to reduce PLP1 expression levels, wherein the cells produce functional myelin or are progenitor cells that produce or differentiate into cells that produce functional myelin.

[0029]

[0036] Yet other aspects of the invention relate to compositions comprising the above-described genetically modified cells, and methods for treating a myelin-related disorder in a subject, including the step of producing functional myelin or cells that produce functional myelin in a subject, wherein the cells have been genetically modified such that: (i) the endogenous PLP1 gene has been modified to decrease its ability to inhibit myelin production; (ii) the endogenous PLP1 gene regulatory element has been modified to decrease its ability to promote PLP1 expression; (iii) the endogenous PLP1 gene regulatory element has been modified to increase its ability to inhibit PLP1 expression; or (iv) the endogenous PLP1 gene product or the PLP1 regulatory element gene product that promotes PLP1 expression has been modified to decrease PLP1 expression levels. The method may also include administering to the subject cells that are precursor cells that differentiate into the target cells.

[0030]

[0037] In a related aspect, the invention provides a method of treating a myelin-associated disorder in a subject, comprising genetically modifying cells of the subject in accordance with the methods of the invention described herein, thereby producing functional myelin in the subject, wherein the myelin-associated disorder is preferably characterized by aberrant PLP1 gene activity and / or expression.

[0031]

[0038] In certain embodiments, the myelin-related disorder is selected from multiple sclerosis (MS), neuromyelitis optica (NMO), transverse myelitis, chronic inflammatory demyelinating polyneuropathy, Guillain-Barré syndrome, progressive multifocal leukoencephalopathy (PML), encephalomyelitis (EPL), central pontine myelinolysis (CPM), adrenoleukodystrophy, Alexander disease, Pelizaeus-Merzbach disease (PMD), Wallerian degeneration, optic neuritis, amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, spinal cord injury, traumatic brain injury, post-radiation injury, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, Marchiafava-Bignami syndrome, trigeminal neuralgia, Marie-Charcot-Tooth disease, Bell's palsy, and leukodystrophy.

[0032]

[0039] In other embodiments, the myelin-related disorder is a leukodystrophy, such as 18q syndrome with myelin basic protein deficiency, acute disseminated encephalomyelitis (ADEM), acute disseminated leukoencephalitis, acute hemorrhagic leukoencephalopathy, adrenoleukodystrophy (ALD), adrenomyeloneuropathy (AMN), adult-onset autosomal dominant leukodystrophy (ADLD), adult polyglucosan body disease, Aicardi-Goutieres syndrome, Alexander disease, autosomal dominant diffuse leukoencephalopathy with axonal glomeruli (HDL). S), autosomal dominant late-onset leukoencephalopathy, Canavan disease, childhood ataxia with diffuse CNS hypomyelination (CACH or vanishing white matter disease), autosomal dominant cerebral arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), cerebroretinal microangiography with calcium deposits and cysts, cerebrotendinous xanthomatosis (CTX), childhood ataxia with central nervous system hypomyelination (CACH), craniometaphyseal dysplasia with leukoencephalopathy, cystic leukoencephalopathy (RNASET2-related), very long chain fatty acid elongation 4 (ELOVL4;Pseudo-Sjögren-Larsson syndrome), familial adult-onset leukodystrophy manifesting as asymptomatic widespread cerebral white matter abnormalities, cerebellar ataxia and dementia, familial leukodystrophy with adult-onset dementia and abnormal glycolipid storage, fatty acid 2-hydroxylase deficiency, fucosidosis, Fukuyama-type congenital muscular dystrophy, galactosialidosis, globoid cell leukodystrophy (Krabbe disease), GM1 gangliosidosis, GM2 gangliosidosis (Tay-Sachs disease), hereditary adult-onset leukodystrophy mimicking chronic progressive multiple sclerosis, hereditary diffuse leukoencephalopathy with axonal glomeruli (HDLS), hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC), hypomyelination, hypogonadotropism, hypogonadism and hypodontia (4H syndrome), lipomembranous dysplasia with leukodystrophy (Nasu disease), metachromatic leukodystrophy - (MLD), megacephalic leukoencephalopathy with subcortical cysts (MLC), neuroaxonal leukoencephalopathy with axonal glomeruli (hereditary diffuse leukoencephalopathy with glomeruli - HDLS), neonatal adrenoleukodystrophy (NALD), oculodetatoldigital dysplasia with cerebral white matter abnormalities, orthochromatic leukodystrophy with pigmented glia, ovarian leukodystrophy syndrome, Pelizaeus-Merzbach disease (X-linked spastic paraplegia) ), Refsum's disease, Sjögren-Larsson syndrome, Sudanophilic leukodystrophy, van der Naap syndrome (vacuolating leukodystrophy with subcortical cysts or MLC), vanishing white matter disease (VWM) or childhood ataxia with diffuse central nervous system hypomyelination (CACH), X-linked adrenoleukodystrophy (X-ALD), Zellweger syndrome spectrum: Zellweger syndrome, neonatal adrenoleukodystrophy; It is also possible that it is a dystrophy, as well as infantile Refsum's disease.

[0033]

[0040] In certain embodiments, the myelin-related disorder includes Pelizaeus-Merzbach disease (PMD).

[0041] In certain embodiments, the method restores the subject's lifespan to at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or about 100% of that of a control subject without a myelin-related disorder.

[0034]

[0042] In certain embodiments, the method reduces at least one symptom in the subject associated with said myelin-related disorder.

[0043] In certain embodiments, the method restores the subject's function to at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or about 100% of that of a control subject without a myelin-related disorder, preferably the function being motor coordination, locomotor activity, and axonal conduction velocity.

[0035]

[0044] In certain embodiments, the cells are selected from the group consisting of genetically modified NSCs, OPCs, neuronal cells, oligodendrocytes, astrocytes, ependymal cells, and microglial cells, preferably NSCs, OPCs, or oligodendrocytes.

[0036]

[0045] In certain embodiments, the endogenous PLP1 gene or its gene regulatory elements, or a portion thereof (e.g., a portion not longer than 4.8, 4.5, 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, or 1.0 kb) is inactivated, disrupted, modified, or replaced.

[0037]

[0046] In certain embodiments, the subject is a mammal, e.g., a human (e.g., a human younger than 20 years old, 15 years old, 10 years old, 5 years old, 3 years old, 2 years old, 1 year old, 6 months old, 3 months old, 1 month old, 2 weeks old, 1 week old, 3 days old, or 1 day old).

[0038]

[0047] All features disclosed herein may be combined in any combination. Each feature disclosed herein, unless expressly stated otherwise, may be replaced by an alternative feature serving the same, equivalent, or similar purpose. [Brief explanation of the drawings]

[0039] [Figure 1]

[0048] FIG. 1 is an image of a histological analysis showing complete myelination of the central nervous system in PLP1 indel-corrected jimpy (or crimpy) PMD model mice, indistinguishable from wild-type MBP (myelin basic protein) staining. [Figure 2]

[0049] Figure 2 is a schematic diagram (not to scale) showing the location of the jimpy gene mutation in the mouse PLP1 gene and the resulting gene product that ultimately causes oligodendrocyte death. The bottom of the figure shows the greatly reduced lifespan of jimpy mice, with a median survival of approximately 23 days. [Figure 3]

[0050] Figure 3 shows severe hypomyelination in the jimpy mouse brain. Note significantly less myelin basic protein (MBP) staining, indicative of mature oligodendrocytes, in postnatal day 19 (P19) jimpy mouse brain sections compared with those of wild-type controls. Jimpy mice also exhibit neurological symptoms of intention tremor and ataxia at the same age (data not shown). [Figure 4]

[0051] 4 and 5 are schematic diagrams showing an exemplary approach to knock out the PLP1 gene in jimpy mouse zygotes through CRISPR SpCas9 / dual guide RNA (sgRNA) targeting of exon 3 to generate CRISPR-knockout jimpy (CR-impy [or crimpy]) offspring mice. Figure 4 shows the relative location of the sgRNA targeting site in exon 3. [Figure 5]Figures 4 and 5 are schematic diagrams illustrating an exemplary approach to knock out the PLP1 gene in jimpy mouse zygotes through CRISPR SpCas9 / dual guide RNA (sgRNA) targeting of exon 3 to generate CRISPR-knockout jimpy (CR-impy [or crimpy]) offspring mice. Figure 5 shows the general experimental approach to generate jimpy male zygotes for reception of sgRNA and SpCas9 mRNA. Successful CRISPR / Cas9-mediated knockout of the jimpy PLP1 gene results in the generation of PLP1-null male CR-impy founders from surrogate host females. Two generations were crossed to the parental strain to generate offspring mice for further characterization. By postnatal day 21 (P21), most jimpy mice exhibited severe neurological symptoms or died, whereas CR-impy mice lacked any obvious phenotype (data not shown). [Figure 6]

[0052] FIG. 6 shows that CR-impy mice have a restored lifespan compared to jimpy and wild-type controls. [Figure 7]

[0053] Figure 7 shows that CR-impy mice show recovery of mature oligodendrocytes by whole brain IHC detecting MBP. Compare 19 days and 6 months of age. [Figure 8]

[0054] Figure 8 shows a schematic diagram of the rotarod test for assessing motor coordination in CR-impy mice, in which motor coordination is quantified by measuring the time it takes for the mouse to fall off the rotating bar as it accelerates. Measurements were performed on wild-type, jimpy, and CR-impy mice at postnatal day 19 (P19), 2 months, and 6 months of age. Statistical differences between different values ​​are indicated by p values. The results show that motor coordination was restored in CR-impy mice compared to wild-type and jimpy mice. [Figure 9]

[0055] Figure 9 shows a schematic diagram of the open field test for assessing locomotor activity in CR-impy mice, where locomotor activity is quantified by measuring the total distance traveled in the box as tracked by automated video tracking for 5 minutes. Measurements were performed in wild-type, jimpy, and CR-impy mice at postnatal day 19 (P19), 2 months, and 6 months of age. Statistical significance between different values ​​is indicated by p-values. The results show that locomotor activity in CR-impy mice was restored compared to wild-type and jimpy mice. [Figure 10]

[0056] Figure 10 shows a schematic diagram of representative results from an optic nerve conduction velocity study and the faster and slower conduction peaks, the first and second peaks, respectively. Myelinated and larger-diameter axons generally have faster conduction compared to unmyelinated and smaller-diameter axons. At postnatal day 19 (P19), both fast and slow conduction velocities, as measured by the first and second peaks, respectively, are statistically significantly different between any two of wild-type, jimpy, and CR-impy mice. However, by 6 months of age, all jimpy mice had died, and no differences were observed between wild-type and CR-impy mice. [Figure 11]

[0057] FIG. 11 shows that there are no discernible differences in optic nerve EM images between wild-type and CR-impy mice at 6 months of age. [Figure 12]

[0058] 12 is a schematic diagram illustrating one embodiment of the invention in which CRISPR-Cas9-mediated gene silencing is delivered to the postnatal brain, e.g., via an AAV viral vector encoding SaCas9 and a single sgRNA, which can at least partially correct mutant OPCs in the patient's brain. The thus-corrected OPCs will provide oligodendrocytes that, in time, will outcompete any mutant oligodendrocytes, thus providing fully restored myelination and function of the patient's neurons. DETAILED DESCRIPTION OF THE INVENTION

[0040] definition

[0059] For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0041]

[0060] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0042]

[0061] The terms "comprise," "comprising," "include," "including," "have," and "having" are used in the inclusive open sense, i.e., meaning that additional elements may be included. The term "such as," as used herein, is non-limiting and is for illustrative purposes only. "Including" and "including but not limited to" are used interchangeably.

[0043]

[0062] The term "or" as used herein shall be understood to mean "and / or" unless the context clearly indicates otherwise.

[0063] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that differs by up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. In one embodiment, the term "about" or "approximately" refers to a range of ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% of the quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length relative to the reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0044]

[0064] The phrases "parenteral administration" and "administering parenterally" are art-recognized terms and include modes of administration other than enteral and topical administration, such as injection, and include, without limitation, intravenous, intramuscular, intrapleural, intravascular, intrapericardial, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

[0045]

[0065] The term "treating" is art-recognized and includes inhibiting a disease, disorder, or condition in a subject, e.g., preventing its progression; and alleviating a disease, disorder, or condition, e.g., causing regression of the disease, disorder, and / or condition. Treating a disease or condition includes ameliorating at least one symptom of a particular disease or condition, even if the underlying pathophysiology is unaffected.

[0046]

[0066] The term "prevent" is art-recognized and includes stopping a disease, disorder, or condition from occurring in a subject who may be predisposed to, but has not yet been diagnosed with, the disease, disorder, and / or condition. Prevention of a disease-related condition includes stopping the condition from occurring after the disease has been diagnosed, but before the condition has been diagnosed.

[0047]

[0067] The term "pharmaceutical composition" refers to a formulation containing the disclosed compounds in a form suitable for administration to a subject. In preferred embodiments, the pharmaceutical composition is in bulk or It is a unit dosage form. The unit dosage form may be in any of a variety of forms, including, for example, a capsule, an IV bag, a tablet, a single pump on an aerosol inhaler, or a vial. The amount of active ingredient (e.g., a formulation of the disclosed compound or its salts) in a unit dose of the composition is an effective amount and will vary according to the particular treatment involved. Those skilled in the art will recognize that it may sometimes be necessary to make routine variations in dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration. Various routes are contemplated, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, intranasal, inhalation, etc. Dosage forms for topical or transdermal administration of the compounds described herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, atomized compounds, and inhalants. In a preferred embodiment, the active compound is mixed under sterile conditions with a pharmaceutically acceptable carrier and any required preservatives, buffers, or propellants.

[0048]

[0068] The phrase "pharmaceutically acceptable" is art-recognized. In certain embodiments, the term includes compositions, polymers, and other materials and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0049]

[0069] The phrase "pharmaceutically acceptable carrier" is art-recognized and includes, for example, a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, involved in carrying or transporting any subject composition from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not harmful to the patient. In certain embodiments, a pharmaceutically acceptable carrier is non-pyrogenic. Some examples of substances that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and and soybean oil; (10) glycols, such as propylene glycol, (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances used in pharmaceutical formulations.

[0050]

[0070] The terms "prophylactic" or "therapeutic" treatment are art-recognized and include administration of one or more of the subject compositions to a host. When administered prior to clinical manifestation of an undesirable condition (e.g., disease or other undesirable condition in the host animal, including, but not limited to, impaired myelination, myelin defects, myelin loss, and ineffective myelin repair), the treatment is prophylactic, i.e., the treatment protects the host from developing the undesirable condition, whereas when administered after manifestation of the undesirable condition, the treatment is therapeutic (i.e., the treatment is intended to reduce, ameliorate, or stabilize an existing undesirable condition or its side effects).

[0051]

[0071] The terms "therapeutic agent," "drug," "pharmaceutical agent," and "bioactive substance" are art-recognized and include any substance that is administered to a patient or subject to treat a disease or condition. The term "substances" includes molecules and other agents that are biologically, physiologically, or pharmacologically active substances that act locally or systemically in a patient or subject. The term includes, without limitation, pharmaceutically acceptable salts and prodrugs thereof. Such agents may be acidic, basic, or salts; they may be neutral molecules, polar molecules, or molecular complexes capable of hydrogen bonding; and they may be prodrugs in the form of ethers, esters, amides, etc., that are biologically activated when administered to a patient or subject.

[0052]

[0072] The phrases "therapeutically effective amount" or "pharmaceutically effective amount" are art-recognized terms. In certain embodiments, the term refers to the amount of a therapeutic agent that produces some desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. In certain embodiments, the term refers to the amount necessary or sufficient to eliminate, reduce, or maintain the target of a particular therapeutic treatment. The effective amount may vary depending on the disease or condition being treated, the particular targeting construct being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular compound without necessitating undue experimentation. In certain embodiments, a therapeutically effective amount of an agent (e.g., a composition or genetically modified cells described herein) for in vivo use will likely depend on many factors, including: the release rate of the agent from the polymer matrix, which will depend in part on the chemical and physical properties of the polymer; the identity of the agent; the mode and method of administration; and any other substances incorporated into the polymer matrix in addition to the agent.

[0053]

[0073] The terms "nucleic acid," "nucleotide," "polynucleotide," and "oligonucleotide" are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in linear or cyclic conformations, and in either single- or double-stranded form. For purposes of this disclosure, these terms shall not be considered limiting with respect to the length of the polymer. The terms can also include known analogues of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moieties (e.g., phosphorothioate backbones). Generally, analogues of a particular nucleotide have the same base-pairing specificity; i.e., an analogue of A will base pair with T.

[0054]

[0074] The terms "polypeptide," "peptide," and "protein" are used interchangeably to refer to a polymer of amino acid residues. The terms also apply to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally occurring amino acid.

[0055]

[0075] A "functional domain" is a domain of a polypeptide that contains a specific activity. Non-limiting examples of activities that a functional domain may possess include nuclease activity, transcriptional regulation activity, viral capsid recognition activity, etc.

[0056]

[0076] "Binding" refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between proteins and nucleic acids). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the overall interaction is sequence-specific. Such interactions generally occur in the presence of a 10 -6 M -1 or a lower dissociation constant (K d "Affinity" refers to binding strength; increased binding affinity is characterized by a lower K d correlates with.

[0057]

[0077] A "binding protein" is a protein that is capable of binding to another molecule. A binding protein can bind, for example, to a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it may bind to itself (e.g., a homodimer, a homotrimer, etc.). A binding protein may bind to one or more molecules of one or more different proteins (forming a complex, etc.). A binding protein can have more than one type of binding activity. For example, a zinc finger protein can have DNA-binding, RNA-binding, and protein-binding activity.

[0058]

[0078] A "zinc finger DNA-binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds to DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through the coordination of zinc ions. The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP.

[0059]

[0079] A "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains are responsible for binding of the TALE to its cognate target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins.

[0060]

[0080] Zinc finger and TALE binding domains can also be "engineered" to bind to predetermined nucleotide sequences, for example, through manipulation of the recognition helix region of a naturally occurring zinc finger or TALE protein (altering one or more amino acids). Thus, engineered DNA-binding proteins (zinc fingers or TALEs) are non-naturally occurring proteins. A non-limiting example for engineering DNA-binding proteins is design and selection. Engineered DNA-binding proteins are proteins that do not occur in nature, whose design / composition arises primarily from rational criteria. Rational criteria for design include substitution rules and the application of computerized algorithms to process information in databases that store information on existing ZFP and / or TALE designs and binding data. See, for example, U.S. Patent Nos. 6,140,081; 6,453,242; 6,534,261; and 8,585,526; also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536; and WO 03 / 016496.

[0061]

[0081] "Selected" zinc finger proteins or TALEs are proteins not found in nature, whose production results primarily from experimental processes such as phage display, interaction traps, or hybrid selection. See, e.g., U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; 8,586,526; WO 95 / 19431; WO See WO 96 / 06166; WO 98 / 53057; WO 98 / 54311; WO 00 / 27878; WO 01 / 60970, WO 01 / 88197, WO 02 / 099084.

[0062]

[0082] In general, "CRISPR" (Clustered Regularly Interspaced Short Palindromic Repeats) is also known as SPI. Also known as DR (Spacer Interspersed Direct Repeats), CRISPR loci refer to a family of DNA loci that are usually specific to a particular bacterial species. CRISPR loci are a distinct class of interspersed short sequence repeats (SSRs) recognized by Escherichia coli (E. coli) (Ishino et al. (1987) J. Bacteriol., 169:5429-5433; and Nakata et al., J. Bacter iol. (1989) 171:3553-3556) and related genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (Groenen et al. (1993) Mol. Microbiol., 10:1057-1065; Hoe et al. (1999) Emerg. Infect. Dis., 5:254-263; Masepohl et al. (1996) Biochim. Biophys. Acta 1307:26-30; and Mojica et al. (1995) Mol. Microbiol., 17:85-93). CRISPR loci typically differ from other SSRs by the structure of their repeats, which are termed short regularly spaced repeats (SRSRs) (Janssen et al. (2002) OMICS J. Integ. Biol., 6:23-33; and Mojica et al. (2000) Mol. Microbiol., 36:244-246). Generally, repeats are short elements that occur as regularly spaced clusters separated by unique intervening sequences of substantially constant length (Mojica et al. (2000), supra). The repeat sequences are highly conserved among strains, but the number of spaced repeats and the sequence of the spacer region typically vary among strains (van Embden et al., J. Bacteriol. (2002) 182:2393-2401). CRISPR loci have been identified in over 40 prokaryotes, including but not limited to the genera Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, and the like. us), Pyrococcus, Picrophilus, Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria,Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, ampylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.

[0063]

[0083] "CRISPR system" refers collectively to the transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including C The CRISPR system may include sequences encoding the as gene, a tracr (transactivating CRISPR) sequence (e.g., a tracrRNA or an active partial tracrRNA), a tracr mate sequence (including "direct repeats" and partial direct repeats that are processed into tracrRNA in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of the CRISPR system are derived from a Class 1, Type I, or Type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a Class 2, Type II, or Type V CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes. Generally, CRISPR systems are characterized by an element (also referred to as a protospacer in the context of endogenous CRISPR systems) that promotes the formation of a CRISPR complex at the target sequence site. In the context of CRISPR complex formation, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. Perfect complementarity is not necessarily required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex. The target sequence can also comprise any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell. A sequence or template that can be used for recombination into a targeted locus containing a target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence." In aspects of the present invention, an exogenous template polynucleotide can be referred to as an editing template. In aspects of the present invention, the recombination is homologous recombination.

[0064]

[0084] "NgAgo" is a prokaryotic Argonaute protein thought to be involved in gene silencing. NgAgo is derived from the archaea Natronobacterium gregoryi (see, e.g., Gao et al. (2016) Nature Biotechnology 34, 768-773). The "NgAgo system" refers to all the necessary components, including, for example, single-stranded guide DNA, for cleavage by the NgAgo enzyme.

