Elimination of CD19-positive lymphoid malignancies by NK cells expressing a CD19-CAR

Abstract

To provide compositions of NK-92(R) cells that express a CD19 CAR, CD16 and IL2, and methods of using these cells to treat cancer in a patient.SOLUTION: The present invention provides an NK-92 cell expressing a CD19 CAR and a Fc receptor, where the NK-92 cell comprises a multi-cistronic DNA construct, the multi-cistronic construct encodes the CD19 CAR and the Fc receptor, and the multi-cistronic transgene further comprises a sequence that encodes an IL-2 or a variant thereof or an IL-15 or a variant thereof.SELECTED DRAWING: Figure 5A

Description

[Technical Field]

[0001] This application claims priority to the inventors' co-pending U.S. Provisional Patent Application No. 62 / 753,719, filed October 31, 2018.

[0002] Sequence Listing The contents of the 38kb ASCII text file of the Sequence Listing entitled 104077.0008PCT Seq_ST25, created on July 15, 2019, have been submitted electronically via EFS-Web with the present application and are incorporated by reference in their entirety.

[0003] The field of this invention is genetically engineered cells for cancer therapy. [Background technology]

[0004] The Background Description contains information that may be useful in understanding the present invention. None of the information provided herein is admitted to be prior art or relevant to the presently claimed invention, nor is any publication specifically or implicitly referenced admitted to be prior art.

[0005] All publications and patent applications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. In the event that a definition or use of a term in an incorporated reference contradicts or contradicts the definition of that term provided herein, the definition of that term provided herein shall apply and the definition of that term in the reference shall not apply.

[0006] Natural killer (NK) cells are cytotoxic lymphocytes that constitute a major component of the innate immune system. They generally account for approximately 10–15% of circulating lymphocytes. They bind to and kill target cells, such as virus-infected cells and many malignant tumor cells, nonspecifically and without prior immune sensitization. (Herberman et al., Science 214:24 (1981)). Target cell killing occurs through the induction of cytolysis. NK cells used in autologous NK cell transplantation are isolated from the peripheral blood lymphocyte ("PBL") fraction of blood from a subject, expanded in cell culture to obtain sufficient numbers of cells, and then reinfused into the subject. Such autologous NK cells have shown some efficacy in in vivo therapy. However, such therapy is limited to autologous settings and further complicated by the fact that not all NK cells are cytolytic.

[0007] NK-92® is a cytolytic cancer cell line that was discovered in the blood of a subject with non-Hodgkin's lymphoma and subsequently immortalized in vitro. NK-92® cells are derived from NK cells but lack the major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors. However, NK-92® cells do not attack normal cells, nor do they induce unacceptable immune rejection responses in humans. Characterization of the NK-92® cell line is disclosed in WO 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK-92® cells are being evaluated as a therapeutic agent in the treatment of certain cancers. Summary of the Invention [Means for solving the problem]

[0008] In some embodiments, the present disclosure provides NK-92® cells expressing a CD19 CAR and an Fc receptor. In some embodiments, the NK-92® cells comprise a multicistronic construct encoding a CD19 CAR and an Fc receptor. In some embodiments, the Fc receptor is CD16. In some embodiments, the Fc receptor comprises SEQ ID NO: 2. In some embodiments, the multicistronic transgene further comprises a sequence encoding IL-2 or a variant thereof. In some embodiments, the IL-2 variant is erIL-2. In some embodiments, the coding sequence for one or more of the CD19 CAR, Fc receptor, or erIL-2 is codon-optimized for expression in a human system.

[0009] In some embodiments, NK-92® cells can kill CD19-expressing cells, e.g., tumor cells. In some embodiments, the tumor cells are SUP-B15 cells. In some embodiments, the CD19 CAR comprises an scFv antibody fragment. In some embodiments, the scFv antibody fragment has the amino acid sequence of SEQ ID NO: 10. In some embodiments, the multicistronic construct comprises the sequence of SEQ ID NO: 9, which encodes the scFv antibody fragment. In some embodiments, the NK-92® cells comprise a sequence encoding a self-cleaving peptide, which is located between the CD19 CAR and CD16, which sequence allows equimolar expression of the CD19 CAR and FcR. In some embodiments, the NK-92® cells comprise an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof.

[0010] In some embodiments, the direct cytotoxicity of NK-92® cells against CD19-expressing cells is 70-100% when the effector to target ratio is 10. In some embodiments, the ADCC activity of NK-92® cells is 30%-90% when the effector to target ratio is 10. In some embodiments, the CD19 CAR comprises a sequence that shares at least 90% identity with SEQ ID NO: 10.

[0011] In some embodiments, the present disclosure provides kits comprising pharmaceutical compositions comprising the NK-92® cells of the present disclosure.

[0012] In some embodiments, the present disclosure provides a method of generating NK-92® cells, the method comprising providing a vector encoding a CD19 CAR and CD16, and introducing the vector into NK-92® cells to generate NK-92® cells. In some embodiments, the vector further comprises a sequence encoding IL-2. In some embodiments, the vector comprises a sequence encoding a self-cleaving peptide, the sequence being located between the CAR and CD16, the sequence allowing equimolar expression of the CAR and CD16. In some embodiments, the vector comprises an internal ribosome entry sequence (IRES) between the CD16-encoding sequence and the IL-2-encoding sequence.

[0013] In some embodiments, the present disclosure provides a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition, wherein the composition comprises a plurality of NK-92® cells of any of claims 1 to 3. In some embodiments, the subject is treated with a therapeutically effective amount of NK-92® cells in a body surface area of ​​1 m. 2 Approximately 1 x 10 8 ~Approx. 1×10 11 The modified cells are administered to the subject.

[0014] In some embodiments, the cancer is leukemia or lymphoma.

[0015] In some embodiments, the cancer is one or more of B-cell malignancies, post-HSCT B-cell malignancies, CLL, B-ALL, acute lymphoblastic leukemia (ALL), post-UCBT B-lineage lymphoid malignancies, chronic lymphocytic leukemia (CLL), B-non-Hodgkin's lymphoma (B-NHL), post-HSCT ALL; lymphoma, refractory follicular lymphoma, or lymphoblastic leukemia. In some embodiments, the B-cell malignancy is mantle cell lymphoma. In some embodiments, the plurality of NK-92® cells are administered intravenously. In some embodiments, the plurality of NK-92® cells are administered intratumorally.

[0016] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the present disclosure. Other objects, advantages, and novel features will be readily apparent to those skilled in the art.

[0017] The objects, features and advantages will be more readily appreciated upon reference to the following disclosure when considered in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0018] [Figure 1] Schematic representation of the structural domains of first, second, and third generation CARs. [Figure 2] The components of the tricistronic plasmid containing the CAR coding sequence, the P2A sequence, the CD16 coding sequence, and the erIL-2 coding sequence are shown. [Figure 3A-B]

[0023] Figure 1 shows the results of flow cytometry analysis demonstrating the expression of CD16 and CD19-CAR on the surface of CD19 t-haNK™ cells. The peaks on the right side of each plot represent the population of cells expressing CD16 or CD19. [Figure 4A-B]Figure 4A shows the cytotoxic effect of CD19 t-haNK™ cells on K562 cells. 16B1 and 18B1 are two CD19 t-haNK™ populations obtained from two electroporation events performed on two different days. Figure 4B shows the cytotoxic effect of selected CD19 t-haNK™ clones on K562 cells in a cytotoxicity assay. [Figure 5A-B] Figure 5A shows the cytotoxic effect of CD19 t-haNK™ cells on SUP-B15 cells. 16B1 and 18B1 are two CD19 t-haNK™ populations obtained from two electroporation events performed on two different days. Figure 5B shows the cytotoxic effect of selected CD19 t-haNK™ clones on SUP-B15 cells in a cytotoxicity assay. [Figure 6A-B] Figure 6A shows the ADCC activity of CD19 t-haNK™ cells against SKBr3 cells in combination with Herceptin (anti-Her2 antibody). The anti-CD20 antibody Rituxan was used as a control. Figure 6B shows the ADCC activity of selected CD19 t-haNK™ clones against CD19KO / CD20+ SUP-B15 cells in combination with the anti-CD20 antibody rituximab. [Figure 7] The doubling times of selected CD19 t-haNK™ clones are shown. [Figure 8] IL-2 release from selected CD19 t-haNK™ clones in culture conditions is shown. [Figure 9] Figure 1 shows the survival curve of IV Raji tumor-bearing animals. Statistical analysis was performed by the log-rank (Mantel-Cox) test, ****, P<0.0001. [Figure 10] Figure 1 shows animal weight changes in the IV Raji tumor model. Data are mean ± SEM. SEM was calculated as the standard deviation divided by the square root of N. [Figure 11]Figure 1 shows tumor growth curves for the SC Raji model. Data are mean ± SEM. Statistical analysis was performed using two-way ANOVA followed by multiple comparisons with Tukey's test; ***, P<0.001; ****, P<0.0001. [Figure 12] Figure 1 shows that CD19 t-haNK™ reduced metastatic disease burden in the liver of SC Raji tumor-bearing mice. (a) Whole liver images of animals from the indicated treatment groups on day 13. Yellow arrows indicate metastatic lesions. Livers were fixed in 10% formalin for at least 24 hours before photography. (b) Quantification of the percentage of tumor cell spread in the liver (assessed by HE staining) on ​​the indicated days. Day 13: *, P=0.0257 by unpaired two-tailed t-test. Statistical analysis for days 11 and 15 could not be performed due to limited sample size. See Table 4 for raw data. [Figure 13] Figure 1 shows animal weight changes in the SC Raji tumor model. Data are mean ± SEM. DETAILED DESCRIPTION OF THE INVENTION

[0019] overview The present disclosure provides NK-92® cells that express a CD19 CAR and an Fc receptor. In some embodiments, the cells further express IL-2. In some embodiments, the NK-92® cells comprise a tricistronic construct comprising nucleic acid sequences encoding the CD19 CAR and Fc, and IL2.

[0020] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0021] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings.

[0022] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly indicates otherwise. Thus, for example, reference to "natural killer cells" includes a plurality of natural killer cells.

[0023] All numerical designations, e.g., pH, temperature, time, concentration, amount, and molecular weight, including ranges, are approximations which vary (+) or (-) by increments of 0.1 or 1.0, as appropriate. It is to be understood, although not always explicitly stated, that all numerical designations may be preceded by the term "about."

[0024] As used herein, "+", when used to indicate the presence of a particular cell marker, means that the cell marker is detectably present relative to an isotype control in fluorescence-activated cell sorting; or is detectable above background in quantitative or semi-quantitative RT-PCR.

[0025] As used herein, "-", when used to indicate the presence of a particular cell marker, means that the cell marker is not detectably present against an isotype control in fluorescence-activated cell sorting; or is not detectable above background in quantitative or semi-quantitative RT-PCR.

