Histidase production promoter

Abstract

To provide a histidase and CEBPE production promoter which is useful for enhancing UV resistance of skin through urocanic acid formation promotion by histidase production in an epidermal keratinocyte and preventing UV-induced skin disease and improving skin conditions.SOLUTION: The present invention provides a pharmaceutical, a quasi drug, a cosmetic product and food and drink, intended to protect skin from ultraviolet rays, comprising a histidase and CEBPE production promoter characterized by containing Rosa rugosa extract. The Rosa rugosa extract of the present invention exhibits excellent histidase and CEBPE production promoting effect.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a histidase production promoter and a CEBPE production promoter each containing an extract of Rugosa rose, as well as an agent for enhancing skin's ultraviolet resistance, which contains the production promoter. [Background technology]

[0002] Excessive exposure to UV rays can cause erythema and blisters, as well as accelerated melanin production, resulting in darkening of the skin, loss of elasticity, and the development of wrinkles. Therefore, various UV protection agents have been developed to protect the skin from UV rays. These include inorganic UV scattering agents such as zinc oxide and titanium oxide, and organic UV absorbers such as 2-ethylhexyl paramethoxycinnamate. The former reflect UV rays, leaving a white residue on the skin after application and providing an unsatisfactory feel. On the other hand, the latter absorb UV rays, offering the advantage of not causing whitening, but can cause an oily and sticky feel when used in large amounts. Furthermore, organic UV absorbers raise safety concerns due to factors such as primary skin irritation. Furthermore, when topical skin preparations containing UV protection agents are applied, some of the agent is removed over time by sweat and sebum, inevitably reducing the UV protection effect.

[0003] Urocanic acid is synthesized from histidine, an amino acid present in skin, by histidase. It has been reported that urocanic acid has UV-absorbing properties (Non-Patent Document 1) and that in skin tissues where the expression of filaggrin, the source of histidine, is suppressed, the amount of urocanic acid decreases and UV sensitivity increases (Non-Patent Document 2). In other words, by promoting the production of histidase, the amount of urocanic acid produced can be increased, thereby enhancing the skin's UV resistance.

[0004] Known substances that promote histidase production and enhance UV resistance include yuzu extract (Patent Document 1) and enzymatic hydrolysis products of water-insoluble proteins contained in pearls or seashells (Patent Document 2). There is a need for the development of additional substances that can promote histidase production and enhance UV resistance in the skin through the production of urocanic acid.

[0005] Rugosa rugosa (scientific name: Rosa rugosa) is a deciduous shrub belonging to the genus Rosaceae, and grows wild in Japan, the Korean Peninsula, northern China, and other areas. There are many varieties of rugosa, and in addition to being used as ornamental plants, it is also used as a raw material for dyes and fragrances, and its fruit, known as rose hips, is edible and can be used to make jam and other foods. Rugosa rugosa is known to have testosterone 5α-reductase inhibitory activity (Patent Document 3), hair-growing effects such as hair loss prevention and hair growth effects (Patent Document 4), α-amylase activity inhibitory activity and α-glucosidase activity inhibitory activity (Patent Document 5), and sebum synthesis inhibitory activity (Patent Document 6). However, nothing has been known about its histidase production-promoting effect. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Laid-Open No. 2018-35145 [Patent Document 2] Japanese Patent Application Laid-Open No. 2013-23438 [Patent Document 3] Japanese Patent Application Publication No. 5-17365 [Patent Document 4] Japanese Patent Application Publication No. 7-277930 [Patent Document 5] Japanese Patent Application Laid-Open No. 2005-306801 [Patent Document 6] Japanese Patent Application Laid-Open No. 2015-124189 [Non-patent literature]

[0007] [Non-Patent Document 1] Zenisek et al, Biochim. Biophys. Acta, 18(4), 589-591(1955) [Non-patent document 2] Mildner et al,J.Invest.Dermatol.,130(9),2286-2294(2010) Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention aims to enhance the UV resistance of the skin through the production of urocanic acid by promoting the production of histidase. The purpose is The object of the present invention is to provide a histidase production promoter. [Means for solving the problem]

[0009] As a result of intensive research aimed at solving the above-mentioned problems, the inventors discovered that extracts of Rugosa rose have an excellent effect of promoting histidase production, thereby enhancing the skin's resistance to ultraviolet rays through the production of urocanic acid, and thus completed the present invention.