[0065]

[0085] "Recombination" refers to the process of genetic information exchange between two polynucleotides, including, but not limited to, donor capture by non-homologous end joining (NHEJ) and homologous recombination. For purposes of this disclosure, "homologous recombination (HR)" refers to a specific type of such exchange that occurs, for example, during repair of double-strand breaks in cells through the homology-directed repair mechanism. This process requires nucleotide sequence homology, uses a "donor" molecule to template repair of a "target" molecule (i.e., the one that has undergone the double-strand break), and is variously known as "non-crossover gene conversion" or "short-tract gene conversion" because it leads to the transfer of genetic information from the donor to the target. While not wishing to be bound by any particular theory, such transfer may involve mismatch correction of heteroduplex DNA formed between the cleaved target and donor, and / or "synthesis-dependent strand annealing," in which the donor is used to resynthesize genetic information so that it becomes part of the target, and / or related processes. Such specialized HR often results in alteration of the sequence of the target molecule such that some or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.

[0066]

[0086] In the disclosed methods, one or more targeted nucleases as described herein are directed to target sequences (e.g., cellular clones) at predetermined sites. The cleavage occurs in the nucleobase (e.g., generating one or more single-stranded nicks and / or one or more double-stranded breaks [DSBs]) in the nucleobase (e.g., chromatin). The DSBs can result in deletions and / or insertions by homology-directed repair (HDR) or by non-homologous repair mechanisms (e.g., NHEJ). Deletions can include any number of base pairs. Similarly, insertions can include any number of base pairs, including, for example, the integration of a "donor" polynucleotide, optionally having homology to the nucleotide sequence in the cleavage region.

[0067]

[0087] In certain embodiments, the methods of the present invention use any suitable nuclease, such as a CRISPR / Cas-based nuclease, to create a DSB in a target gene (e.g., the PLP1 gene or its regulatory elements), and the resulting repair (e.g., NHEJ) generates a small insertion or deletion (e.g., an indel) that disrupts the function of the PLP1 gene or its regulatory elements, resulting in reduced or eliminated PLP1 function. In this embodiment, the methods of the present invention do not require a donor sequence.

[0068]

[0088] In other embodiments, the donor sequence may be included in a method for repairing or replacing a defective PLP1 gene or its regulatory elements. The donor sequence may be physically integrated, or the donor polynucleotide may be used as a template for repair of the break through homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the donor into cellular chromatin. Thus, a first sequence in cellular chromatin may be modified, and in certain embodiments, converted to a sequence present in the donor polynucleotide. Thus, use of the terms "replace" or "substitution" is understood to indicate the replacement of one nucleotide sequence with another (i.e., replacement of a sequence in an informational sense), and does not necessarily require the physical or chemical replacement of one polynucleotide with another.

[0069]

[0089] In any of the methods described herein, additional paired zinc finger proteins, TALEN, CRISPR / Cas or NgAgo systems can be used to make additional (e.g., two or more) double-stranded breaks at additional target sites within the cell (e.g., within the same target gene, such as PLP1, but at different targeting sites).

[0070]

[0090] Any of the methods described herein may be used to partially or completely inactivate one or more target sequences in cells by inserting donors of any size and / or by targeted integration of donor sequences that disrupt expression of a gene or genes of interest. Cell lines with partially or completely inactivated genes are also provided.

[0071]

[0091] In any of the methods described herein, the exogenous nucleotide sequence ("donor sequence" or "transgene") may contain sequence that is homologous, but not identical, to the genomic sequence in the region of interest, thereby stimulating homologous recombination to insert the non-identical sequence into the region of interest. Thus, in certain embodiments, the portion of the donor sequence that is homologous to the sequence in the region of interest exhibits between about 80 and 99% (or any integer therebetween) sequence identity to the genomic sequence to be replaced. In other embodiments, the homology between the donor and genomic sequences is greater than 99%, e.g., where only a single nucleotide differs between the donor and genomic sequences over 100 contiguous base pairs. In certain instances, the non-homologous portion of the donor sequence may contain sequence that is not present in the region of interest, such that a new sequence is introduced into the region of interest. In these instances, the non-homologous sequence is generally flanked by 50 to 1,000 base pairs (or any integer therebetween), or any number of base pairs greater than 1,000, that are homologous or identical to the sequence in the region of interest. In other embodiments, the donor sequence is non-homologous to the first sequence and is a non-homologous set. It is inserted into the genome by recombination mechanisms.

[0072]

[0092] "Genetically modified" refers to a modification made to a nucleic acid such that the sequence of the nucleic acid is altered compared to the nucleic acid before modification. Genetically modifying a cell refers to modifying cellular nucleic acid within the cell, and includes genetic modifications to endogenous and / or exogenous nucleic acid within the cell, such as genomic DNA and transcribed mRNA. Genetic modifications can also include truncations, deletions, and insertions in endogenous and / or exogenous nucleic acid within the cell, integration of exogenous DNA, gene correction, and / or gene mutation.

[0073]

[0093] "Cleavage" refers to the disruption of the covalent backbone of a nucleic acid (e.g., DNA or RNA, e.g., mRNA) molecule. Cleavage can be initiated by a variety of methods, including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-strand and double-strand breaks are possible, and double-strand breaks can occur as a result of two separate single-strand break events. DNA cleavage can result in the production of either blunt ends or cohesive ends. In certain embodiments, fusion polypeptides are used for targeted double-strand DNA cleavage.

[0074]

[0094] A "cleavage half-domain" is a polypeptide sequence that combines with a second polypeptide (either the same or different) to form a complex having cleavage activity (preferably double-strand cleavage activity). The terms "first and second cleavage half-domains," "+ and - cleavage half-domains," and "right and left cleavage half-domains" are used interchangeably and refer to pairs of cleavage half-domains that dimerize.

[0075]

[0095] An "engineered cleavage half-domain" is a cleavage half-domain that has been modified to form an obligate heterodimer with another cleavage half-domain (e.g., another engineered cleavage half-domain). See also U.S. Patent Publication Nos. 2005 / 0064474, 20070218528, 20080131962, and 20110201055, which are incorporated herein by reference in their entireties.

[0076]

[0096] The term "sequence" refers to a sequence of nucleotides of any length, which may be DNA or RNA; may be linear, circular or branched, and may be single- or double-stranded.

[0077]

[0097] The term "donor sequence" refers to a nucleotide sequence to be inserted into a genome. The donor sequence may be of any length, for example, between 2 and 100,000,000 nucleotides in length (or any integer value therebetween), preferably between about 100 and 100,000 nucleotides in length (or any integer value therebetween), more preferably between about 2,000 and 20,000 nucleotides in length (or any integer value therebetween), and even more preferably between about 5 and 15 kb in length (or any value therebetween).

[0078]

[0098] "Chromatin" is the nucleoprotein structure that comprises the cellular genome. Cellular chromatin contains nucleic acids, primarily DNA, and proteins, including histones and non-histone chromosomal proteins. The majority of eukaryotic chromatin exists in the form of nucleosomes, in which the nucleosome core contains approximately 150 base pairs of DNA associated with an octamer containing two each of histones H2A, H2B, H3, and H4; and linker DNA (of varying lengths depending on the organism) extends between the nucleosome cores. A molecule of histone H1 is generally associated with the linker DNA. For purposes of this disclosure, the term "chromatin" is intended to include all types of cellular nucleoproteins in both prokaryotes and eukaryotes. Cellular chromatin includes both chromosomal and episomal chromatin (e.g., mitochondrial DNA).

[0079]

[0099] A "chromosome" is a chromatin complex that contains all or part of a cell's genome. A cell's genome is often characterized by its karyotype, which is the collection of all chromosomes that comprise the cell's genome. A cell's genome can contain one or more chromosomes.

[0080]

[0100] An "episome" is a replicating nucleic acid, nucleoprotein complex, or chromosomal nucleus of a cell. An episome is any other structure that contains nucleic acid that is not part of a genome. Examples of episomes include plasmids and certain viral genomes / vectors (e.g., AAV vectors and coding sequences).

[0081]

[0101] An "accessible region" is a region in which a target site in a nucleic acid is located within the target region. Accessible regions are sites in cellular chromatin that can be bound by exogenous molecules that recognize the region. While not wishing to be bound by any particular theory, accessible regions are thought to be those that are not packaged into nucleosomal structures. The characteristic structure of accessible regions can often be detected by their sensitivity to chemical and enzymatic probes, such as nucleases.

[0082]

[0102] A "target site" or "target sequence" is a sequence that satisfies the conditions for binding. If present, it is a nucleic acid sequence that defines the portion of the nucleic acid to which the binding molecule will bind.

[0103] An "exogenous" molecule is one that is not normally present in a cell, but is present in one or more An exogenous molecule is a molecule that can be introduced into a cell by genetic, biochemical, or other means. The "normal presence in a cell" is determined with respect to the specific developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is only present during embryonic muscle development is an exogenous molecule with respect to adult muscle cells. Similarly, a molecule that is induced by heat shock is an exogenous molecule with respect to non-heat-shocked cells. An exogenous molecule can include, for example, a functional version of a dysfunctional endogenous molecule or a dysfunctional version of a normally functioning endogenous molecule.

[0083]

[0104] The exogenous molecule may be produced, inter alia, by combinatorial chemistry processes. The nucleic acid may be a small molecule, such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex containing one or more of the above molecules. Nucleic acids include DNA and RNA and may be single- or double-stranded; linear, branched, or circular; and may be of any length. Nucleic acids include those capable of forming duplexes as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA-binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases, and helicases.

[0084]

[0105] An exogenous molecule is a molecule of the same type as an endogenous molecule, e.g., an exogenous protein or The exogenous molecule may be a nucleic acid. For example, the exogenous nucleic acid may comprise an infectious viral genome, a plasmid or episome introduced into the cell, or a chromosome not normally present in the cell. Methods for the introduction of exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, biolistics, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer. An exogenous molecule may also be the same type of molecule as an endogenous molecule, but derived from a different species than that from which the cell is derived. For example, human nucleic acid sequences can be introduced into cell lines originally derived from mice or hamsters. Methods for introducing exogenous molecules into plant cells are known to those of skill in the art and include, but are not limited to, protoplast transformation, silicon carbide (e.g., WHISKERS) transformation, and the like. TM), Agrobacterium-mediated transformation, lipid-mediated transfer (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, biolistics (e.g., using a "gene gun"), calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer.

[0085]

[0106] In contrast, "endogenous" molecules are expressed in specific cells at specific developmental stages and under specific environmental conditions. Endogenous nucleic acids are those normally present in the cell. For example, endogenous nucleic acids can include chromosomes, the genome of mitochondria, chloroplasts, or other organelles, or naturally occurring episomal nucleic acids. Additional endogenous molecules can include proteins, such as transcription factors and enzymes.

[0086]

[0107] As used herein, the term "product of an exogenous nucleic acid" includes polynucleotides and Both transcription products (polynucleotides, eg, RNA) and translation products (polypeptides) are included.

[0087]

[0108] A "fusion" molecule is a molecule in which two or more subunit molecules are bonded together, preferably covalently. Binding refers to linked molecules. The subunit molecules may be molecules of the same chemical type or molecules of different chemical types. Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (e.g., fusions between ZFP or TALE DNA binding domains and one or more activation domains) and fusion nucleic acids (e.g., nucleic acids encoding the above-mentioned fusion proteins). Examples of the second type of fusion molecule include, but are not limited to, fusions between triplex-forming nucleic acids and polypeptides, and fusions between minor groove binders and nucleic acids.

[0088]

[0109] Expression of the fusion protein in a cell can be achieved by delivery of the fusion protein to the cell, Alternatively, it can result from delivery of a polynucleotide encoding the fusion protein into a cell, where the polynucleotide is transcribed and the transcript is translated to produce the fusion protein. Trans-splicing, polypeptide cleavage, and polypeptide ligation can also be involved in the expression of the protein in the cell. Methods for polynucleotide and polypeptide delivery into cells are presented elsewhere in this disclosure.

[0089]

[0110] "Gene," for purposes of this disclosure, includes a gene product (see below). It includes coding DNA regions as well as DNA regions that control the production of a gene product (gene control elements), whether or not these gene control element sequences are adjacent to the coding and / or transcribed sequence. Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translation control sequences, such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions.

[0090]

[0111] "Gene expression" refers to the conversion of the information, contained in a gene, into a gene product. A gene product may be the direct transcription product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of mRNA. Gene products also include RNAs that are modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins that are modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0091]

[0112] "Modulation" of gene expression refers to a change in gene activity. Modulation of expression can include, but is not limited to: This may include, but is not limited to, gene activation and gene repression, as well as the activity and / or stability of gene expression products such as proteins and mRNAs (e.g., expression regulation at the transcriptional, translational, and / or post-translational levels). Genome editing (e.g., cleavage, modification, inactivation, random mutation) may also be used to regulate expression, and RNAi or antisense oligo (ASO)-mediated mRNA cleavage and / or translation blockage may also be used. Gene inactivation refers to any reduction in gene expression compared to cells that do not contain a ZFP, TALE, NgAgo, or CRISPR / Cas system as described herein. Thus, gene inactivation may be partial or complete.

[0092]

[0113] A "region of interest" is a region of cellular chromatin to which it is desired that an exogenous molecule bind. The region of interest can be any region of a gene, for example, a gene, or a non-coding sequence within or adjacent to a gene. Binding can be for the purpose of targeted DNA cleavage and / or targeted recombination. The region of interest can be, for example, in a chromosome, an episome, an organelle genome (e.g., mitochondria, chloroplasts), or an infectious virus genome. The region of interest can be within the coding region of a gene, within a transcribed non-coding region, such as a leader sequence, trailer sequence, or intron, or within a non-transcribed region upstream or downstream of the coding region. The region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integer value of nucleotide pairs.

[0093]

[0114] "Eukaryotic" cells include, but are not limited to, stem cells (pluripotent and multipotent stem cells) These include fungal cells (e.g., yeast), plant cells, animal cells, mammalian cells, and human cells (e.g., oligodendrocytes), including cells capable of expressing the endothelial cell membrane protein (ECM).

[0094]

[0115] The terms "operably linked" and "operably linked" " (or "operably linked") is used interchangeably in reference to the juxtaposition of two or more components (e.g., sequence elements) where the components are positioned to allow for both components to function normally and for at least one component to mediate the function exerted by at least one other component. By way of example, a transcriptional control element sequence, such as a promoter, is operably linked to a coding sequence if it modulates the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional control elements. A transcriptional control element sequence is generally operably linked in cis with the coding sequence, but need not be directly adjacent to the coding sequence. For example, an enhancer is a transcriptional control element sequence operably linked to a coding sequence, even though they are not contiguous.

[0095]

[0116] With respect to fusion polypeptides, the term "operably linked" refers to It can also refer to the fact that each of the components performs the same function when linked to the other component as it does when not so linked. For example, with respect to a fusion polypeptide in which a ZFP, TALE, NgAgo, or Cas DNA-binding domain is fused to an activation domain, the ZFP, TALE, NgAgo, or Cas DNA-binding domain and activation domain are operably linked if, in the fusion polypeptide, the ZFP, TALE, NgAgo, or Cas DNA-binding domain portion is capable of binding to its target site and / or binding site, while the activation domain is capable of upregulating gene expression. In the case of a fusion polypeptide in which a ZFP, TALE, NgAgo, or Cas DNA-binding domain is fused to a cleavage domain, in the fusion polypeptide, the ZFP, TALE, NgAgo, or Cas DNA-binding domain portion is capable of binding to its target site and / or binding site, while the activation domain is capable of upregulating gene expression. A ZFP, TALE, NgAgo or Cas DNA binding domain and a cleavage domain are operably linked if the cleavage domain portion is capable of cleaving DNA near the target site, while the ZFP, TALE, NgAgo or Cas DNA binding domain and cleavage domain are capable of binding to its target site and / or binding site, while the cleavage domain portion is capable of cleaving DNA near the target site.

[0096]

[0117] A "functional fragment" of a protein, polypeptide, or nucleic acid is one whose sequence is identical to or more than the full-length A functional fragment is a protein, polypeptide, or nucleic acid that is not identical to the protein, polypeptide, or nucleic acid but retains the same function as the full-length protein, polypeptide, or nucleic acid. A functional fragment may have more, fewer, or the same number of residues as the corresponding native molecule and / or may contain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are well known in the art. Similarly, methods for determining protein function are well known. For example, the DNA binding function of a polypeptide can be determined by, for example, filter binding, electrophoretic mobility shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al., supra. The ability of a protein to interact with another protein can be determined by, for example, co-immunoprecipitation, two-hybrid assays, or both genetic and biochemical complementation. See, e.g., Fields et al. (1989) Nature 340:245-246; U.S. Patent No. 5,585,245, and PCT WO 98 / 44350.

[0097]

[0118] A "vector" is capable of transferring gene sequences into a target cell. Typically, "vector construct," "expression vector," and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a gene of interest and transferring gene sequences to a target cell. Thus, the terms include cloning and expression vehicles, as well as integrating vectors.

[0098]

[0119] The terms "subject" and "patient" are used interchangeably and refer to a mammal, e.g., For example, human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. Accordingly, the term "subject" or "patient," as used herein, refers to any mammalian patient or subject to which the nucleases, donors, and / or genetically modified cells of the invention can be administered. Subjects of the invention include those with myelin-related disorders.

[0099]

[0120] "Stemness" refers to the relative ability of any cell to behave in a stem cell-like manner, i.e. It refers to the degree of totipotency, pluripotency, or oligopotency, and extended or indefinite self-renewal, that any particular stem cell may possess.

[0100]

[0121] "Cells that promote functional myelin production" (in cells without modifications) By "cells" is meant cells that exhibit increased myelin production (when compared to cells that have been previously treated with steroids) and / or cells that exhibit improved functional capacity of the myelin produced by the cells.

[0101]

[0122] The term "indel" refers to the insertion of a base in the nucleotide sequence of an organism or cell. Insertion (also called insertion mutation) refers to the addition of one or more nucleotide base pairs to a nucleotide sequence, while deletion refers to a mutation in which a portion of the nucleotide sequence is removed. Any number of nucleotides can be inserted or deleted, from a single base to an entire piece of a chromosome.

[0102]

[0123] "Nonsense-mediated decay" contains a premature translation termination codon (PTC) This refers to the translation coupling mechanism in eukaryotic cells that eliminates mRNA transcripts. In mammalian cells, in most cases, strong mRNA transcripts are only produced when the PTC is located upstream of an intron. NMD is also linked to pre-mRNA splicing, as reduction occurs.

[0103] overview

[0124] Embodiments described herein involve disrupting the proteolipid protein 1 (PLP1) gene. This application relates to methods for generating cells genetically modified to disrupt or inactivate PLP1 and methods for their use in treating human myelin-related disorders. This application is based, in part, on the demonstration of efficient, site-specific introduction of PLP1-inactivating indels in glial cells and zygotes. Nuclease-mediated editing of the PLP1 gene has been shown to restore normal function and full lifespan in the jimpy mouse model of the myelin-related disorder Pelizaeus-Merzbach disease (PMD), as well as to restore function in PMD model glial cells in vitro. Without being bound by theory, it is believed that PLP1-associated toxicity is bypassed by inactivating the PLP1 gene, thereby enhancing the ability of modified glial cells or oligodendrocytes to produce functional myelin.

[0104]

[0125] Described herein are site specific sequences in the PLP1 gene or its regulatory elements. The site-specific nuclease or gene editing PLP1 gene disruption composition can be delivered using, for example, one or more AAV vectors, integrase-deficient lentiviral vectors (IDLVs), and / or nucleic acids such as plasmids, minicircle plasmids, and oligonucleotides.

[0105]

[0126] Also herein, neural stem cells (NSCs) and / or oligodendrocytes We describe precise in situ editing of the PLP1 gene or its gene regulatory elements to generate enhanced functional myelin production capacity in NSCs and / or OPCs. Nuclease- or gene-editing-mediated introduction of disruptive mutations in situ into the endogenous PLP1 gene in NSCs and / or OPCs confers these enhanced capabilities to the progeny of the edited cells. Furthermore, specific knockout or mutation of PLP1-regulated genes in situ into the endogenous gene in NSCs or OPCs confers enhanced / improved functional myelin production in the progeny of the cells.

[0106]

[0127] Cells and The methods and methods can be transplanted into animal models and / or human patients. Moreover, the cells maintain the ability to persist in vivo and promote functional myelin production in the subject after transplantation.

[0107]

[0128] The practice of the methods, and the preparation and use of the compositions disclosed herein are described elsewhere. Unless otherwise specified, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields are used, as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed., Cold Spring Harbor Laboratory Press, 1989 and 3rd ed., 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodically revised editions; METHODS IN ENZYMOLOGY series, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, 3rd edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (eds. P.M. Wassarman and A.P. Wolffe), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (ed. P.B. Becker), Humana Press, Totowa, 1999.

[0108]

[0129] Further aspects of the invention are described in the following sections. fusion molecule

[0130] Described herein are methods for transfecting a selected target gene (e.g., The present invention also provides a composition, e.g., a nuclease, useful for cleaving a gene (e.g., PLP1 or its gene regulatory element). In certain embodiments, one or more components of the fusion molecule (e.g., a nuclease) are naturally occurring. In other embodiments, one or more components of the fusion molecule (e.g., a nuclease) are non-naturally occurring, i.e., engineered in the DNA binding domain(s) and / or cleavage domain(s). For example, the DNA binding domain of a naturally occurring nuclease can be modified to bind to a selected target site (e.g., a meganuclease engineered to bind to a site different from its cognate binding site). In other embodiments, the nuclease comprises heterologous DNA binding and cleavage domains (e.g., zinc finger nucleases; TAL effector domain DNA binding proteins; meganuclease DNA binding domains comprising a heterologous cleavage domain).