[0026] As will be understood by those skilled in the art, for any and all purposes, particularly with respect to the provision of a written description, all ranges disclosed herein encompass any and all possible subranges and combinations thereof. Any recited range can be readily recognized as fully descriptive and allows for the same range to be divided into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range disclosed herein can be readily divided into a lower third, middle third, and upper third, etc. As will also be understood by those skilled in the art, all language, e.g., "up to," "at least," "greater than," "less than," etc., is inclusive of the recited number and refers to a range that can be subsequently divided into the subranges listed above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1 to 3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells refers to a group having 1, 2, 3, 4, or 5 cells, and so on.

[0027] As used herein, the term "substantially identical" is used interchangeably with the terms "equivalent" or "substantially similar," and when referring to a quantifiable characteristic of NK-92® cells, such as cytotoxicity, viability, or cell doubling time, means that two measurements of that characteristic differ from each other by no more than 15%, no more than 10%, no more than 8%, or no more than 5%.

[0028] It is also to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

[0029] For purposes of the present invention, and unless otherwise indicated, the term "NK-92®™" shall refer to the original NK-92® cell line as well as NK-92® cell lines, clones of NK-92® cells, and NK-92® cells that have been modified (e.g., by the introduction of an exogenous gene). NK-92® cells and exemplary and non-limiting modifications thereof are described in U.S. Pat. Nos. 7,618,817; 8,034,332; 8,313,943; 9,181,322; 9,150,636; and U.S. Patent Application Publication No. 10 / 008,955, all of which are incorporated herein by reference in their entireties, and include wild-type NK-92®, NK-92®-CD16, NK-92®-CD16-γ, NK-92®-CD16-ζ, NK-92®-CD16(F176V), NK-92® MI, and NK-92® CI. NK-92® cells are known to those of skill in the art, and such cells are readily available from NantKwest®, Inc.

[0030] As used herein, the term "NK-92® cells" refers to natural killer cells derived from a highly potent, unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8 (1994)), the rights of which are owned by NantKwest® (hereinafter "NK-92® cells").

[0031] As used herein, the term "aNK cells" refers to unmodified natural killer cells derived from a highly potent, unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights of which are owned by NantKwest® (hereinafter "aNK cells").

[0032] As used herein, the term "haNK cells" refers to natural killer cells derived from a highly potent, unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8 (1994)), the rights of which are owned by NantKwest®, that have been modified to express CD16 on the cell surface (hereinafter "CD16+NK-92® cells" or "haNK cells").

[0033] As used herein, the term "taNK cells®" refers to natural killer cells derived from a highly potent, unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8 (1994)), the rights of which are owned by NantKwest®, that have been modified to express a chimeric antigen receptor (hereinafter "CAR-modified NK-92® cells" or "taNK cells®").

[0034] As used herein, the term "t-haNK™" cells refers to natural killer cells derived from a highly potent, unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8 (1994)), which are carried by NantkWest® and have been modified to express CD16 on the cell surface and to express a chimeric antigen receptor (hereinafter "CAR-modified CD16+ NK-92® cells" or "t-haNK™ cells"). In some embodiments, the tumor-specific antigen is CD19, and these NK-92® cells are referred to as CD-19 t-haNK™ cells.

[0035] As used herein, the term "multicistronic construct" refers to a recombinant DNA construct that can be transcribed into a single mRNA molecule, and the single mRNA molecule encodes two or more transgenes. If the multicistronic construct encodes two transgenes, it is called a bicistronic construct; if it encodes three genes, it is called a tricistronic construct; if it encodes four genes, it is called a quadrocistronic construct, and so on.

[0036] The term "chimeric antigen receptor" (CAR) as used herein refers to an extracellular antigen-binding domain fused to an intracellular signaling domain. CARs can be expressed in T cells or NK cells to increase cytotoxicity. Generally, the extracellular antigen-binding domain is an scFv specific for an antigen found on the target cell. CAR-expressing NK-92® cells are targeted to cells expressing a certain antigen on their cell surface based on the specificity of the scFv domain. The scFv domain can be engineered to recognize any antigen, including tumor-specific and virus-specific antigens. For example, CD19 CAR recognizes CD19, a cell surface marker expressed by some cancers.

[0037] As used herein, the term "tumor-specific antigen" refers to an antigen that is present on cancer or neoplastic cells but is not detectable on normal cells derived from the same tissue or lineage as the cancer cells. As used herein, tumor-specific antigen also refers to tumor-associated antigens, i.e., antigens that are expressed at higher levels on cancer cells compared to normal cells derived from the same tissue or lineage as the cancer cells.

[0038] As used herein, the term "target," when referring to tumor targeting, refers to the ability of NK-92® cells to recognize and kill tumor cells (i.e., target cells). The term "targeted" in this context refers to the ability of a CAR expressed by an NK-92® cell to recognize and bind to a cell surface antigen expressed, for example, by a tumor.

[0039] The term "antibody" refers to an intact immunoglobulin of any isotype, or a fragment thereof that can compete with the intact antibody for specific binding to a target antigen, including chimeric, humanized, fully human, and bispecific antibodies. An intact antibody generally contains at least two full-length heavy chains and two full-length light chains, although in some cases it may contain fewer chains; for example, antibodies naturally occurring in camels may contain only heavy chains. An antibody may be derived entirely from a single source or may be "chimeric," such that different portions of the antibody are derived from two different antibodies. Antigen-binding proteins, antibodies, or binding fragments can be produced by recombinant DNA techniques in hybridomas or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise indicated, the term "antibody" includes antibodies containing two full-length heavy chains and two full-length light chains, as well as derivatives, variants, fragments, and muteins thereof. Additionally, unless expressly excluded, antibodies include monoclonal antibodies, bispecific antibodies, minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), and fragments thereof. In some embodiments, the term also includes peptibodies.

[0040] The term "subject" refers to non-human animals, e.g., mammals, such as cats, dogs, cows, horses, pigs, sheep, and goats, as well as humans. The term subject also refers to a patient in need of treatment for a disease described herein.

[0041] "Optionally" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances in which the event or circumstance occurs and instances in which it does not occur.

[0042] The term "comprising" shall mean that the compositions and methods include the recited elements, but do not exclude other elements. "Consisting essentially of," when used to define compositions and methods, shall mean excluding other elements of any essential importance to the combination. For example, a composition consisting essentially of the elements defined herein does not exclude other elements that do not materially affect the basic and novel characteristics of the claim. "Consisting of" shall mean excluding more than trace amounts of other components and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0043] As used herein, the terms "cytotoxic" and "cytolytic" are intended to be synonymous when used to describe the activity of effector cells, eg, NK cells. Generally, cytotoxic activity involves killing of target cells by any of a variety of biological, biochemical, or biophysical mechanisms. Cytolysis more specifically refers to the activity of an effector to lyse the plasma membrane of a target cell, thereby disrupting its physical integrity. This results in killing of the target cell. Without wishing to be bound by theory, it is believed that the cytotoxic effect of NK cells is due to cytolysis.

[0044] The term "killing" in relation to a cell / cell population is intended to include any type of manipulation that results in the death of that cell / cell population.

[0045] The term "cytokine" refers to a general class of biological molecules that affect cells of the immune system. Exemplary cytokines include, but are not limited to, FLT3 ligand, interferons, and interleukins (ILs), particularly IL-2, IL-12, IL-15, IL-18, and IL-21.

[0046] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal, or cells thereof, whether in vitro or in situ, suitable for the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0047] The term "treating" or "treatment" encompasses the treatment of a disease or disorder described herein in a subject, e.g., a human, and includes (i) inhibiting the disease or disorder, i.e., halting its development; (ii) alleviating the disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. The term "administering" a monoclonal antibody or natural killer cells to a subject or their "administration" to a subject includes any route of introducing or delivering the antibody or cells to perform its intended function. Administration can be by any route suitable for delivering cells or monoclonal antibodies. Thus, delivery routes can include intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, modified NK-92® cells are administered directly to a tumor, e.g., by injection into the tumor. In some embodiments, the modified NK-92® cells described herein are administered parenterally, for example, by injection, infusion, or implantation (subcutaneously, intravenously, intramuscularly, intravesicularly, intratumorally, or intraperitoneally).

[0048] The term "expression" refers to the production of a gene product.

[0049] As used herein, the term "cytotoxicity," when used to describe the activity of effector cells, e.g., NK cells, relates to the killing of target cells by any of a variety of biological, biochemical, or biophysical mechanisms.

[0050] The terms "reduce," "reduced," "reduction," and "decrease" are all used herein to refer to a decrease by at least 10% compared to a reference level, for example, a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% decrease (i.e., an absent level compared to a reference sample), or any decrease from 10 to 100% compared to a reference level.

[0051] The term "cancer" refers to all types of cancer, neoplasm, or malignant tumor found in mammals, including leukemia, carcinoma, and sarcoma. Exemplary cancers include cancer of the brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus, and medulloblastoma. Additional examples include Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, carcinoma, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, neoplasms of the endocrine and exocrine pancreas, and prostate cancer.

[0052] The term "therapeutically effective amount" or "effective amount" refers to the amount required to improve the symptoms of a disease relative to an untreated patient. The effective amount of active compound used to practice the present disclosure for the therapeutic treatment of a disease will vary depending on the mode of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. Such an amount is referred to as an "effective" amount.

[0053] Headings or subheadings may be used herein for the convenience of the reader and do not affect the scope of the disclosure. Additionally, some terms used herein are more specifically defined below.

[0054] NK-92® cells NK-92® is a cytolytic cancer cell line that was discovered in the blood of a subject with non-Hodgkin's lymphoma and subsequently immortalized in vitro. NK-92® cells are derived from NK cells but lack the major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors. However, NK-92® cells do not attack normal cells, nor do they induce unacceptable immune rejection responses in humans. Characterization of the NK-92® cell line is disclosed in WO 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK-92® cells are being evaluated as a therapeutic agent in the treatment of certain cancers.

[0055] vector Described herein are vectors for transfecting cells to produce the modified cells described herein. In one embodiment, the vectors described herein are transient expression vectors. The exogenous transgenes introduced using such vectors are not integrated into the nuclear genome of the cell; therefore, in the absence of vector replication, the exogenous transgenes are degraded or diluted over time.

[0056] In one embodiment, the vectors described herein allow for stable transfection of cells. In one embodiment, the vectors allow for integration of a transgene into the genome of a cell. In one embodiment, the vectors have a positive selection marker. Positive selection markers include any gene that allows cells to grow under conditions that would kill cells that do not express the gene. Non-limiting examples include antibiotic resistance, such as geneticin (Neo gene from Tn5).