[0010] That is, the present invention includes the following inventions. (1) A histidase production promoter characterized by containing an extract of Rugosa rose. (2) A CEBPE production promoter characterized by containing an extract of Rugosa rose. (3) A composition for enhancing skin's ultraviolet resistance, comprising the agent according to (1) or (2). [Effects of the Invention]

[0011] The Rosa rugosa extract of the present invention exhibited excellent histidase and CEBPE production-promoting effects. A histidase and CEBPE production promoter containing this extract enhances the production of urocanic acid in the skin and strengthens the skin's UV resistance. Because it strengthens the skin's own UV resistance, it is less susceptible to being removed from the skin by sweat, sebum, or contact, reducing UV protection efficacy, compared to applying UV absorbers or UV scattering agents to the skin. The histidase and CEBPE production promoter of the present invention contains a mild-acting plant extract as an active ingredient, resulting in no side effects and high safety. Therefore, it can be used safely in pharmaceuticals, quasi-drugs, cosmetics, and food and beverages. DETAILED DESCRIPTION OF THE INVENTION

[0012] Examples of the rugosa rose used in the present invention include rugosa rose (scientific name: Rosa rugosa Thunb.), Yae-rugosa rose (scientific name: Rosa rugosa Thunb. var. plena), and Maikai (scientific name: Rosa rugosa Thunb. var. plena Regel). In the present invention, the extract of rugosa rose refers to an extract of the entire plant (whole plant), or a part of the plant such as leaves, stems, flowers, buds, fruits, seeds, or roots, or a mixture thereof, with leaf extract being preferred. Furthermore, for extraction, these plants may be used as is, or may be processed by drying, crushing, shredding, or the like.

[0013] The method for extracting Rugosa rose of the present invention is not particularly limited, and may be, for example, a heated extraction or an extraction at room temperature or low temperature. Examples of solvents used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are preferred, with water, ethanol, 1,3-butylene glycol, and propylene glycol being particularly preferred. These solvents may be used alone or in combination.

[0014] The extract may be used as is in the form of an extracted solution, or may be subjected to processes such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, etc., as necessary. The extracted solution may also be subjected to processes such as concentration to dryness, spray drying, or freeze drying, and used as a dried product, or may be subjected to column purification or the like to concentrate or isolate the active ingredients before use. The rugosa rose used in the present invention is a naturally occurring plant, and the components extracted from the rugosa rose are a mixture of numerous compounds with diverse structures present simultaneously. Therefore, it is difficult to clarify the structures or properties of all of the components contained, and it is preferable to treat them as an extract.

[0015] In epidermal keratinocytes, expression of the filaggrin gene leads to the synthesis of profilaggrin, a precursor composed of 10 to 12 linked filaggrin units. Profilagrin undergoes dephosphorylation and protease degradation to form filaggrin. Further degradation of filaggrin in the stratum corneum produces histidine, which is then used by histidase to synthesize urocanic acid, which has UV-absorbing properties and contributes to UV resistance in the skin. Therefore, the Rugosa rose extract used in the present invention can promote the production of urocanic acid and enhance the UV resistance of keratinocytes and skin through its ability to promote the production of histidase and CEBPE, a transcription factor that regulates its expression. Furthermore, through its UV resistance-enhancing effect, the Rugosa rose extract is useful for preventing UV-induced skin diseases and improving skin conditions, such as preventing skin cancer, seborrheic keratosis, and sun dermatitis, and for improving age spots, wrinkles, and sagging skin.

[0016] Histidase in the present invention is an enzyme that converts histidine to urocanic acid, and is also called histidine ammonia-lyase or histidinase. "Promotion of histidase production" refers to promotion of histidase gene expression in cells, and also encompasses the subsequent synthesis of histidase protein and enhancement of histidase enzyme activity.

[0017] In the present invention, CEBPE is a transcription factor also known as CCAAT / enhancer binding protein (C / EBP), epsilon, or CRP. Histidase gene expression is regulated by CEBPE as a transcription factor, and promoting CEBPE expression promotes histidase gene expression. "Promotion of CEBPE production" in the present invention refers to promotion of CEBPE gene expression in cells, but also encompasses the subsequent synthesis of CEBPE transcription factors and activation of the histidase gene expression promoter region.