[0109] DNA-binding domain

[0131] In certain embodiments, the compositions and methods described herein involve binding to a donor molecule. Meganuclease (homing endonuclease) DNA-binding domains are used to bind to regions of interest in the cellular genome. Naturally occurring meganucleases recognize 15-40 base pair cleavage sites and are generally grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, and the HNH family. Exemplary homing endonucleases include I-SceI, I-CeuI, PI-PspI, PI-SceI-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII. Their recognition sequences are known. See U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280: 345-353, and the New England Biolabs catalog. Furthermore, the DNA binding specificity of homing endonucleases and meganucleases can be engineered to bind to non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; See also Ashworth et al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128. The DNA binding domains of homing endonucleases and meganucleases can be modified in the context of the nuclease as a whole (i.e., so that the nuclease contains a cognate cleavage domain) or can be fused to a heterologous cleavage domain.

[0110]

[0132] In other embodiments, the nucleases used in the methods and compositions described herein The one or more DNA-binding domains include naturally occurring or engineered (non-naturally occurring) TAL effector DNA-binding domains. See, for example, U.S. Patent No. 8,586,526, which is incorporated herein by reference in its entirety. Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system that injects more than 25 different effector proteins into plant cells. Among these injected proteins are transcription activator-like (TAL) effectors that mimic plant transcription activators and manipulate the plant transcriptome (see Kay et al. (2007) Science 318:648-651). These proteins contain a DNA-binding domain and a transcription activation domain. One of the best-characterized TAL effectors is AvrBs3 from Xanthomonas campestgris pv. Vesicatoria (see Bonas et al. (1989) Mol Gen Genet 218: 127-136 and WO2010079430). TAL effectors contain a tandemly repeated centralizing domain, each containing approximately 34 amino acids, which is important for the DNA-binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcriptional activation domain (for review, see Schornack S et al. (2006) J Plant Physiol 163(3): 256-272). Furthermore, in the plant pathogenic bacterium Ralstonia solanacearum, two genes designated brg11 and hpx17 in R. solanacearum biovar 1 strain GM1000 and biovar 4 strain RS 1000 have been found to be homologous to the AvrBs3 family of Xanthomonas (see Heuer et al. (2007) Appl and Envir Micro 73(13): 4379-4384).These genes are 98.9% identical to each other in nucleotide sequence, but differ in that there is a 1,575 bp deletion in the repeat domain of hpx17. However, neither of these gene products has more than 40% sequence identity with the AvrBs3 family proteins of Xanthomonas. See, for example, U.S. Patent No. 8,586,526, which is hereby incorporated by reference in its entirety.

[0111]

[0133] The specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequences are approximately 102 bp, and the repeats are typically 91 - 100% homologous to each other (Bonas et al., ibid.). Repeat polymorphisms usually occur at positions 12 and 13, and there appears to be a one-to-one correspondence between the identity of adjacent nucleotides in the target sequence of the TAL effector and the identity of the highly variable two-residue (RVD) at positions 12 and 13 (see Moscou and Bogdanove, (2009) Science 326:1501 and Boch et al. (2009) Science 326:1509 - 1512). Experimentally, the native code for DNA recognition by these TAL effectors has been determined such that the HD sequence at positions 12 and 13 leads to binding to cytosine (C), NG binds to T, NI binds to A, C, G or T, NN binds to A or G, and ING binds to T. These DNA-binding repeats have been assembled into proteins containing novel combinations and numbers of repeats, which can interact with novel sequences and artificial transcription factors have been created that can activate the expression of non-endogenous reporter genes in plant cells (Boch et al., ibid.). Engineered TAL proteins have been linked to the Fоk1 cleavage half-domain to generate TAL effector domain nuclease fusions (TALENs). See, for example, U.S. Patent No. 8,586,526; Christian et al. ((2010) <Genetics epub 10.1534 / genetics. 110.120717). In certain embodiments, the TALE domain is U.S. Patent No. 8,586,52 6, including N-caps and / or C-caps.

[0112]

[0134] In certain embodiments, in vivo cleavage and / or targeting of the cellular genome The DNA binding domain of one or more nucleases used for tagging cleavage comprises a zinc finger protein. Preferably, the zinc finger protein is non-naturally occurring in that it is engineered to bind to a selected target site. See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; all of which are incorporated herein by reference in their entirety. See Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005 / 0064474; 2007 / 0218528; 2005 / 0267061.

[0113]

[0135] The engineered zinc finger binding domains are similar to naturally occurring zinc finger proteins. It is also possible for the protein to have a novel binding specificity compared to the original protein. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, the use of a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, co-owned U.S. Patent Nos. 6,453,242 and 6,534,261, which are incorporated herein by reference in their entireties.

[0114]

[0136] Exemplary selection methods, including phage display and two-hybrid systems, are described in U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; and WO 98 / 37186; WO 98 / 53057; WO 00 / 27878; WO 01 / 88197 and GB 2,338,237. Additionally, enhanced binding specificity for zinc finger binding domains has been described, for example, in co-owned WO 02 / 077227.

[0115]

[0137] Furthermore, as disclosed in these and other references, zinc finger The domains and / or multi-fingered zinc finger proteins can be linked together using any suitable linker sequence, including, for example, linkers of 5 or more amino acids in length. See also U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The proteins described herein can also include any combination of suitable linkers between the individual zinc fingers of the protein.

[0116]

[0138] In some aspects, the DNA binding domain is a region of the PLP1 gene or PL Targeting the P1 gene regulatory element.

[0139] Selection of target sites; ZFPs and fusion proteins (and the proteins Methods for the design and construction of polynucleotides encoding the nucleotides (e.g., ... Nos. 6,534,261; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO 95 / 19431; WO 96 / 06166; WO 98 / 53057; WO 98 / 54311; WO 00 / 27878; WO 01 / 60970 WO 01 / 88197; WO 02 / 099084; WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496.

[0117]

[0140] Furthermore, as disclosed in these and other references, zinc fingering The main and / or multi-fingered zinc finger proteins can be linked together using any suitable linker sequence, including, for example, linkers of 5 or more amino acids in length. See also U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The proteins described herein can also include any combination of suitable linkers between the individual zinc fingers of the protein.

[0118]

[0141] In certain embodiments, the DNA binding domain is a CRISPR / Cas nuclease The CRISPR / Cas nuclease system is part of the system. See, e.g., U.S. Patent No. 8,697,359 and U.S. Patent Application No. 14 / 278,903. The CRISPR (clustered regularly interspaced short palindromic repeats) locus, which encodes the RNA components of the system, and the cas (CRISPR-associated) locus, which encodes the proteins (Jansen et al., 2002. Mol. Microbiol. 43: 1565-1575; Makarova et al., 2002. Nucleic Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1: 7; Haft et al., 2005. PLoS Comput. Biol. 1: e60) constitute the genetic arrangement of the CRISPR / Cas nuclease system. CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes and non-coding RNA elements that can program the specificity of CRISPR-mediated nucleic acid cleavage. CRISPR-Cas systems are separated into two classes: Class 1 uses several Cas proteins together with CRISPR RNA (crRNA) to assemble a functional endonuclease, and Class 2 CRISPR systems use crRNA and a single Cas protein.

[0119]

[0142] Class 2 Type II CRISPR is one of the best-characterized systems. The CRISPR system then executes targeted DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat region of the pre-crRNA and mediates processing of the pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex guides a functional domain (e.g., a nuclease, e.g., Cas) to the target DNA through Watson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA adjacent to the protospacer adjacent motif (PAM), an additional prerequisite for target recognition. Finally, Cas9 mediates cleavage of the target DNA, generating a double-strand break within the protospacer. The activity of the CRISPR / Cas system involves three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks in a process called "adaptation"; (ii) expression of the appropriate proteins and expression and processing of the array, followed by (iii) RNA-mediated interference with the alien nucleic acid. Thus, in bacterial cells, several of the so-called "Cas" proteins are involved in the natural function of the CRISPR / Cas system and play a role in functions such as the insertion of alien DNA.

[0120]

[0143] In certain embodiments, the Cas protein is a "function" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound that shares qualitative biological properties with the native sequence polypeptide. "Functional derivatives" include, but are not limited to, native sequence fragments and derivatives of native sequence polypeptides, as well as fragments thereof, so long as they share a biological activity with the corresponding native sequence polypeptide. The biological activity contemplated herein is the ability of a functional derivative to hydrolyze a DNA substrate into fragments. The term "derivative" includes both amino acid sequence variants of a polypeptide, covalent modifications, and fusions thereof, such as derivative Cas proteins. Suitable derivatives of a Cas polypeptide or fragments thereof include, but are not limited to, mutants, fusions, and covalent modifications of a Cas protein or fragments thereof. Cas proteins, including Cas proteins or fragments thereof, and derivatives of Cas proteins or fragments thereof, can be obtained from cells or chemically synthesized, or by a combination of these two methods. The cells can be cells that naturally produce Cas proteins, or cells that naturally produce Cas proteins and are genetically engineered to produce endogenous Cas proteins at higher expression levels, or cells that produce Cas proteins from exogenously introduced nucleic acids that encode the same or different Cas proteins as the endogenous Cas proteins. In some cases, the cells do not naturally produce Cas proteins and are genetically engineered to produce Cas proteins. In some embodiments, the Cas protein is a small Cas9 ortholog for delivery via AAV vectors (Ran et al. (2015) Nature 510, p. 186). In certain embodiments, the Cas protein is a SaCas9 or SpCas9Cas protein.

[0121]

[0144] In certain embodiments, the Cas9 protein is a mammalian Cas9, or Streptococcus pyogenes, Neisseria meningitidis, Streptococcus thermophilus, Streptococcus pneumnoniae, Campylobacter coli, Campylobacter jejuni, Streptococcus mutans, Pasteurella multocida, Bifidobacterium longum, Bacillus smithii, Treponema denticola, Mycoplasma canis, or Enterococcus faecalis faecalis, Sutterella wadsworthensis, Filifactor alocis, Lactobacillus johnsonii, Campylobacter lari, Corynebacter diptheriae, Parvibaculum lavamentivorans, Mycoplasma gallisepticum, Staphylococcus aureus subsubspecies Aureus, Legionella pneumophila Paris, Treponema denticola Cas9 from Staphylococcus denticola, Staphylococcus pseudintermedius, or Neisseria cinerea.

[0122]

[0145] In certain embodiments, the Cas9 protein comprises one or more nuclear-localized It has an array.

[0146] In some embodiments, the DNA binding domain is a class 2 type V CRISP It is part of the R / Cas Cpf1 system. Like Cas9, Cpf1 nucleases contain a RuvC-like endonuclease domain, but they lack the second HNH endonuclease domain and N-terminal alpha helix recognition lobe of Cas9. Cpf1 cleaves DNA in a cohesive pattern and requires only one RNA for cleavage, rather than the two required by Cas9 (tracrRNA and crRNA). The cohesive end cleavage pattern of Cpf1 opens the possibility of directional gene transfer, similar to traditional restriction enzyme cloning. Cohesive end-mediated gene transfer may also be particularly useful for targeting non-dividing cells, which are difficult to modify through homology-directed repair (HDR). Cpf1 also expands the number of sites targetable by CRISPR into AT-rich regions or genomes lacking the 3'-NGG PAM sites preferred by SpCas9 (see, e.g., Zetsche et al. (2015) Cell 163(3):759-771 and Makarova et al. (2015) Nature Reviews Microbiology 13(11):722-736).

[0123]

[0147] In some embodiments, the DNA binding domain is a nucleotide sequence encoding a nucleotide sequence that encodes ... This is part of the Argonaute endonuclease system suitable for genome editing in human cells. An exemplary Argonaute endonuclease system suitable for genome editing in human cells can include the Argonaute DNA guide endonuclease (NgAgo) from Natronobacterium gregorii (Gao et al. (2016) Nature Biotechnology. 34: 768-773). NgAgo binds to ~24-nucleotide 5'-phosphorylated single-stranded guide DNA (gDNA) and efficiently generates site-specific DNA double-strand breaks upon loading with gDNA. Using 5'-phosphorylated ssDNA as the guide molecule reduces the chance of cellular oligonucleotides misleading NgAgo. The guide molecule can only attach to NgAgo during protein expression. Once the guide is loaded, NgAgo cannot exchange free ssDNA for the gDNA. The NgAgo-gDNA system does not require a protospacer adjacent motif (PAM) as does Cas9, and appears to have a low tolerance for guide-target mismatches and high efficiency in editing (G+C)-rich genomic targets.

[0124]

[0148] Loading exogenous guide DNA of arbitrary DNA sequence onto NgAgo protein It is also possible to generate targeted double-stranded breaks in DNA. Because the specificity of NgAgo cleavage is guided by the guide DNA, an NgAgo-DNA complex formed with an exogenous guide DNA specified by the researcher will therefore direct NgAgo target DNA cleavage to the complementary target DNA specified by the researcher. In this manner, targeted double-stranded breaks in DNA can also be generated. The NgAgo guide DNA system (or an orthologous Ago-guide DNA system from another organism) allows for targeted cleavage of genomic DNA within cells. Such breaks can be either single-stranded or double-stranded. For cleavage of mammalian genomic DNA, it would be preferable to use an NgAgo codon version optimized for expression in mammalian cells. Furthermore, it may be preferable to treat cells with an in vitro-formed NgAgo-DNA complex in which the NgAgo protein is fused to a cell-penetrating peptide. Furthermore, it may be preferable to use an NgAgo protein version with improved activity at 37°C through mutagenesis. Ago-RNA-mediated DNA cleavage can also be used to affect a number of outcomes, including gene knockout, targeted gene addition, gene correction, and targeted gene deletion, using techniques that are standard in the art for the development of DNA cleavage.

[0125]

[0149] Thus, nucleases have the ability to insert or delete bases (generating indels). The present invention includes a DNA-binding domain that specifically binds to a target site in any gene (e.g., PLP1) for which it is desired to inactivate or reduce gene expression.

[0126] Cleavage domain

[0150] Any suitable cleavage domain may be operably linked to the DNA binding domain. It is also possible to combine ZFP DNA binding domains to form nucleases.For example, ZFP DNA binding domains have been fused to nuclease domains to generate ZFNs, which are functional entities that recognize intended nucleic acid targets through engineered (ZFP) DNA binding domains and can cut DNA near ZFP binding sites through nuclease activity, including for use in genome modification in various organisms.See, for example, U.S. Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231; and International Publication WO 07 / 014275.Similarly, TALE DNA binding domains have been fused to nuclease domains to generate TALENs. See, e.g., U.S. Patent No. 8,586,526.

[0127]

[0151] As mentioned above, the cleavage domain is heterologous to the DNA binding domain. Heterologous cleavage domains can also be derived from any endonuclease or exonuclease, for example, a zinc finger DNA-binding domain and a cleavage domain from a nuclease, or a TALEN DNA-binding domain and a cleavage domain from a meganuclease, or a meganuclease DNA-binding domain and a cleavage domain from a different nuclease. Heterologous cleavage domains can also be derived from any endonuclease or exonuclease. Exemplary endonucleases from which cleavage domains can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. Additional enzymes that cleave DNA are known (e.g., S1 nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease). One or more of these enzymes (or functional fragments thereof) can also be used as a source of cleavage domains and cleavage half-domains.

[0128]

[0152] Similarly, the cleavage half-domains shown above require dimerization for cleavage activity. The cleavage half-domains can be derived from any such nuclease or fragment thereof. Generally, if the fusion protein contains a cleavage half-domain, two fusion proteins are required for cleavage. Alternatively, a single protein containing two cleavage half-domains can be used. The two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof). Furthermore, the target sites of the two fusion proteins are preferably positioned relative to each other such that binding of the two fusion proteins to their respective target sites positions the cleavage half-domains in a spatial orientation that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerization. Thus, in certain embodiments, the proximal ends of the target sites are separated by 5-8 nucleotides or 15-18 nucleotides. However, any integral number of nucleotides or nucleotide pairs can be intervening between the two target sites (e.g., 2-50 nucleotide pairs or more). Generally, a cleavage site is located between the target sites.

[0129]

[0153] Restriction endonucleases (restriction enzymes) are present in many species and bind to DNA. They are capable of sequence-specific binding (at their recognition site) and cleaving DNA at or near the binding site. Certain restriction enzymes (e.g., type IIS) cleave DNA at sites distant from their recognition site. A and has separable binding and cleavage domains. For example, the type IIS enzyme Fok I catalyzes double-stranded cleavage of DNA at 9 nucleotides from the recognition site on one strand and 13 nucleotides from the recognition site on the other strand. See, e.g., U.S. Patent Nos. 5,356,802; 5,436,150 and 5,487,994; and Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, the fusion protein comprises a cleavage domain (or cleavage half-domain) derived from at least one Type IIS restriction enzyme, which may or may not be engineered, and one or more zinc finger binding domains.

[0130]

[0154] Exemplary Type IIS restriction enzymes, in which the cleavage domain is separable from the binding domain, are The Fok I enzyme is Fok I. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Therefore, for purposes of this disclosure, the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain. Thus, for targeted double-strand cleavage and / or targeted replacement of cellular sequences using zinc finger-Fok I fusions, two fusion proteins each containing a Fok I cleavage half-domain can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage half-domains can also be used. Parameters for targeted cleavage and targeted sequence modification using zinc finger-Fok I fusions are provided elsewhere in this disclosure.

[0131]

[0155] The cleavage domain or cleavage half-domain retains cleavage activity or functions The target protein can be any portion of a protein that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.

[0132]

[0156] Exemplary Type IIS restriction enzymes are described in International Publication WO 2005 / 022990, which is incorporated herein by reference in its entirety. 07 / 014275. Additional restriction enzymes also contain separable binding and cleavage domains and are contemplated by the present disclosure. See, e.g., Roberts et al. (2003) Nucleic Acids Res. 31:418-420.

[0133]

[0157] In certain embodiments, the cleavage domain may be any of the cleavage domains disclosed herein, e.g., any of the cleavage domains disclosed herein. and 20080131962, the disclosures of which are incorporated by reference. These include one or more engineered cleavage half-domains (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described in U.S. Patent Publication Nos. 20050064474; 20060188987; 20070305346; and 20080131962. Amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of Fok1 are all targets for affecting dimerization of the Fok1 cleavage half-domain.

[0134]

[0158] Cleavage domains containing more than one mutation may be used, for example, "E490 Mutations at positions 490 (E→K) and 538 (I→K) in one cleavage half-domain to produce an engineered cleavage half-domain designated "Q486E:I499" and mutations at positions 486 (Q→E) and 499 (I→L) in another cleavage half-domain to produce an engineered cleavage half-domain designated "Q486E:I499." mutations substituting the wild-type Gln(Q) residue at position 486 with a Glu(E) residue, the wild-type Iso(I) residue at position 499 with a Leu(L) residue, and the wild-type Asn(N) residue at position 496 with an Asp(D) or Glu(E) residue (also referred to as "ELD" and "ELE" domains, respectively); engineered cleavage half-domains containing mutations at positions 490, 538, and 537 (numbering relative to wild-type FokI), e.g., substituting the wild-type Glu(E) residue at position 490 with a Lys(K) residue and the wild-type Iso(I) residue at position 538 with a Lys(K) residue and mutations at positions 490 and 537 substituting a Lys(K) or Arg(R) residue for the wild-type His(H) residue at FokI (also referred to as "KKK" and "KKR" domains, respectively); and / or engineered cleavage half-domains containing mutations at positions 490 and 537 (numbering relative to wild-type FokI), e.g., mutations substituting a Lys(K) residue for the wild-type Glu(E) residue at position 490 and a Lys(K) or Arg(R) residue for the wild-type His(H) residue at position 537 (referred to as "KIK" and "KIR" domains, respectively). See, e.g., U.S. Patent Nos. 7,914,796; 8,034,598; and 8,623,618, the disclosures of which are incorporated herein in their entireties for all purposes. In other embodiments, the engineered cleavage half-domains comprise "Sharkey" and / or "Sharkey's" mutations (see Guo et al., (2010) J. Mol. Biol. 400(1):96-107).

[0135]

[0159] Alternatively, nucleases can be used to split nucleic acids using the so-called "split enzyme" technique. They can be assembled in vivo at the target site (see, e.g., U.S. Patent Publication No. 20090068164). The components of such split enzymes can be expressed on separate expression constructs, or the individual components can be linked in a single open reading frame separated, for example, by a self-cleaving 2A peptide or an IRES sequence. The components can also be individual zinc finger binding domains or meganuclease nucleic acid binding domains.

[0136]

[0160] Yeast-based stains, such as those described in U.S. Pat. No. 8,563,314 In the system, nucleases can be screened for activity prior to use.

[0137]

[0161] Cas9-related CRISPR / Cas systems consist of two RNA non-coding components: The CRISPR / Cas system contains a tracrRNA and a pre-crRNA array containing a nuclease guide sequence (spacer) interposed between identical direct repeats (DRs). To achieve genome engineering using the CRISPR / Cas system, both of these RNA functions must be present (see Cong et al., (2013) Sciencexpress1 / 10.1126 / science 1231143). In some embodiments, the tracrRNA and pre-crRNA are provided via separate expression constructs or as separate RNAs.

[0138]

[0162] In other embodiments, engineered mature crRNA (conferring target specificity) A chimeric RNA is constructed such that the tracrRNA is fused to a tracrRNA (which provides interaction with Cas9) to generate a chimeric cr-RNA-tracrRNA hybrid (also referred to as a single guide RNA or sgRNA). Thus, along with Cas9 nuclease, modification of the PLP1 gene in the methods of the present invention requires the introduction of an sgRNA containing a sequence of approximately 20 bases specific to the target DNA 5' of the non-variable scaffold sequence. The sgRNA can be delivered as RNA or by transformation with a plasmid containing the sgRNA coding sequence under a promoter. In a specific embodiment, the sgRNA sequence for use in modifying the PLP1 gene includes, but is not limited to, AAGACCACCATCTGCGGCAA, which targets exon 3 of the PLP1 gene. NGG (SEQ ID NO: 1) and CCAGCAGGAGGGCCCCATAANGG (SEQ ID NO: 2), and GTCAGAGTGCCAAAGACATGGNNGRRT (SEQ ID NO: 3) targeting exon 1 of the PLP1 gene.

