Enhanced oligonucleotides for modulating FUBP1 expression

Abstract

The present invention relates to an enhanced antisense oligonucleotide that is complementary to Far Upstream Element-Binding Protein 1 (FUBP1) and can reduce FUBP1 target nucleic acids, such as FUBP1 mRNA. The present invention relates to an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention particularly relates to the use of an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof to destabilize cccDNA, such as HBV cccDNA. The present invention further relates to an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof for use in the treatment of cancer. Pharmaceutical compositions and their uses in the treatment and / or prevention of HBV infection, or their uses in the treatment of cancer, are also included in the present invention.

Description

[Technical Field]

[0001] The present invention relates to an enhanced antisense oligonucleotide that is complementary to Far Upstream Element-Binding Protein 1 (FUBP1) and can reduce FUBP1 target nucleic acids, such as FUBP1 mRNA. The present invention relates to an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention particularly relates to the use of an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof for destabilizing cccDNA, such as HBV cccDNA. The present invention further relates to an enhanced antisense oligonucleotide that targets FUBP1 or a conjugate thereof for use in the treatment of cancer. Pharmaceutical compositions and their uses in the treatment and / or prevention of HBV infection, or their uses in the treatment of cancer, are also included in the present invention. [Background technology]

[0002] Far Upstream Element-Binding Protein 1 (FUBP1 or FBP1) is a single-stranded DNA-binding protein that binds to multiple DNA elements. This protein is also thought to bind RNA and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. FUBP1 is known to activate the transcription of the proto-oncogene c-myc by binding to the far upstream element (FUSE) located upstream of c-myc in undifferentiated cells. The protein is primarily present in the nucleus of cells. Upregulation of FUBP1 has been observed in many types of cancer. Furthermore, FUBP1 can bind to and mediate the replication of RNA derived from hepatitis C virus and enterovirus (Zhang and Chen 2013 Oncogene vol. 32 pp. 2907-2916).

[0003] FUBP1 has also been identified in hepatocellular carcinoma (HCC) and has been suggested to be involved in HCC tumorigenesis (Ramdzan et al., 2008 Proteomics Vol. 8 p. 5086-5096), and it has been suggested that FUBP1 is required for HCC tumor growth, as exemplified using lentiviral-expressed shRNA targeting FUBP1 (Rabenhorst et al., 2009 Hepatology Vol. 50 p. 1121-1129).

[0004] Knockdown of FUBP1 by lentiviral-expressed shRNA has been demonstrated to enhance treatment response in ovarian cancer (Zhang et al. 2017 Oncology Letters Vol 14 p.5819-5824).

[0005] WO 2004 / 027061 discloses a screening method including a step of analyzing whether a test substance inhibits FBP (FBP is currently called FUBP), and a pharmaceutical composition for treating a proliferative disease, which contains the substance that inhibits FBP as an active ingredient.

[0006] Poly(U)-binding splicing factor 60 (PUF 60) is a potential regulator of both transcriptional and post-transcriptional processes of HBV pregenome expression. PUF60 is known to form a complex with FUBP1 in association with c-myc repression. However, FUBP1 is not involved in PUF60-dependent regulation of HBV pregenome expression (Sun et al., 2017 Scientific Reports 7:12874).

[0007] HBV infection remains a major global health problem affecting an estimated 350 million chronically infected carriers. Approximately 25% of carriers eventually die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most important carcinogen after tobacco, causing 60% to 80% of all primary liver cancers. HBV is 100 times more infectious than HIV.

[0008] Hepatitis B virus (HBV) is an enveloped, partially double-stranded DNA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORFs) encoding the core, polymerase (Pol), envelope, and X proteins, respectively. The Pol ORF is the longest, and the envelope ORF is located within it, while the X and core ORFs overlap with the Pol ORF. The replication cycle of the HBV genome involves two major events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular (RC DNA) and 2) the generation of RC DNA by reverse transcription of pregenomic RNA (pgRNA). RC DNA can be derived from infectious virus particles or can arise as an intracellular replication intermediate.

[0009] HBsAg quantification is an important biomarker for prognosis and treatment response in chronic hepatitis B, where loss of circulating HBsAg in chronically infected patients is seen as a key event in achieving cure. However, HBsAg loss and achievement of seroconversion (functional cure) are rarely observed in chronically infected patients. Hepatitis B e antigen (also known as HBV envelope antigen or HBeAg) is a viral protein secreted by hepatitis B-infected cells. HBeAg is associated with chronic hepatitis B infection and is used as a marker of active viral disease and the degree of infection in patients.

[0010] Therefore, reducing the secretion of HBeAg in addition to the secretion of HBsAg may result in improved inhibition of the development of chronic HBV infection compared with inhibiting the secretion of HBsAg alone.

[0011] Current treatments, such as nucleoside(t) analogs, are molecules that inhibit HBV DNA synthesis but do not aim to reduce HBsAg levels. Most treatments currently under development aim to achieve functional cure, defined as sustained HBsAg loss with or without anti-HBs seroconversion, with undetectable serum DNA and transcriptionally inactive cccDNA, but do not address cccDNA persistence. In contrast, complete cure of HBV infection is defined as cccDNA loss combined with persistent HBV DNA and HBsAg loss. Persistence of cccDNA in infected hepatocytes is a major barrier to eradicating the virus in patients with chronic hepatitis B virus (CHB), and there is an urgent need to develop new therapies for complete HBV cure that eliminate cccDNA.

[0012] In WO 2019 / 193165, it was shown that inhibition of FUBP1 function using either small molecules, siRNAs, or LNA antisense oligonucleotides resulted in a reduction of HBV cccDNA. In the Examples section of WO 2019 / 193165, single-stranded LNA gapmer oligonucleotides were analyzed, which were able to inhibit FUBP1 expression.

[0013] There is a need for therapeutic agents that can specifically inhibit FUBP1. The present inventors have screened over 2,000 antisense oligonucleotides targeting human FUBP1 and identified sequences and compounds that are particularly potent and effective in specifically targeting human FUBP1. Specifically, nine alternating flank gapmers were identified, which resulted in strong downregulation of human FUBP1 in vitro. Eight compounds target a region within exon 14 of human FUBP1, and one compound targets a region within exon 20 (CMP No. 18_1).

[0014] Object of the invention The present invention provides antisense oligonucleotides and conjugates thereof that regulate FUBP1 expression. The present inventors have identified specific target sequences present in exon 14 or exon 20 of human FUBP1 pre-mRNA that can be targeted by antisense oligonucleotides or conjugates thereof to effectively inhibit FUBP1. In particular, targeting positions 16184-16205 of SEQ ID NO: 1 is advantageous in terms of reducing FUBP1.

[0015] Furthermore, the present inventors have identified a specific target sequence present in exon 20 of human FUBP1 pre-mRNA that can be targeted by antisense oligonucleotides or their conjugates to effectively inhibit FUBP1. In particular, targeting positions 30536-30553 of SEQ ID NO: 1 is advantageous in terms of reducing FUBP1.