[0018] In the present invention, the "composition for enhancing the ultraviolet resistance of skin" refers to an external or internal composition that enhances the ultraviolet resistance of skin and protects the skin from the effects of ultraviolet rays by increasing urocanic acid, which has ultraviolet absorbing ability, inside the skin.

[0019] When the histidase and CEBPE production promoter of the present invention is administered to a living body, it can be administered as is, but it is preferable to provide it as a composition for external or internal use on the skin together with appropriate additives within a range that does not impair the effects of the present invention. The composition of the present invention includes pharmaceuticals, quasi-drugs, cosmetics, etc.

[0020] When the histidase and CEBPE production promoters of the present invention are incorporated into pharmaceuticals, they can be mixed with pharmacologically and pharmaceutically acceptable additives and formulated into various preparations suitable for application to affected areas. Pharmacologically and pharmaceutically acceptable additives that can be used, depending on the dosage form and intended use, include excipients, thickeners, isotonicity agents, pH adjusters, stabilizers, antiseptics, preservatives, dispersants, emulsifiers, gelling agents, colorants, and fragrances. Suitable forms for the pharmaceuticals of the present invention include topical preparations, such as ointments, creams, gels, solutions, and patches. Ointments refer to homogeneous, semi-solid topical preparations, including oleaginous ointments, emulsion ointments, and water-soluble ointments. Gels refer to topical preparations in which a water-insoluble component, a hydrated compound, is suspended in an aqueous liquid. Liquids refer to liquid topical preparations, including lotions, suspensions, emulsions, liniments, and the like.

[0021] When the histidase and CEBPE production promoter of the present invention is contained in a quasi-drug or cosmetic, the dosage form may be any of an aqueous solution, solubilized solution, emulsion, powder, powder dispersion, oil solution, gel, ointment, aerosol, water-oil two-layer system, or water-oil-powder three-layer system. Furthermore, the quasi-drug or cosmetic may contain, in addition to the histidase and CEBPE production promoter, various ingredients, additives, bases, etc. commonly used in topical skin compositions, selected and appropriate for their type, and may be produced according to techniques known in the art. The form may be any of a liquid, emulsion, cream, gel, paste, spray, etc. The ingredients include, for example, oils and fats (olive oil, coconut oil, evening primrose oil, jojoba oil, castor oil, hardened castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons (liquid paraffin, squalene, squalane, petrolatum, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.), esters (isopropyl myristate, isopropyl palmitate ... These include: isopropyl, cetyl octanoate, glycerin trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citric acid, lactic acid, α-hydroxyacetic acid, pyrrolidone carboxylic acid, etc.), sugars (maltitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and protein hydrolysates, amino acids and their salts, vitamins, plant and animal extracts, various surfactants, moisturizers, UV absorbers, antioxidants, stabilizers, preservatives, disinfectants, fragrances, etc.

[0022] Examples of types of quasi-drugs and cosmetics include lotions, emulsions, gels, beauty serums, general creams, sunscreen creams, packs, masks, facial cleansers, cosmetic soaps, foundations, powders, bath additives, body lotions, body shampoos, hair shampoos, hair conditioners, scalp lotions, scalp creams, hair tonics, and hair growth agents.

[0023] The content of the histidase and CEBPE production promoter in the composition for enhancing skin UV resistance of the present invention is not particularly limited as long as it is an amount that can exhibit the effect of promoting histidase and CEBPE production in epidermal keratinocytes, but is preferably 0.00001 to 10 wt %, and more preferably 0.0001 to 1 wt %, based on the dry solid weight of the Rugosa rose extract. The above amounts are merely examples, and may be set or adjusted as appropriate taking into consideration the type and form of the composition, typical usage amount, efficacy and effects, cost, etc.

[0024] The histidase and CEBPE production promoters of the present invention can also be contained in compositions for internal use. In the present invention, the term "foods and beverages" is used to mean health foods, functional foods, nutritional supplements, and foods for specified health uses. The form of the foods and beverages may be any suitable form for consumption, such as solid, liquid, granular, powdered, capsule-like, creamy, or paste-like.