[0139] Target area

[0163] As detailed above, the DNA binding domain can be bound to any sequence of choice. The engineered DNA-binding domain may have novel binding specificities compared to naturally occurring DNA-binding domains.

[0140]

[0164] In certain embodiments, the target site(s) is endogenous PLP1 Located in an exon of a gene. Non-limiting examples of suitable genomic exon regions for targeting include exons 1, 3, or 7 of PLP1. In some embodiments, the target site comprises an approximately 80 nucleotide segment 5' of exon 3 of PLP1.

[0141]

[0165] In certain embodiments, the nuclease targets the PLP1 gene. In certain embodiments, the nuclease targets a PLP1 gene regulatory element, such as a promoter or enhancer.

[0142] donor

[0166] In certain aspects, the present disclosure provides a method for the nuclease-mediated insertion of an exogenous sequence into a cellular genome. This invention relates to mediated targeted integration. As mentioned above, the insertion of exogenous sequence (also referred to as "donor sequence" or "donor" or "transgene") is for example to delete a specific region (for example, the deletion of one copy of the PLP1 gene duplication that occurs in approximately 70% of PMD patients) and / or to correct a mutant gene (for example, the PLP1 point mutation that occurs in approximately 30% of PMD patients) or to increase the expression of a wild-type gene. It is readily apparent that donor sequence is typically not identical to the genomic sequence to be placed. The donor sequence can contain a non-homologous sequence flanked by two regions of homology to enable efficient HDR at the position of interest, or can be integrated through non-homologous recombination repair mechanism. Furthermore, the donor sequence can also comprise a vector molecule that contains a sequence that is not homologous to the region of interest in cellular chromatin. The donor molecule can also contain several discontinuous regions that are homologous to cellular DNA. Furthermore, for targeted insertion of a sequence not normally present in the region of interest, the sequence can be present in the donor nucleic acid molecule and flanked by regions of homology to the sequence in the region of interest.

[0143]

[0167] As with nucleases, the donor can be introduced in any form. In certain embodiments, the donor can be introduced using DNA and / or viral vectors by methods known in the art.See, for example, US Patent Publication Nos. 20100047805 and 20110207221. The donor can be introduced into cells in double-stranded or single-stranded form. The donor can be introduced into cells in circular or linear form. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art.For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides can be linked to one or both ends.See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of a terminal amino group(s) and the use of modified internucleotide linkages, such as phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.

[0144]

[0168] In certain embodiments, the donor contains a fragment greater than 1 kb in length, e.g., 2-200 kb. The donor may contain sequences (e.g., coding sequences, also referred to as transgenes) of between 100 kb and 200 kb (or any value therebetween). The donor may also contain at least one nuclease target site. In certain embodiments, the donor contains at least two target sites, e.g., for a ZFN, TALEN, NgAgo, or CRISPR / Cas nuclease pair. Typically, the nuclease target site(s) are outside the transgene sequence, e.g., 5' and / or 3' of the transgene sequence, to cleave the transgene. The nuclease cleavage site(s) may be for any nuclease(s). In certain embodiments, the nuclease target site(s) contained in the double-stranded donor are for the same nuclease(s) used to cleave the endogenous target into which the cleaved donor is integrated via a homology-independent method.

[0145]

[0169] The donor is a vector whose expression is driven by the endogenous promoter, i.e., the donor, at the integration site. It is also possible for the donor to be inserted so that it is driven by a promoter that drives expression of the endogenous gene into which it is inserted. However, it will be apparent that the donor can also include a promoter and / or enhancer, for example, a constitutive promoter or an inducible or tissue-specific promoter.

[0146]

[0170] All, some, or none of the endogenous genes are expressed It is also possible to insert the donor molecule into an endogenous gene, such as to inactivate or reduce expression of PLP1. In some embodiments, the transgene is integrated into PLP1 or a PLP1 gene regulatory element such that PLP1 is inactivated or its expression is reduced.

[0147]

[0171] Additionally, although not required for expression, exogenous sequences may also be involved in transcription or Translational regulatory or other sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals, may also be included. Additionally, a splice acceptor sequence may also be included. Exemplary splice acceptor site sequences are known to those skilled in the art and include, by way of example only, CTGACCTCTTCTCTTCCTCCCACAG (SEQ ID NO: 4) (derived from the human HBB gene) and TTTCTCTCCACAG (SEQ ID NO: 5) (derived from the human immunoglobulin gamma gene).

[0148]

[0172] The donor sequences (transgenes and / or repair templates) described herein are Donors can be isolated from plasmids, cells, or other sources using standard techniques known in the art, such as PCR. Donors for use can include a variety of morphological types, including circular supercoiled, circular relaxed, linear, etc. Alternatively, they can be chemically synthesized using standard oligonucleotide synthesis techniques. Furthermore, donors can be methylated or lack methylation. Donors can also be in the form of bacterial or yeast artificial chromosomes (BACs or YACs).

[0149]

[0173] The donor polynucleotides described herein may include one or more non-naturally occurring Bases and / or backbones may be included. In particular, the methods described herein may be used to perform insertion of donor molecules containing methylated cytosines to achieve transcriptional quiescence in the region of interest.

[0150]

[0174] The exogenous (donor) polynucleotide may be any sequence of interest (exogenous sequence). Exemplary exogenous sequences include, but are not limited to, any polypeptide coding sequence (e.g., cDNA), promoter sequences, enhancer sequences, enzymes, etc. These include epitope tags, marker genes, cleavage enzyme recognition sites, and various types of expression constructs. Marker genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored, fluorescent, or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and sequences encoding proteins that mediate enhanced cell growth and / or gene amplification (e.g., dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA, or any detectable amino acid sequence.

[0151]

[0175] In some embodiments, the donor receives a gene containing, but not limited to, an antibody, an antigen, Coding sequences further include polynucleotides encoding any polypeptide whose expression in a cell is desirable, including enzymes, receptors (cell surface or nuclear), hormones, lymphokines, cytokines, reporter polypeptides, growth factors, and functional fragments of any of the above. The coding sequence can be, for example, a cDNA.

[0152]

[0176] In certain embodiments, the exogenous sequence is expressed in a cell that has undergone targeted integration. It is also possible to include a marker gene (described above) and linked sequences encoding additional functionality that allow for selection of the target gene. Non-limiting examples of marker genes include GFP, drug selection marker(s), etc.

[0153]

[0177] In certain embodiments, the donor contains a mutation, e.g., a gene that replaces a deleterious endogenous sequence. The donor may also include a wild-type gene that is responsible for the mutation. For example, a wild-type (or other functional) gene sequence may be inserted into the genome of a stem cell in which the endogenous copy of the gene is mutated. In other embodiments, the donor may include, for example, a mutant gene that replaces a wild-type endogenous gene. For example, a wild-type PLP1 sequence may be inserted into the genome of a stem cell to mutate an endogenous deleterious mutant PLP1 gene involved in a myelin-related disorder.

[0154]

[0178] The construction of such expression cassettes in accordance with the teachings herein is well within the skill of the art of molecular biology. Using methodologies well known in the art (see, e.g., Ausubel or Maniatis), the responsiveness of the expression cassette to stress-inducing factors associated with the selected regulatory element can be tested by introducing the expression cassette into an appropriate cell line (e.g., primary cells, transformed cells, or immortalized cell line) prior to use to generate transgenic animals.

[0155]

[0179] Additionally, although not required for expression, the exogenous sequence may also include transcriptional or translational regulatory elements. Sequences such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals may also be included. Additionally, the regulatory elements of a gene of interest may be operably linked to a reporter gene to generate a chimeric gene (e.g., a reporter expression cassette).

[0156]

[0180] Targeted insertion of non-coding nucleic acid sequences is also achievable. Sequences encoding siRNA, RNAi, siRNA, shRNA, and microRNA (miRNA) can also be used for targeted insertion.

[0157]

[0181] In further embodiments, the donor nucleic acid contains specific nucleic acids for further nuclease design. It is also possible to include non-coding sequences that are alternative target sites. The original donor molecule can then be cleaved and further modified by the insertion of another donor molecule of interest. It is also possible to express in cells a nuclease comprising: In this manner, repeated integration of the donor molecule can be generated, allowing trait stacking at specific loci of interest or safe harbor loci.

[0158]

[0182] In some embodiments, the jim of Pelizaeus-Merzbach disease (PMD) Therapeutic gene modification compositions described herein can be further screened using in vivo assays that assess remyelination and reduction in clinical severity in the py mouse model.

[0159] Gene silencing

[0183] In certain embodiments, the nuclease targets the PLP1 gene. In certain embodiments, the nuclease targets a PLP1 gene regulatory element, such as a promoter or enhancer.

[0160]

[0184] In some embodiments, the endogenous PLP1 gene product or PLP1 expression is stimulated. The PLP1 regulatory element gene product is modified to reduce PLP1 expression levels. In certain embodiments, gene silencing is used to modify the endogenous PLP1 gene product or PLP1 regulatory element gene product to reduce PLP1 expression levels in cells.

[0161]

[0185] In other embodiments, the PLP is expressed in a tissue or cell of a subject in need thereof. The endogenous PLP1 gene product or PLP1 regulatory element gene product is modified through the use of gene silencing agents that reduce or inhibit expression of PLP1 or PLP1 regulatory elements that promote expression of 1. "Expression" refers to the overall flow of information from a gene to produce a gene product (typically a protein, optionally post-translationally modified or functional / structural RNA).

[0162]

[0186] In some embodiments, the agent may inhibit PLP1 expression in a cell. RNAi constructs that specifically block or reduce the expression of target genes can also be included. RNAi constructs contain double-stranded RNA that can specifically block the expression of target genes. "RNA interference" or "RNAi" is a term originally applied to the phenomenon observed in plants and insects in which double-stranded RNA (dsRNA) specifically and post-transcriptionally blocks gene expression.

[0163]

[0187] As used herein, the term "dsRNA" refers to an siRNA molecule, or double-stranded RNA. The term "RNA" refers to other RNA molecules that contain siRNA fragments and can be processed into siRNAs in cells, such as hairpin RNA fragments (shRNAs) and microRNAs (miRNAs).

[0164]

[0188] The term "loss of function" refers to the gene that is inhibited by the subject RNAi method. , refers to a decrease in the expression level of a gene as compared to the level in the absence of the RNAi construct.

[0165]

[0189] As used herein, the phrase "mediating RNAi" refers to a gene that mediates RNAi. This refers to the ability to discriminate between RNAs being degraded, e.g., degradation occurs in a sequence-specific manner rather than in a sequence-independent dsRNA response, e.g., the PKR response.

[0166]

[0190] As used herein, the term "RNAi construct" refers to a construct that is cleaved in vivo. The term "RNAi constructs" as used herein is a general term that includes small interfering RNA (siRNA), hairpin RNA, and other RNA species (e.g., miRNA) that can form siRNA and / or miRNA. The RNAi constructs herein also include those that can be used to induce transcription in cells. These include expression vectors capable of generating transcripts that form dsRNA or hairpin RNA, and / or transcripts that can produce siRNA in vivo (also referred to as RNAi expression vectors).

[0167]

[0191] "RNAi expression vector" (referred to herein as "dsRNA encoding plasmid"). A vector (also referred to as a "vector") refers to a replicable nucleic acid construct used to express (transcribe) RNA that produces siRNA / shRNA / miRNA moieties in cells in which the construct is expressed. Such a vector includes (1) a genetic element(s) that has a regulatory role in gene expression, such as a promoter, operator, or enhancer, operably linked to (2) a "coding" sequence that is transcribed to produce double-stranded RNA (two RNA moieties that anneal to form siRNA in the cell, or a single hairpin RNA that can be processed into siRNA, or miRNA), and (3) a transcription unit that includes the assembly of appropriate transcription start and stop sequences.

[0168]

[0192] The selection of promoters and other regulatory elements will generally depend on the intended host cell, For example, they vary according to the OPC. In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids," which refer to circular double-stranded DNA loops that, in their vector form, are not bound to the chromosome. As used herein, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, this application describes other types of expression vectors that serve equivalent functions and that subsequently become known in the art.

[0169]

[0193] The RNAi construct expresses the gene to be inhibited (i.e., The double-stranded RNA contains a nucleotide sequence that hybridizes to the nucleotide sequence of at least a portion of an mRNA transcript of a target gene (i.e., a "target" gene). The double-stranded RNA need only be sufficiently similar to natural RNA to have the ability to mediate RNAi. Thus, embodiments allow for sequence variation that might be expected due to genetic mutation, lineage polymorphism, or evolutionary divergence. The number of nucleotide mismatches tolerated between the target sequence and the RNAi construct sequence is no more than 1 in 5 base pairs, or 1 in 10 base pairs, or 1 in 20 base pairs, or 1 in 50 base pairs. Mismatches in the center of the siRNA duplex are most critical and can essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3' end of the siRNA strand that is complementary to the target RNA do not significantly contribute to the specificity of target recognition.

[0170]

[0194] By sequence comparison and alignment algorithms known in the art, and e.g. Sequence identity can be optimized by calculating the percent difference between nucleotide sequences using the Smith-Waterman algorithm, as implemented in the BESTFIT software program (e.g., University of Wisconsin Genetic Computing Group) with default parameters. Higher than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA can be functionally defined as a nucleotide sequence capable of hybridizing to a portion of the target gene transcript.

[0171]

[0195] Production of RNAi constructs by chemical synthesis or by recombinant nucleic acid technology It is also possible to carry out the transcription of RNA polymerases. Endogenous RNA polymerases of the treated cells can mediate transcription in vivo, or cloned RNA polymerases can be used for in vitro transcription. For example, RNAi constructs can include modifications to either the phosphate-sugar backbone or the nucleosides to decrease susceptibility to cellular nucleases, improve bioavailability, improve formulation properties, and / or alter other pharmacodynamic properties. For example, natural The phosphodiester linkage of RNA can be modified to include at least one nitrogen or sulfur heteroatom. The modification can be tailored in RNA structure to enable specific gene inhibition while avoiding the general reaction to dsRNA. Similarly, bases can be modified to block the activity of adenosine deaminase. RNAi constructs can be produced enzymatically or by partial / total organic synthesis, and modified ribonucleotides can be introduced by in vitro enzymatic or organic synthesis.

[0172]

[0196] Adapting methods to chemically modify RNA molecules to modify RNAi constructs (See, e.g., Nucleic Acids Res, 25:776-780; J Mol Recog 7:89-98; Nucleic Acids Res 23:2661-2668; Antisense Nucleic Acid Drug Dev 7:55-61.) Simply by way of example, the backbone of the RNAi construct can be modified with phosphorothioates, phosphoramidites, phosphodithioates, chimeric methylphosphonate phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine-containing oligomers, or sugar modifications (e.g., 2'-substituted ribonucleosides, a-configuration).

[0173]

[0197] A double-stranded structure formed by a single self-complementary RNA strand or two complementary RNA strands It is also possible to form a double-stranded RNA (RNA) duplex. RNA duplex formation can be initiated either inside or outside the cell. The RNA can be introduced in an amount that allows delivery of at least one copy per cell. While a higher dose of double-stranded material (e.g., at least 5, 10, 100, 500, or 1000 copies per cell) may result in more effective inhibition, lower doses may also be useful for certain applications. Inhibition is sequence-specific, in that the nucleotide sequence corresponding to the double-stranded region of the RNA is targeted for gene inhibition.

[0174]

[0198] In certain embodiments, the subject RNAi constructs are "small interfering RNAs" or These nucleic acids are "siRNAs." These nucleic acids are approximately 19 to 30 nucleotides in length, and even more preferably 21 to 23 nucleotides in length, e.g., lengths corresponding to fragments generated by nucleases that "dicing" longer double-stranded RNA. It is understood that siRNAs recruit nuclease complexes and, by pairing with specific sequences, guide the complexes to the target mRNA. As a result, the target mRNA is degraded by the nucleases in the protein complex. In certain embodiments, the 21 to 23 nucleotide siRNA molecules contain a 3' hydroxyl group.

[0175]

[0199] The siRNA molecules described herein can be synthesized using several techniques known to those skilled in the art. siRNA can be obtained.For example, siRNA can be chemically synthesized or recombinantly produced by using methods known in the art.For example, short sense and antisense RNA oligomers can be synthesized and annealed to form double-stranded RNA structures that contain 2-nucleotide overhangs at each end (Proc Natl Acad Sci USA, 98:9742-9747; EMBO J, 20:6877-88).These double-stranded siRNA structures can then be directly introduced into cells by passive uptake or by any selected delivery system, for example, any of those described below.

[0176]

[0200] In certain embodiments, for example, in the presence of the enzyme Dicer, longer double-stranded RNA In one embodiment, a Drosophila in vitro system is used. In this embodiment, dsRNA is combined with a soluble extract from a Drosophila embryo to generate siRNA constructs. The combination is maintained under conditions in which the dsRNA is processed into RNA molecules of about 21 to about 23 nucleotides.

[0177]

[0201] siRNA can also be purified using a number of techniques known to those skilled in the art. For example, siRNA can be purified using gel electrophoresis. Alternatively, siRNA can be purified using non-denaturing methods, such as non-denaturing column chromatography. Furthermore, siRNA can be purified using chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, or affinity purification involving antibodies.

[0178]

[0202] In certain embodiments, the RNAi construct is in the form of a hairpin construct (hairpin Hairpin RNAs are also called silencing RNAs. Hairpin RNAs can be exogenously synthesized or formed in vivo by transcription from an RNA polymerase III promoter. Examples of producing and using such hairpin RNAs for gene silencing in mammalian cells are described, for example, in Genes Dev, 2002, 16:948-58; Nature, 2002, 418:38-9; RNA, 2002, 8:842-50; and Proc Natl Acad Sci, 2002, 99:6047-52. Preferably, such hairpin RNAs are engineered in cells or animals to ensure continuous and stable suppression of desired genes. It is known in the art that siRNAs can be produced by processing hairpin RNAs in cells.

[0179]

[0203] In certain embodiments, the RNAi construct comprises a microRNA or miRNA miRNAs are non-coding, single-stranded RNAs transcribed by RNA polymerase II from either their own genes or introns. After transcription, the primary miRNA is first processed into a pre-miRNA (approximately 70 nucleotides) with a stem-loop structure, which is then processed into a functional miRNA (21–23 nucleotides). Like siRNAs and shRNAs, miRNAs also have the potential to use RISC for mRNA degradation and post-transcriptional gene silencing, and to target any mRNA of interest. In contrast to siRNAs, which have perfect complementarity with their target mRNAs, miRNAs bind only imperfectly to their target mRNAs. This partial complementarity allows each miRNA to potentially interact with a large, similar set of target mRNAs. In addition to mRNA degradation, miRNAs can also cause translational repression without endonucleolytic cleavage. Therefore, genes targeted by miRNAs can be translationally regulated without affecting the target mRNA levels. A potential advantage of miRNAs over siRNAs is that one single miRNA transcript can be processed into multiple siRNAs.

[0180]

[0204] In yet other embodiments, for delivery of double-stranded RNA, e.g., as a transcription product, For this purpose, a plasmid is used. In this embodiment, the plasmid is designed to contain "coding sequence" for each of the sense and antisense strands of the RNAi construct.The coding sequence can be the same sequence, for example, flanked by an inverted promoter, or can be two separate sequences, each under the transcriptional control of a separate promoter.After the coding sequence is transcribed, complementary RNA transcripts base pair to form double-stranded RNA.

[0181]

[0205] PCT application WO01 / 77350 describes the use of the same transgene in eukaryotic cells. Examples of vectors for bidirectional transcription of a transgene, generating both sense and antisense RNA transcripts, are described. Accordingly, certain embodiments provide recombinant vectors with the following unique properties: the vector contains a viral replicon with two overlapping transcription units arranged in opposite orientations and flanking the transgene of the RNAi construct of interest. In this case, two overlapping transcription units generate both sense and antisense RNA transcripts from the same transgene fragment in a host cell.

[0182]

[0206] In some embodiments, the lentiviral vector is administered to an siRNA, e.g., a small fragment. It is also possible to knock down the expression of the PLP1 gene using long-term expression of short hairpin RNA (shRNA). Although there continue to be some safety concerns regarding the use of lentiviral vectors for gene therapy, self-inactivating lentiviral vectors are considered excellent candidates for gene therapy because they can be easily transfected into mammalian cells.

[0183]

[0207] For example, OligoEngene software (OligoEngene, Sequences can be identified as targets for siRNA using a recombinant vector (Synthesis, Seattle, WA) to generate small hairpin RNA (shRNA) downregulation of PLP1 expression. The oligo sequences can be annealed and ligated into a linearized pSUPER RNAi vector (OligoEngene, Seattle, WA) and transformed into E. coli strain DH5α cells. After selecting positive clones, the plasmids can be transfected into 293T cells by calcium precipitation. The collected viral supernatant containing the shRNA can then be used to infect mammalian cells to downregulate the PLP1 gene product, thereby reducing PLP1 expression levels in the cells.

[0184]

[0208] Carriers developed for DNA are used in part because of their similar physicochemical properties. For this reason, they can also be used for RNAi. These carriers can be broadly divided into two categories: viral and nonviral. See a recent review of viral delivery systems for RNAi (Castanotto and Rossi, The promises and pitfalls of RNA-interference-based therapeutics. Nature 457(7228):426-33, 2009, incorporated herein by reference). Nonviral RNAi vectors typically involve complexing RNAi constructs with positively charged vectors (e.g., cationic cell-penetrating peptides, cationic polymers and dendrimers, and cationic lipids); conjugating RNAi constructs with small molecules (e.g., cholesterol, bile acids, and lipids), polymers, antibodies, and RNA; and encapsulating RNAi constructs in nanoparticulate formulations. Modifications of the RNA backbone improve the stability of siRNA without affecting its RNAi efficiency. The choice of RNAi delivery system can depend on the characteristics of the siRNA, the type of target cell, and the delivery route for in vivo applications.