[0016] Therefore, an object of the present invention is to provide an enhanced antisense oligonucleotide targeting FUBP1 or a conjugate thereof, which can inhibit the expression of FUBP1 in vitro and in vivo, thereby reducing cccDNA in HBV-infected cells. The enhanced antisense oligonucleotide targeting FUBP1 or a conjugate thereof can be used for the treatment and / or prevention of HBV infection or the treatment of cancer. Summary of the Invention

[0017] The present invention relates to antisense oligonucleotides or conjugates thereof that target FUBP1 (Far upstream element-binding protein 1) nucleic acids, such as mammalian FUBP1 nucleic acids, and can inhibit expression of the nucleic acid in cells expressing the nucleic acid, and their use in medicine. The antisense oligonucleotides are complementary to mammalian FUBP1 nucleic acids, such as human FUBP1.

[0018] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence complementary, eg, completely complementary, to a region from nucleotides 16184 to 16205 of human FUBP1 pre-mRNA (set forth in SEQ ID NO: 1).

[0019] The present invention also provides an antisense oligonucleotide comprising a contiguous nucleotide sequence complementary, for example completely complementary, to a region of nucleotides 30536 to 30553 of human FUBP1 pre-mRNA (shown in SEQ ID NO: 1).

[0020] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 16184 to 16200 of SEQ ID NO:1.

[0021] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 16186 to 16203 of SEQ ID NO:1.

[0022] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 30536 to 30553 of SEQ ID NO:1.

[0023] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, e.g., fully complementary, to a region of nucleotides 16188 to 16205 of SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, e.g., fully complementary, to a region of nucleotides 16189 to 16205 of SEQ ID NO: 1.

[0024] The antisense oligonucleotides of the invention are typically 12 to 30, such as 12 to 22, such as 16 to 20 nucleotides in length and comprise a contiguous nucleotide sequence of at least 12 nucleotides, such as 13, 14, 15, 16, 17 or 18 nucleotides, that is complementary, e.g., fully complementary, to a region of human FUBP1 pre-mRNA (as set forth in SEQ ID NO: 1) selected from a region derived from nucleotides 16184-16205, 16184-16200, 16186-16203, 16188-16205, 16189-16205, and 30536-30553 of SEQ ID NO: 1.

[0025] The present invention provides an antisense oligonucleotide having a length of 12 to 22 nucleotides, which comprises a contiguous nucleotide sequence having a length of 12 to 22 nucleotides, and which is complementary, for example, completely complementary, to SEQ ID NO: 10.

[0026] The present invention provides an antisense oligonucleotide having a length of 12 to 20 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), which comprises a contiguous nucleotide sequence having a length of 12 to 18 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), and which is complementary, e.g., completely complementary, to SEQ ID NO: 11.

[0027] The present invention provides an antisense oligonucleotide having a length of 12 to 20 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), which comprises a contiguous nucleotide sequence having a length of 12 to 18 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), and which is complementary, e.g., completely complementary, to SEQ ID NO: 19.

[0028] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a contiguous nucleotide sequence of 10 to 30 nucleotides, wherein the contiguous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18; or 100% identical to at least 14 contiguous nucleotides thereof.

[0029] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a contiguous nucleotide sequence of 10 to 30 nucleotides, wherein the contiguous nucleotide sequence is 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or at least 15 contiguous nucleotides thereof.

[0030] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a contiguous nucleotide sequence of 10 to 30 nucleotides, wherein the contiguous nucleotide sequence is 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or at least 16 contiguous nucleotides thereof.

[0031] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9 and 18, or 14, 15, 16, or 17 contiguous nucleotides thereof.

[0032] The present invention provides antisense oligonucleotides comprising (or consisting of) a contiguous nucleotide sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9 and 18.

[0033] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence that is 100% identical to SEQ ID NO: 6 (CTTATGCTTTTTATGGT), or 14, 15, or 16 contiguous nucleotides thereof.

[0034] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence that is 100% identical to SEQ ID NO: 7 (CTTATGCTTTTTATGGTT), or 14, 15, 16, or 17 contiguous nucleotides thereof.

[0035] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence that is 100% identical to SEQ ID NO: 8 (GCTTTTTATGGTTTCAC), or 14, 15, or 16 contiguous nucleotides thereof.

[0036] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence that is 100% identical to SEQ ID NO: 9 (TATGCTTTTTATGGTTTC), or 14, 15, 16, or 17 contiguous nucleotides thereof.

[0037] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence that is 100% identical to SEQ ID NO: 18 (ACCAATTTTCATTTCTAC), or 14, 15, 16, or 17 contiguous nucleotides thereof.

[0038] The present invention provides the following CTTatGctttttatgGT (SEQ ID NO: 6, Compound No. 6_1), CTTaTgctttttatgGT (SEQ ID NO: 6, Compound No. 6_2), CTtATgctttttatgGTT (SEQ ID NO: 7, Compound No. 7_1), CTtAtgctttttatgGTT (SEQ ID NO: 7, Compound No. 7_2), CTtAtgctttttatGgTT (SEQ ID NO: 7, Compound No. 7_3), CTtAtgctttttatGGTT (SEQ ID NO: 7, Compound No. 7_4), GcttTttatggtTtCAC (SEQ ID NO: 8, Compound No. 8_1), TATgcTttttatggtTTC (SEQ ID NO: 9, Compound No. 9_1), and AcCAAttttcatttCtAC (SEQ ID NO: 18, Compound No. 18_1) an antisense oligonucleotide selected from Antisense oligonucleotides are provided in which uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are LNA 5-methylcytosines, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0039] The present invention also provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention.

[0040] The present invention provides an antisense oligonucleotide selected from the group listed in Table 1, or a pharmaceutically acceptable salt thereof. [Table 1] Helm annotation keys: [LR](G) is a β-D-oxy-LNA guanine nucleoside; [LR](T) is β-D-oxy-LNA thymine nucleoside; [LR](A) is a β-D-oxy-LNA adenine nucleoside; [LR] ([5meC] is β-D-oxy-LNA 5-methylcytosine nucleoside, [dR](G) is a DNA guanine nucleoside; [dR](T) is a DNA thymine nucleoside; [dR](A) is a DNA adenine nucleoside; [dR] ([C] is a DNA cytosine nucleoside, [sP] is a phosphorothioate internucleoside linkage; P is a phosphodiester internucleoside linkage.

[0041] Thus, the present invention provides antisense oligonucleotides selected from the group consisting of compound numbers 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1 and 9_1.

[0042] The present invention further provides an antisense oligonucleotide having compound number 18_1.

[0043] In one embodiment, the antisense oligonucleotide is not antisense oligonucleotide compound number 53_1 or 54_1 as disclosed in WO 2019 / 193165 (see also Table 7 in the Examples section).

[0044] In one embodiment, the antisense oligonucleotide is not antisense oligonucleotide compound numbers 78_1 and 79_1 as disclosed in WO 2019 / 193165 (see also Table 7 in the Examples section).

[0045] The present invention further provides a conjugate comprising an antisense oligonucleotide of the invention and at least one conjugate moiety covalently attached to the antisense oligonucleotide.

[0046] In some embodiments, the conjugate moiety can bind to an asialoglycoprotein receptor, such as the human asialoglycoprotein receptor. For example, the conjugate moiety may comprise at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine.