[0057] In one embodiment, the vector is a plasmid vector. In one embodiment, the vector is a viral vector. As will be appreciated by those skilled in the art, any suitable vector can be used. Suitable vectors are well known in the art.

[0058] In some embodiments, cells are transfected with mRNA encoding a protein of interest (e.g., a CAR). Transfection of the mRNA results in transient expression of the protein. In one embodiment, transfection of the mRNA into NK-92® cells is performed immediately prior to administration of the cells. In one embodiment, "immediately prior to" administration of the cells refers to about 15 minutes to about 48 hours prior to administration. Preferably, mRNA transfection is performed about 5 hours to about 24 hours prior to administration.

[0059] CD19 CD19 is a transmembrane glycoprotein that belongs to the immunoglobulin superfamily. It has a single transmembrane domain, a cytoplasmic C-terminus, and an extracellular N-terminus. CD19 is a biomarker for normal and neoplastic B cells and follicular dendritic cells and is critically involved in establishing the endogenous B cell signaling threshold through modulation of both B cell receptor-dependent and -independent signaling.

[0060] CD19 is expressed in most acute lymphoblastic leukemias (ALL), chronic lymphocytic leukemias (CLL), and B-cell lymphomas. The majority of B-cell malignancies express normal to high levels of CD19 (80% of ALL, 88% of B-cell lymphomas, and 100% of B-cell leukemias). Although CD19 is a hallmark of B cells, it has also been observed in cases of myeloid malignancies, e.g., 2% of AML cases. Wang et al., Exp. Hematol. Oncol. Nov. 29, 2012;1:36. Non-limiting examples of malignancies associated with CD19 are listed in Table 1.

[0061] [Table 1]

[0062] CAR Phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are often associated with one or more changes in the expression of specific gene products, such as the loss of normal cell surface components or the acquisition of other cell surface components (i.e., antigens not detectable in the corresponding normal, non-cancerous tissue). Antigens expressed in neoplastic or tumor cells but not in normal cells, or antigens expressed in neoplastic cells at levels substantially higher than those found in normal cells, are referred to as "tumor-specific antigens" or "tumor-associated antigens." Tumor-specific antigens have been used as targets for cancer immunotherapy. One such therapy utilizes chimeric antigen receptors (CARs) expressed on the surface of immune cells, such as T cells and NK cells, to improve cytotoxicity against cancer cells. CARs comprise a single-chain variable fragment (scFv) linked to at least one intracellular signaling domain. The scFv recognizes and binds to antigens on target cells (e.g., cancer cells) and triggers effector cell activation. The signaling domain contains an immunoreceptor tyrosine-based activation domain (ITAM) that is important for intracellular signaling by the receptor.

[0063] The present disclosure provides NK-92® cells that are genetically engineered to express at least a chimeric antigen receptor (CAR) on the cell surface. CARs combine an extracellular antigen recognition moiety (usually derived from the variable domain of a specific antibody) with an intracellular signaling domain (single or with additional costimulatory elements) that can trigger a cytolytic response upon recognition of a specific antigen. Several types of CARs exist, all of which can be used in the present application. First generation CARs contain one cytoplasmic signaling domain. The signaling domain can be derived, for example, from Fc epsilon receptor gamma (FcεRIγ), which contains one ITAM, or from CD3ζ, which contains three ITAMs. CD3ζ CARs are thought to be more efficient at tumor eradication than FcεRIγ CARs. See, e.g., Haynes, et al. 2001, J. Immunology 166:182-187; Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID See, e.g., 956304. Second and third generation CARs combine multiple signaling domains, e.g., the cytoplasmic signaling domain of CD3ζ and costimulatory signaling domains, e.g., CD28 / CD134 / CD137 / ICOS and CD28 / CD134, in a single CAR to promote activation and proliferation of NK-92® cells. Thus, in some embodiments, the CD19 CAR expressed by CD19 t-haNK™ cells comprises the hinge region from CD8 and / or the transmembrane domain of CD28. In some embodiments, the CD19 CAR comprises a cytoplasmic signaling domain of FcεRIγ. In some embodiments, the CD19 CAR comprises a cytoplasmic signaling domain of CD3ζ. Examples of hinge regions, transmembrane domains of CD28, and cytoplasmic signaling domains of FcεRIγ or CD3ζ are disclosed in U.S. Provisional Patent Application No. 62 / 674,936, the entire contents of which are incorporated herein by reference.

[0064] While previous publications, e.g., Haynes, et al. 2001, J. Immunology 166:182-187 and Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304, have disclosed that CD3ζ CARs can be more effective than FcεRIγ CARs in tumor eradication, the present inventors have surprisingly and unexpectedly found that this is not the case with the cells, compositions, and methods disclosed herein. Indeed, the inventors have found that when the NK-92® cells disclosed herein have an FcεRIγ CAR domain, they are as effective, or in some embodiments, even more effective, than when they have a CD3ζ CAR.

[0065] Optionally, the CAR is specific for CD19. In some embodiments, the CD19 is human CD19. In some embodiments, the CD19 CAR comprises an scFv fragment comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the CD19 CAR comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CD19 t-haNK™ cells comprise the nucleic acid sequence of SEQ ID NO: 9, which encodes SEQ ID NO: 10. In some embodiments, the CD19 t-haNK™ cells comprise the nucleic acid sequence of SEQ ID NO: 11, which encodes SEQ ID NO: 12. In some embodiments, the CD19 t-haNK™ cells comprise the tricistronic construct of SEQ ID NO: 13.

[0066] In some embodiments, the CD19 CAR polypeptide comprises a sequence sharing at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to SEQ ID NO: 10. In some embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the polypeptide to assist cell surface detection by use of an anti-epitope tag peptide monoclonal or polyclonal antibody.

[0067] In examples, variant polypeptides are generated using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985), or other known techniques are performed on cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0068] In some embodiments, the polynucleotide encoding a CD19 CAR is mutated to change the amino acid sequence encoding the CAR without altering the function of the CAR. For example, polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues can be made in SEQ ID NO:9 or SEQ ID NO:11.

[0069] Conservative substitutions in SEQ ID NO: 10 or 12, which replace one class of amino acid with another amino acid of the same class, fall within the scope of the disclosed variants, so long as the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those of skill in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., β-sheet or α-helical conformation, (2) charge, (3) hydrophobicity, or (4) the bulkiness of the side chains at the target site may alter polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of a member of one of these classes for another class. Substitutions can be introduced into conservative substitution sites or, more preferably, non-conserved sites.

[0070] In examples, variant polypeptides are produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985), or other known techniques can be performed on cloned DNA to produce variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0071] Optionally, CD19 t-haNK Cells™ can be used to treat cancer, particularly cancers that express CD19. Optionally, the cancer is a type of cancer, including, but not limited to, leukemia (e.g., acute leukemia (e.g., acute lymphocytic leukemia, acute myeloid leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemia (e.g., chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, solid tumors, including, but not limited to, sarcomas and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial cell carcinoma, lymphangioma, and leukemia. The cancer is selected from the group consisting of sarcoma, lymphangioendothelial sarcoma, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver cancer, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0072] Fc receptors In some embodiments, NK-92® cells are engineered to express at least one Fc receptor such that at least one Fc receptor is displayed on the cell surface of the NK-92® cells. Fc receptors bind to the Fc portion of an antibody. Several Fc receptors are known and vary in their preferred ligand, affinity, expression, and effect upon binding to an antibody.

[0073] [Table 2]

[0074] [Table 3]

[0075] In some embodiments, the NK-92® cells are modified to express Fc receptor proteins on the cell surface.

[0076] In some embodiments, the Fc receptor is CD16. For purposes of this disclosure, specific amino acid residues of CD16 are designated with reference to SEQ ID NO:2, or SEQ ID NO:1, which differs at one position from SEQ ID NO:1. Thus, an amino acid residue "at position 158" of a CD16 polypeptide is the amino acid residue corresponding to position 158 of SEQ ID NO:2 (or SEQ ID NO:1) when the CD16 polypeptide and SEQ ID NO:2 are maximally aligned. In some embodiments, NK-92® cells have been engineered to express the mature form of the protein, e.g., human CD16 having a phenylalanine at position 158 of SEQ ID NO:1. In an exemplary embodiment, NK-92® cells have been engineered to express the mature form of the protein, e.g., the high-affinity form of human CD16 having a valine at position 158 of SEQ ID NO:2. Position 158 of the mature protein corresponds to position 176 of the CD16 sequence, including the native signal peptide. In some embodiments, a CD16 polypeptide is encoded by a polynucleotide that encodes the precursor (i.e., having the native signal peptide) polypeptide sequence of SEQ ID NO:3 or SEQ ID NO:4. Thus, in one embodiment, the Fc receptor comprises FcγRIII-A (CD16). In some embodiments, NK-92® cells are genetically modified to express an Fc receptor-encoding polypeptide having at least 90% sequence identity to SEQ ID NO: 1 (FcγRIII-A or CD16 with a phenylalanine at position 158 (F-158); or SEQ ID NO: 2 (CD16 with a valine at position 158 (F158V), a higher affinity form).

[0077] In some embodiments, a polynucleotide encoding a CD16 polypeptide has at least about 70% polynucleotide sequence identity to a polynucleotide sequence encoding a full-length naturally occurring CD16 including a signal peptide with a phenylalanine at position 176 of full-length CD16 (corresponding to position 158 of the mature CD16 protein). In some embodiments, a polynucleotide encoding a CD16 polypeptide has at least about 70% polynucleotide sequence identity to a polynucleotide sequence encoding a full-length naturally occurring CD16 including a signal peptide with a valine at position 176 (corresponding to position 158 of the mature protein). In some embodiments, a polynucleotide encoding CD16 has at least 70%, 80%, 90%, or 95% identity to SEQ ID NO: 13 and includes a codon encoding a valine at position 176 of the full-length CD16 polypeptide including the signal peptide. In some embodiments, a polynucleotide encoding CD16 includes SEQ ID NO: 13 but includes a codon encoding a valine at position 176 of full-length CD16.

[0078] In some embodiments, the CD16 polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity to SEQ ID NO: 2 and includes a valine at position 158 as determined with reference to SEQ ID NO: 2. In some embodiments, the polynucleotide encodes SEQ ID NO: 2. In some embodiments, the CD16 polynucleotide encodes the extracellular domain of CD16, with or without a signal sequence, or any other fragment of full-length CD16, or a chimeric receptor comprising at least a subsequence of CD16 fused to the amino acid sequence of another protein. In other embodiments, an epitope tag peptide, e.g., FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the mature polypeptide to assist cell surface detection by use of anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0079] In some embodiments, homologous CD16 polynucleotides can be from about 150 to about 700, about 750, or about 800 polynucleotides in length, although CD16 variants having more than 700 to 800 polynucleotides are within the scope of the present disclosure.