[0185]

[0209] In certain embodiments, the RNAi construct is coupled to a cationic cell-penetrating peptide (C CPPs have been used for the intracellular delivery of macromolecules, including proteins (e.g., antibodies), peptides, antisense oligonucleotides, and plasmid DNA. In addition to utilizing traditional endocytic pathways, CPP-mediated RNAi delivery systems can either form noncovalent complexes through electrostatic interactions (noncovalent CPP-siRNA) or covalent crosslinks through disulfide bonds (covalent CPP-siRNA), and then directly enter cells by crossing the cell membrane.

[0186]

[0210] In certain embodiments, the RNAi constructs are synthesized using polymeric and dendrimeric chiral nucleotide sequences. Linear or branched cationic polymers are well-established and efficient transfection agents for DNA and RNA. These positively charged polymers can form polyplexes with the negatively charged phosphates of nucleic acids through electrostatic interactions. Other suitable polymeric carriers for siRNA include micelles, nanoplexes, nanocapsules, and nanogels. The properties of polyplexes (e.g., size, surface charge, and structure) depend on the ratio of the positive charges of the cationic polymer to the number of phosphate groups on the siRNA. Various polymers, such as poly-l-lysine, polyethyleneimine (PEI), poly-d,l-lactide-co-glycolide (PLGA), poly(alkyl cyanoacrylate), chitosan, and gelatin, are suitable. Others include dendrimers containing positively charged surface groups, whose precise core-shell nanostructure allows for drug loading by internal encapsulation, surface adsorption, or chemical conjugation. Exemplary dendrimers include cationic polyamidoamine (PAMAM, amino-terminated surface), optionally with PEGylation to improve the surface characteristics of the dendrimer; poly(propyleneimine) (PPI), and cyclodextrin-containing cationic polymers and dendrimers.

[0187]

[0211] In certain embodiments, the RNAi construct is delivered as a bioconjugate To improve stability, cellular internalization, or cell-specific active targeted delivery, RNAi constructs can also be conjugated to a variety of molecules, including small molecules (e.g., cholesterol, bile acids, and lipids), peptides (e.g., cationic cell-penetrating peptides), polymers (e.g., endosomolytic agents, amphiphilic poly(vinyl ether) PBAVE), proteins (e.g., antibodies), and aptamers (e.g., RNA aptamers).

[0188]

[0212] In certain embodiments, the RNAi constructs are delivered in liposomes, micelles, microemulsions, or other media. Liposomes are commonly used as siRNA carriers, including liposomes, nucleosomes, and solid lipid nanoparticles. Liposomes are relatively simple and have well-known pharmaceutical properties, making them a popular siRNA carrier. Several liposome carriers of cancer drugs have demonstrated excellent safety records in humans, and one (Doxil) has been approved by the FDA for human use. Lipid-based carriers have also been successfully used to deliver siRNA to target sites in endothelium, RES organs (e.g., the liver), and solid tumors (e.g., intravenous or intraperitoneal injection of siRNA loaded into liposomes of cationic and fusogenic lipids).

[0189]

[0213] In certain embodiments, the RNAi constructs are used as molecular Trojan horses (e.g., Trojan This delivery is achieved using Trojan horse liposome (THL) formulations and avidin-biotin technology. Molecular Trojan horses can also be formulated as Trojan horse liposomes, which deliver shRNA-expressing plasmid DNA to the brain in vivo. Similar to non-viral gene therapy delivery, plasmid DNA encoding small hairpin RNA (shRNA) can also be delivered to the brain after intravenous administration with PEGylated immunoliposomes (PIL). For example, plasmid DNA can be encapsulated in liposomes (e.g., 100 nm liposomes), which are PEGylated and conjugated with receptor-specific targeting monoclonal antibodies (MAbs). Using this delivery method, weekly intravenous RNAi with PILs allows for 90% knockdown of the human epidermal growth factor receptor (EGFR), resulting in a 90% increase in survival time in mice with intracranial brain cancer. The same technology can also be used to deliver other RNAi constructs, including siRNAs and miRNAs, to the brain. For example, siRNA may be monobiotinylated in parallel with the production of a conjugate of the targeting MAb and streptavidin.

[0190]

[0214] Molecular Trojan horses (MTHs) are receptor-mediated transporters across the blood-brain barrier (BBB). Peptidomimetic MAbs are endogenous peptides or peptidomimetic monoclonal antibodies (MAbs) that undergo RMT (Reversed Metastasis to Metastasis) through the BBB. Peptidomimetic MAbs bind to extracellular surface epitopes on BBB receptors, allowing the MAbs to undergo RMT across the BBB without interfering with BBB transport of endogenous ligands. Peptidomimetic MAbs are capable of transporting endogenous peptides through the BBB RMT system. It may carry any attached drugs or even plasmid DNA across the BBB.

[0191]

[0215] A panel of species-specific MAb molecular Trojan horses has been developed for brain drug delivery. For example, for drug delivery in mice, rat 8D3 MAb against the mouse TfR is used. This MTH is not active in rats. For brain drug delivery in rats, murine OX26 MAb against the rat TfR is used, and this MTH is not active in mice or other species. For brain drug delivery to Old World primates, such as rhesus monkeys, murine 83-14 MAb against the human insulin receptor (HIR) is used. HIRMAbs are not active in New World primates, such as squirrel monkeys. Genetically engineered versions of HIRMAbs, both chimeric and humanized, have been produced and are capable of brain drug delivery in humans.

[0192]

[0216] Protein therapeutic delivery to the brain following intravenous administration of molecular Trojan horses has been shown to be These experimental systems have been adapted for in vivo pharmacological implementation. 2007). These studies of recombinant protein delivery to the brain in vivo, involving intravenous administration, demonstrate that BBB MTH is capable of delivering macromolecular therapeutics into the brain in vivo.

[0193]

[0217] Trojan horse for non-viral plasmid DNA delivery in vivo We developed a liposome (THL) formulation, whereby MTH associates with non-viral plasmid DNA in a manner that is stable in vivo. Specifically, a single plasmid DNA molecule is encapsulated inside a ~100 nm liposome, the surface of which is conjugated with thousands of polymer chains, e.g., 2000 Da polyethylene glycol (PEG). 1-2% of the ends of the PEG chains are conjugated with receptor (R)-specific MAbs that act as MTH. This results in a PEGylated immunoliposome (PIL) formulation encapsulating the plasmid DNA. The targeting MAbs bind to BBB receptors, inducing RMT from the blood to the brain interstitial fluid. The targeting MAbs then bind to the same receptors on brain cells, inducing receptor-mediated endocytosis into the intracellular space of the brain. In the case of the insulin receptor, which normally delivers its endogenous ligand, insulin, to the nuclear compartment, the insulin receptor delivers the plasmid DNA to the nucleus of the brain cell, followed by expression of the endogenous transgene. In a typical formulation, there are 30-80 MAb molecules conjugated to each liposome. Any DNA that is not completely encapsulated inside the liposome can be thoroughly removed by nuclease treatment.

[0194]

[0218] This technology was used to express luciferase and β-galactosidase reporter genes. Genes (and many other genes in a similar fashion) have been delivered to the mouse brain with Trojan horse liposomes via intravenous injection into adult mice at a dose of 5 μg of plasmid DNA per mouse in a volume of 0.2 mL. Following intravenous administration of this non-viral formulation, there was generalized expression of the transgene throughout the brain. The expression pattern paralleled that of the neural transferrin receptor, which is ubiquitous in the brain. The transgene was expressed in both cortical and subcortical structures, the choroid plexus, the hippocampus, the midbrain, and the spinal cord, and was highly expressed in the Purkinje cell layer of the cerebellum. Trojan horse liposome technology enables "adult transgenics" within 24 hours after intravenous administration of the non-viral formulation. The gene was delivered to virtually every cell in the brain. At a dose of 10 μg of plasmid DNA / kg body weight, it was also possible to deliver approximately three to four plasmid DNA molecules to each brain cell in adult primate brains.

[0195]

[0219] In a similar study, tyrosine hydroxylase (TH) cDNA was cloned into SV4 TH was formulated into an expression plasmid driven by the 0 promoter. TH expression plasmids were encapsulated in Trojan horse liposomes that were targeted to rat brain using the murine OX26 MAb against the rat TfR. TH gene therapy with Trojan horse liposomes resulted in complete normalization of striatal TH enzyme activity ipsilateral to the lesion and an 82% reduction in apomorphine-induced abnormal rotational behavior. See Pardridge (Adv Drug Deliv Rev. 59(2-3):141-152, 2007).

[0196]

[0220] In certain embodiments, tissue-specific promoters are used to generate transgenes in the brain. These promoters drive and restrict expression of genes (e.g., RNAi constructs or ASOs). One brain-specific promoter that can be used in the present invention can have the 5' flanking sequence (FS) of the human glial fibrillary acidic protein (GFAP) gene to eliminate transgene expression in peripheral (non-CNS) tissues. Thus, the combined use of tissue-specific promoters and Trojan horse liposome delivery technology allows for the localization of in vivo expression of therapeutic genes to specific organs or tissue types, such as the brain.

[0197]

[0221] RNAi construct (Trojan horse liposome targeted by TfR MAb) IV injection of RNAi constructs (encapsulated in liposomes) has been used to deliver expression of RNAi constructs (shRNA-encoding plasmid DNA) in the brain and achieve 90% knockdown of target gene expression in brain tumors. There was no measurable activity of the target gene in the contralateral brain, and RNAi gene therapy had no effect on the expression of non-target genes. See Pardridge (Adv Drug Deliv Rev. 59(2-3):141-152, 2007). Thus, the in vivo therapeutic effects of RNAi have become possible by combining RNAi technology with Trojan horse liposome targeting technology.

[0198]

[0222] Antisense oligodeoxynucleotides (ASOs), antisense peptides The delivery of either nucleic acid (PNA) or siRNA requires the high affinity attachment of these agents to molecular Trojan horses.The bond between MTH and nucleic acid therapeutic agents must be stable in vivo in circulation.In some embodiments, these nucleic acids can be attached to targeting ligands through polycationic bridges, such as polylysine or protamine.Alternatively, in other embodiments, these nucleic acid therapeutic agents can be attached to targeting ligands using avidin-biotin technology.

[0199]

[0223] The binding between avidin or streptavidin and biotin is very tight. It is not destroyed by serum proteins. It is also possible to combine the conjugate of the targeting MAb and either avidin or streptavidin (SA) in one vial. In the second vial, the monobiotinylated antisense agent (ASO) or RNAi / siRNA is produced. The two vials are mixed immediately before intravenous administration. Because the affinity of biotin for avidin or SA binding is very high, the conjugate between the antisense agent or siRNA and the targeting MAb is immediately formed. The dissociation half-life of biotin binding to avidin or SA is 89 days, and the dissociation constant is 10 -15 M. Thus, the in vivo association between the antisense agent and the targeting MAb in the circulation remains intact for several hours after intravenous administration. Attachment of the antisense agent to the targeting MAb through an avidin-biotin linkage does not have an inhibitory effect on hybridization of the antisense agent with the target RNA. This was demonstrated in previous studies by both RNase protection assays and Northern blotting.

[0200]

[0224] Using this technology, ASO agents (phosphorothioate (PS) and peptide nuclei) Polynucleotides (PNAs), such as monobiotinylated PNAs, as well as RNAi constructs (such as monobiotinylated siRNAs) have been delivered to the brain using MTH.

[0201]

[0225] In certain embodiments, instead of using monobiotinylated siRNA, SA and The chemical conjugate of the molecule Trojan horse is used. In another embodiment, MAb-avidin fusion protein is used. Monobiotinylated siRNA and MTH-SA or MTH-avidin conjugate can be mixed before intravenous administration. MTH can also carry siRNA molecules across the BBB and BCM, as previously shown for PNA antisense agents.

[0202]

[0226] In another embodiment, PLP1 or a PLP1 regulatory element that promotes PLP1 expression Gene silencing agents that reduce or inhibit the expression of can also include antisense oligonucleotides (ASOs).Antisense oligonucleotides are relatively short nucleic acids that are complementary (or antisense) to the coding strand (sense strand) of mRNA that encodes a specific protein.Antisense oligonucleotides are typically based on RNA, but they can also be based on DNA.In addition, antisense oligonucleotides are often modified to increase their stability.

[0203]

[0227] The binding of these relatively short oligonucleotides to mRNA is Antisense oligonucleotides are thought to induce double-stranded RNA stretches that trigger message degradation by β-lactamase. Furthermore, oligonucleotides are sometimes specifically designed to bind near the promoter of a message, and under these circumstances, antisense oligonucleotides may also interfere with message translation. Regardless of the specific mechanism by which an antisense oligonucleotide functions, its administration to cells or tissues allows for the degradation of mRNA encoding a specific protein. Thus, antisense oligonucleotides reduce the expression and / or activity of a specific protein (e.g., PLP1).

[0204]

[0228] Oligonucleotides may be single-stranded or double-stranded, DNA or RNA, or It may also be chimeric mixtures or derivatives or modified forms thereof. The oligonucleotides may be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, the stability, hybridization, etc. of the molecule. Oligonucleotides can also include other attached groups, such as peptides (for example, for targeting host cell receptors), or agents that promote transport across cell membranes (see, for example, Proc Natl Acad Sci 86:6553-6556; Proc Natl Acad Sci 84:648-652; PCT Publication No. WO88 / 09810, published December 15, 1988) or blood-brain barriers (see, for example, PCT Publication No. WO89 / 10134, published April 25, 1988), hybridization-triggered cleavage agents (see, for example, BioTechniques 6:958-976) or intercalating agents (see, for example, Pharm Res 5:539-549).To this end, oligonucleotides can be conjugated or coupled to another molecule.

[0205]

[0229] The oligonucleotides described herein can be synthesized by standard methods known in the art. For example, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (Nucl. Acids Res. 16:3209), and methylphosphonate oligonucleotides can be prepared using controlled pore glass polymer supports (Proc Natl Acad Sci 85:7448-7451). ).

[0206]

[0230] The selection of appropriate oligonucleotides is within the skill of the art. Given a nucleic acid sequence encoding a protein, one skilled in the art can design antisense oligonucleotides that bind to the protein and test these oligonucleotides in in vitro or in vivo systems to confirm that they bind to the mRNA encoding the particular protein and mediate its degradation. To design an antisense oligonucleotide that specifically binds to a particular protein and mediates its degradation, it is important that the sequence recognized by the oligonucleotide be unique or substantially unique to that particular protein. For example, a sequence that is frequently repeated throughout a protein may not be an ideal choice for designing an oligonucleotide that specifically recognizes and degrades a particular message. One skilled in the art can design an oligonucleotide and compare the sequence of the oligonucleotide to nucleic acid sequences deposited in publicly available databases to confirm that the sequence is specific or substantially specific to a particular protein.

[0207]

[0231] Several methods have been developed to deliver antisense DNA or RNA into cells. For example, antisense molecules may be injected directly into a tissue site, or modified antisense molecules designed to target desired cells (e.g., antisense linked to a peptide or antibody that specifically binds to a receptor or antigen expressed on the surface of a target cell) may be administered systemically.

[0208]

[0232] However, in certain instances, sufficient activity to repress translation of endogenous mRNAs may be obtained. Achieving intracellular concentrations of antisense oligonucleotides can be difficult. Therefore, another approach utilizes recombinant DNA constructs in which antisense oligonucleotides are placed under the control of a strong Pol III or Pol II promoter. For example, a vector can be introduced in vivo so that it is incorporated into cells and directs the transcription of antisense RNA. Such vectors can remain episomal or be integrated into chromosomes, provided that they can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or other vectors known in the art that are used for replication and expression in mammalian cells.

[0209]

[0233] Expression of the sequence encoding the antisense RNA is in mammalian, preferably human, cells. The promoter may be one known in the art to act in cells. Such promoters may be inducible or constitutive. Examples of such promoters include, but are not limited to, the SV40 early promoter region (Nature 290:304-310), the promoter contained in the 3' terminal repeat of Rous sarcoma virus (Cell 22:787-797), the herpes thymidine kinase promoter (Proc Natl Acad Sci 78:1441-1445), and the regulatory sequence of the metallothionein gene (Nature 296:39-42). Plasmid-type, cosmid, YAC, or viral vectors may be used to prepare recombinant DNA constructs that can be directly introduced into tissue sites. Alternatively, viral vectors that selectively infect the desired tissue may be used, in which case administration can be achieved by another route (e.g., systemic).

[0210] cell

[0234] Thus, provided herein are sequences that can be used to identify, for example, exon 1 or exon 2 of PLP1. Targeted deletion of three nucleotide sequences or inactivates PLP1 expression The present invention provides a genetically modified cell that contains an insertion or deletion (indel) in the PLP1 gene, such as other modification(s) that increase or decrease PLP1 expression. The cell preferably produces functional myelin or is a precursor cell of a myelin-producing cell. In certain embodiments, the cell is a zygote, egg, neural stem cell (NSC), OPC, or oligodendrocyte. In certain embodiments, the genetically modified cell contains a targeted deletion of approximately 80 nucleotides at the 5' end of exon 3 of PLP1 that inactivates PLP1 expression. Also provided are genetically modified cells in which PLP1 regulatory elements involved in PLP1 transcription or translation are modified.

[0211]

[0235] Indels (insertions or deletions) typically consist of one or more nucleotides. The indel is integrated into the cell genome in a targeted manner using a nuclease. In certain embodiments, the indel is integrated into PLP1, for example, for inactivating the PLP1 gene. In certain embodiments, the indel is generated as a result of NHEJ or other repair mechanisms after the introduction of a double-strand break (DSB) by a nuclease (e.g., in the PLP1 gene or its regulatory element). In other embodiments, the indel is integrated into the endogenous genomic locus associated with PLP1, for example, within a PLP1 gene regulatory element, such as an enhancer or promoter. In any of the cells described herein, the integration can be within an exon and / or intron (e.g., exon 1 or 3 of PLP1).

[0212]

[0236] Targeted integration or deletion, as opposed to random integration or deletion ensures that the indel is integrated into a specific gene. The indel can be integrated anywhere in the target gene. In certain embodiments, the indel or donor sequence is integrated at or near the nuclease cleavage site, e.g., within 1 to 3,000 (or any value therebetween) base pairs upstream or downstream of the cleavage site, more preferably within 1 to 1,000 (or any value therebetween) base pairs on either side of the cleavage site, or within 1 to 500 (or any value therebetween), or within 1 to 100 (or any value therebetween) base pairs on either side of the cleavage site. In certain embodiments, the integrated sequence, including the donor transgene, does not include any vector sequences (e.g., viral vector sequences).

[0213]

[0237] Any cell type, including but not limited to cells and cell lines, As described herein, the cells can also be genetically modified to include a sequence that inactivates or reduces PLP1 expression.Other non-limiting examples of the cells described herein include zygotes, neural stem cells (NSCs), oligodendrocyte progenitor cells (OPCs), neuronal cells, and glial cells, such as oligodendrocytes, astrocytes, ependymal cells, or microglial cells.Other non-limiting examples of the cells described herein include autologous (e.g., patient-derived) or heterologous (allogeneic) pluripotent, totipotent, or multipotent stem cells (e.g., embryonic stem cells, etc.).In certain embodiments, the cells described herein are OPCs.

[0214]

[0238] The cells as described herein can be used to treat myelin-related disorders in subjects with the disorder. These nuclease-modified cells are useful in treating and / or preventing damage, for example, by ex vivo therapy. The nuclease-modified cells can be expanded and then reintroduced into the patient using standard techniques. See, for example, Tebas et al. (2014) New Eng J Med 370(10):901. In the case of stem cells, after injection into the subject, in vivo differentiation of these precursors into cells expressing inactivated PLP1 also occurs. Pharmaceutical compositions comprising the cells described herein are also provided. Furthermore, the cells can be cryopreserved before administration to the patient.

[0215]

[0239] The cells and ex vivo methods described herein can be used to generate mycoplasmas in a subject. The inventions described herein provide a safer, cost-effective, and time-efficient method of treating and / or preventing myelin-related disorders and eliminate the need for continuous prophylactic drug administration or risky therapies.

[0216] delivery

[0240] The nucleases described herein, the polynucleotides encoding these nucleases, Nucleotides, donor polynucleotides, and compositions containing proteins, oligonucleotides, and / or polynucleotides may be delivered by any suitable means. In certain embodiments, the nucleases and / or donors are delivered in vivo. In other embodiments, the nucleases and / or donors are delivered to isolated cells (e.g., autologous or heterologous stem cells) to provide modified cells useful for ex vivo delivery to patients with myelin-related disorders.

[0217]

[0241] The methods for delivering nucleases as described herein include, for example, Nos. 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, the disclosures of all of which are incorporated herein by reference in their entirety.

[0218]

[0242] The nuclease and / or donor constructs as described herein may also be Any nucleic acid delivery mechanism can be used for delivery, including naked DNA and / or RNA (e.g., mRNA) and vectors containing sequences encoding one or more of the components.Any vector system can be used, including but not limited to, plasmid vectors, DNA minicircles, retrovirus vectors, lentivirus vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc., and combinations thereof.See also U.S. Patent Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, and U.S. Patent Application No. 14 / 271,008, which are incorporated herein by reference in their entirety.In addition, it will be apparent that any of these systems can also contain one or more sequences required for therapy. Thus, when one or more nucleases and donor constructs are introduced into a cell, the nucleases and / or donor polynucleotides can be carried in the same delivery system or different delivery mechanisms. When multiple systems are used, each delivery mechanism can contain sequences encoding one or more nucleases and / or donor constructs (e.g., mRNA encoding one or more nucleases and / or mRNA or AAV carrying one or more donor constructs).