[0047] In some embodiments, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).Therefore, the antisense oligonucleotide of the present invention can be conjugated to at least one conjugate moiety that comprises at least one N-acetylgalactosamine (GalNAc) moiety, for example, at least one conjugate moiety that comprises at least one N-acetylgalactosamine (GalNAc) moiety as described below.According to one aspect of the present invention, the conjugate moiety is a GalNAc residue R as described herein below.

[0048] In some embodiments, the conjugate moiety is at least trivalent, e.g., bivalent, trivalent, or tetravalent, GalNAc residue, R. Preferably, the conjugate moiety is a trivalent GalNAc residue, R. As used herein, the term "trivalent GalNAc residue" refers to a residue comprising three N-acetylgalactosamine moieties, i.e., preferably three moieties of the following formula: [ka]

[0049] The conjugate moiety or GalNAc residue R and the antisense oligonucleotide may be linked together via a linker L, such as a biocleavable linker L. Thus, the conjugate compound may comprise a linker L positioned between the antisense oligonucleotide and the conjugate moiety or GalNAc residue R, respectively.

[0050] In some embodiments, the linker L comprises 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via a phosphodiester internucleoside linkage. Additionally, the linker L may be attached to the antisense compound via a phosphodiester internucleoside linkage.

[0051] Exemplary conjugates are provided in Table 2 (HELM annotation format) and Figures 1-8, 8.1 and 10.

[0052] The present invention provides a conjugate selected from the group of conjugates listed in Table 2, or a pharmaceutically acceptable salt thereof. [Table 2]

[0053] In the above table, [5gn2c6] is a GalNAc residue R having the formula: [ka]

[0054] It should be understood that R as shown in the figures above and used in the tables above is a mixture of the two stereoisomers shown in Figures 9D1 and 9D2.

[0055] According to a further aspect of the invention, R as shown in the figures above and used in the tables above is the stereoisomer shown in Figure 9D1.

[0056] According to a further aspect of the invention, R shown in the figures above and used in the tables above is the stereoisomer shown in Figure 9D1. The structures of the conjugates provided in Table 2 are shown in Figures 1-8 and 8.1.

[0057] The present invention provides the conjugate of Figure 1 or a pharmaceutically acceptable salt thereof.

[0058] The present invention provides an antisense oligonucleotide of Compound No. 6_1 or a pharmaceutically acceptable salt thereof.

[0059] The present invention provides the conjugate of Figure 2 or a pharmaceutically acceptable salt thereof.

[0060] The present invention provides an antisense oligonucleotide of Compound No. 6_2 or a pharmaceutically acceptable salt thereof.

[0061] The present invention provides the conjugate of Figure 3 or a pharmaceutically acceptable salt thereof.

[0062] The present invention provides an antisense oligonucleotide of Compound No. 7_1 or a pharmaceutically acceptable salt thereof.

[0063] The present invention provides the conjugate of Figure 4 or a pharmaceutically acceptable salt thereof.

[0064] The present invention provides an antisense oligonucleotide of Compound No. 7_2 or a pharmaceutically acceptable salt thereof.

[0065] The present invention provides the conjugate of Figure 5 or a pharmaceutically acceptable salt thereof.

[0066] The present invention provides an antisense oligonucleotide of Compound No. 7_3 or a pharmaceutically acceptable salt thereof.

[0067] The present invention provides the conjugate of Figure 6 or a pharmaceutically acceptable salt thereof.

[0068] The present invention provides an antisense oligonucleotide of Compound No. 7_4 or a pharmaceutically acceptable salt thereof.

[0069] The present invention provides the conjugate of Figure 7 or a pharmaceutically acceptable salt thereof.

[0070] The present invention provides an antisense oligonucleotide of Compound No. 8_1 or a pharmaceutically acceptable salt thereof.

[0071] The present invention provides the conjugate of Figure 8 or a pharmaceutically acceptable salt thereof.

[0072] The present invention provides an antisense oligonucleotide of Compound No. 9_1 or a pharmaceutically acceptable salt thereof.

[0073] The present invention provides an antisense oligonucleotide of Compound No. 18_1 or a pharmaceutically acceptable salt thereof.

[0074] The present invention provides the conjugate of Figure 8.1 or a pharmaceutically acceptable salt thereof.

[0075] Compounds of formula (I) The present invention also provides a compound of formula (I): [ka] During the ceremony, n is 0 or 1 p is 0 or 1 provided that when n is 1, p is preferably 1; and when n is 0 and p is 0, R is preferably H; L is a linker, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides; R is a GalNAc residue, preferably a trivalent GalNAc residue; A is an antisense oligonucleotide residue according to the invention.

[0076] The term "antisense oligonucleotide residue" refers to a residue that is a -(L) n -(OP(=O)(-OH)-) p - is linked to residue R via -, such as the antisense oligonucleotides shown in Table 6. Preferred antisense oligonucleotide residues are shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A and 8A. Further preferred antisense oligonucleotide residues are shown in Figure 8.1A.

[0077] GalNAc residue R R is a GalNAc residue, preferably a trivalent GalNAc residue. As used herein, the term "GalNAc residue" refers to a residue that includes at least one N-acetylgalactosamine (GalNAc) moiety, i.e., at least one moiety of the following formula: [ka]

[0078] As used herein, the term "trivalent GalNAc residue" refers to a residue comprising three N-acetylgalactosamine (GalNAc) moieties, i.e., preferably three moieties of the following formula: [ka]

[0079] Preferably, the GalNAc residue is composed of at least one, preferably three, GalNAc building blocks having the following structure: La ), [ka] wherein the linker ais selected from alkyl groups, alkyl-oxy-alkyl groups, alkyl groups containing at least one phosphodiester bond, alkyl groups containing at least one amide bond, alkyl-oxy-alkyl groups containing at least one phosphodiester bond, and alkyl-oxy-alkyl groups containing at least one amide bond.

[0080] The term "alkyl" refers to a substituted or unsubstituted straight or branched alkyl group, such as a C1 to C20 alkyl group, preferably a C2 to C8 alkyl group, such as a C2, C3, C4, C5, C6, C7 or C8 alkyl group. Preferably, the alkyl group is an unsubstituted, more preferably a straight and unsubstituted alkyl group.

[0081] The term "alkyloxyalkyl" group refers to at least two alkyl groups linked through oxygen, preferably ethyl-oxy-ethyl groups, e.g., -(CH2-O) x - group, where the integer x is preferably in the range of 2 to 20, more preferably in the range of 2 to 6, for example 2, 3, 4, 5 or 6; more preferably x is 3 or 5.

[0082] According to one aspect of the present invention, the GalNAc building block (L a ) has the following structure (L a ) is selected from the group

[0083] More than one residue (L), such as the three residues in a trivalent GalNAc residue a ) are present among the GalNAc residues, it is preferred that all residues are the same.

[0084] Most preferably, L a has the following structure: [ka]

[0085] When the conjugate moiety R comprises multiple, e.g., preferably three, GalNAc moieties, R may be a GalNAc building block (L aIn addition to the structural unit (L a ) is -(L) n -(OP(=O)(-OH)-) p - linked to the antisense oligonucleotide residue A via a multivalent, preferably tetravalent building block (L b ) is included.