[0080] Homologous polynucleotide sequences include those that encode polypeptide sequences that encode variants of CD16. Homologous polynucleotide sequences also include naturally occurring allelic variations with respect to SEQ ID NO:1. Transfection of NK-92® cells with any polynucleotide that encodes a polypeptide having the amino acid sequence set forth in either SEQ ID NO:1 or SEQ ID NO:2, a naturally occurring variant thereof, or a sequence that is at least 70% identical, or at least 80%, 90%, or 95% identical to SEQ ID NO:1 or SEQ ID NO:2 is within the scope of this disclosure. In some embodiments, homologous polynucleotide sequences encode conservative amino acid substitutions in SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, NK-92® cells are transfected using a degenerate homologous CD16 polynucleotide sequence that differs from the native polynucleotide sequence but encodes the same polypeptide.

[0081] In another example, NK-92® cells are modified using a cDNA sequence having a polymorphism that alters the CD16 amino acid sequence, such as an allelic variation between individuals that represents a genetic polymorphism in the CD16 gene. In another example, CD16 genes from other species having a polynucleotide sequence that differs from the sequence of SEQ ID NO: 1 are used to modify NK-92® cells.

[0082] Variant polypeptides can be made using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restriction-selection mutagenesis (Wells et al., 1985), or other known techniques can be performed on cloned DNA to produce CD16 variants (Ausubel, 2002; Sambrook and Russell, 2001).

[0083] In some embodiments, polynucleotides encoding CD16 are mutated to alter the amino acid sequence encoding CD16 without altering the function of CD16. For example, polynucleotide substitutions can be made in SEQ ID NO: 1 or SEQ ID NO: 2, resulting in amino acid substitutions at, for example, "non-essential" amino acid residues.

[0084] Conservative substitutions in SEQ ID NO:1 or SEQ ID NO:2 that replace one class of amino acid with another amino acid of the same class fall within the scope of the disclosed CD16 variants, so long as the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., β-sheet or α-helical conformation, (2) charge, (3) hydrophobicity, or (4) the bulkiness of the side chains at the target site may alter CD16 polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of a member of one of these classes for another class. Substitutions can be introduced into conservative substitution sites or, more preferably, non-conserved sites.

[0085] In some embodiments, the CD16 polypeptide variant is at least 200 amino acids in length and has at least 70% amino acid sequence identity, or at least 80%, or at least 90% identity, to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the CD16 polypeptide variant is at least 225 amino acids in length and has at least 70% amino acid sequence identity, or at least 80%, or at least 90% identity, to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the CD16 polypeptide variant has a valine at position 158 as determined with reference to SEQ ID NO: 2.

[0086] In some embodiments, a nucleic acid encoding a CD16 polypeptide may encode a CD16 fusion protein. CD16 fusion polypeptides include any portion of CD16 fused to a non-CD16 polypeptide, or the entire CD16. Fusion polypeptides are conveniently produced using recombinant methods. For example, a polynucleotide encoding a CD16 polypeptide, such as SEQ ID NO: 1 or SEQ ID NO: 2, is fused in frame with a non-CD16-encoding polynucleotide (e.g., a polynucleotide sequence encoding a signal peptide of a heterologous protein). In some embodiments, fusion polypeptides can be produced in which the heterologous polypeptide sequence is fused to the C-terminus of CD16 or located internally within CD16. Typically, up to about 30% of the CD16 cytoplasmic domain can be replaced. Such modifications can improve expression or cytotoxicity (e.g., ADCC responsiveness). In other examples, chimeric proteins, such as domains from other lymphocyte activation receptors, including but not limited to, Ig-a, Ig-B, CD3-e, CD3-d, DAP-12, and DAP-10, replace a portion of the CD16 cytoplasmic domain.

[0087] Fusion genes can be synthesized by conventional techniques, such as PCR amplification using an automated DNA synthesizer and anchor primers that generate complementary overhangs between two consecutive gene fragments that can then be annealed and reamplified to generate a chimeric gene sequence (Ausubel, 2002). Many vectors are commercially available that facilitate subcloning of CD16 in frame with the fusion moiety.

[0088] cytokines The cytotoxicity of NK-92® cells is dependent on the presence of cytokines, such as interleukin-2 (IL-2). The cost of using exogenously added IL-2, which is required to maintain and expand NK-92 cells in commercial-scale cultures, is significant. Administration of IL-2 to human subjects in amounts sufficient to sustain the activation of NK92® cells causes adverse side effects.

[0089] In one embodiment, the NK-92® cells are modified to express at least one cytokine. In particular, the at least one cytokine is IL-2 (SEQ ID NO: 6), IL-12, IL-15, IL-18, IL-21, or a variant thereof. In some embodiments, the cytokine is IL-2, IL-15, or a variant thereof. In certain embodiments, the IL-2 is a variant that is targeted to the endoplasmic reticulum, and the IL-15 is a variant that is targeted to the endoplasmic reticulum.

[0090] In one embodiment, IL-2 is cloned and expressed with a signal sequence that targets IL-2 to the endoplasmic reticulum (erIL-2) (SEQ ID NO: 7). This allows IL-2 to be expressed at levels sufficient for autocrine activation without releasing IL-2 extracellularly. Konstantinidis et al., "Targeting IL-2 to the endoplasmic reticulum confines autocrine growth stimulation to NK-92." (R) cells,” Exp Hematol. 2005 Feb;33(2):159-64 The continued activation of FcR-expressing NK-92® cells can be prevented, for example, by the presence of a suicide gene.

[0091] Suicide gene The term "suicide gene" refers to a transgene that allows for negative selection of cells expressing the suicide gene. Suicide genes are used as a safety system that allows cells expressing the gene to be killed by introducing a selection agent. This is desirable when the recombinant gene causes mutations that lead to uncontrolled cell growth or when the cells themselves are capable of such growth. Numerous suicide gene systems have been identified, including the herpes simplex virus thymidine kinase (TK) gene, cytosine deaminase gene, varicella-zoster virus thymidine kinase gene, nitroreductase gene, Escherichia coli gpt gene, and E. coli Deo gene. Typically, suicide genes encode proteins that have no adverse effects on cells but kill them in the presence of a defined compound. Thus, suicide genes are typically part of a system.

[0092] In one embodiment, the suicide gene is active in NK-92® cells. In one embodiment, the suicide gene is a thymidine kinase (TK) gene. The TK gene can be a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Cells expressing the TK protein can be killed using ganciclovir.

[0093] In another embodiment, the suicide gene is cytosine deaminase, which is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al. "Cytosine deaminase adenoviral vector and 5-fluorocytosine selectively reduce breast cancer cells 1 million-fold when they contaminate hematopoietic cells: a potential purging method for autologous transplantation." Blood. 1998 Jul 15;92(2):672-82.

[0094] In another embodiment, the suicide gene is a cytochrome P450 that is toxic in the presence of ifosfamide or cyclophosphamide. See, e.g., Touati et al. "A suicide gene therapy combining the improvement of cyclophosphamide tumor cytotoxicity and the development of an anti-tumor immune response." Curr Gene Ther. 2014;14(3):236-46.

[0095] In another embodiment, the suicide gene is iCasp9. Di Stasi, (2011) "Inducible apoptosis as a safety switch for adoptive cell therapy." N Engl J Med 365:1673-1683. See also Morgan, "Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic" Molecular Therapy (2012); 20:11-13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inactive small molecule that has been shown to be well tolerated in clinical trials and has been used in adoptive cell therapy settings.

[0096] Codon optimization In some embodiments, the sequence of the construct used to transduce aNK cells is codon-optimized to maximize the expression efficiency of CD19 CAR, CD16, and / or erIL-2 in a human system. Codon optimization is typically performed by modifying a nucleic acid sequence by replacing at least one, two or more, or a significant number of, the codons of the native sequence with codons that are more frequently or most frequently used in the genes of the expression system. Codon optimization can be used to improve translation rate or to produce recombinant RNA transcripts with desired properties, such as a longer half-life compared to transcripts produced using non-optimized sequences. Methods for codon optimization are readily available, such as GeneArt™ from Thermo Fisher Scientific (Waltham, MA); Optimizer, freely accessible at http: / / genomes.urv.es / OPTIMIZER; and GeneGPS Expression Optimization Technology from DNA 2.0 (Newark, California). In a specific embodiment, the coding sequence of the CD19 CAR is codon-optimized and comprises the sequence set forth in SEQ ID NO:9.

[0097] Transgene expression The transgene can be engineered into the expression vector by any mechanism known to those of skill in the art. If multiple transgenes are to be inserted into a cell, the transgenes can be engineered into the same expression vector or into different expression vectors.

[0098] In some embodiments, cells are transfected with mRNA encoding the transgenic protein to be expressed.

[0099] Transgenes and mRNA can be introduced into NK-92® cells using any transfection method known in the art, including, but not limited to, infection, electroporation, lipofection, nucleofection, or a "gene gun."

[0100] NK-92® cells expressing CD19 CAR The present disclosure provides modified NK-92® cells that express a CD19 CAR and an FcR. Optionally, the modified NK-92® cells further express IL-2.

[0101] In some embodiments, the modified NK-92® cells comprise a multicistronic transgene, wherein the multicistronic transgene encodes a chimeric antigen receptor and an Fc receptor, and optionally IL-2.

[0102] In some embodiments, the FcR is CD 16. In some embodiments, the CD16 is a high affinity CD16 comprising or consisting of SEQ ID NO: 2. In some embodiments, the IL-2 is erIL-2 comprising or consisting of SEQ ID NO: 7.

[0103] In some embodiments, the CD19 CAR coding sequence and the CD16 coding sequence are separated by a sequence encoding a self-cleaving peptide to produce equimolar expression of CD19 CAR and CD16 encoded from the same mRNA. Self-cleaving peptides and their coding sequences are well known and are disclosed, for example, in Wang et al., Scientific Reports 5, Article number 16273 (2015), the relevant disclosure of which is incorporated herein by reference. Non-limiting examples of self-cleaving peptides include porcine teschovirus-1 2A (P2A), thosea asigna virus 2A (T2A), equine rhinitis A virus 2A (E2A), silkworm (B. mori) cytoplasmic polyhedrosis virus (BmCPV 2A), and flacherie virus (BmIFV 2A). In some embodiments, the self-cleaving peptide is a P2A peptide encoded by SEQ ID NO: 8: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct.

[0104] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are separated by an internal ribosome entry sequence (IRES) that allows translation initiation from an internal region of the mRNA transcribed from the nucleic acid sequence.