[0025] Types of food and beverages include, but are not limited to, bread, noodles, confectionery, dairy products, processed seafood and livestock foods, oils and fats and processed oil and fat foods, seasonings, various beverages (soft drinks, carbonated drinks, beauty drinks, nutritional drinks, fruit drinks, dairy drinks, etc.), and concentrated concentrates and powders for adjusting such beverages.

[0026] The food and drink of the present invention may contain additives that are commonly used depending on the type of food and drink. Any additives that are acceptable from the standpoint of food hygiene can be used, and examples of such additives include sweeteners such as glucose, sucrose, fructose, isomerized liquid sugar, aspartame, and stevia; acidulants such as citric acid, malic acid, and tartaric acid; excipients such as dextrin and starch; binders, diluents, flavorings, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspending agents, and antiseptics.

[0027] The content of the rosehip extract in the food and beverage products of the present invention may be any amount that can exert the effect of promoting the production of histidase and CEBPE in epidermal keratinocytes, but may be appropriately determined taking into consideration the general intake amount of the target food and beverage product, the form of the food and beverage product, efficacy, taste, preference, cost, etc. [Example]

[0028] Next, in order to explain the present invention in detail, specific examples will be given. These examples are intended to specifically explain the effects, but are not intended to limit the scope of the invention. The contents in the examples are in wt%. [Example]

[0029] An extract of Rugosa rose was prepared as follows. (Production Example 1) Preparation of hot water extract of rosehip leaves 1 L of purified water was added to 50 g of Rugosa rose (dried leaves), and extraction was carried out for 2 hours at 90-100°C. The obtained extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 5.2 g of a hot water extract of Rugosa rose leaves.

[0030] (Production Example 2) Preparation of 50% ethanol extract of Rugosa rose leaves 50g of Rugosa rose (dried leaves) was added to 1L of 50% ethanol solution and extracted at room temperature for 1 week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 4.8g of a 50% ethanol extract of Rugosa rose leaves.

[0031] (Production Example 3) Preparation of ethanol extract of rosehip leaves 1 L of ethanol was added to 50 g of Rugosa rose (dried leaves), and the mixture was extracted at room temperature for 1 week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 4.1 g of an ethanol extract of Rugosa rose leaves.

[0032] (Production Example 4) Preparation of Hot Water Extract of Rugosa Rose Fruit 1 L of purified water was added to 50 g of Rugosa rose (dried fruit), and extraction was carried out for 2 hours at 90-100° C. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 4.7 g of a hot water extract of Rugosa rose fruit.

[0033] (Production Example 5) Preparation of 50% ethanol extract of Rugosa rose fruit 50g of Rugosa rose (dried fruit) was added to 1L of 50% ethanol solution and extracted at room temperature for 1 week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 4.1g of a 50% ethanol extract of Rugosa rose fruit.

[0034] (Production Example 6) Preparation of ethanol extract of Rugosa rose fruit 1 L of ethanol was added to 50 g of dried rugosa rose fruit, and the mixture was extracted at room temperature for 1 week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 3.1 g of an ethanol extract of rugosa rose fruit.

[0035] (Production Example 7) Preparation of hot water extract of Rugosa rose flower 1 L of purified water was added to 50 g of Rugosa rose (dried flowers), and extraction was carried out for 2 hours at 90-100°C. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 4.0 g of a hot water extract of Rugosa rose flowers.

[0036] (Production Example 8) Preparation of 50% ethanol extract of Rugosa rose flower 50g of Rugosa rose (dried flowers) was added to 1L of 50% ethanol solution and extracted at room temperature for 1 week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 3.5g of a 50% ethanol extract of Rugosa rose flowers.

[0037] (Production Example 9) Preparation of ethanol extract of Rugosa rose flower 1 L of ethanol was added to 50 g of Rugosa rose (dried flowers), and the mixture was extracted at room temperature for one week. The resulting extract was filtered, and the filtrate was concentrated under reduced pressure and freeze-dried to obtain 2.0 g of an ethanol extract of Rugosa rose flowers. [Example]