[0086] L b is preferably selected from one of the following structures: [ka] In the formula, X is O or S, Z is O or NH, and n is 1 to 4, preferably 2 or 3, and more preferably 2.

[0087] More preferably, L b has the following structure: [ka]

[0088] L b is the structure L b * or structure L b **, or a mixture thereof. b L b * and L b ** is a mixture of [ka]

[0089] Thus, the conjugating moiety R preferably has the structure (L a )3-L b and more preferably R comprises one of the following structures: [ka] More preferably, it comprises the following structure: [ka] In the formula, L b is preferably L b * and L b ** is a mixture of X is O or S, Z is O or NH, n is 1 to 3, preferably 2, and L a is as described above, and preferably L a is as follows, [ka] and mixtures thereof, preferably all residues between GalNAc residues (L a ) are the same.

[0090] (L a )3-L b If is: [ka]

[0091] L a is more preferably selected from the group consisting of: [ka]

[0092] (L a )3-L b If is: [ka] or [ka] Preferably, [ka] and L a is preferably: [ka]

[0093] Optionally, the conjugation moiety R may be linked to a linker L c Thus, R preferably has the structure (L a )3-L b -(L c ) c -, where the integer c is 1 or 0.

[0094] Such linker compounds are known to those skilled in the art and are linked to the remainder of the compound, the antisense oligonucleotide residue, i.e., -(L) n -(OP(=O)(-OH)-) p -Through (L a )3-L b is appropriately selected to couple

[0095] L b Depending on the structure of L c is selected from the group consisting of alkyl, alkyl-oxy-alkyl, amino-alkyl (—NH-alkyl-), amino-alkyl-oxy-alkyl, unnatural amino acid residues, and natural amino acid residues. c is a substituted or unsubstituted lysine group.

[0096] According to one aspect of the present invention, R is selected from the group consisting of (L a )3-L b -(L c ) c , c=1, (La)3-Lb-(Lc)c, (L a )3-L b is as follows: [ka]

[0097] L c is preferably an amino acid such as an amino-alkyl group or a substituted or unsubstituted lysine group, and in particular L C is, for example, selected from the group consisting of: [ka] Amino group is L b , thereby forming an amide bond. Preferred residues R according to this embodiment are shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, and 9D2. Thus, according to one embodiment of the present invention, R is selected from the group consisting of residues shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, and 9D2.

[0098] According to a further aspect of the present invention, R is selected from the group consisting of the structure (L a )3-L b -(L c ) c where c is 0 and (L a )3-L b is as follows: [ka]

[0099] Preferred residues R according to this aspect of the invention are shown in Figures 9B1 and 9B2.

[0100] According to a further aspect of the present invention, R is selected from the group consisting of the structure (L a )3-L b -(L c ) c (L a )3-L b is [ka] Z is O. In this case, c is preferably 1, and L c is preferably an alkyl group, more preferably a C3-C6 alkyl group, more preferably a propyl group, and most preferably an n-propyl group. Preferred residues R according to this embodiment are shown in Figures 9E1, 9F1, 9G1 and 9H1. Thus, according to one embodiment of the present invention, R is selected from the group consisting of residues shown in Figures 9E1, 9F1, 9G1 and 9H1.

[0101] According to a further aspect of the present invention, R is selected from the group consisting of the structure (L a )3-L b -(L c ) c (L a )3-L b is [ka] Z is NH. In this case, c is preferably 1, and L c is preferably an alkyl group, an amino acid-containing group, or a group having the structure: [ka]

[0102] In particular, in this case, L c is as follows: [ka]

[0103] Preferred residues R according to this aspect of the invention are shown in Figure 9J1.

[0104] According to a further aspect of the present invention, R is selected from the group consisting of the structure (L a )3-L b -(L c ) c (L a )3-L b is [ka] Z is NH and c is 0. Preferred residues R according to this aspect of the invention are shown in Figure 9I1.

[0105] According to one aspect of the present invention, R is selected from the group consisting of (L a )3-L b -(L c ) c , c=0, (La)3-Lb-(Lc)c, (L a )3-L b is as follows: [ka]

[0106] Preferred residues R according to this aspect of the invention are shown in Figures 9L1 and 9L2.

[0107] Thus, R is preferably selected from residues shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1 9L2 and mixtures thereof, such as stereoisomeric mixtures of 9A1 and 9A2; 9C1 and 9C2 or 9D1 and 9D2, more preferably R is selected from residues shown in 9D1, 9D2 and mixtures thereof, more preferably R is a mixture of residues shown in 9D1 and 9D2, such as a mixture having a molar ratio of 9D1 to 9D2 in the range of 10:90 to 90:10, such as in the range of 30:70 to 70:30, such as in the range of 45:55 to 55:45.

[0108] Thus, compound (I) is preferably selected from the compounds shown in Figures 10A1, 10A2; 10C1, 10C2, 10D1, 10D2, 10E1, 10F1, 10G1, 10H1, 10I1, 10J1, 10L1, 10L2 and mixtures thereof, for example, stereoisomeric mixtures of 10A1 and 10A2; 10C1 and 10C2 or 10D1 and 10D2 shown in Figures 10D1, 10D2, more preferably, compound (I) is a mixture of compounds shown in Figures 10D1 and 10D2, such as a mixture having a molar ratio of 10D1 to 10D2 in the range of 10:90 to 90:10, for example, in the range of 30:70 to 70:30, for example, in the range of 45:55 to 55:45.

[0109] Linker L In the above formula, L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, e.g., 2 to 5 nucleosides, e.g., 2 nucleosides, optionally the nucleosides are phosphodiester-linked nucleosides.

[0110] The linker L comprises 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via phosphodiester internucleoside linkages. Additionally, the linker L may be attached to the antisense compound via a phosphodiester internucleoside linkage. Furthermore, the linker L is attached to the conjugate moiety R through a suitable functional group, for example, an amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-), or thiophosphodiester (-OP(=S)(-OH)-O-) bond. It should be understood that L may optionally further comprise an alkyl or alkyl-oxy-alkyl group between the functional group linking L to R and the nucleoside. In this case, the nucleoside is preferably linked to the alkyl or alkyl-oxy-alkyl group via a phosphodiester bond, which is linked to R through a suitable functional group, for example, an amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-), or thiophosphodiester (-OP(=S)(-OH)-O-) bond. According to a preferred embodiment, L is: [ka]

[0111] Antisense (A) oligonucleotide residues A is connected to R via its 5' end by -(L) n -(OP(=O)(-OH)-) pand a residue of an antisense oligonucleotide according to the invention, such as the antisense oligonucleotides shown in Table 6, to which A is attached via a nucleotide. Preferably, A is an antisense oligonucleotide residue shown in Figure 1A, Figure 2A, Figure 3A, Figure 4A, Figure 5A, Figure 6A, Figure 7A and Figure 8A, or selected from the residues shown in Figure 1A, Figure 2A, Figure 3A, Figure 4A, Figure 5A, Figure 6A, Figure 7A, Figure 8A and Figure 8.1A.