[0105] In some embodiments, the modified NK-92® cells comprise a tricistronic construct that expresses a CAR, high-affinity CD16, and erIL-2 from a single mRNA. In some embodiments, the tricistronic construct comprises the sequence set forth in SEQ ID NO:11. Integration of the CAR allows effector cells to specifically engage and kill target cells expressing the target recognized by the CAR; integration of CD16 allows ADCC when combined with a therapeutic monoclonal antibody; and erIL2 allows cell expansion in the absence of exogenous IL-2, maintaining selective pressure for transgene expression. One illustrative tricistronic construct is shown in Figure 2.

[0106] To produce modified NK-92® cells expressing CAR and CD16 (e.g., high-affinity CD16), as well as erIL-2, the multicistronic plasmid is introduced into aNK cells, e.g., by electroporation. The transformed NK-92® cells are grown in medium without IL-2, and individual clones can be selected from the transformed NK-92® cells by limiting dilution cloning and characterized based on criteria such as, for example, high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate, and / or IL-2 secretion. Suitable clones may also express surface markers, e.g., CD3, CD16, CD54, CD56, NKG2D, and / or NKp30, at levels substantially similar to those of aNK cells. Optionally, whole genome sequencing (WGS) is performed to determine the transgene integration site. Clones meeting one or more of these criteria are selected for further development and can be used to treat patients in the clinic.

[0107] Expression Expression of IL-2 can be confirmed by the ability of the modified NK-92® cells to grow in IL-2-free conditions. Expression of CAR and CD16 can be measured by flow cytometry. For NK-92® cells transformed with a tricistronic construct containing coding sequences for a CD19 CAR, CD16, and IL-2 (e.g., erIL-2), typically at least 70%, at least 80%, or at least 85% of the transformed cells capable of growing in IL-2-free conditions also exhibit high expression levels of both CAR and CD16.

[0108] Optionally, the level of IL-2 secretion by the transformed NK-92® cells can be measured at various time points using methods well known in the art, for example, by ELISA.

[0109] In some embodiments, IL-2 levels are measured in the culture supernatant to determine the level of IL-2 released into the cell culture medium. In some embodiments, IL-2 levels are measured in the cell pellet to assess the total intracellular level of IL-2. In some embodiments, the amount of IL-2 in both the supernatant and the cell pellet are measured to determine the total amount of IL-2 produced by the transformed NK-92® cells.

[0110] Optionally, other surface markers of the transformed NK-92® cells can be measured by flow cytometry. These markers include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Suitable clones are those that demonstrate substantially similar expression levels of these markers as aNK cells under identical growth conditions.

[0111] cytotoxicity Optionally, the cytotoxicity of NK-92® cells transformed with a tricistronic plasmid can be assessed using a flow-based cytotoxicity assay. Effector cells (NK-92® cells) and fluorophore-labeled target cells, e.g., tumor cells, are mixed at different effector-to-target ratios. Propidium iodide (PI) can be added to the cells, and the samples are analyzed by a flow cytometer. Preferably, the fluorophore used to label the target cells can be distinguished from PI by a flow cytometer. In some embodiments, the fluorophore is CFSE. In some embodiments, the fluorophore is PKHGL67. Cytotoxicity can be determined by the % of PI-positive cells within the fluorophore-positive target population.

[0112] Optionally, the cytotoxicity of NK-92® cells transformed with the tricistronic plasmid can also be tested using methods well known in the art. The cytotoxicity of NK-92® cells can be reflected by their direct cytotoxicity or ADCC activity. The direct cytotoxicity of the produced NK-92® cells, their ability to target and kill abnormal cells, e.g., tumor cells, can be determined using methods well known in the art, for example, the procedure described by Klingemann et al. (Cancer Immunol. Immunother. 33:395-397 (1991)). 51 The CAR expression level can be assessed by a Cr release assay (Gong et al. (Leukemia, Apr;8(4):652-8(1994)). In some embodiments, the target cells express an antigen that can be recognized by the CAR expressed on the surface of t-haNK™ cells. Briefly, 51 Cr-labeled target cells are mixed with NK-92® cells and lysed. The percentage of specific cytotoxicity released is 51 It can be calculated based on the amount of Cr. See US Patent Application Publication No. 20020068044.

[0113] Alternatively, the direct cytotoxicity of the generated NK-92® cells can be evaluated using a calcein release assay. For example, NK-92® cells (referred to as effectors in the assay) can be mixed with calcein-loaded target cells (referred to as targets in the assay) at a certain ratio. After a certain period of incubation, the calcein released from the target cells can be evaluated, for example, using a fluorescent plate reader.

[0114] The effector-to-target ratio used in each assay can vary; in some cases, the effector:target ratio can be 20:1, 15:1, 10:1, 8:1, or 5:1; preferably, the effector:target ratio is 10:1. Target cells can be any cells that express an antigen molecule that can be recognized by a CAR on NK-92® cells (t-haNK™ cells). For example, SUP-B15 cells can be recognized by a CD19 CAR and are target cells for CD19 t-haNK™ cells. The cytotoxicity value of NK-92® cells can vary depending on the type of target cell and effector:target ratio used. Generally, NK-92® cells produced using the methods described herein can have a cytotoxicity of 60-100%, e.g., 70-100% or 80-100%. In some cases, the NK-92® cells may have a cytotoxicity of 80-100%, e.g., 82-100%, 85-100%, 87-100%, 88-100%, or 89-100%, when using an effector:target ratio of 1:10 by calcein release assay.

[0115] In some cases, the cytotoxicity of NK-92® cells, e.g., t-haNK™ cells, that is assessed is antibody-dependent cellular cytotoxicity (ADCC). The method for measuring ADCC activity of NK-92® cells is similar to the method for measuring direct cytotoxicity described above, except that an antibody capable of recognizing target cells is also added. The Fc receptors on NK cells recognize the cell-bound antibody, triggering a cytolytic reaction and killing the target cells. In one illustrative example, t-haNK™ cells can be incubated with Herceptin (anti-Her2 antibody) and SKBr3 (target cells), and killing of SKBr3 cells is determined by the activation of internal components of the target cells, e.g., 51 It can be measured by Cr or calcein release, or by PI staining of target cells.

[0116] Doubling Time The growth rate of NK-92® cells, e.g., t-haNK™ cells, can be assessed using cell doubling time, i.e., the time it takes for cells to proliferate to reach twice the initial cell number. Doubling time is inversely proportional to the growth rate of NK-92® cells; the longer the doubling time, the slower the growth rate.

[0117] WGS Optionally, whole genome sequencing (WGS) of the transformed NK-92® cells is performed to identify the insertion site of the multicistronic construct.

[0118] therapeutic use The present disclosure also provides methods for treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinoma, melanoma, or sarcoma. In some embodiments, the present invention is used to treat cancers derived from the hematopoietic system, such as leukemia or lymphoma. In some embodiments, the cancer is a solid tumor.

[0119] In some embodiments, methods of treating any type of cancer in a subject comprise administering to the patient a therapeutically effective amount of the NK-92® cells described above, thereby treating the cancer. In some embodiments, the NK-92® cells express an Fc receptor, e.g., a high-affinity Fc receptor having the sequence set forth in SEQ ID NO: 2. In some embodiments, the NK-92® cells express a CD19 CAR, an Fc receptor, and IL-2. In some embodiments, the modified NK-92® cells comprise a multicistronic construct, wherein the multicistronic construct encodes a chimeric antigen receptor and an Fc receptor.

[0120] Also provided are methods of treating a subject in need of treatment with the modified NK-92® cells described herein. In some embodiments, the subject or patient is suffering from cancer or an infectious disease, e.g., a viral infection.

[0121] The modified NK-92® cells can be administered to an individual by an absolute number of cells, e.g., from about 1000 cells / injection up to about 10 billion cells / injection, e.g., about, at least about, or at most about 1 x 10 cells per injection. 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×1 0 3 , 5×10 3 NK-92® cells (and the like), or any range between any two numbers (including the endpoints), can be administered. Accordingly, the present disclosure also provides compositions comprising a plurality of NK-92® cells, where the number of cells is greater than or equal to 1 x 10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5, 1×10 4 , 5×10 4 , 1×10 3 , or 5 x 10 3 A composition is provided that is (e.g.,

[0122] In other embodiments, the individual is administered about 1000 cells / injection / ml 2 ~Up to approximately 10 billion cells / injection / m 2 , e.g., about, at least about, or at most about 1 x 10 per injection 8 pieces / m 2 , 1×10 7 pieces / m 2 , 5×10 7 pieces / m 2 , 1×10 6 pieces / m 2 , 5×10 6 pieces / m 2 , 1×10 5 pieces / m 2 , 5×10 5 pieces / m 2 , 1×10 4 pieces / m 2 , 5× 10 4 pieces / m 2 , 1×10 3 pieces / m 2 , 5×10 3 pieces / m 2 (etc.) of NK-92® cells, or any range between any two numbers (including the endpoints). Cut.

[0123] In other embodiments, NK-92® cells can be administered to such individuals in relative numbers of cells, e.g., from about 1,000 cells per kilogram of the individual up to about 10 billion cells per kilogram of the individual, e.g., about, at least about, or at most about 1 x 10 cells per kilogram of the individual. 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×104 , 1×10 3 , or 5 x 10 3 pieces (etc.) NK-92® cells, or any range between any two numbers, inclusive of the endpoints, can be administered.

[0124] In other embodiments, the total dose is m of body surface area. 2 It can be calculated as follows: 2 Approximately 1 x 10 11 , 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 The average person is 100,000 people, or any range between any two numbers (including the endpoints). The gap is approximately 1.6m 2 ~approx. 1.8m 2 In a preferred embodiment, about 1 billion to about 3 billion NK-92® cells are administered to a patient. In another embodiment, the amount of NK-92® cells injected per dose is about 1 / m² of body surface area. 2 It can be calculated as follows: 2 1x10 11 , 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 The average body surface area for humans is 1.6 to 1.8 m 2 is.

[0125] In other embodiments, NK-92® cells can be administered to such individuals in relative numbers of cells, e.g., from about 1,000 cells to up to about 10 billion cells per kilogram of the individual, e.g., about, at least about, or at most about 1 x 10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×104 , 5×10 4 , 1×10 3 , or 5 x 10 3 NK-92 (registered trademark) Cells, or any range between any two numbers (including the endpoints), can be administered.

[0126] The NK-92® cells can be administered once to a patient with cancer, or they can be administered multiple times, for example, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or once every 1, 2, 3, 4, 5, 6, or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks, or any range between any two numbers (inclusive of the endpoints) during treatment.