[0038] (Test Example 1) Changes in histidase expression due to CEBPE knockdown We investigated transcription factors that bind to histidase in the vicinity of histidase by referring to the ChIP-seq database (ChIP-Atlas). As a result, a peak for CEBPE, a transcription factor known to be involved in epidermal differentiation, was reported on histidase. This suggests that CEBPE may bind to the histidase DNA sequence and regulate histidase expression. Next, human keratinocytes were cultured in 12-well plates at 2 × 10 4 Cells were seeded and induced to differentiate by adding 2 mM CaCl2 after 24 hours. After 10 days of differentiation, siRNA treatment was performed to knock down CEBPE. siRNA treatment was performed using the CEBPE TriFECTa RNAi Kit (IDT) and the Lipofectamine RNAiMAX Reagent (Invitrogen). After siRNA treatment, the cells were cultured again for 24 hours in medium supplemented with 2 mM CaCl2, after which total RNA was extracted. Total RNA was extracted using RNAiso Plus (TAKARA). Histidase and CEBPE mRNA expression levels were measured using real-time RT-PCR based on total RNA. SYBR Select Master Mix (Life Technologies) was used for real-time RT-PCR, with 18S rRNA as the internal standard. Real-time RT-PCR was performed according to established procedures, and the expression levels of histidase and CEBPE mRNA were calculated as a ratio to the expression level of the internal standard 18S rRNA. The primers used for histidase, CEBPE and 18S rRNA were as follows:

[0039] Primer set for histidase CTGAAGGGCACCACCAAA (SEQ ID NO: 1) GACCGAAACCGAAAAGCAA (SEQ ID NO: 2) Primer set for CEBPE CGCCCGTGGTGTTATTTAAAG (SEQ ID NO: 3) GGCAGAGGGAGAAGCAGAGA (SEQ ID NO: 4) Primer set for 18S rRNA CCGAGCCGCCTGGATAC (SEQ ID NO: 5) CAGTTCCGAAAACCAACAAAATAGA (SEQ ID NO: 6)

[0040] The results of these tests are shown in Table 1. As a result, the expression level of histidase mRNA was reduced by CEBPE knockdown, indicating that the transcription factor CEBPE controls the expression of the histidase gene.

[0041] [Table 1]

[0042] (Test Example 2) Effect of Rugosa rose extract on UV-induced decrease in CEBPE expression The effect of the extracts of Rugosa rose produced in Example 1 (Production Examples 1 to 9) on CEBPE production was evaluated using the expression level of CEBPE mRNA as an index. The specific method is described below.

[0043] 1 x 10 human keratinocytes were placed in a 6 cm dish. 5 The cells were seeded, and the next day, 2 mM CaCl2 was added to induce differentiation. On the sixth day of differentiation induction, 10 μg / mL of each sample was added. 24 hours later, UVB light was applied at 50 mJ / cm2. 2 After irradiation, the cells were cultured again for 24 hours in medium containing each sample, and then total RNA was extracted. As a control, cells to which purified water was added instead of the sample were used. The expression level of CEBPE mRNA was measured in the same manner as in Test Example 1.

[0044] The test results are shown in Table 2. As a result, all of the extracts of Rugosa rose (Production Examples 1 to 3) were found to have the effect of suppressing the decrease in CEBPE mRNA expression caused by ultraviolet light. The same effect was also confirmed for the extracts of Rugosa rose (Production Examples 4 to 9).

[0045] [Table 2]

[0046] (Test Example 3) Effect of Rugosa rose extract on histidase production The effect of the extracts of Rugosa rose produced in Example 1 (Production Examples 1 to 9) on histidase production was evaluated using the expression level of histidase mRNA as an index. The specific method is described below.

[0047] 1 x 10 human keratinocytes were placed in a 6 cm dish. 5 Cells were seeded, and the next day, 2 mM CaCl2 was added to induce differentiation. On the sixth day after differentiation induction, 0.1, 1, or 10 μg / mL of each sample was added. 24 hours later, total RNA was extracted. As a control, cells to which purified water had been added instead of the sample were used. The expression level of histidase mRNA was measured using the same method as in Test Example 1.

[0048] The test results are shown in Table 3. As a result, the extract of Rugosa rose (Production Example 1) was found to have the effect of promoting the expression of histidase mRNA. The extracts of Rugosa rose (Production Examples 2 to 9) were also tested in the same manner, and the effect was confirmed.

[0049] [Table 3] [Example]

[0050] Product formulation examples Formulation examples of products containing the Rugosa rose extracts produced in Production Examples 1 to 9 are shown below.