[0112] According to a further aspect of the invention, A is the antisense oligonucleotide residue shown in Figure 8.1A.

[0113] Therefore, compound (I) is preferably selected from the compounds shown in Figures 10A1, 10A2; 10C1, 10C2, 10D1, 10D2, 10E1, 10F1, 10G1, 10H1, 10I1, 10J1, 10L1 10L2, and mixtures thereof, such as stereoisomeric mixtures of 10A1 and 10A2; 10C1 and 10C2 or 10D1 and 10D2, more preferably compound (I) is selected from the compounds shown in 10D1 and 10D2 and mixtures thereof, more preferably compound (I) is a mixture of compounds 10D1 and 10D2, and preferably A is selected from the antisense oligonucleotides shown in Table 6, and preferably A is a stereoisomeric mixture shown in Figures 1A, 2A an antisense oligonucleotide residue selected from residues shown in Figures 3A, 4A, 5A, 6A, 7A and 8A, wherein L is a linker comprising or consisting of 2 to 10 nucleosides, e.g., 2 to 5 nucleosides, e.g., 2 nucleosides, optionally wherein the nucleosides are phosphodiester-linked nucleosides;

[0114] More preferably, L is: [ka]

[0115] In a further embodiment, R is a residue having the structure (I): [ka]

[0116] L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, e.g., 2 to 5 nucleosides, e.g., 2 nucleosides, optionally the nucleosides are phosphodiester-linked nucleosides, more preferably L is: [ka] and A is an antisense oligonucleotide according to the invention, for example an antisense oligonucleotide shown in Table 6.

[0117] According to one aspect of the invention, A is an antisense oligonucleotide residue shown in Figure 1A, Figure 2A, Figure 3A, Figure 4A, Figure 5A, Figure 6A, Figure 7A and Figure 8A, or selected from the residues shown in Figure 1A, Figure 2A, Figure 3A, Figure 4A, Figure 5A, Figure 6A, Figure 7A, Figure 8A and Figure 8.1A.

[0118] According to a further aspect of the invention, A is the antisense oligonucleotide residue shown in Figure 8.1A.

[0119] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide of the present invention or a conjugate of the present invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0120] The present invention provides pharmaceutically acceptable salts of the antisense oligonucleotides or conjugates thereof of the present invention. In some embodiments, the pharmaceutically acceptable salts are selected from the group consisting of sodium salts, potassium salts, and ammonium salts.

[0121] The present invention provides a pharmaceutical solution of the antisense oligonucleotide or conjugate thereof of the present invention, comprising the antisense oligonucleotide or conjugate thereof of the present invention and a pharmaceutically acceptable solvent such as phosphate-buffered saline. Alternatively, the solvent is water or a sodium chloride solution.

[0122] The present invention provides the antisense oligonucleotides or conjugates thereof of the present invention in solid powder form, such as in the form of a lyophilized powder.

[0123] The present invention provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention or conjugates thereof.

[0124] The present invention provides a pharmaceutically acceptable salt of an antisense oligonucleotide according to the present invention or a conjugate of the present invention, wherein the pharmaceutically acceptable salt is a sodium salt. Alternatively, the salt is a potassium salt.

[0125] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention, the conjugate of the present invention, or the salt of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0126] The present invention provides a method for inhibiting FUBP1 expression in a target cell expressing FUBP1, comprising administering to the cell an effective amount of an antisense oligonucleotide of the present invention, a conjugate of the present invention, a salt of the present invention, or a composition of the present invention. The method may be an in vivo method or an in vitro method.

[0127] The present invention provides a method for treating and / or preventing HBV infection in a subject, such as a human, comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a composition of the present invention to treat and / or prevent HBV infection, e.g., a disease selected from chronic HBV infection and proliferative diseases, e.g., cancer, particularly hepatocellular carcinoma.

[0128] In some embodiments, the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the pharmaceutical composition of the present invention is for use in the treatment and / or prevention of HBV infection, e.g., chronic HBV infection.

[0129] The present invention provides an antisense oligonucleotide of the present invention, a conjugate of the present invention, a pharmaceutical composition of the present invention, or a salt of the present invention for use in medicine. In a further aspect, the present invention provides a method for inhibiting FUBP1 expression in a target cell expressing FUBP1 by administering an effective amount of an antisense oligonucleotide of the present invention or a conjugate of the present invention to the cell. In a further aspect, the present invention provides an in vivo or in vitro method for inhibiting FUBP1 expression in a target cell expressing FUBP1 by administering an effective amount of an antisense oligonucleotide or conjugate of the present invention to the cell. The cell may be a human cell, such as a liver cell, e.g., a hepatocyte. In one embodiment, the cell is a hepatocellular carcinoma cell.

[0130] In a further aspect, the present invention provides a method for reducing cccDNA in HBV-infected cells by administering to the cells an effective amount of an antisense oligonucleotide of the present invention or a conjugate of the present invention.

[0131] In a further aspect, the present invention provides a method for an in vivo or in vitro method for reducing cccDNA in HBV-infected cells by administering to the cells an effective amount of an antisense oligonucleotide of the present invention or a conjugate of the present invention.

[0132] In a further aspect, the present invention provides a method for treating and / or preventing an HBV infection, such as a chronic HBV infection, and a proliferative disease, such as a disease selected from the group consisting of cancer, in particular hepatocellular carcinoma.

[0133] In a further aspect, the present invention provides an antisense oligonucleotide or conjugate of the invention, or a pharmaceutical composition of the invention, for use in the manufacture of a medicament for treating and / or preventing a disease selected from the group consisting of HBV infection, such as chronic HBV infection, and a proliferative disease, such as cancer, particularly hepatocellular carcinoma.

[0134] In a further aspect, the present invention provides an antisense oligonucleotide or conjugate of the invention for use in the manufacture of an antiviral medicament, or a pharmaceutical composition of the invention.

[0135] In a further aspect, the present invention provides the antisense oligonucleotide or conjugate of the invention for use in the manufacture of an antitumor medicament, or the pharmaceutical composition of the invention.

[0136] The present invention provides an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a pharmaceutical composition of the present invention for use in the treatment and / or prevention of a disease selected from the group consisting of HBV infection, e.g., chronic HBV infection, and proliferative diseases, e.g., cancer, particularly hepatocellular carcinoma.