[0127] In some embodiments, NK-92® cells are administered in a composition comprising NK-92® cells and a vehicle, such as human serum or an equivalent thereof. In some embodiments, the vehicle comprises human serum albumin. In some embodiments, the vehicle comprises human plasma. In some embodiments, the vehicle comprises about 1% to about 15% human serum or a human serum equivalent. In some embodiments, the vehicle comprises about 1% to about 10% human serum or a human serum equivalent. In some embodiments, the vehicle comprises about 1% to about 5% human serum or a human serum equivalent. In a preferred embodiment, the vehicle comprises about 2.5% human serum or a human serum equivalent. In some embodiments, the serum is human AB serum. In some embodiments, a serum substitute acceptable for use in human therapy is used in place of human serum. Such serum substitutes are known in the art or may be developed in the future. It is contemplated that concentrations greater than 15% human serum can be used, but concentrations greater than about 5% are cost prohibitive. In some embodiments, the NK-92® cells are administered in a composition comprising the NK-92® cells and an isotonic solution that supports cell survival, hi some embodiments, the NK-92® cells are administered in a composition reconstituted from a cryopreserved sample.

[0128] Pharmaceutically acceptable compositions comprising NK-92® cells can include a variety of carriers and excipients. A variety of aqueous carriers can be used, such as buffered saline. These solutions are sterile and generally free of undesirable substances. Suitable carriers and excipients and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). A pharmaceutically acceptable carrier refers to a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing undesirable biological effects or adversely interacting with other components of the pharmaceutical composition in which it is contained. When administered to a subject, the carrier is optionally selected to minimize degradation of the active ingredient and to minimize adverse side effects in the subject. As used herein, the term pharmaceutically acceptable is used synonymously with physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally contain agents for buffering and preservation during storage, and may include buffers and carriers for appropriate delivery depending on the route of administration.

[0129] These compositions for in vivo or in vitro use can be sterilized by sterilization techniques used for cells. The compositions may contain acceptable auxiliary substances required for appropriate physiological conditions, such as pH adjusting and buffering agents, and toxicity adjusting agents, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate. The concentration of cells and / or other agents in these formulations can vary and is selected primarily based on fluid volume, viscosity, and body weight according to the particular mode of administration selected and the needs of the subject.

[0130] In one embodiment, the NK-92® cells are administered to the patient in combination with one or more other treatments or medications for the cancer being treated. In some embodiments, the one or more other treatments for the cancer being treated include, for example, antibodies, radiation, chemotherapy, stem cell transplant, or hormone therapy.

[0131] In some embodiments, the NK-92® cells and the other cancer agent / treatment are administered simultaneously or nearly simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other). In some embodiments, the NK-92® cells and the other cancer agent / treatment are administered sequentially. In some embodiments, the other cancer treatment / treatment is administered 1, 2, or 3 days after administration of the NK-92® cells.

[0132] In one embodiment, the other cancer agent is an antibody. In one embodiment, NK-92® cells are administered in combination with an antibody that targets diseased cells. In one embodiment, the NK-92® cells and antibody can be administered to a patient together, e.g., in the same formulation; separately, e.g., in separate formulations, in combination; or separately, e.g., on different dosing schedules or at different times of the day. If administered separately, the antibody can be administered via any suitable route, e.g., intravenous or intratumoral injection.

[0133] In some embodiments, the NK-92® cells of the present disclosure are used in combination with therapeutic antibodies and / or other anti-cancer agents. Therapeutic antibodies can be used to target cells expressing cancer- or tumor-associated markers. Examples of cancer therapeutic monoclonal antibodies are listed in Table 4. In some embodiments, the NK-92® cells express an Fc receptor, e.g., a high-affinity Fc receptor having the sequence set forth in SEQ ID NO: 2. In some embodiments, the NK-92® cells are haNK® cells. In one embodiment, the therapeutic antibody is avelumab.

[0134] [Table 4]

[0135] [Table 5]

[0136] Such administration of NK-92® cells can be performed simultaneously with or sequentially to the administration of the monoclonal antibody. In some embodiments, the NK-92® cells are administered to the subject after the subject has been treated with the monoclonal antibody. Alternatively, the NK-92® cells can be administered simultaneously, e.g., within 24 hours of the monoclonal antibody.

[0137] In some embodiments, the NK-92® cells are administered intravenously. In some embodiments, the NK-92® cells are injected directly into the bone marrow.

[0138] Accordingly, the present disclosure provides a method of treating cancer or a viral infection in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of NK-92® cells disclosed herein, thereby treating the cancer.

[0139] kit Also disclosed are kits for treating cancer or infectious diseases using a composition comprising a plurality of NK-92® cells described herein. In some embodiments, the kits of the present disclosure may also comprise at least one monoclonal antibody. The NK-92® cells included in the kit express a CAR and an Fc receptor. In some embodiments, the NK-92® cells further express IL-2, e.g., erIL-2, or IL-15, e.g., erIL-15. In some embodiments, the NK-92® cells comprise a multicistronic construct, the multicistronic construct encoding a chimeric antigen receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0140] In certain embodiments, the kit may contain additional compounds, e.g., therapeutically active compounds or drugs, to be administered before, concurrently with, or after administration of NK-92® cells. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, lidocaine, quinidine, chemotherapeutic agents, etc.

[0141] In various embodiments, the kit's instructions include directions for using the kit components in the treatment of cancer or infectious disease. The instructions may further include information on how to handle the NK-92® cells (e.g., thawing and / or culturing). The instructions may further include guidance on dosage and frequency of administration.

[0142] In certain embodiments, the kit further comprises one or more containers filled with one or more compositions described herein, e.g., compositions comprising NK-92® cells described herein. Optionally, such containers may be associated with a label indicating that the kit is for treating cancer, e.g., those described herein. Optionally, the label also includes notice in the form prescribed by an authority regulating the manufacture, use, or sale of pharmaceutical or biological products, which notice reflects approval by the authority of the manufacture, use, or sale for human administration.

[0143] Disclosed are materials, compositions, and components that can be used in, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are described, it is understood that although specific reference to each of the various individual and collective combinations and permutations of these compounds may not be expressly stated, each is specifically contemplated and described herein. For example, when a method is disclosed and discussed, and numerous modifications that can be made to numerous molecules comprising that method are discussed, each and every combination and permutation of the method and possible modifications is specifically contemplated unless specifically indicated otherwise. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including, but not limited to, steps in methods using the disclosed compositions. Thus, where there are various additional steps that can be performed, it is understood that each of those additional steps can be performed with any specified method step or combination of method steps of the disclosed methods, and that each such combination or subset of combinations should be considered specifically contemplated and disclosed. [Example]

[0144] The following examples are for illustrative purposes only and should not be construed as limiting. There are a variety of alternative techniques and procedures available to those skilled in the art that would also enable successful implementation of the following examples.

[0145] Example 1: Production of PD-1 CAR-modified NK-92® cells The CD19 CAR was cloned into the tricistronic plasmid pNEUKv1 FcR_IL-2 vector, which also contains the CD16 and erIL-2 transgenes. The tricistronic plasmid was electroporated into aNK cells. CD19 CAR-expressing NK-92® cells were selected by IL-2-depleted medium, as untransformed aNK cells, which are IL-2 dependent, could not survive in IL-2-depleted medium.

[0146] Limiting dilution cloning An aliquot of the polyclonal CD19 t-haNK™ pool culture was diluted to a density of 3 cells / ml in growth medium without IL-2 supplementation. This cell suspension was aliquoted in a volume of 200 μl per well in a 96-well plate, corresponding to an average of 0.6 cells per well. The plates were incubated at 37°C for 10 days and then visually inspected for cell growth. A total of 20 cultures, now designated clones, were picked, transferred to large containers, and numbered according to their initial growth rate, with clones #1 to #10 being the first to be passaged.

[0147] Example 2: Bioanalytical Methods Cell culture: Polyclonal and clonal CD19 t-haNK™ cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative tested donor) and without IL-2.

[0148] aNK cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative tested donor) and 500 IU / ml recombinant human IL-2.

[0149] haNK cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum (from a CMV-negative tested donor) and without IL-2.

[0150] K562 cells were cultured in RPMI-1640 supplemented with 10% heat-inactivated fetal bovine serum and an antibiotic / antimycotic cocktail. K562 cells were passaged every 2–5 days or when the culture medium turned yellow.

[0151] SUP-B15 and SUP-B15 CD19KO / CD20+ Cells were cultured in 20% heat-inactivated fetal bovine serum, 55 μM beta-mercaptoethanol, and antibiotic / antimycotic The cells were cultured in RPMI-1640 supplemented with a cocktail of the following: 1) ATP-dependent ATPase inhibitors (ATP-dependent ATPase inhibitors), 2) ATP-dependent ATPase inhibitors (ATP-dependent ATPase inhibitors), 3) ATP-dependent ATPase inhibitors (ATP-dependent ATPase inhibitors), 4) ATP-dependent ATPase inhibitors (ATP-dependent ATPase inhibitors), 5) ATP-dependent ATPase inhibitors (ATP-dependent

[0152] Antibody staining for flow cytometry analysis: Cells were collected by centrifugation, washed twice in FACS buffer (5% FBS in 1x D-PBS), and resuspended in 1 ml of FACS buffer. For direct fluorophore-conjugated antibody staining of surface proteins, cells were incubated with the appropriate conjugated antibody (or isotype control) for 20 minutes in the dark at 4°C, then washed twice in FACS buffer. For detection of CAR protein, cells were incubated with biotinylated anti-F(ab')2 fragment antibody, followed by streptavidin-APC antibody. Samples were analyzed on a MACSQuant flow cytometer.

[0153] Growth assay: 1 × 10 cells resuspended in growth medium supplemented with 5% heat-inactivated human AB serum 5 From an initial concentration of cells / mL (day 1), cultures were counted by an automated cell counter on days 3, 5, and 7. Growth rate was calculated using the following formula: Doubling time (hours) = [Duration (hours) × log(2)] / [log(final cell density) – log(initial cell density)] It was calculated by

[0154] Cytotoxicity: Suspension-grown cell lines were resuspended by pipetting the cell culture up and down. Cell viability was determined by automated counting (trypan blue exclusion). Target cells were labeled with CFSE dye, and dilutions of target and effector cells to the required cell concentrations were performed in RPMI-1640 supplemented with 10% heat-inactivated FBS and antibiotic / antimycotic. Effector and target cells were mixed in 96-well plates at different effector-to-target ratios (E:T of 20:1, 10:1, 5:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1) and co-cultured for 4 hours in a 37°C incubator with a 5% CO2 atmosphere. PI was then added for fluorescent labeling of dead cells, and the assay was analyzed on a MACSquant flow cytometry instrument.

[0155] ADCC: Suspension-grown cell lines were resuspended by pipetting the cell culture up and down. Cell viability was determined by automated counting (trypan blue exclusion). Target cells were labeled with PKH67-GL dye, and dilutions of target and effector cells to the required cell concentrations were performed in RPMI-1640 supplemented with 10% heat-inactivated FBS and antibiotic / antimycotic. Target cells were preincubated with the monoclonal antibodies trastuzumab, rituximab, or no antibody for 30 minutes at room temperature. Antibody-labeled target cells (and no-antibody controls) were then mixed with effector cells at different effector-to-target ratios (20:1, 10:1, 5:1, 2.5:1, 1.25:1, 0.62:1, 0.31:1, and 0.15:1 E:T) in a 96-well plate and co-cultured for 4 hours at 37°C in a 5% CO2 atmosphere. PI was then added for fluorescent labeling of dead cells and the assay was analyzed on a MACSquant flow cytometry instrument.