[0219]

[0243] Suitable vectors include those that are non-integrating, non-immunogenic, and capable of infecting dividing and cytoplasmic cells. It is also possible to include a delivery vector capable of infecting both the Cas9 nuclease and the sgRNA. In some embodiments, in vivo delivery of the Cas9 nuclease and the sgRNA can be mediated by an adeno-associated virus (AAV) vector. AAV vectors for in vivo delivery include AAV serotypes capable of penetrating the central nervous system and infecting glial myelin-producing cell types (oligodendrocytes, OPCs, NPCs, etc.) in the central nervous system of a subject. In exemplary embodiments, an AAV vector is used for in vivo delivery of the Cas9 nuclease (e.g., SaCas9 or SpCas9 nuclease). In certain embodiments, the nuclease SaCas9 and the sgRNA are incorporated into a single AAV vector for nuclease-mediated gene disruption of PLP1 in cells. Packaging. See further details below.

[0220]

[0244] Using conventional viral and non-viral based gene transfer methods It is also possible to introduce nucleic acids encoding nucleases and donor constructs into cells (e.g., mammalian cells) and target tissues. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes, lipid nanoparticles (LNPs), polylactic-co-glycolic acid nanoparticles, polyamine complexing agents, or poloxamers. Viral vector delivery systems include DNA and RNA viruses that carry either episomal or integrated genomes after delivery to cells. For reviews of gene therapy, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., Current Topics in Microbiology and Immunology. See Doerfler and Boehm (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0221]

[0245] Non-viral methods for delivery of nucleic acids include electroporation, lipofection, These include microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced DNA uptake. Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar), can also be used for nucleic acid delivery.

[0222]

[0246] Further exemplary nucleic acid delivery systems include those from Amaxa Biosystems (Germany). Lipofection reagents include those offered by Maxcyte, Inc. (Rockville, MD), BTX Molecular Delivery Systems (Holliston, MA), and Copernicus Therapeutics Inc. (see, e.g., U.S. Patent No. 6,008,336). Lipofection is described, e.g., in U.S. Patent Nos. 5,049,386; 4,946,787; and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam). TM and Lipofectin TM ). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91 / 17424, WO 91 / 16024. In some aspects, the nuclease is delivered as mRNA (e.g., using electroporation), and the transgene is delivered through other modalities, such as viral vectors, minicircle DNA, plasmid DNA, single-stranded DNA, linear DNA, liposomes, nanoparticles, etc.

[0223]

[0247] Lipid:nucleus, including targeted liposomes such as immunolipid complexes The preparation of acid conjugates is well known to those skilled in the art (e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:382-389 (1994)). Gate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); see U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0224]

[0248] Further delivery methods include the use of EnGeneIC delivery vehicles for the nucleic acids to be delivered. These EDVs are packaged into endothelial cells (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies, where one arm of the antibody has specificity for the target tissue and the other arm has specificity for the EDV. The antibody carries the EDV to the surface of the target cell, and the EDV is then internalized into the cell by endocytosis. Once inside the cell, the contents are released (see MacDiarmid et al. (2009) Nature Biotechnology 27(7):643).

[0225]

[0249] Encode the engineered CRISPR / Cas system or target cells The use of RNA or DNA virus-based systems to deliver nucleic acids encoding RNAi constructs capable of producing siRNA, shRNA, or miRNA internally takes advantage of the well-developed processes within the body for targeting viruses to specific cells and transporting the viral payload to the nucleus. Viral vectors can be administered directly to a subject (in vivo), or they can be used to treat cells in vitro and then administered to a subject (ex vivo). Conventional virus-based systems for delivering CRISPR / Cas systems include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated viral, vaccinia viral, and herpes simplex viral vectors for gene transfer. Integration into the host genome is possible with retroviral, lentiviral, and adeno-associated viral gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues.

[0226]

[0250] Retroviral tropism is conferred by incorporating foreign envelope proteins Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats that have packaging capacity for up to 6-10 kb of foreign sequence. A minimal set of cis-acting long terminal repeats is sufficient for vector replication and packaging, which is then used to integrate a therapeutic gene into the target cell, providing persistent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).

[0227]

[0251] Adenovirus-based vectors have very high immunogenicity in many cell types. Transduction efficiency can be high and does not require cell division. High titers and high levels of expression have been obtained using such vectors. This vector can be produced in large quantities using a relatively simple system. Adeno-associated virus ("AAV") vectors are also used to transduce target nucleic acids into cells, for example, in the in vitro production of nucleic acids and peptides and for in vivo and ex vivo gene therapy (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994)). Construction of recombinant AAV vectors is described in U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). Any AAV serotype can be used, including AAV1, AAV3, AAV4, AAV5, AAV6 and AAV8, AAV 8.2, AAV9, and AAV rh10, and pseudotyped AAV such as AAV2 / 8, AAV2 / 5, and AAV2 / 6. Additional adenovirus-based vectors include AAV variants that efficiently and widely transduce mammalian central nervous system (CNS) after intravenous injection, such as the AAV-PHP.B vector described in Deverman et al. (2016) Nature Biotechnology 204-209.

[0228]

[0252] Defective genes inserted into helper cell lines to produce transducing agents At least six viral vector approaches that utilize vector complementation approaches are currently available for gene transfer in clinical trials.

[0229]

[0253] pLASN and MFG-S are retroviruses used in clinical trials. Examples include (Dunbar et al., Blood 85:3048-305 (1995); Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al., PNAS 94:22 12133-12138 (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., Science 270:475-480 (1995)). Transduction efficiencies of 50% or greater have been observed with MFG-S packaging vectors (Ellem et al., Immunol Immunother. 44(1):10-20 (1997); Dranoff et al., Hum. Gene Ther. 1:111-2 (1997)).

[0230]

[0254] Recombinant adeno-associated viral vectors (rAAV) are defective and non-pathogenic vectors. A promising alternative gene delivery system is based on the adeno-associated type 2 virus, a rubeofibrillar virus. All vectors are derived from plasmids that retain only the 145 base pair (bp) inverted terminal sequences of AAV flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery via integration into the transduced cell genome are key features of this vector system (Wagner et al., Lancet 351:9117 1702-3 (1998); Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, and AAVrhlO, as well as all of their variants, including engineered mutants selected from libraries, can also be used in accordance with the present invention.

[0231]

[0255] It is possible to produce replication-deficient recombinant adenoviral vectors (Ad) at high titers, The vectors are also capable of readily infecting several different cell types. Most adenoviral vectors are engineered so that a transgene replaces the Ad E1a, E1b, and / or E3 genes; the replication-incompetent vector is then amplified in human 293 cells to supply the deleted gene function in trans. Ad vectors can transduce many types of tissue in vivo, including non-dividing differentiated cells such as those found in liver, kidney, and muscle. Conventional Ad vectors have a large carrying capacity. In clinical trials, the use of Ad vectors has involved polynucleotide therapy for anti-tumor immunization using intramuscular injection (Sterman et al., Hum. Genet. 2002). Ther. 7:1083-9 (1998)). Further examples of the use of adenoviral vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24:1 5-10(1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089(1998); Welsh et al., Hum. Gene Ther. 2:205-18(1995); Alvarez et al., Hum. Gene Ther. 5:597-613(1997); Topf et al., Gene Ther. 5:507-513(1998); Sterman et al., Hum. Gene Ther. 7:1083-1089(1998).

[0232]

[0256] Packaging cells are used to form viral particles capable of infecting host cells. Such cell lines include 293 cells, which package adenovirus, and Ψ2 or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producer cell lines that package nucleic acid vectors into viral particles. The vectors typically contain minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically possess only the inverted terminal repeat (ITR) sequences from the AAV genome, which are necessary for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing a helper plasmid encoding other AAV genes, i.e., rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in significant amounts because it lacks ITR sequences. Adenovirus contamination can also be reduced by, for example, heat treatment, to which adenovirus is more sensitive than AAV.

[0233]

[0257] In many gene therapy applications, gene therapy vectors are targeted to specific tissue types. It is desirable to deliver a high degree of specificity to a given cell type. Therefore, viral vectors can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is selected to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and that the recombinant virus infects specific human breast cancer cells expressing the human epidermal growth factor receptor. This principle can also be extended to other virus-target cell pairs, where the target cell expresses a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) with specific binding affinity for virtually any selected cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. It is also possible to engineer such vectors to contain specific uptake sequences that favor uptake by specific target cells.

[0234]

[0258] Administration to an individual subject typically involves systemic administration (e.g., intravenous, intraperitoneal) Gene therapy vectors can also be delivered in vivo via intravenous (intramuscular, subcutaneous, sublingual, or intracranial injection), topical application as described below, or pulmonary inhalation. Alternatively, vectors can be delivered ex vivo to cells, such as cells explanted from an individual patient (e.g., OPCs) or universal donor neural stem cells, which can then be reimplanted into the patient, typically after selection of cells that have taken up the vector.

[0235]

[0259] A vector (e.g., retroviral vector) containing the nuclease and / or donor construct Nucleic acid molecules (e.g., viruses, adenoviruses, AAV, liposomes, etc.) can be administered directly to an organism for transduction of cells in vivo. Alternatively, naked DNA can be administered. Administration can be by any route typically used to introduce molecules that ultimately contact glial cells, including, but not limited to, injection, infusion, topical application, inhalation, and electroporation. Suitable methods for administering such nucleic acids are available and well known to those of skill in the art, and while more than one route can be used to administer a particular composition, certain routes can often provide a more immediate and effective response than others.

[0236]

[0260] Suitable vectors for the introduction of the polynucleotides described herein include non-integrating vectors. and immunoglobulin vectors (IDLV). See, e.g., Ory et al. (1996) Proc. Natl. Acad. Sci. USA 93:11382-11388; Dull et al. (1998) J. Virol. 72:8463-8471; Zuffery et al. (1998) J. Viro. 72:9873-9880; Follenzi et al. (2000) Nature Genetics 25:217-222; U.S. Patent Publication No. 2009 / 054985.

[0237]

[0261] Pharmaceutically acceptable carriers will depend, in part, on the particular composition being administered. The dosage will be determined by the dosage and the particular method used to administer the composition. Accordingly, as described below, there is a wide variety of suitable formulations of pharmaceutical compositions available (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0238]

[0262] The nuclease coding sequence and the donor construct can be synthesized using the same or different systems. It will be apparent that multiple vectors can be delivered simultaneously or in any sequential order. For example, the donor polynucleotide can be delivered by AAV, while one or more nucleases can be delivered by mRNA. Furthermore, different systems can be administered by the same or different routes (intramuscular injection, tail vein injection, other intravenous injection, intraperitoneal administration, and / or intramuscular injection). Multiple vectors can be delivered simultaneously or in any sequential order.

[0239]

[0263] Formulations for both ex vivo and in vivo administration include: The active ingredient is often mixed with a pharmaceutically acceptable excipient that is compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In addition, the composition may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition.

[0240] AAV-delivered CRISPR / Cas-mediated gene silencing

[0264] In certain embodiments, the PLP1 gene or a regulatory element thereof, or a portion thereof The methods of the present invention can also be carried out by delivering a CRISPR / Cas system containing a guide RNA (sgRNA) that specifically targets the target gene.

[0241]

[0265] In one embodiment, the system comprises, optionally with a third AAV vector: Two AAV vectors can also be used: one encoding Cas9 or its functional ortholog, one containing a guide RNA sequence for targeted cleavage of the PLP1 gene or regulatory element, and optionally, one containing a donor cDNA sequence of a mutant PLP1 gene (e.g., a PLP1 point mutation) to be inserted at the cleavage site to repair or replace the defective PLP1 gene. The donor-to-Cas9 construct administration ratio can range anywhere from 1:1 to 5:1.

[0242]

[0266] In another embodiment, the system can also use two AAV vectors. One vector encodes a Cas9 ortholog less than 3.5 kb in length and has a guide RNA encoded in cis, and one vector contains a donor cDNA sequence of the mutant PLP1 gene to be inserted at the cleavage site. For targets larger than 4.8 kb, the donor can contain either up to 4.8 kb of the 3' cDNA portion of the gene, allowing correction of the upstream bulk of the mutant gene, or the 5' promoter and upstream cDNA portion of the gene, which would then be spliced ​​to the correct downstream sequence.

[0243]

[0267] In a further embodiment, the system uses two AAV vectors: one C One encodes as9 or a functional ortholog, and the other contains a specific guide RNA sequence for cleavage of the target gene.

[0244]

[0268] In yet another embodiment, the system uses one AAV vector, The target contains a nucleic acid encoding a functional type II CRISPR-Cas9 and a specific guide RNA for cleavage of the target gene (e.g., PLP1).

[0245]

[0269] In one embodiment, the method comprises binding to a target gene and The method includes providing one or more AAV vectors (typically one, two, or three AAV vectors) containing elements of a CRISPR system, which achieve gene / polynucleotide cleavage and thereby modify the target gene, e.g., disrupt the target gene, or correct or replace all or part of the target gene with a donor nucleic acid. The elements of the CRISPR system include a CRISPR enzyme capable of complexing with a guide RNA sequence, and the guide RNA capable of hybridizing to a target sequence within the target gene.

[0246]

[0270] Cleavage at the target gene occurs by CRISPR enzymes, which split one or both strands. In some embodiments, the method includes correcting or replacing the cut target gene by introducing a donor nucleic acid, where the donor nucleic acid encodes a protein that corrects the mutated or defective target gene.

[0247]

[0271] Cas genes as described herein include, but are not limited to, C The enzyme may be a Cas9 homolog or ortholog. Cas9 orthologs can include Cas9 from Streptococcus pyogenes, Neisseria meningitidis, Streptococcus thermophilus, Streptococcus pneumoniae, Campylobacter coli, Campylobacter jejuni, Streptococcus mutans, Pasteurella multocida, Bifidobacterium longum, Bacillus smithii, Treponema denticola, Mycoplasma canis, and Enterococcus faecalis. Cas9 can include mutant Cas9 derived from these organisms.

[0248]

[0272] Exemplary AAV vectors include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV17, AAV18, AAV19, AAV20, AAV21, AAV22, AAV23, AAV24, AAV25, AAV The capsid sequences of any of AV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8, or capsid mutants of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8. Recombinant AAV vectors of the invention also include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8, and mutants thereof.

[0249]

[0273] Specific capsid variants include AAV1, AAV2, AAV3, AAV4, and AA Capsid variants of V5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74 or AAV-2i8 are included, for example, capsid sequences containing amino acid substitutions, deletions or insertions / additions.

[0250]

[0274] AAV vectors contain additional elements that function in cis or trans In certain embodiments, the AAV vector comprising the vector genome also has: one or more inverted terminal repeat (ITR) sequences adjacent to the 5' or 3' end of the donor sequence; an expression control element (e.g., a promoter or enhancer) that drives transcription of the donor sequence, such as a constitutive or regulatable control element, or a tissue-specific expression control element; an intron sequence, a stuffer or filler polynucleotide sequence; and / or a poly-adenine sequence located 3' of the donor sequence.

[0251]

[0275] Typically, expression control elements are operably linked to polynucleotides. A vector is a nucleic acid sequence or sequences that affect the expression of a gene. Regulatory elements, including expression control elements as described herein, such as promoters and enhancers present in a vector, are included to facilitate proper nucleic acid transcription and translation (e.g., promoters, enhancers, splicing signals for introns, maintaining the correct reading frame of the gene to allow in-frame translation of mRNA, and stop codons, etc.) and AAV packaging. These elements typically act in cis and are referred to as "cis-acting" elements, but can also act in trans.

[0252]

[0276] Achieve expression control at the levels of transcription, translation, splicing, message stability, etc. It is also possible to construct a transcribed nucleic acid sequence. Typically, expression control elements that regulate transcription are juxtaposed near the 5' end (i.e., "upstream") of the transcribed nucleic acid. Expression control elements can also be located at the 3' end (i.e., "downstream") of the transcribed sequence or within the transcript (e.g., in an intron). Expression control elements can be located adjacent to the transcribed sequence or distant from the sequence. Typically, due to polynucleotide length limitations of particular vectors, e.g., AAV vectors, such expression control elements will be within 1 to 1000 nucleotides of the transcribed nucleic acid.

[0253]

[0277] A "promoter," as used herein, refers to a gene that is operably linked to adjacent sequences. The promoter binds to the nucleic acid and increases the amount expressed from the nucleic acid when compared to the amount expressed in the absence of the promoter.

[0254]

[0278] "Enhancers," as used herein, are sequences that are located adjacent to a nucleic acid and typically Although located upstream of the promoter element, enhancers can also function and be located downstream or within the DNA sequence (e.g., donor nucleic acid). The element can be located within 100, 200, or 300 or more base pairs upstream or downstream of the nucleic acid. Enhancer elements also typically increase expression of nucleic acids.

[0255]

[0279] Expression control elements regulate the expression of polynucleotides in many different cell types. These elements include ubiquitous or promiscuous promoters / enhancers capable of driving expression. Such elements include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter / enhancer sequence, the Rous sarcoma virus (RSV) promoter / enhancer sequence, and other viral promoters / enhancers that are active in a variety of mammalian cell types, or non-naturally occurring synthetic elements (e.g., Boshart et al., Cell, 41 :521-530 (1985)), the SV40 promoter, the dihydrofolate reductase (DHFR) promoter, the cytoplasmic β-actin promoter, and the phosphoglycerol kinase (PGK) promoter.

[0256]

[0280] Expression control elements are also referred to herein as "tissue-specific expression control elements / proteases." These expression control elements may include those that are active in specific tissues or cell types, referred to as "motors." Tissue-specific expression control elements are typically active in specific cells or tissues (e.g., eye, retina, central nervous system, spinal cord, eye, retina, etc.). In certain embodiments, tissue-specific expression control elements are active in the CNS, e.g., neural stem cells, OPCs, oligodendrocytes, etc. In certain embodiments, tissue-specific expression control elements are active in the zygote or egg.

[0257]

[0281] Expression control elements are typically active in these cells, tissues, or organs. This is because they are recognized by transcriptional activator proteins or other transcriptional regulators that are unique to a particular cell, tissue, or organ type.

[0258]

[0282] Expression control elements also can be regulated, i.e., can be functionally regulated by a signal or stimulus. Expression can also be conferred in a manner that increases or decreases the expression of an operably linked nucleic acid. A controllable element that increases expression of an operably linked nucleic acid in response to a signal or stimulus is also referred to as an "inducible element" (i.e., induced by a signal). Specific examples include, but are not limited to, hormone (e.g., steroid)-inducible promoters. A controllable element that decreases expression of an operably linked nucleic acid in response to a signal or stimulus is referred to as an "inhibitory element" (i.e., the signal decreases expression such that when the signal is removed or absent, expression increases). Typically, the amount of increase or decrease conferred by such an element is proportional to the amount of signal or stimulus present; the greater the amount of signal or stimulus, the greater the increase or decrease in expression.

[0259]

[0283] Expression control elements also include the native element(s). When it is desired to mimic natural expression, natural regulatory elements (e.g., promoters) can also be used. When expression of a nucleic acid is to be controlled temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus, natural elements can also be used. Other natural expression control elements, such as introns, polyadenylation sites, or Kozak consensus sequences, can also be used.

[0260]

[0284] AAV vectors also contain filler or stuffer polynucleotide sequences. For example, if the donor nucleic acid has a length of less than about 4.7 kb, the filler or stuffer polynucleotide sequence has a length such that, when combined with the donor nucleic acid, the total combined length is between about 3.0 and 5.5 kb, between about 4.0 and 5.0 kb, or between about 4.3 and 4.8 kb.

[0261]

[0285] Filler or stuffer polynucleotide sequences may be used to enhance the function or The filler or stuffer polynucleotide sequence may be located at any desired position in the vector sequence so as not to interfere with activity. In one aspect, the filler or stuffer polynucleotide sequence is located adjacent to the 5' and / or 3' ends of each of the donor nucleic acid sequences. Located between the ITRs (e.g., the ITRs of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74 or AAV-2i8, and variants thereof).

[0262]

[0286] Typically, the filler or stuffer polynucleotide sequences are inert or or non-invasive and has no function or activity. In various specific aspects, the filler or stuffer polynucleotide sequence is not a bacterial polynucleotide sequence, the filler or stuffer polynucleotide sequence is not a sequence encoding a protein or peptide, and the filler or stuffer polynucleotide sequence is a sequence distinct from any of: the donor sequence, the AAV inverted terminal repeat (ITR) sequence, the expression control element, or the polyadenylation (polyA) signal. In various specific aspects, the filler or stuffer polynucleotide sequence is an intron sequence, related or unrelated to the donor sequence.

[0263]

[0287] Intron length for packaging AAV vectors into viral particles Introns and intron fragments (e.g., portions of intron I of FIX) that function as filler or stuffer polynucleotide sequences can also enhance expression. The inclusion of intron elements can also enhance expression compared to expression in the absence of the intron elements (Kurachi et al., 1995, supra).

[0264]

[0288] The use of introns is not limited to naturally occurring genomic sequences and can be used in completely different Introns associated with genes or other DNA sequences can also be included. Thus, other untranslated (non-protein coding) regions of nucleic acids, such as introns found in genomic sequences from cognate (related) and non-cognate (unrelated) genes, can also function as filler or stuffer polynucleotide sequences in accordance with the present invention.

[0265]

[0289] Donor nucleic acid, expression control element, ITR, polyA sequence, filler or stuffer - Polynucleotide sequences can vary in length. In certain aspects, the sequence may be about 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-2,500, 2,500-3,000, 3,000-3,500, 3,500-4,000, 4,000-4,500, 4,500-5,000 or more nucleotides in length, up to the maximum AAV packaging size limit.

[0266]

[0290] The AAV vector delivers the CRI containing the Cas9 coding sequence and sgRNA. The SPR / Cas system may also be introduced / transferred / transformed / transfected into a target cell. The terms "transduce" and "transfect" refer to the introduction of a molecule, such as a nucleic acid, into a cell or host organism. Thus, transducing a cell (e.g., a cell or tissue or organ cell, e.g., in a mammal) refers to a genetic change in the cell following the uptake of an exogenous molecule, e.g., a polynucleotide or protein (e.g., a transgene), into the cell. Thus, a "transduced" cell refers to a genetic change in the cell following the uptake of an exogenous molecule, e.g., a polynucleotide or protein (e.g., a transgene), into the cell. In the methods and uses of the present invention, the transduced cell may be in a subject, for example in vivo or ex vivo.