[0137] Sequence Listing The sequence listing submitted with this application is incorporated herein by reference. In the event of any discrepancy between the sequence listing and the specification or drawings, the information disclosed in the specification (including the drawings) shall be presumed to be correct. [Brief explanation of the drawings]

[0138] [Figure 1] Compound 6_1 (SEQ ID NO: 6) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 1A] Residue A of Compound 6_1 (SEQ ID NO: 6) [Figure 2] Compound 6_2 (SEQ ID NO: 6) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 2A] Residue A of Compound 6_2 (SEQ ID NO: 6) [Figure 3] Compound 7_1 (SEQ ID NO: 7) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 3A] Residue A of Compound 7_1 (SEQ ID NO: 7) [Figure 4] Compound 7_2 (SEQ ID NO: 7) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 4A] Residue A of Compound 7_2 (SEQ ID NO: 7) [Figure 5] Compound 7_3 (SEQ ID NO: 7) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 5A] Residues of compound 7_3 (SEQ ID NO: 7) [Figure 6] Compound 7_4 (SEQ ID NO: 7) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 6A] Residue A of Compound 7_4 (SEQ ID NO: 7) [Figure 7] Compound 8_1 (SEQ ID NO: 8) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 7A] Residue A of Compound 8_1 (SEQ ID NO: 8) [Figure 8] Compound 9_1 (SEQ ID NO: 9) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 8A]Residue A of Compound 9_1 (SEQ ID NO: 9) [Figure 8.1] Compound 18_1 (SEQ ID NO: 18) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 8.1A] Residue A of Compound 18_1 (SEQ ID NO: 18) [Figure 9] Figure 9 shows an exemplary GalNAc moiety. Compound K in Figure 9L is composed of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it is still on the solid support as part of its synthesis, where X is S or O, Y is S or O, and n=1-3 (see WO 2017 / 178656). Figures 9B and 9D, also referred to herein as GalNAc2 and GN2, are shown without and with the C6 linker, respectively. [Figure 10] Figure 10 shows exemplary antisense oligonucleotide conjugates. The compounds in Figures 10A-D contain a dilysine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figures 10A and 10B, the oligonucleotide is directly attached to the asialoglycoprotein receptor-targeting conjugate moiety, preferably without a linker. In the compounds in Figures 10C and 10D, the oligonucleotide is attached to the asialoglycoprotein receptor-targeting conjugate moiety via a C6 linker. The compounds in Figures 10E-J contain commercially available trebler brancher molecules and spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. Compound K in Figure 10L is composed of a monomeric GalNAc phosphoramidite added to the oligonucleotide while it is still on the solid support as part of its synthesis, where X = S or O, Y = S or O, and n = 1-3 (see WO 2017 / 178656). [Figure 11] 11 shows the results of an analysis of the in vitro efficacy of anti-FUBP1 compounds in Hela cells. FUBP1 mRNA levels were normalized and are shown as % of control. [Figure 12]Target Binding: FUBP1 mRNA. As described in Example 3, four antisense oligonucleotide compounds were tested in HBV-infected PHH cells. Each compound was delivered to cells at a concentration of 10 μM once a week for three weeks. One week after the final treatment, FUBP1 mRNA target KD was assessed. Total RNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit according to the manufacturer's protocol, and FUBP1 mRNA was quantified by TaqMan qPCR. This figure shows the residual expression of target mRNA compared to a negative control (NDC=1) using oligos tested at 10 μM. Data were normalized to the human GUS B reference gene, and the mean + SD from two biological replicates is reported for each oligo tested. 50% and 20% FCs are highlighted on the graph. CMP number 7_3 shows the best FUBP1 mRNA KD, with an 80% reduction in mRNA expression at 10 μM. CMP No. 18_1 shows the strongest effect in reducing FUBP1 mRNA compared to prior art oligos (CMP Nos. 35_1 and 50_1) and comparable to the oligonucleotide with CMP No. 7_3, both of which reduce target mRNA expression by approximately 80% at 10 μM compared to NDC (see Example 3 for more details). [Figure 13] Evaluation of the in vivo hepatic PK / PD correlation of oligonucleotides with CMP numbers 7_3 and 18_1 conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide was evaluated in a single-dose mouse study (Conj. = conjugate, see Example 4 for further details).

[0139] definition HBV infection The term "hepatitis B virus infection" or "HBV infection" is commonly known in the art and refers to an infectious disease caused by hepatitis B virus (HBV) and affecting the liver. HBV infection can be acute or chronic. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million people worldwide. Approximately 686,000 deaths per year are attributed to HBV-related end-stage liver disease and hepatocellular carcinoma (HCC) (GBD, 2013; Schweitzer et al., 2015). WHO predicted that without further intervention, the number of CHB-infected individuals will remain at their current high level over the next 40 to 50 years, with a cumulative 20 million deaths between 2015 and 2030 (WHO, 2016). CHB infection is not a homogeneous disease with distinct clinical manifestations. Infected individuals progress through several stages of CHB-related liver disease over their lifetime. These stages also form the basis for standard of care (SOC) treatment. Current guidelines recommend treating only select individuals infected with CHB based on three criteria: serum ALT level, HBV DNA level, and liver disease severity (EASL, 2017). This recommendation is due to the fact that SOCs, namely nucleosid(ate) analogs (NAs) and pegylated interferon-α (PEG-IFN), are not curative and must be administered for extended periods, thereby increasing safety risks. NAs effectively suppress HBV DNA replication; however, they have very limited or no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the primary targets of new drugs aimed at curing HBV. In the plasma of CHB patients, HBsAg subviral (empty) particles outnumber HBV virions by 103-105 times (Ganem & Prince, 2014). This excess is thought to contribute to the immunopathogenesis of the disease, including the failure of individuals to develop neutralizing anti-HBs antibodies, a serological marker observed after resolution of acute HBV infection.

[0140] In some embodiments, the term "HBV infection" refers to "chronic HBV infection."

[0141] Furthermore, the term encompasses infection with any HBV genotype.

[0142] In some embodiments, the patient being treated is infected with HBV genotype A.

[0143] In some embodiments, the patient being treated is infected with HBV genotype B.

[0144] In some embodiments, the patient being treated is infected with HBV genotype C (which was tested in Example 3 of the Examples section).

[0145] In some embodiments, the patient being treated is infected with HBV genotype D.

[0146] In some embodiments, the patient being treated is infected with HBV genotype E.

[0147] In some embodiments, the patient being treated is infected with HBV genotype F.

[0148] In some embodiments, the patient being treated is infected with HBV genotype G.

[0149] In some embodiments, the patient being treated is infected with HBV genotype H.

[0150] In some embodiments, the patient being treated is infected with HBV genotype I.

[0151] In some embodiments, the patient being treated is infected with HBV genotype J. cccDNA (covalently closed circular DNA)

[0152] cccDNA is the viral genetic template present in the nucleus of infected hepatocytes, generates all HBV RNA transcripts required for productive infection, and is responsible for viral persistence during the natural history of chronic HBV infection (Locarnini & Zoulim (2010) Antivir Ther. Vol. 15 Suppl., No. 3, pp. 3-14, doi:10.3851 / IMP1619). cccDNA acts as a viral reservoir and is the source of viral rebound after treatment cessation, necessitating long-term, sometimes lifelong, treatment. PEG-IFN can only be administered to a small subset of CHB patients due to its various side effects.

[0153] Therefore, there is a great need for novel therapies that can bring about complete cure, defined by the degradation or elimination of HBV cccDNA, in the majority of CHB patients.

[0154] compound As used herein, the term "compound" refers to any molecule that can inhibit the expression or activity of FUBP1. A specific compound of the present invention is a nucleic acid molecule, such as an antisense oligonucleotide according to the present invention, or any conjugate containing such a nucleic acid molecule. For example, in the present specification, the compound may be a nucleic acid molecule, particularly an antisense oligonucleotide, that targets FUBP1.