[0156] IL-2 quantification Cells for analysis were washed in D-PBS 1x to remove residual medium, resuspended in fresh growth medium, and plated at 10 cells / well in two 96-well plates. 5The cells were aliquoted in triplicate at a density of 100 cells / well (=200 μl / well), and the plates were incubated at 37°C in a 5% CO2 humidified incubator. One set of plates was removed for analysis after 24 hours of incubation, and the other after 48 hours. Sample supernatants for analysis were prepared by a first centrifugation step at 500 × g for 5 minutes to remove cells, followed by a second centrifugation at 2000 × g for 5 minutes to remove cellular debris. Sample supernatants were frozen at -80°C until analysis. The cell pellets from the 500 × g centrifugation step were resuspended, triplicates pooled, and cell densities recorded. IL-2 concentrations in the sample supernatants were measured using a human IL-2 ELISA detection kit available from ThermoFisher Scientific (Waltham, MA) according to the manufacturer's instructions and compared with the provided standard. IL-2 concentrations were normalized to cell number at 24 and 48 hours and expressed as pg / ml / 10 5 Expressed as individual cells.

[0157] Example 3: Phenotype of modified NK-92® cells Expression of CD19 CAR in CD19 t-haNK™ cells was measured by flow cytometry, and the results showed that CD19 t-haNK™ cells could grow in the absence of IL-2, and more than 80% of the cells expressed high levels of both CD16 (Figure 3A) and CAR (Figure 3B).

[0158] In a separate experiment, 20 selected clones were screened by flow cytometry for surface expression of CD19CAR (detected with a biotinylated F(ab')2 fragment-specific primary antibody and a streptavidin-APC secondary antibody) and CD16 (detected with the 3G8 monoclonal antibody). Clones that showed multiple positive populations, low staining intensity for CD16, or high background were discarded.

[0159] [Table 6]

[0160] The expression profiles of six NK cell markers in selected CD19 t-haNK™ clones were determined by antibody staining and flow cytometry and compared with aNK. All clones and aNK were negative for CD3 expression, while only aNK were negative for CD16 expression. All clones were positive for CD54, CD56, NKp30, and NKG2D expression, and their expression levels were similar to those of the aNK control.

[0161] [Table 7]

[0162] Example 4: Cytotoxicity of CD19 t-haNK™ cells against target cell lines The cytotoxicity of CD19 t-haNK™ cells was analyzed by incubating them with target cells, K562 cells, SUP-B15 cells, and SKBr cells. Figure 4A shows that CD19 t-haNK™ cells maintained comparable cytotoxicity to parental aNK cells in killing K562 cells (target cells). 16B1 and 18B1 are two CD19 t-haNK™ populations obtained from two electroporation events performed on different days.

[0163] In a separate experiment, selected CD19 t-haNK™ clones were used as effectors in a flow cytometry-based in vitro cytotoxicity assay against the K562 target cell line (CD19-, NK-sensitive). All clones demonstrated efficient cytolytic activity against K562 in a 4-hour cytotoxicity assay. The mean maximal killing efficiency for the CD19 t-haNK™ clones ranged from 70.9±10.1% to 84.4±0.6% (n=2-5) compared to 84.1±2.4% for the aNK control at a 10:1 ratio. See Figure 4B.

[0164] Figure 5A shows that CD19 t-haNK™ cells demonstrated enhanced specific killing of the aNK™-resistant, CD19-positive SUP-B15 cell line, showing that at an effector-to-target ratio of 10, only about 10-20% of the cells were killed by aNK cells, whereas about 80-90% of the cells were killed by CD19 t-haNK™ cells.

[0165] In separate experiments, selected CD19 t-haNK™ clones were used as effectors in a flow cytometry-based in vitro cytotoxicity assay against the SUP-B15 target cell line (CD19+, NK-resistant). All clones were able to efficiently target and kill the resistant SUP-B15 cells in a 4-hour cytotoxicity assay. The mean maximum killing efficiency for the CD19 t-haNK™ clones was 85.7±0.1% to 92.2±1.2% (n=2-5) compared to 10.8±7.4% for the aNK control at a 10:1 ratio. See Figure 5B.

[0166] FIG. 6A shows that the ADCC activity of CD19 t-haNK™ cells against SKBr3 cells (CD19-, Her2 / neu+) was comparable to that of haNK® cells expressing only the CD16(158V) receptor when combined with the anti-Her2 / neu antibody Herceptin.

[0167] In a separate experiment, selected CD19 t-haNK™ clones were used as effectors in a flow cytometry-based in vitro ADCC assay against a modified SUP-B15 target cell line (CD19-, CD20+, Her2-neu-, NK-resistant) in combination with anti-CD20 rituximab monoclonal antibody or with anti-Her2-neu trastuzumab monoclonal antibody. In a 4-hour cytotoxicity assay, all clones were able to efficiently target and kill the resistant SUP-B15CD19KO / CD20+ cells when combined with the anti-CD20 antibody rituximab. The maximum killing efficiency for the CD19 t-haNK™ clones was 63.7% to 77.8% compared to 67.1% for the haNK® control at a 10:1 ratio (n=1-2). Neither haNK® nor the CD19 t-haNK™ clones were able to kill target SUP-B15CD19KO / CD20+ cells when combined with the anti-Her2 / neu control antibody trastuzumab (maximum killing efficiency for the CD19 t-haNK™ clones was 7.7%-21.9% at a 10:1 ratio, and 4.1% for haNK®). ADCC-mediated killing for the CD19 t-haNK™ clones was 46.4%-65.2% compared to 62.7% for the haNK® control at a 10:1 ratio. See Figure 6B.

[0168] Example 5: Other characteristics of CD19 t-haNK™ cells The population doubling time of selected CD19 t-haNK™ clones was determined by cell growth assay over 7 days without medium changes, and the average doubling time was calculated. All clones had population doubling times ranging from 33.1 to 54.5 hours compared to 34.5 hours for the aNK control. See Figure 7.

[0169] CD19 t-haNK™ clones were placed in culture in 6-well plates at a density of 10e5 cells / ml without IL-2, and culture supernatants were collected after 24 and 48 hours. Supernatants were analyzed by ELISA to detect and measure potential release of ERIL-2 by CD19 t-haNK™ cells. After 24 hours in culture, CD19 t-haNK™ clones released 16.1-1278.5 pg / ml / 105 cells. See Figure 8.

[0170] Example 6: CD19 t-haNK™: Evaluation of the antitumor activity of CD19-targeted t-haNK™ cells in intravenous and subcutaneous models of Raji human Burkitt's lymphoma in NSG mice CD19 t-haNK™ are natural killer cells that express a chimeric antigen receptor (CAR) against CD19 to treat hematological cancers of the B-cell lineage. In this study, the antitumor efficacy of repeated intravenous (IV) administration of CD19 t-haNK™ was evaluated in both IV and subcutaneous (SC) Raji xenograft models in NSG mice. In both models, CD19 t-haNK™ cells demonstrated significant therapeutic efficacy. Specifically, in the IV tumor model, CD19 t-haNK™ cells significantly improved animal survival compared to vehicle controls. In the SC tumor model, CD19 t-haNK™ significantly suppressed tumor growth, reduced the number of animal morbidity / mortality events, and significantly reduced metastatic disease burden in the liver.

[0171] Targeted aNK cells expressing a chimeric antigen receptor (CAR) against CD19 have previously shown efficacy in Raji tumor-bearing NSG mice, most likely due to target-specific cytotoxicity in the CAR-expressing cells (see, e.g., Oelsner et al., Cytotherapy, 2017). In this study, the efficacy of CD19 t-haNK™ cells was evaluated in two different variations of the Raji xenograft model: 1) intravenously (IV)-inoculated Raji cells; and 2) subcutaneously (SC)-inoculated Raji tumors, both of which received repeated IV administrations of CD19 t-haNK™ cells. Note that additional animal groups (Groups B and E) were also evaluated in this model as part of the original study protocol, but were not included in this report because they were irrelevant to CD19 t-haNK™ efficacy determinations (see Table 6 for a simplified experimental design).

[0172] Example 7: Materials for CD19 t-haNK™ Testing CD19 t-haNK™ cells (clone 19.6): CD19 t-haNK™ cells were cultured in growth medium supplemented with 5% heat-inactivated human AB serum following the protocol provided by Process Development, NantKwest®, Inc., Torrey Pines.

[0173] Test animals: The test animals used were female NOD.Cg-Prkdc mice aged 9-10 weeks and weighing 20-27 grams at the start of the test (after isolation). scid Il2rg tm1Wjl Twenty animals were used for the IV tumor model. 12 mice were used for the SC tumor model, while 12 were used for the SC tumor model. The animal supplier was The Jackson Laboratory (610 Main Street, Bar Harbor, ME 04609 US). Sterile stainless steel ear tags were applied to each mouse by a portable ear tagger for identification. In addition, each cage had a cage card containing the study number and animal number information.

[0174] Raji Cancer Cell Line: Raji cells were initially purchased from ATCC (Catalog #CCL-86™; Lot #61723871) and then expanded and prepared by Preclinical Development, NantKwest®, Inc. The cells were certified by IDEXX on March 18, 2018 (see Appendix 2 for the certification report). The cell culture medium was ATCC formulated RPMI-1640 medium supplemented with 10% fetal bovine serum, penicillin (100 U / mL), and streptomycin (100 μg / mL). Exponentially growing Raji cells (passage 12) were harvested by centrifugation. Cells were washed and plated at 5 × 10 for IV inoculation. 5 in serum-free medium at a concentration of 1 x 10 viable cells / mL, and 2.5 x 10 for SC transplantation. 6 The cells were resuspended in medium / Matrigel (1:1 v / v) at a concentration of 1 viable cell / mL. Cells were stored on ice before animal injection. Cells used in in vivo studies had a viability of 96%.

[0175] Raji IV model: Twenty animals were injected IV via the lateral tail vein with 0.2 mL of Raji cell suspension (1 × 10 cells) using a 27-gauge needle. 5 cell inoculum).

[0176] Raji SC model: Twelve animals were implanted SC with 0.1 mL of Raji cell suspension (2.5 × 10 cells) on both flanks using a 25-gauge needle. 5 cell inoculum).