[0267]

[0291] The methods and uses of the present invention include CRISPR / Cas / sgRNA and optionally Thus, they provide a means for delivering (transducing) donor nucleic acids (transgenes) into host cells, including dividing and / or non-dividing cells. The AAV vectors, methods, uses, and pharmaceutical formulations of the present invention are further useful in methods of delivering, administering, or providing nucleic acids or proteins to a subject in need thereof as a therapy. In this manner, the nucleic acid can be transcribed and the protein produced in vivo in the subject. The subject can benefit from or need the nucleic acid or protein because they have a nucleic acid or protein deficiency, or because production of the nucleic acid or protein in the subject provides some therapeutic effect, whether as a therapy or otherwise.

[0268]

[0292] In various embodiments, the AAV vector is delivered to a eukaryotic cell in a subject. The subject is typically an animal, and this includes humans and veterinary applications. Accordingly, suitable subjects include mammals, such as humans, as well as non-human mammals (e.g., primates). Other subjects include primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock animals (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, juveniles, and adult subjects. For example, subjects can be humans younger than 20, 15, 10, 5, 3, 2, 1 year, 6 months, 3 months, or 1 month. Subjects can also include animal disease models, such as mouse and other animal models of blood clotting disorders and others known to those skilled in the art.

[0269]

[0293] Subjects suitable for treatment include those who produce insufficient amounts of functional gene product (protein). The present invention also includes subjects who have or are at risk of developing a defective gene product (e.g., PLP1) or who have a defective gene product (e.g., PLP1), or who have a gene encoding a protein with defective or partial function or activity, which may lead to disease. In certain embodiments, the subject may benefit from or need to disrupt, correct, or replace a defective gene (e.g., PLP1), or who need to disrupt, correct, or replace a gene encoding a protein with defective or partial function or activity.

[0270]

[0294] The therapeutic or beneficial effect of a treatment may therefore depend on the desired outcome provided to a particular subject. A therapeutic or beneficial effect is any objectively or subjectively measurable or detectable improvement or benefit. A therapeutic or beneficial effect may be, but need not necessarily be, the complete elimination of all or any particular adverse symptoms, disorders, diseases, or complications of a disease. Thus, a satisfactory clinical endpoint is achieved when there is an incremental amelioration or partial reduction of an adverse symptom, disorder, disease, or complication caused by or associated with the disease, or when there is an inhibition, reduction, diminishment, suppression, prevention, limitation, or control over a short or long period of time (hours, days, weeks, months, etc.) of the worsening or progression of one or more adverse symptoms, disorders, diseases, or complications caused by or associated with the disease.

[0271]

[0295] Dosage to achieve therapeutic effect, e.g., vector genome / kilogram of body weight The dose per (vg / kg) will vary based on several factors, including, but not limited to: the route of administration, the nucleic acid expression required to achieve a therapeutic effect, the particular disease being treated, any host immune response to the vector, and the stability of the expressed protein. Those skilled in the art will be able to predict the optimal dose for a patient with a particular disease or disorder based on the foregoing factors as well as other factors. It is also possible to determine a rAAV / vector genome dose range for treating a subject.

[0272]

[0296] Untoward symptoms, conditions, or symptoms caused by or associated with a disease Administration to a subject or in vivo delivery can occur before a complication or the like develops. For example, (e.g., genetic) screening can be used to identify subjects as candidates for the compositions, methods, and uses of the invention. Thus, such subjects include those that screen positive for insufficient or defective functional gene products (proteins), or those that produce abnormal, partially functional, or non-functional gene products (proteins).

[0273]

[0297] The method of administration or delivery includes any mode compatible with the subject. The methods and uses include delivery and administration systemically, regionally, or locally, or by any route, for example, by injection or infusion. Such delivery and administration include parenteral, for example, intraocular, intravascular, intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous, or transmucosal. Exemplary administration and delivery routes include intravenous (iv), intraperitoneal (ip), intraarterial, subcutaneous, intrapleural, intubation, intrapulmonary, intracavity, iontophoresis, intraorgan, and intralymphatic. In certain embodiments, the AAV vector is administered or delivered parenterally, for example, intravenously, intraarterial, intraocular, intramuscular, subcutaneously, or through a catheter or intubation.

[0274]

[0298] The dosage depends on the type, onset, progression, severity, frequency, duration, and severity of the disease to be treated. The dosage may vary with and depend on the likelihood, desired clinical endpoint, previous or concurrent treatments, the subject's general health, age, sex, race, or immunological competence, and other factors that will be recognized by those of skill in the art. The dose, number, frequency, or duration may be proportionally increased or decreased as indicated by any adverse side effects of the treatment or therapy, complications or other risk factors, and the condition of the subject. Those of skill in the art will recognize factors that may affect the dosage and timing necessary to provide an amount sufficient to provide therapeutic or prophylactic benefit.

[0275]

[0299] The subject AAV vectors, and other compositions, can be formulated into pharmaceutical compositions, e.g., pharmaceutically acceptable carriers. The pharmaceutical compositions may be incorporated into an acceptable carrier or excipient. Such pharmaceutical compositions are useful, inter alia, for administration and delivery to a subject in vivo or ex vivo.

[0276]

[0300] As used herein, the terms "pharmaceutically acceptable" and "physiologically acceptable" "Pharmaceutically acceptable" or "physiologically acceptable" means a biologically acceptable gaseous, liquid, or solid formulation, or mixture thereof, suitable for one or more routes of administration, in vivo delivery, or contact. A "pharmaceutically acceptable" or "physiologically acceptable" composition is a substance that is not biologically or otherwise undesirable, e.g., the substance can be administered to a subject without causing substantial undesirable biological effects. Thus, such pharmaceutical compositions can be used, for example, in administering viral vectors or viral particles to a subject.

[0277]

[0301] Such compositions include those suitable for pharmaceutical administration or in vivo contact or delivery. Compatible carriers include solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic agents, and absorption enhancers or delayers. Aqueous and non-aqueous solvents, solutions, and suspensions can also include suspending agents and thickeners. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Supplementary active compounds (e.g., preservatives, antibacterial, antiviral, and antifungal agents) can also be incorporated into the compositions. It is also possible to

[0278]

[0302] The specific route of administration or delivery may be as set forth herein or as known to those skilled in the art. Pharmaceutical compositions can also be formulated to be compatible with various routes of administration. Thus, pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes.

[0279]

[0303] Compositions suitable for parenteral administration include aqueous and non-aqueous solutions, suspensions or emulsions of the active compound. or emulsions, which preparations are typically sterile and can be isotonic with the blood of the intended recipient. Non-limiting illustrative examples include water, saline, dextrose, fructose, ethanol, animal, vegetable, or synthetic oils.

[0280]

[0304] Co-solvents and adjuvants may also be added to the formulation. Non-limiting examples include those containing hydroxyl groups or other polar groups, such as alcohols, e.g., isopropyl alcohol; glycols, e.g., propylene glycol, polyethylene glycol, polypropylene glycol, glycol ethers; glycerol; polyoxyethylene alcohols and polyoxyethylene fatty acid esters. Adjuvants include, for example, surfactants, e.g., soybean lecithin and oleic acid; sorbitan esters, e.g., sorbitan trioleate; and polyvinylpyrrolidone.

[0281]

[0305] Pharmaceutical compositions and delivery systems suitable for the compositions, methods and uses of the present invention are disclosed in the art. The following publications are known in the art (e.g., Remington: The Science and Practice of Pharmacy (2003) 20th ed., Mack Publishing Co., Easton, PA; Remington's Pharmaceutical Sciences (1990) 18th ed., Mack Publishing Co., Easton, PA; The Merck Index (1996) 12th ed., Merck Publishing Group, Whitehouse, NJ; Pharmaceutical Principles of Solid Dosage Forms (1993), Technonic Publishing Co., Inc., Lancaster, Pa.; Ansel and Stoklosa, Pharmaceutical Calculations (2001) 11th ed., Lippincott Williams & Wilkins, Baltimore, MD; and Poznansky et al., Drug See Delivery Systems (1980), R.L. Juliano, ed., Oxford, NY, pp. 253-315).

[0282]

[0306] "Unit dosage form" as used herein refers to a single dose administered to a subject to be treated. "Dose" refers to physically discrete units suitable as dosage forms: each unit contains a predetermined amount, calculated to produce a desired effect (e.g., a prophylactic or therapeutic effect) when administered in one or more doses, optionally in association with a pharmaceutical carrier (excipient, diluent, vehicle, or filler). Unit dosage forms can be, for example, in ampoules and vials, which may contain liquid compositions or compositions in a freeze-dried or lyophilized state; for example, a sterile liquid carrier can be added prior to in vivo administration or delivery. Individual unit dosage forms can also be included in multi-dose kits or containers. For ease of administration and uniformity of dosage, AAV vectors and pharmaceutical compositions thereof can be packaged in single or multiple unit dosage forms.

[0283]

[0307] In a related embodiment, the AAV delivery systems described herein are administered to target cells (e.g., For example, OPCs or NPCs, either in vitro, in vivo, or ex vivo SC), other nucleases (e.g., TALENs or ZFNs) or RNAi constructs (which encode functional siRNAs and produce the siRNAs once inside the target cells) or ASO constructs (which encode and produce functional antisense oligos).

[0284] Applicable

[0308] The methods and compositions disclosed herein provide cell-based therapeutics for myelin-related disorders. The present invention provides a method for the treatment of inflammatory bowel disease (IGD)-related diseases, such as stroke, stroke, and stroke. The present invention provides a method for the treatment of IGD ...

[0285]

[0309] Using the subject's own cells allows for a more precise identification of the donor and recipient for transplantation. This eliminates the need for HLA matching. Furthermore, the genetically modified cells described herein have also been shown to be suitable for serial (secondary) transplantation, in that stem cells can be isolated from a subject, and these cells retain the genetic modification and can be administered to one or more additional subjects. Thus, the methods and compositions provide for the treatment and / or prevention of myelin-related disorders.

[0286]

[0310] Targeted deletion of PLP1, parts of PLP1, or PLP regulatory elements It can also be used to correct abnormal genes, generate loss-of-function mutations in endogenous genes, or change the expression of endogenous genes. In another aspect, targeted integration of anti-PLP1 donor PLP1 or PLP1 gene regulatory element nucleotide sequences can be used to correct abnormal genes, insert wild-type genes, generate gain-of-function mutations in endogenous genes, or change the expression of endogenous genes. For example, a transgene encoding PLP1 or a PLP1 gene regulatory element transgene can be integrated into cells to provide cells (e.g., oligodendrocytes or precursors) that produce non-harmful proteins that can enhance functional myelin production. Targeted knockout or gene silencing of PLP1 or PLP1 gene regulatory elements, or modification by the methods described herein, can also provide cells that enhance functional myelin production by reducing PLP1 toxicity through inactivation of the PLP1 gene. Genome editing can also include correcting or introducing mutations (e.g., point mutations) in endogenous genes, for example, to modify endogenous PLP1 gene expression.

[0287]

[0311] administering the compositions (e.g., cells and / or nucleotides) described herein to a subject The compounds may be administered to treat myelin-related diseases and disorders. Myelin-related diseases and disorders contemplated for treatment by some aspects of the present invention may include any disease, condition (e.g., those resulting from traumatic spinal cord injury and cerebral infarction), or disorder associated with demyelination, insufficient myelination and remyelination, or dysmyelination in a subject. As used herein, myelin-related disorders may result from myelination-related disorders or demyelination resulting from various neurotoxic insults. "Demyelination," as used herein, refers to the demyelinating process or loss of myelin sheaths that damage nerves and is a hallmark of several neurodegenerative autoimmune diseases, including multiple sclerosis, transverse myelitis, chronic inflammatory demyelinating neuropathy, and Guillain-Barré syndrome. Leukodystrophies are caused by inherited enzyme deficiencies, resulting in abnormal formation, destruction, and / or abnormal turnover of myelin sheaths within the CNS white matter. Both acquired and inherited myelin disorders share a poor prognosis and lead to significant disability. Aspects of the present invention may include methods for treating a neurodegenerative autoimmune disease in a subject. Remyelination of neurons requires oligodendrocytes. The term "remyelination," as used herein, refers to the regeneration of the myelin sheath of a nerve by replacing or restoring the function of myelin-producing cells.

[0288]

[0312] Myelin-related disorders that can be treated or ameliorated by the methods of the present invention The disease or disorder includes a disease, disorder, or injury associated with dysmyelination or demyelination in brain cells, e.g., CNS neurons, of a subject, including, but not limited to, diseases and disorders in which the myelin around neurons is absent, incomplete, improperly formed, or altered. These diseases include, but are not limited to, multiple sclerosis (MS), neuromyelitis optica (NMO), progressive multifocal leukoencephalopathy (PML), encephalomyelitis (EPL), central pontine myelinolysis (CPM), adrenoleukodystrophy, Alexander disease, Pelizaeus-Merzbach disease (PMD), Wallerian degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, spinal cord injury, traumatic brain injury, post-radiation injury, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, AR, Bassen-Kornzweig syndrome, Marchiafava-Bignami syndrome, metachromatic leukodystrophy, trigeminal neuralgia, acute disseminated encephalitis, Guillain-Barré syndrome, Marie-Charcot-Tooth disease, and Bell's palsy.

[0289]

[0313] Myelin-related disorders that can be treated or ameliorated by the methods of the present invention Diseases or disorders include those characterized by myelin defects. Insufficient myelination in the central nervous system has been associated with a wide variety of neurological disorders. Among these is a form of cerebral palsy in which congenital defects in forebrain myelination contribute to neurological morbidity in children with periventricular leukomalacia (Goldman et al., 2008). Goldman, SA, Schanz, S., and Windrem, MS (2008). Stem cell-based strategies for treating pediatric disorders of myelin. Hum Mol Genet. 17, R76-83. At the other end of the age spectrum, myelin loss and ineffective repair may also contribute to the cognitive decline associated with aging (Kohama et al., 2011) Kohama, SG, Rosene, DL, and Sherman, LS (2011) Age (Dordr). Age-related changes in human and non-human primate white matter: from myelination disturbances to cognitive decline. It is therefore contemplated that effective compounds and methods that enhance myelination and / or remyelination could have substantial therapeutic benefit in halting disease progression and restoring function in PMD and in a wide variety of myelin-related disorders.

[0290]

[0314] In some embodiments, enhancing or promoting myelin-dependent processes To improve cognitive function, the compositions of the present invention can be administered to subjects who do not have and / or are not expected to have a myelin-related disorder. In some embodiments, the compounds described herein can be administered to cognitively healthy subjects to promote myelination of CNS neurons, which is known to be a myelin-dependent process. In certain embodiments, the compounds described herein can be administered in combination with a cognition-enhancing (nootropic) agent. Exemplary agents include any drug, supplement, or other substance that improves cognitive function, particularly executive function, memory, creativity, or motivation, in healthy individuals. Non-limiting examples include racetams (e.g., piracetam, oxiracetam, and aniracetam), dietary supplements (e.g., Bacopa monnieri (Bacop)), and the like. a monnieri, Panax ginseng, Ginkgo biloba, and GABA), stimulants (e.g., amphetamine drugs, methylphenidate, eugeroics, xanthines, and nicotine), L-theanine, tolcapone, levodopa, atomoxetine, and desipramine.

[0291]

[0315] One particular aspect of the present invention contemplates treating PMD in a subject. The method includes administering to the subject a therapeutically effective amount of the genetically modified cell or nucleotide composition described above.

[0292]

[0316] The overall dosage will depend on the subject's general health, the subject's disease state, and the severity of the condition. A therapeutically effective amount will depend on several factors, including the amount of treatment, the observed improvement, and the formulation and route of administration of the selected agent(s). Determination of a therapeutically effective amount is within the ability of one skilled in the art. The exact formulation, route of administration, and dosage can be chosen by the individual physician, taking into account the subject's condition.

[0293]

[0317] In certain embodiments, intact CNS neurons or myelin proteins of the subject At least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, The genetically modified cells or nucleotide compositions described herein can be administered in an amount effective to increase myelin production in CNS neurons in a subject by increasing the amount of myelin protein (e.g., MBP) by 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000%.

[0294]

[0318] In other embodiments, intact CNS neurons or viable neurons in a subject The genetically modified cells or nucleotide compositions can also be administered in an amount effective to promote survival of CNS neurons in a subject by increasing the number of surviving neurons by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% as compared to the number of surviving neurons.

[0295]

[0319] Another strategy for treating subjects with myelin-related disorders is oligodendrocyte proliferation. The therapeutically effective amount of the genetically modified cells or nucleotide compositions described herein is administered in conjunction with a therapeutically effective amount of a cell differentiation and / or proliferation inducing agent(s) and / or an anti-neurodegenerative disease agent, examples of which include L-dopa, cholinesterase inhibitors, anticholinergics, dopamine agonists, steroids, and immunomodulatory agents, including interferons, monoclonal antibodies, and glatiramer acetate.

[0296]

[0320] Thus, in a further aspect of the invention, the genetically modified cells described herein Alternatively, the nucleotide compositions can be administered as part of a combination therapy with adjunctive therapies for treating neurodegenerative and myelin-related disorders.

[0297]

[0321] The phrase "combination therapy" refers to any combination of the oligodendrocyte precursor differentiation inducers described herein. The conductive compound and the therapeutic agent are intended to provide a beneficial effect from the synergistic action of the therapeutic agents. This includes administering the oligodendrocyte precursor differentiation-inducing compound as part of a specific therapeutic regimen. When administered as a combination, the oligodendrocyte precursor differentiation-inducing compound and the therapeutic agent can be formulated as separate compositions. The administration of the therapeutic agents in the combination is typically carried out over a defined period of time (usually minutes, hours, days, or weeks, depending on the combination selected).

[0298]

[0322] "Combination therapy" refers to the administration of these therapeutic agents in a sequential manner, i.e., each agent is administered at a different dose. This term is intended to include administration of at least two of these therapeutic agents at different times, as well as administration of these therapeutic agents or agents in a substantially simultaneous manner. Substantially simultaneous administration can be achieved, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent, or multiple single capsules of each therapeutic agent. Sequential or substantially simultaneous administration of each therapeutic agent can be achieved by any suitable route, including, but not limited to, oral, intravenous, intramuscular, and direct absorption through mucosal tissue. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of a selected combination can be administered by intravenous injection, while other therapeutic agents of the combination are administered orally. Alternatively, for example, all therapeutic agents can be administered orally, or all therapeutic agents can be administered by intravenous injection. The order in which the therapeutic agents are administered is not strictly critical. "Combination therapy" can also include administration of the above-mentioned therapeutic agents in further combination with other biologically active ingredients (such as, but not limited to, second and different therapeutic agents) and non-drug therapies (e.g., surgery).

[0299]

[0323] In another aspect of the invention, the genetically modified cells or nucleotides described herein The therapeutic agents administered in a combination therapy that includes the medicament composition can also include at least one anti-neurodegenerative agent, such as, but not limited to, an immunotherapeutic agent.

[0300]

[0324] Immunotherapeutic agents for use in the methods of the invention include those that target the immune component of the disease, and / or therapies targeting the acute inflammatory response manifested during acute attacks in remitting-relapsing myelin-related disorders such as multiple sclerosis. Examples include, but are not limited to, immunomodulatory agents such as interferon beta 1a and beta 1b (Avonex and Betaseron, respectively), netalizumab (Copaxone), netalizumab (Tysabri), glatiramer acetate (Copaxone), or mitoxantrone.

[0301]

[0325] The invention is further illustrated by the following examples, which are included within the scope of the claims. is not intended to be limiting. [Example]

[0302] Example 1 Nuclease-Mediated PLP1 Inactivation to Treat Inherited Myelin Disorders Introduction

[0326] Abnormal myelination leads to abnormal neuronal signaling and neurological dysfunction. Restoring myelination in these patients by correcting genetic defects within endogenous myelin-forming cells represents a promising avenue for cure, but the feasibility of this therapeutic approach remains to be demonstrated. We therefore chose to test this paradigm by focusing on a severe, prototypic leukodystrophy termed Pelizaeus-Merzbach disease (PMD).

[0303]

[0327] PMD is caused by mutations in proteolipid protein 1 (PLP1). PMD is a severe X-linked genetic disorder of myelin caused by a myelin-deficient individual. Patients with PMD typically experience severe neurological illness, including significant cognitive and motor deficits, and the disease is common in childhood. This disease inevitably leads to premature death during childhood or adolescence. Therefore, we sought to determine whether severe PMD patients could be treated through the introduction of nuclease-mediated insertions or deletions (indels) in the PLP1 gene or its regulatory elements (PLP1-indels), which effectively and permanently inactivates or reduces PLP1 expression. Nuclease-mediated indels can also be targeted to oligodendrocytes or their precursors, including neural stem cells or oligodendrocyte progenitor cells (OPCs). Targeting progenitor cells would provide a durable and self-amplifying therapy, as PLP1 indel progenitors would continue to generate functional PLP1 indel oligodendrocytes throughout the patient's lifetime. Given that many distinct and diverse PMD-causing mutations have already been identified in patients, our PLP1 indel approach is unique because it provides a universal approach applicable to all PMD patients.

[0304] jimpy mouse

[0328] To develop PLP1-indel therapeutics, the inventors developed a gene encoding a gene encoding a gene called jimpy. We utilized a mouse model of PMD that harbors a point mutation in the splice acceptor site of intron 4 of the PLP1 gene, leading to misfolded PLP1 and ultimately to oligodendrocyte loss, marked hypomyelination, severe tremor, ataxia, epilepsy, and early death by 3 weeks of age. Thus, the model effectively recapitulates many aspects of the severe PMD seen in human patients.