[0155] Oligonucleotides The term "oligonucleotide," as used herein, is defined as a molecule containing two or more covalently linked nucleosides, as commonly understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically produced in a laboratory by solid-phase chemical synthesis, followed by purification and isolation. Reference to the sequence of an oligonucleotide refers to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or modifications thereof. Oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. Oligonucleotides of the present invention may contain one or more modified nucleosides, such as 2' sugar-modified nucleosides. Oligonucleotides of the present invention may contain one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0156] antisense oligonucleotides The term "antisense oligonucleotide" or "ASO" as used herein is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid.Antisense oligonucleotides are not essentially double-stranded, and therefore are not siRNA or shRNA.Preferably, the antisense oligonucleotides of the present invention are single-stranded.It is understood that the single-stranded oligonucleotides of the present invention can form hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide), as long as the degree of intra- or inter-self-complementarity over the entire length of the oligonucleotide is less than 50%.

[0157] In some embodiments, the single-stranded antisense oligonucleotides of the present invention may be free of RNA nucleosides.

[0158] Advantageously, the oligonucleotides of the invention comprise one or more modified nucleosides or nucleotides, such as 2' sugar modified nucleosides. Furthermore, it is advantageous for the unmodified nucleosides to be DNA nucleosides.

[0159] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleosides of an oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, such as an FG-F' gapmer region, and may optionally include a nucleotide linker region that can be used to attach additional nucleotide(s), such as a functional group (e.g., a conjugate group), to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of an antisense oligonucleotide constitutes a contiguous nucleotide sequence.

[0160] Nucleotides and Nucleosides Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides. Nucleotides, such as DNA nucleotides and RNA nucleotides, naturally contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers."

[0161] Modified Nucleosides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified relative to an equivalent DNA or RNA nucleoside by the introduction of one or more modifications to the sugar or (nucleic acid) base moiety. Advantageously, one or more of the modified nucleosides of the antisense oligonucleotides of the present invention contain a modified sugar moiety. The term "modified nucleoside" may also be used interchangeably with the terms "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA nucleosides if they are capable of Watson-Crick base pairing.

[0162] Modified internucleoside linkages The term "modified internucleoside linkage" is defined as commonly understood by those skilled in the art as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides together. Thus, the oligonucleotides of the present invention can include one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages or one or more phosphorodithioate internucleoside linkages.

[0163] In some embodiments, at least 50% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are phosphorothioate, and at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, or such as at least 90% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are phosphorothioate. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are phosphorothioate.

[0164] In some advantageous embodiments, all internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0165] Phosphorothioate linkages can exist in various tautomeric forms, for example as shown below. [ka]

[0166] As disclosed in EP 2742135, it is recognized that antisense oligonucleotides may contain other internucleoside linkages (other than phosphodiester, phosphorothioate and phosphorodithioate), such as alkylphosphonate / methylphosphonate internucleoside linkages, which according to EP 2742135 may be tolerated, for example, within the gap region of another DNA phosphorothioate.

[0167] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but function during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.

[0168] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0169] Nucleobase moieties may be represented by the letter code for each corresponding nucleobase, e.g., A, T, G, C, or U, where each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplary oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.

[0170] Modified Oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide containing one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric oligonucleotide" is a term used in the literature to describe an oligonucleotide containing sugar-modified nucleosides and DNA nucleosides. The antisense oligonucleotide of the present invention is preferably a chimeric oligonucleotide.

[0171] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleobases; for example, 5-methylcytosine is often used in place of cytosine; therefore, the term "complementarity" is understood to encompass Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research, vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1).

[0172] The term "% complementary," as used herein, refers to the percentage of nucleotides in a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleobases (from Watson-Crick base pairs) that are complementary between two sequences (aligning the target sequence 5'-3' with the oligonucleotide sequence from 3'-5'), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in calculating the % complementarity of a contiguous nucleotide sequence. It will be understood that chemical modifications of nucleobases are disregarded in determining complementarity, so long as the nucleobase retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating % identity).

[0173] The term "fully complementary" refers to 100% complementarity.

[0174] identity The term "identity" as used herein refers to the percentage (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that is identical to a reference sequence (e.g., a sequence motif) across the contiguous nucleotide sequence. Thus, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleobases between two sequences (in the contiguous nucleotide sequence of the compound of the present invention and the reference sequence), dividing this number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (number of matches x 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percentage identity of a contiguous nucleotide sequence. It should be understood that in determining identity, chemical modifications of nucleobases are ignored as long as the nucleobase retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating percent identity).

[0175] Hybridization As used herein, the terms "hybridization," "hybridizing," or "hybridizes" should be understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the binding between two nucleic acid strands is the strength of hybridization. This is measured by the melting temperature (T), defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. m ) is often explained by the following: Under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The Gibbs free energy ΔG° at standard conditions more accurately represents binding affinity, ΔG° = -RTln(K d ) to calculate the dissociation constant (Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with the reaction at an aqueous concentration of 1 M, pH 7, and temperature of 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and ΔG° in the case of a spontaneous reaction is less than zero. ΔG° can be experimentally measured, for example, by using isothermal titration calorimetry (ITC) as described, for example, in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will know that commercially available devices are available for measuring ΔG°. ΔG° can be numerically estimated using the nearest neighbor model described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, or using appropriately derived thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To ensure the potential for hybridization modulation of their intended nucleic acid targets, oligonucleotides of the invention hybridize to target nucleic acids with estimated ΔG° values ​​of less than −10 kcal for oligonucleotides 10-30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the Gibbs free energy ΔG° under standard conditions. The oligonucleotides may hybridize to the target nucleic acid with an estimated ΔG° value in the range of less than −10 kcal, such as less than −15 kcal, such as less than −20 kcal, and such as less than −25 kcal for oligonucleotides 8 to 30 nucleotides in length.In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value of −10 to −60 kcal, such as −12 to −40, such as −15 to −30 kcal, or −16 to −27 kcal, such as −18 to −25 kcal.

[0176] target The term "target" as used herein refers to the mammalian protein Far Upstream Element-Binding Protein 1, also known as "FUBP1" or "FBP" or "FUBP" or "hDH V." The Homo sapiens FUBP1 gene is located on chromosome 1, 77944055..77979435, complement (NC_000001.11, gene number 1462). The FUBP1 gene encodes a ssDNA-binding protein that activates the far upstream element of c-myc and stimulates c-myc expression in undifferentiated cells. Regulation of FUSE by FUBP occurs through single-stranded binding of FUBP to the non-coding strand. The FUBP1 protein possesses ATP-dependent DNA helicase activity. The amino acid sequence of human FUBP1 is known in the art and can be assessed by UniProt; see, for example, UniProt entry Q96AE4 for human FUBP1 (incorporated herein by reference).

[0177] target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid encoding a mammalian FUBP1, and may be, for example, a gene, RNA, mRNA, pre-mRNA, mature mRNA, or cDNA sequence. Thus, the target may be referred to as a FUBP1 target nucleic acid.