[0177] Example 8: Experimental Procedure for CD19 t-haNK™ Test IV Raji model: Within 24 hours after cancer cell inoculation, defined as day 1, 20 animals were sham-randomized according to body weight into two groups of 10 to achieve similar mean body weights between groups. On days 2, 5, 8, 10, 12, and 17, exponentially grown CD19 t-haNK™ cells were harvested by centrifugation and injected at 1 x 10 cells per mouse in an injection volume of 200 μL. 7 for IV administration at a dose of 5 x 10 cells 7 The cells were formulated in growth medium at a concentration of 100 cells / mL. As shown in Table 6, animals in Group A received the vehicle control, while animals in Group C received CD19 t-haNK™ cells.

[0178] Animals were weighed before tumor cell injection and twice weekly. Animals were observed daily for mortality / morbidity (G0-G4) and clinical signs of toxicity (T1-T12; see Table 6). Paralyzed or moribund animals were euthanized. Animals were euthanized by CO2 inhalation followed by cervical dislocation. Mortality events (euthanasia or natural death) were recorded in a Death Log and compiled to calculate survival curves.

[0179] SC Raji model: After SC tumor implantation, animals were examined at least twice weekly for tumor establishment. When tumors became palpable, tumor volume (TV) was measured once or twice weekly using a digital handheld caliper and calculated according to the formula: TV = length × width. 2 The tumor volume was calculated using the formula: [length = maximum diameter of the tumor, width = minimum diameter]. The tumor volume was calculated by the time the mean tumor volume reached an injectable size (195 mm in this case). 3 On day 1, 24 after implantation, 12 tumor-bearing animals were sham-randomized into two groups of 6 to achieve similar tumor volumes between groups, which was defined as day 0. On days 1, 4, 7, 9, 11, and 13, exponentially grown CD19 t-haNK™ cells were harvested by centrifugation, subjected to 1000 cGy gamma irradiation, and administered at 1 x 10 per mouse in an injection volume of 200 μL. 7 for IV administration at a dose of 5 x 10 cells 7The tumor cells were formulated in growth medium at a concentration of 100 cells / mL. As shown in Table 6, animals in Group D received vehicle solution, while animals in Group F received CD19 t-haNK™ cells. Animals were weighed prior to tumor cell injection and then twice weekly.

[0180] Animals were observed daily for mortality / morbidity (G0-G4) and clinical signs of toxicity (T1-T12). Paralyzed or moribund animals were euthanized. Moribund animals were euthanized as soon as they showed morbidity, while surviving animals were subjected to scheduled euthanasia for tissue collection. Specifically, half of the surviving animals (maximum of 3 mice / group) were euthanized 6 hours after the last dose of test article on Day 13. The remaining animals were euthanized 48 hours after the last dose on Day 15. Euthanasia was performed by cervical dislocation while the animals were under deep anesthesia after the final intracardiac bleed. Blood / serum samples were not analyzed in this portion of the study and therefore are not included in this report.

[0181] At termination, a necropsy was performed and organs with visible gross disease were removed, fixed in 10% formalin, and submitted to an affiliated pathology laboratory (Seventh Wave Laboratories) for histological evaluation of tumor / metastatic disease burden.

[0182] [Table 8]

[0183] Example 9: Data analysis for the CD19 t-haNK™ study The following formula: tumor volume = length x width 2 Tumor volume was calculated using 1 / 2 (length and width are the longest and shortest diameters of the tumor, respectively).

[0184] Tumor growth inhibition (TGI) calculation was performed as follows: TGI = (T C -T t ) / ΔT C × 100% (where Tc and Tt are the average values ​​for the control and treated groups at the end of the study, respectively). (ΔTc is the change in mean tumor volume in the control group).

[0185] Tumor growth curves were analyzed by two-way ANOVA followed by multiple comparisons with the Tukey test. Survival curves were analyzed by the log-rank (Mantel-Cox) test. Differences in liver metastatic disease burden on individual days were analyzed by unpaired two-tailed t-test. P<0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 7.

[0186] Example 10: IV Raji Model Results for CD19 t-haNK™ Testing The primary readout in the IV tumor model was animal survival. Mortality events were counted when animals were found dead or when animals were euthanized due to disease-related morbidity and / or paralysis. As shown in Figure 9, compared with vehicle controls, CD19 t-haNK™ cell treatment significantly improved animal survival, resulting in a median survival of 27 days compared to 21.5 days in the vehicle control group (P<0.0001). Animal weight changes were also monitored throughout the study. As shown in Figure 10, CD19 t-haNK™-treated animals demonstrated moderate (less than 10%) and short-term weight loss when treatment was first initiated, which is not an uncommon phenomenon in animals receiving IV NK infusions and is not specific to CD19 t-haNK™ cells. These weights were able to recover after the first week of treatment before declining again due to disease progression.

[0187] Example 11: SC Raji Model Results for CD19 t-haNK™ Testing The primary readout in the SC tumor model was tumor growth. As shown in Figure 11, CD19 t-haNK™ cells demonstrated clear and statistically significant tumor growth inhibition compared to the vehicle control group from day 7 onwards, with a TGI of 49% at the end of the study (day 13).

[0188] Furthermore, because Raji is an aggressive lymphoma model, even when inoculated SC, cancer cells can disseminate and develop multiple metastatic sites, which ultimately lead to animal morbidity and / or mortality. In the vehicle group, there were a total of 3 animals (50%) that were moribund and therefore euthanized on days 11-13. In contrast, there were no unscheduled death events in the CD19 t-haNK™ cell group (Table 7).

[0189] Furthermore, a qualitative reduction in liver metastases was observed in CD19 t-haNK™-treated animals during necropsy ( Figure 12a ). Semiquantitative estimates of disease burden were performed by an affiliated pathology laboratory (Seventh Wave Laboratories) on representatively sampled HE-stained liver sections. As summarized in Figure 12b and Table 8, there was a clear trend toward increased disease burden as the study progressed. The livers of CD19 t-haNK™-treated animals exhibited a significantly lower percentage of cancer-infiltrated area compared with vehicle controls. Due to the small sample size and unplanned early deaths in the control group, statistical analysis could only be performed on the day 13 data. This analysis demonstrated a significant difference in disease burden, with infiltration averaging 10% in CD19 t-haNK™-treated animals compared with 30% infiltration in the control group. Body weight changes were monitored throughout the study, and similar to the IV Raji model, CD19 t-haNK™ treated animals demonstrated moderate (<10%) and transient weight loss at the beginning of the treatment regimen (FIG. 13).

[0190] [Table 9]

[0191] [Table 10]

[0192] Example 12: Conclusions of the CD19 t-haNK™ Study To evaluate the antitumor efficacy of CD19 t-haNK™ cells in a repeated IV administration regimen, two variations of the Raji xenograft model, using IV and SC tumor inoculation, respectively, were utilized in this study. In the IV tumor model, CD19 t-haNK™ cells were able to significantly improve animal survival, extending median survival by 5.5 days (a 26% increase) compared to the vehicle control group. In the SC tumor model, CD19 t-haNK™ cells were able to significantly suppress tumor growth, resulting in a 49% TGI at the end of the study. Furthermore, CD19 t-haNK™ treatment was able to reduce the number of animal morbidity / mortality events (3 / 6 in the control group vs. 0 / 6 in CD19 t-haNK™-treated animals) and significantly reduce the metastatic disease burden in the livers of SC Raji tumor-bearing animals. In summary, CD19 t-haNK™ cells demonstrated significant therapeutic efficacy compared to vehicle controls in both variations of the Raji xenograft model.

[0193] It should be apparent to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. Accordingly, the inventive subject matter should not be limited except as by the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms "comprise" and "comprising" should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that a referenced element, component, or step may be present, utilized, or combined with other elements, components, or steps not expressly referenced. When the specification and claims refer to at least one selected from the group consisting of A, B, C... and N, the sentence should be interpreted as requiring only one element from that group, not A and N, B and N, etc.

Claims

1. 1. A NK cell for use in reducing metastatic lesions, the NK cell expressing a CD19 CAR comprising a first domain comprising a CD19-specific single chain variable fragment (scfv) fused to a second domain comprising a transmembrane domain and a cytoplasmic signaling domain having the amino acid sequence of amino acids 275 to 407 of SEQ ID NO:

12.

2. 2. The NK cell of claim 1, wherein the CD19 CAR coding sequence is codon-optimized for expression in a human system.

3. The NK cell of claim 1 or 2, which is capable of killing CD19-expressing cells.

4. The NK cell of claim 3 , wherein the CD19-expressing cell is a tumor cell.

5. The NK cell according to claim 4, wherein the tumor cell is a SUP-B15 cell.

6. The NK cell of claim 1 , wherein the scFv antibody fragment has the amino acid sequence of SEQ ID NO:

10.

7. The NK cell of claim 1 , wherein the NK cell comprises a nucleic acid of the sequence of SEQ ID NO: 9, the sequence encoding the scFv antibody fragment.

8. 2. The NK cell of claim 1, wherein the direct cytotoxicity of the NK cell against CD19-expressing cells is 70-100% when the effector to target ratio is 10.

9. The NK cell according to claim 1, wherein the ADCC activity of the NK cell is 30 to 90% when the effector to target ratio is 10.

10. 2. The NK cell of claim 1, wherein the CD19 CAR comprises a sequence having at least 90% identity to SEQ ID NO:

12.

11. The NK cell of claim 1 , which expresses CD16 on the cell surface.

12. The NK cell of claim 1, which expresses IL-2 or IL-15.

13. The NK cell of claim 1, comprising a multicistronic vector encoding a CD19 CAR, CD16, and IL-2 or IL-15.

14. The NK cell of claim 13, wherein the multicistronic vector comprises the nucleic acid of SEQ ID NO:

13.

15. The NK cell of claim 1 , which is a primary NK cell.

16. The NK cell of claim 15, wherein the primary NK cell is an NK-92 cell.

17. The NK cell of claim 16, wherein the NK-92 comprises a multicistronic vector encoding a CD19 CAR, CD16, and IL-2 or IL-15.

18. The NK cell of claim 17, wherein the multicistronic vector comprises the nucleic acid of SEQ ID NO:

13.

19. A kit comprising a pharmaceutical composition comprising the NK cells of claim 1.

20. 1. A method of generating NK cells for use in reducing metastatic lesions, the method comprising: providing a multicistronic vector encoding a CD19 CAR, CD16, and IL-2 or IL-15; and introducing the vector into an NK cell to generate the NK cell, wherein the CD19 CAR has the amino acid sequence of SEQ ID NO:

12.

21. 21. The method of claim 20, wherein the vector comprises a sequence encoding a self-cleaving peptide, the sequence being located between the CAR and CD16, and the sequence allowing equimolar expression of the CAR and CD16.

22. 21. The method of claim 20, wherein the vector comprises an internal ribosome entry sequence (IRES) between the CD16 coding sequence and the IL-2 or IL-15 coding sequence.

Images