[0051] (Formulation example 1) Lotion Formulation Content (wt%) 1. Rugosa extract (Production Example 1) 0.1 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance 0.1 11. Remaining purified water [Manufacturing Method] Components 1 to 6 and 11, and components 7 to 10 are each uniformly dissolved, then the two are mixed and filtered to prepare the lotion.

[0052] (Formulation example 2) Cream Formulation Content (wt%) 1. Rugosa extract (Production Example 2) 0.1 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12. Ethyl parahydroxybenzoate 0.05 13. 1,3-butylene glycol 8.5 14. Remaining purified water [Manufacturing Method] Ingredients 2-9 are heated, dissolved, and mixed, and the mixture is kept at 70°C to form the oil phase. Ingredients 1 and 11-14 are heated, dissolved, and mixed, and the mixture is kept at 75°C to form the water phase. Next, the water phase is added to the oil phase and emulsified, and the mixture is cooled while stirring. At 45°C, ingredient 10 is added, and the mixture is further cooled to 30°C to form the final product.

[0053] (Formulation Example 3) Emulsion Formulation Content (wt%) 1. Rugosa extract (Production Example 3) 0.1 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Remaining purified water [Manufacturing Method] Heat, dissolve, and mix ingredients 2-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, then cool further to 30°C to form the final product.

[0054] (Formulation Example 4) Gel Formulation Content (wt%) 1. Rugosa extract (Production Example 4) 0.1 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Remaining purified water [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.

[0055] (Prescription Example 5) Ointment Formulation Content (wt%) 1. Rugosa extract (Production Example 5) 2.0 2. Polyoxyethylene cetyl ether (30E.O.) 2.0 3. Glyceryl monostearate 10.0 4. Liquid Paraffin 5.0 5. Cetyl alcohol 6.0 6. Methyl parahydroxybenzoate 0.1 7. Propylene Glycol 10.0 8. Remaining purified water [Manufacturing Method] Heat, dissolve, and mix ingredients 2-5, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 6-8, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool to 30°C while stirring to form the final product.

[0056] (Prescription Example 6) Pack Formulation Content (wt%) 1. Rugosa extract (Production Example 6) 0.1 2. Polyvinyl alcohol 12.0 3. Ethanol 5.0 4.1,3-Butylene Glycol 8.0 5. Methyl parahydroxybenzoate 0.2 6. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 7. Citric acid 0.1 8. Sodium citrate 0.3 9.Fragrance (appropriate amount) 10. Remaining purified water [Manufacturing method] Dissolve ingredients 1 to 10 uniformly to obtain the product.

[0057] (Formulation example 7) Foundation Formulation Content (wt%) 1. Rugosa extract (Production Example 7) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Butyl parahydroxybenzoate 0.1 10. Sodium carboxymethylcellulose 0.1 11. Bentonite 0.5 12. Propylene Glycol 4.0 13. Triethanolamine 1.1 14. Methyl parahydroxybenzoate 0.2 15. Titanium dioxide 8.0 16. Talc 4.0 17. Bengala 1.0 18. Yellow Iron Oxide 2.0 19.Fragrance (appropriate amount) 20. Remaining purified water [Manufacturing Method] Components 2-9 are heated and dissolved, and the temperature is maintained at 80°C to form the oil phase. Component 10 is thoroughly swelled in component 20, and then components 1 and 11-14 are added and mixed uniformly. Components 15-18, which have been pulverized and mixed in a grinder, are added to form the water phase. The water phase is heated to 80°C, and the water phase is gradually added to the oil phase and emulsified. The mixture is then cooled with stirring, and component 19 is added at 45°C. The mixture is then cooled to 30°C to form the final product.

[0058] (Prescription Example 8) Solid soap Formulation Content (wt%) 1. Rugosa extract (Production Example 8) 0.1 2. Soap base(*) 80.0 3. Glycerin 10.0 4. Sorbitol 1.0 5. Edetic acid 0.1 6. Titanium dioxide 0.1 7.Fragrance (appropriate amount) 8. Remaining purified water (*) A mixture of sodium higher fatty acids including sodium laurate, sodium myristate, sodium palmitate, sodium stearate, and sodium oleate [Manufacturing method] All ingredients are mixed, kneaded using a mixer and rollers, and pressed into a rod-shaped molded product using a plodder.The molded product is then cooled and dried to obtain the product.