[0305]

[0329] The jimpy mouse represents the most severe model of PMD. 1 is a schematic diagram (not to scale) showing the location of the jimpy gene mutation in the PLP1 gene and the resulting gene product that ultimately causes oligodendrocyte death. The bottom of the figure shows the greatly reduced lifespan of jimpy mice, which have a median survival of only about 23 days.

[0306]

[0330] Figure 3 shows severe hypomyelination in the jimpy mouse brain. Wild-type vs. Note significantly less MBP staining in P19 (postnatal day 19) jimpy mouse brain sections compared to controls. Jimpy mice also exhibit intention tremor and ataxia at the same age (data not shown).

[0307] Guide RNA selection and validation

[0331] CRISPR-Cas9 is a gene encoding a single 22-bp guide protein containing the nuclease Cas9. This is an example of an efficient nuclease-mediated system for inducing indels in mammalian cells by introducing sgRNAs (sgRNAs). Appropriate sgRNAs were designed as described in Hsu et al. (2013) Nature Biotechnology 31, 827-832. Specifically, sgRNAs were selected for early exon targeting to maximize on-target and minimize off-target indel formation, while increasing the efficiency of nonsense-mediated decay. sgRNAs were validated for nuclease activity using Clontech's Guide-it sgRNA screening kit and for functional indel induction in mouse and human cells by electroporating plasmids expressing SaCas9 or SpCas9 and sgRNAs using the Thermofisher Neon transfection system. Cleavage efficiency and sgRNA ranking were determined by quantifying indel formation through deep sequencing using the Illumina MiSeq system. The top sgRNAs are detailed in Table 1.

[0308] Table 1: Top validated sgRNA sequences

[0309] [Table 1]

[0332] Figures 4 and 5 show the exon 1 gene expression patterns for generating CR-impy KO offspring mice. Figure 3 is a schematic diagram showing an exemplary approach to knockout the PLP1 gene in jimpy mouse zygotes through CRISPR SpCas9 / dual guide RNA (sgRNA) targeting of exon 3. Figure 4 shows the relative locations of sgRNA A and B targeting sites in exon 3. Figure 5 shows the general experimental approach to generate jimpy male zygotes to receive sgRNA and SpCas9 mRNA. Upon successful CRISPR / Cas9-mediated knockout of the jimpy PLP1 gene, PLP1-null male CR-impy founders are sired by surrogate host females. Parental Lineage Two generations of mating between the lines will generate offspring mice for further characterization.

[0310] SPCas9-mediated PLP1 deletion in animals

[0333] As the first proof-of-concept of our therapeutic PLP1 indel strategy, we Zygotes from the y breeder were electroporated with 200 ng / μl SpCas9 mRNA and 10 ng / μl each of sgRNAs A and B and then implanted into surrogate females (see Figure 5). This resulted in the generation of CRISPR-knockout jimpy (CR-impy [or crimpy]) male mice carrying an ~80-nucleotide deletion at the 5' end of exon 3 of PLP1. While jimpy males exhibited a severe phenotype and died by the third week of life, crimpy males were very different from jimpy males in that they showed no tremors, epilepsy, ataxia, or early death (data not shown). Remarkably, the crimpy males successfully mated and survived for more than 6 months before being sacrificed for histological analysis, which showed complete myelination of the central nervous system, indistinguishable from wild-type mice (see Figure 1). Transmission of the crimpy allele to healthy grandchildren confirms the dramatic therapeutic effect of our PLP1 indel treatment.

[0311]

[0334] Indeed, Figure 6 shows that CR-impy mice exhibited significantly higher levels of leukemia compared with jimpy and wild-type controls. and have restored lifespan (n>15 for each group, p<0.0001).

[0312]

[0335] Figure 7 shows that CR-impy mice matured using whole-brain IHC to detect MBP. This shows oligodendrocyte recovery. At postnatal day D19, both wild-type and CR-impy mice have significantly more MBP staining than jimpy mice. At 6 months of age, all jimpy mice have died, but the levels of MBP staining in wild-type and CR-impy mice are indistinguishable.

[0313]

[0336] Two additional functional tests were used to demonstrate motor coordination and Recovery of locomotor activity was assessed.

[0337] Figure 8. Rotarod test to assess motor coordination in CR-impy mice. A schematic diagram of the CR-impy mouse model is shown, in which motor coordination is quantified by measuring the time it takes to fall from a rotating bar as it accelerates. Measurements were performed on wild-type, jimpy, and CR-impy mice at postnatal ages P19, 2 months, and 6 months. Statistical significance between different values ​​is indicated by p-values. At P19, both wild-type and CR-impy mice had a statistically significantly longer time to fall compared with jimpy mice. At 2 and 6 months of age, all jimpy mice had died, but the levels of time to fall measured in wild-type and CR-impy mice were indistinguishable. This result demonstrates the recovery of motor coordination in CR-impy mice compared with wild-type and jimpy mice.

[0314]

[0338] Figure 9 shows an open-field method for assessing locomotor activity in CR-impy mice. A schematic diagram of the box test is shown, in which locomotor activity is quantified by measuring the total distance traveled in the box as tracked by automated video tracking for 5 minutes. Measurements were performed on wild-type, jimpy, and CR-impy mice at postnatal ages P19, 2 months, and 6 months. Statistical significance between different values ​​is indicated by p-values. At P19, both wild-type and CR-impy mice traveled a statistically significantly greater total distance compared to jimpy mice. At 2 and 6 months of age, all jimpy mice had died, but the levels of total distance traveled measured in wild-type and CR-impy mice were indistinguishable. The results demonstrate a recovery of locomotor activity in CR-impy mice compared to wild-type and jimpy mice.

[0315]

[0339] Further functional testing was performed based on measurements of conduction velocity after axonal stimulation. Figure 1 shows a schematic diagram of optic nerve conduction velocity testing and representative results of the faster and slower conduction peaks, the first and second peaks, respectively. Myelinated and large-diameter axons generally have faster conduction compared to unmyelinated and smaller-diameter axons. At postnatal day 19, both fast and slow conduction velocities, as measured by the first and second peaks, respectively, are statistically significantly different between wild-type, jimpy, and CR-impy mice. However, by 6 months of age, when all jimpy mice had died, the differences between wild-type and CR-impy mice, if any, are no longer statistically significant. This suggests that axonal conduction velocity accelerates in CR-impy mice, initially lagging behind that of wild-type mice but eventually catching up over the long term.

[0316]

[0340] Indeed, electron microscopy of wild-type and CR-impy mouse optic nerves at approximately 6 months of age (EM) imaging shows no discernible differences, see Figure 11.

[0341] CR-impy mice continue to exhibit functional outcomes similar to those of wild-type mice at 6 months. This suggests long-term functional stability of gene therapy-mediated correction.

[0317]

[0342] These results suggest that the introduction of an inactivating indel in PLP1 may be a potent anti-PMD agent in mice. We show that the model can be completely rescued. summary

[0343] The present disclosure provides methods for generating genetically modified cells and methods for treating human myelin disorders. In particular, the inventors have used nuclease-mediated gene disruption of the proteolipid protein 1 (PLP1) gene as a novel therapeutic approach for myelin-related disorders, which has proven effective in the setting of a leukodystrophy called Pelizaeus-Merzbach disease (PMD).

[0318]

[0344] Figure 12 shows that mutant OPCs can be at least partially corrected in the patient brain.

[0023] Figure 1 is a schematic diagram illustrating one embodiment of the invention in which CRISPR-Cas9-mediated gene silencing is delivered to the neonatal brain via, for example, an AAV viral vector encoding SaCas9 and sgRNA, which are capable of silencing OPCs. The corrected OPCs will, in time, outcompete any mutant OPCs, thereby providing fully restored myelination and function of patient neurons.

[0319]

[0345] Our strategy involves targeting the PLP1 gene, which enhances the ability to generate functional myelin. Through gene inactivation, PLP1-associated toxicity is bypassed. In some instances, neural stem cells, oligodendrocyte progenitor cells (OPCs), or other glial cells can be edited in situ in the patient's central nervous system. In other instances, cells can be modified ex vivo and then transplanted into the patient.

[0320]

[0346] More specifically, the present inventors have investigated the PLP1 gene or PLP1 gene regulatory element. We have demonstrated a novel therapeutic strategy that uses nuclease-mediated generation of indels in the gene to inactivate PLP1 translation or transcription, respectively. We have shown that nuclease-mediated editing of the PLP1 gene in vivo in rodents restores normal function and full lifespan to mice with a severe form of PMD. We have also shown that this disruption of PLP1 restores function to PMD model cells in vitro. As part of these proof-of-concept studies, we demonstrate the use of CRISPR-Cas9 nucleases with site-specific guide RNAs; however, this therapeutic strategy can involve any site-specific nuclease or gene editing technology.

[0321]

[0347] The development of therapeutic agents for patients with PMD and other leukodystrophies is expected to This is difficult due to the wide variety of DNA mutations that can occur. Herein, we provide a universal therapeutic agent for all PMD patients. This single method / product can be used in all PMD patients to effectively inactivate harmful mutant PLP1 genes. Furthermore, inactivation of the PLP1 gene may also be beneficial in other myelin disorders, as it reduces cellular stress in oligodendrocytes. Therefore, this therapeutic approach has considerable value, and there is strong pharmaceutical and economic interest in pursuing clinical PLP1 inactivation therapy.

[0322]

[0348] The methods described herein can be used in several ways and in a variety of ways well known in the art. It should be understood that the present invention can be practiced with various modifications and permutations. It should also be recognized that any theory presented regarding the mode of action should not be construed as limiting the present invention in any way, but is presented so as to provide a more complete understanding of the method of the present invention.

[0323]

[0349] All publications and patents mentioned in the above specification are hereby incorporated by reference. Example 2 Postnatal inactivation of PLP1 using AAV delivery of CRISPR / Cas9

[0350] This example demonstrates whether postnatal inactivation of PLP1 can be used to effectively treat PMD. It is also possible to reduce the severity of PMD.

[0324]

[0351] CRI containing sgRNA targeting the PLP1 locus in patients To facilitate delivery of the SPR / Cas9 system, we generated several CNS-targeting AAV serotypes, including PHP.B, and verified AAV tropism for OPCs. The AAV constructs (AAV9 or AAV-PHP.B) contained the SaCRISPR-Cas9 nuclease (CMV-SaCas9, the SaCas9 coding sequence under the control of the CMV promoter) and a site-specific guide RNA (sgRNA) for PLP1 (U6-sgRNA, the sgRNA is under the control of the U6 promoter), which targets the PLP1 gene. The PLP1 gene is designed to generate a nucleotide sequence that inhibits the expression of the defective PLP1 protein.

[0325]

[0352] Case Western Reserve University Facility Operation Mice were maintained according to approved protocols reviewed by the Animal Care and Use Committee. Mice were housed in temperature- and humidity-controlled enclosures under a 12-hour photoperiod and allowed free access to food.

[0326]

[0353] Next, Jimpy (a severe mouse model of Pelizaeus-Merzbach disease) Mice were treated via stereotactic intracerebroventricular injection of CRISPR-containing AAV or GFP-encoding control. Specifically, male postnatal day 0 pups were obtained from jimpy mating pairs and rapidly anesthetized using cryo-anesthesia.

[0327]

[0354] CMV-SaCas9 into a 10 μL Hamilton syringe with a 32-gauge needle The AAV (AAV9 or AAV-PHP.B) containing U6-sgRNA targeting PLP1 was loaded. The needle was lowered through the skull to a depth of approximately 2 mm at the 2 / 5 position, from the intersection of the sagittal and lambdoid sutures to the eye. 2 μL of the virus solution was injected into the lateral ventricle. Approximately 1 × 10 10 ~1x10 11 For total delivery of the vector genome, the injection was repeated in the contralateral lateral ventricle using the same coordinates and injection volume. The same procedure was also repeated for control mice.

[0328]

[0355] The pups were allowed to recover on a heating pad and then returned to their mothers. Pups were monitored daily for phenotypic improvement compared to untreated or vehicle-treated jimpy animals, which exhibited motor phenotypes (eg, intention tremors and seizures) and died by 3 weeks of age.

[0329]

[0356] Treated animals surviving beyond 3 weeks were analyzed for behavioral (e.g., motor performance) The results are analyzed using tarod and open field tests, see Example 1 and Figures 8 and 9), histology (immunostaining of the CNS for myelin proteins and electron microscopy for myelin ultrastructure, see Example 1 and Figures 7 and 11), or daily monitoring for lifespan extension statistical analysis (see Example 1 and Figure 6).

[0330]

[0357] Furthermore, the spatial requirements for the number of cells that need to be edited in the CNS ( Determine the "dose response" of gene-edited cells to generate functional responses by immunohistochemistry.

[0358] Finally, we introduced the optimized construct at postnatal days P1, P7, and P14. Therefore, we examine the temporal relationship.

[0331]

[0359] Optimizing CRISPR / Cas9 approaches within a defined therapeutic window , reducing the expression of mutant PLP1 protein, increasing the lifespan of treated individuals, and restoring axonal myelination.

[0332] Example 3 Postnatal knockdown of PLP1 using antisense oligonucleotides (ASOs)

[0360] This example demonstrates the postnatal downregulation or knockdown of PLP1 gene activity using ASOs. It is also possible to demonstrate that a dose-down regimen can be used to effectively treat or reduce the severity of PMD.

[0333]

[0361] Case Western Reserve University Facility Operation Mice are maintained according to an approved protocol reviewed by the Animal Care and Use Committee. Mice are housed in a temperature- and humidity-controlled vivarium under a 12-hour photoperiod. and allow free access to food.

[0334]

[0362] Male pups on postnatal day 0 were named Jimpy (a severe form of Pelizaeus-Merzbach disease). Mouse models (mice) were obtained from mating pairs and rapidly anesthetized using cryo-anesthesia. A 10 μL Hamilton syringe with a 32-gauge needle was loaded with antisense oligonucleotides targeting PLP1. The needle was lowered through the skull to a depth of approximately 2 mm at the 2 / 5 position, from the intersection of the sagittal and lambdoid sutures to the eye. 2 μL of ASO solution was injected into the lateral ventricle. The injection was then repeated in the contralateral lateral ventricle using the same coordinates and injection volume for a total delivery of approximately 10-75 μg of ASO to the ventricular system.

[0335]

[0363] Pups are allowed to recover on a heating pad and then returned to their mother. Pups are monitored daily for phenotypic improvement compared to untreated or vehicle-treated jimpy animals, which exhibit motor phenotypes (eg, intention tremors and seizures) and die by 3 weeks of age.

[0336]

[0364] Treated animals surviving beyond 3 weeks were analyzed for behavioral (e.g., motor performance) The results are analyzed using tarod and open field tests, see Example 1 and Figures 8 and 9), histology (immunostaining of the CNS for myelin proteins and electron microscopy for myelin ultrastructure, see Example 1 and Figures 7 and 11), or daily monitoring for lifespan extension statistical analysis (see Example 1 and Figure 6).

[0337] Example 4 Postnatal knockdown of PLP1 using RNAi

[0365] This example demonstrates postnatal downregulation or norovirus expression of PLP1 gene activity using RNAi. This demonstrates that a reduction in PMD can also be used to effectively treat or reduce the severity of PMD.

[0338]

[0366] Case Western Reserve University Facility Operation Mice are maintained according to approved protocols reviewed by the Animal Care and Use Committee. Mice are housed in temperature- and humidity-controlled vivariums under a 12-hour photoperiod and allowed free access to food.

[0339]

[0367] Male pups on postnatal day 0 were named Jimpy (a severe form of Pelizaeus-Merzbach disease). Mouse models (mice) are obtained from mating pairs and rapidly anesthetized using cryo-anesthesia. A 10 μL Hamilton syringe with a 32-gauge needle is loaded with AAV (AAV9 or AAV-PHP.B) containing a CMV-RNAi construct targeting PLP1 (an RNAi construct that can be transcribed intracellularly under the control of the CMV promoter to generate functional RNAi molecules, which can then be processed into siRNA / shRNA / miRNA targeting PLP1). Alternatively, the needle is loaded with a non-viral formulation of the PLP1-targeting RNAi construct using a non-viral siRNA carrier, such as a cell-penetrating peptide, polymer, dendrimer, siRNA bioconjugate, or lipid-based siRNA carrier. The needle is lowered through the skull to a depth of approximately 2 mm, at the 2 / 5 position, from the intersection of the sagittal and lambdoid sutures to the eye. 2 μL of the RNAi solution is injected into the lateral ventricle. The injection is then repeated in the contralateral lateral ventricle using the same coordinates and injection volume.

[0340]

[0368] Pups are allowed to recover on a heating pad and then returned to their mother. Pups are monitored daily for phenotypic improvement compared to untreated or vehicle-treated jimpy animals, which exhibit motor phenotypes (eg, intention tremors and seizures) and die by 3 weeks of age.

[0341]

[0369] Treated animals surviving beyond 3 weeks were analyzed for behavioral (e.g., motor performance) The results are analyzed using tarod and open field tests, see Example 1 and Figures 8 and 9), histology (immunostaining of the CNS for myelin proteins and electron microscopy for myelin ultrastructure, see Example 1 and Figures 7 and 11), or daily monitoring for lifespan extension statistical analysis (see Example 1 and Figure 6).

Claims

1. 1. A pharmaceutical composition for use in enhancing functional myelin production in cells of a subject having a myelin-related disorder, comprising: a gene silencing agent that specifically targets an endogenous PLP1 gene or its gene product, which is RNA, to reduce PLP1 expression levels in said cells; and a pharmaceutically acceptable carrier, wherein said endogenous PLP1 gene is a deleterious, disease-causing mutant PLP1 gene; wherein the cells produce functional myelin or are precursor cells that produce or differentiate into cells that produce functional myelin, and the cells are selected from neural stem cells (NSCs), oligodendrocyte progenitor cells (OPCs), or oligodendrocyte cells. The pharmaceutical composition.

2. 2. The pharmaceutical composition of claim 1, wherein the gene silencing agent comprises an antisense oligonucleotide (ASO).

3. 2. The pharmaceutical composition of claim 1, wherein the gene silencing agent comprises an RNAi construct.

4. The pharmaceutical composition of claim 3 , wherein the RNAi construct is selected from the group consisting of siRNA, shRNA, and miRNA.

5. 2. The pharmaceutical composition of claim 1, wherein the gene silencing agent comprises a delivery vehicle encoding an RNAi construct.

6. 6. The pharmaceutical composition of claim 5, wherein the delivery vehicle is an AAV vector, an adenoviral vector, or a lentiviral vector.

7. 2. The pharmaceutical composition of claim 1, wherein the gene silencing agent comprises a nuclease selected from the group consisting of zinc finger nucleases (ZFNs), TALE effectors (TALENs), CRISPR / Cas systems, and NgAgo systems.

8. 10. The pharmaceutical composition of claim 1, comprising a lipid-based carrier, polylactic-co-glycolic acid (PLGA) nanoparticles, a polyamine complexing agent, or a poloxamer.

9. 9. The pharmaceutical composition of claim 8, wherein the lipid-based carrier comprises a liposome, a micelle, a microemulsion, or a solid lipid nanoparticle.

10. 10. The pharmaceutical composition of claim 1, wherein the subject is a human.

11. 11. The pharmaceutical composition of claim 10, wherein the human is younger than 20 years old, 15 years old, 10 years old, 5 years old, 3 years old, 2 years old, 1 year old, 6 months old, 3 months old, 1 month old, 2 weeks old, 1 week old, 3 days old, or 1 day old.

12. 1. A pharmaceutical composition for use in enhancing functional myelin production in cells of a subject having a myelin-related disorder, comprising: a gene silencing RNAi construct that specifically targets an endogenous PLP1 gene or its RNA gene product to reduce PLP1 expression levels in said cells; and a pharmaceutically acceptable carrier, wherein said endogenous PLP1 gene is a deleterious disease-causing mutant PLP1 gene; wherein the cells produce functional myelin or are precursor cells that produce or differentiate into cells that produce functional myelin, and the cells are selected from neural stem cells (NSCs), oligodendrocyte progenitor cells (OPCs), or oligodendrocyte cells. The pharmaceutical composition.

13. 13. The pharmaceutical composition of claim 12, wherein the RNAi construct is selected from the group consisting of siRNA, shRNA, and miRNA.

14. 13. The pharmaceutical composition of claim 12, comprising a lipid-based carrier, polylactic-co-glycolic acid (PLGA) nanoparticles, a polyamine complexing agent, or a poloxamer.

15. 15. The pharmaceutical composition of claim 14, wherein the lipid-based carrier comprises a liposome, a micelle, a microemulsion, or a solid lipid nanoparticle.

16. 16. The pharmaceutical composition according to any one of claims 1 to 15, wherein the myelin-related disorder comprises Pelizaeus-Merzbach disease (PMD) or leukodystrophy, or is selected from the group consisting of multiple sclerosis (MS), neuromyelitis optica (NMO), transverse myelitis, chronic inflammatory demyelinating polyneuropathy, Guillain-Barré syndrome, progressive multifocal leukoencephalopathy (PML), encephalomyelitis pleuromyelitis (EPL), central pontine myelinolysis (CPM), adrenoleukodystrophy, Alexander disease, Pelizaeus-Merzbach disease (PMD), Wollberg's disease, and the like. the pharmaceutical composition is selected from Lehrer's degeneration, optic neuritis, amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, spinal cord injury, traumatic brain injury, injury after radiation exposure, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, AR, Bassen-Kornzweig syndrome, Marchiafava-Bignami syndrome, metachromatic leukodystrophy, trigeminal neuralgia, acute disseminated encephalitis, Marie-Charcot-Tooth disease, and Bell's palsy.

17. 17. The pharmaceutical composition of claim 16, wherein the myelin-related disorder comprises PMD, and wherein the pharmaceutical composition increases the longevity of the subject compared to the subject's longevity if untreated.

18. 16. The pharmaceutical composition of any one of claims 1 to 15, wherein the pharmaceutical composition alleviates at least one symptom in the subject associated with the myelin-related disorder.

Images