[0059] (Formulation example 9) Body cleanser Formulation Content (wt%) 1. Rugosa extract (Production Example 9) 0.2 2. Stearic acid 10.0 3. Palmitic acid 8.0 4. Myristic acid 12.0 5. Lauric Acid 4.0 6. Oleyl alcohol 1.5 7. Refined Lanolin 1.0 8. Coconut oil fatty acid diethanolamide 1.0 9. Glycerin 10.0 10. Potassium hydroxide 6.0 11.Fragrance (appropriate amount) 12. Preservatives (appropriate amount) 13. Sequestering agent (appropriate amount) 14. Remaining purified water [Manufacturing Method] Components 2-5 are heated, melted, and mixed, and the mixture is kept at 70°C to form an oil phase. Component 10 is dissolved in an appropriate amount of component 14, and the mixture is added to the oil phase for saponification. Next, components 6-9 are added to the saponified mixture, and then components 1, 11-13, and the remaining component 14 are added at room temperature.

[0060] (Formulation example 10) Hair lotion Formulation Content (wt%) 1. Rugosa extract (Production Example 1) 0.2 2. Stearic acid 5.0 3. Cetyl Alcohol 5.0 4. Liquid Paraffin 2.0 5. Glycerin Monostearate 1.3 6. Sorbitan monooleate 1.5 7. Polyoxyethylene sorbitan monooleate (10E.O.) 0.8 8. Glycerin 6.0 9. Preservatives (appropriate amount) 10. Remaining purified water [Manufacturing Method] Heat, dissolve, and mix ingredients 2-7, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 8-10, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool while stirring to form the final product.

[0061] (Prescription Example 11) Hair tonic Formulation Content (wt%) 1. Rugosa extract (Production Example 2) 2.0 2.95% Ethanol 60.0 3. Glycerin 2.0 4. Remaining purified water [Manufacturing method] Dissolve component 1 in component 2, add components 3 and 4, and mix thoroughly to produce the product.

[0062] (Prescription Example 12) Shampoo Formulation Content (wt%) 1. Rugosa extract (Production Example 3) 0.1 2. Triethanolamine alkyl sulfate 18.0 3. Lauric acid diethanolamide 3.0 4. Methylcellulose 0.5 5.Fragrance (appropriate amount) 6. Remaining purified water [Manufacturing method] After dissolving component 4 uniformly in component 6, add components 1 and 2, heat to dissolve at 70-75°C, add component 3, add component 5 during cooling, and cool to 30°C to complete the product.

[0063] (Prescription Example 13) Bath additive Formulation Content (wt%) 1. Rugosa extract (Production Example 4) 5.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 Appropriate amount 4.Fragrance (appropriate amount) 5. Remaining amount of anhydrous sodium sulfate [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0064] (Prescription Example 14) Tablets Formulation Content (wt%) 1. Rugosa extract (Production Example 1) 1.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 24.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Ingredients 1 to 5 are mixed, then 10% water is added as a binder, and the mixture is extruded and granulated, then dried. Ingredient 6 is added to the formed granules, and the mixture is compressed into tablets. Each tablet weighs 0.52 g.

[0065] (Formulation Example 15) Beverage Formulation Content (wt%) 1. Rugosa extract (Production Example 2) 0.1 2. Stevia 0.05 3. Malic acid 5.0 4. Sodium ascorbate 1.0 5.Fragrance 0.1 6. Remaining purified water [Manufacturing method] Dissolve ingredients 1 to 5 in a portion of the purified water of ingredient 6 by stirring. Next, add the remaining purified water of ingredient 6 and mix, heat to 90°C, and fill into a 50 mL glass bottle. [Industrial Applicability]

[0066] The histidase and CEBPE production promoter according to the present invention, which is characterized by containing a Rugosa rose extract, exhibits the effect of enhancing skin's ultraviolet resistance. Therefore, it can be used in the fields of manufacturing pharmaceuticals, quasi-drugs, cosmetics, and food and beverage products for the purposes of preventing ultraviolet-induced skin diseases and improving skin conditions, such as preventing skin cancer, seborrheic keratosis, and sun dermatitis, and improving age spots, wrinkles, and sagging skin.

Claims

1. A histidase production promoter comprising an extract of Rugosa rose.

2. A CEBPE production promoter characterized by containing an extract of Rugosa rose.

Images