[0178] Suitably, the target nucleic acid encodes a mammalian FUBP1, such as a human FUBP1 gene encoding a FUBP1 protein, in particular the pre-mRNA or mRNA sequences provided herein as SEQ ID NO: 1, 2 and / or 3. SEQ ID NO: 1 is the sequence of human FUBP1 pre-mRNA. SEQ ID NOs: 2 and 3 are the sequences of human FUBP1 mRNA. Table 3 lists the predicted exon and intron regions of SEQ ID NO:1. [Table 3]

[0179] In some embodiments, the target nucleic acid can be a cynomolgus monkey FUBP1 nucleic acid, such as mRNA or pre-mRNA.

[0180] In some embodiments, the target nucleic acid can be a mouse FUBP1 nucleic acid, such as mRNA or pre-mRNA.

[0181] Table 4 provides a summary of the genomic sequences of human, cynomolgus monkey and mouse FUBP1. Table 5 provides a summary of the pre-mRNA sequences of human, monkey and mouse FUBP1, as well as the mature mRNA of human FUBP1.

[0182] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and / or 5, or naturally occurring variants thereof (eg, sequences encoding mammalian FUBP1).

[0183] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2 and / or 3, or a naturally occurring variant thereof (eg, a sequence encoding a mammalian FUBP1).

[0184] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 4, and 5, or naturally occurring variants thereof (eg, sequences encoding mammalian FUBP1). [Table 4]

[0185] When the antisense oligonucleotides of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0186] For in vivo or in vitro application, the therapeutic antisense oligonucleotide of the present invention can typically inhibit the expression of a FUBP1 target nucleic acid in cells expressing the FUBP1 target nucleic acid. The contiguous sequence of nucleobases of the antisense oligonucleotide of the present invention is typically complementary to a conserved region of a FUBP1 target nucleic acid, measured over the length of the antisense oligonucleotide, optionally excluding one or two mismatches, and optionally excluding a nucleotide-based linker region or other non-complementary terminal nucleotide that can connect the antisense oligonucleotide to any functional group, such as a conjugate.

[0187] The target nucleic acid can be a messenger RNA, such as a pre-mRNA encoding a mammalian FUBP1 protein, such as human FUBP1, e.g., a human FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 1, a cynomolgus monkey FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 4, or a mouse FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 5, or a mature FUBP1 mRNA, such as the human mature mRNAs disclosed as SEQ ID NOs: 2 and 3. SEQ ID NOs: 1-5, 10, 11, 15, and 19 are DNA sequences. It will be understood that the target RNA sequence has uracil (U) bases in place of thymidine (T) bases.

[0188] Further information regarding exemplary target nucleic acids is provided in Table 5. [Table 5]

[0189] In some embodiments, the target nucleic acid is SEQ ID NO:1.

[0190] In some embodiments, the target nucleic acid is SEQ ID NO:2.

[0191] In some embodiments, the target nucleic acid is SEQ ID NO:3.

[0192] In some embodiments, the target nucleic acid is SEQ ID NO:4.

[0193] In some embodiments, the target nucleic acid is SEQ ID NO:5.

[0194] In some embodiments, the target nucleic acid is SEQ ID NO: 1, 2, and / or 3.

[0195] In some embodiments, the target nucleic acid is SEQ ID NO: 1 and / or 4. Thus, antisense oligonucleotides can target both human and cynomolgus monkey FUBP1.

[0196] In some embodiments, the target nucleic acid is SEQ ID NO: 1 and / or 5. Thus, the antisense oligonucleotides target both human and mouse FUBP1.

[0197] In some embodiments, the target nucleic acid is SEQ ID NO: 1, 4, and / or 5. Thus, antisense oligonucleotides can target human, cynomolgus monkey, and mouse FUBP1.

[0198] Target sequence The term "target sequence" as used herein refers to a sequence of nucleotides present in a target nucleic acid, which comprises a nucleobase sequence complementary to an oligonucleotide or nucleic acid molecule of the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleobase sequence complementary to the continuous nucleotide sequence (i.e., a subsequence) of an antisense oligonucleotide of the present invention. This region of the target nucleic acid may be interchangeably referred to as a target nucleotide sequence, a target sequence, or a target region. In some embodiments, the target sequence is longer than the complementary sequence of a single antisense oligonucleotide, and may represent, for example, a preferred region of the target nucleic acid that can be targeted by several antisense oligonucleotides of the present invention.

[0199] In one embodiment, the target sequence is a region within exon 14 of human FUBP1 mRNA (see Table 3 above).

[0200] In another embodiment, the target sequence is a region within exon 20 of human FUBP1 mRNA (see Table 3 above).

[0201] The antisense oligonucleotides of the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, such as a target sequence described herein.

[0202] Target sequences defined by regions of the human FUBP1 pre-mRNA (using SEQ ID NO: 1 as reference) that can be targeted by the oligonucleotides of the present invention are provided herein below.

[0203] Oligonucleotides of the invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, eg, a subsequence of a target nucleic acid, eg, a target sequence described herein.

[0204] The oligonucleotide comprises a contiguous nucleotide sequence complementary to a target sequence present in a target nucleic acid molecule, the contiguous nucleotide sequence (and thus the target sequence) comprising at least 12 contiguous nucleotides, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides, e.g., 14-20, e.g., 14-18 contiguous nucleotides.

[0205] Target sequence region The present inventors have identified particularly effective sequences of FUBP1 target nucleic acids that can be targeted by the oligonucleotides of the present invention.

[0206] In some embodiments, the target sequence is SEQ ID NO:10.

[0207] In some embodiments, the target sequence is SEQ ID NO:11.

[0208] In some embodiments, the target sequence is SEQ ID NO:15.

[0209] In some embodiments, the target sequence is SEQ ID NO:19.

[0210] SEQ ID NO: 10: GTGAAAACCATAAAAAGCATAAG SEQ ID NO: 11: AACCATAAAAAGCATAAG SEQ ID NO: 15: GTGAAAACCATAAAAAGCATA SEQ ID NO: 19: GTAGAAATGAAAATTGGT SEQ ID NOs: 10, 11, 15 and 19 are DNA sequences. It will be understood that the target RNA sequences have uracil (U) bases in place of thymidine (T) bases.

[0211] In some embodiments, the target sequence is the region from nucleotide 16184 to 16200 of SEQ ID NO:1.

[0212] In some embodiments, the target sequence is the region from nucleotides 16186 to 16203 of SEQ ID NO:1.

[0213] In some embodiments, the target sequence is the region from nucleotides 16188 to 16205 of SEQ ID NO:1.

[0214] In some embodiments, the target sequence is the region from nucleotides 16189 to 16205 of SEQ ID NO:1.

[0215] In some embodiments, the target sequence is the region from nucleotides 30536 to 30553 of SEQ ID NO:1.

[0216] target cell As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, e.g., a rodent cell, e.g., a mouse cell or a rat cell, or a primate cell, e.g., a monkey cell or a human cell.

[0217] Typically, the target cell expresses FUBP1 mRNA, such as FUBP1 pre-mRNA or FUBP1 mature mRNA. For example, the target cell expresses human FUBP1 pre-mRNA, such as SEQ ID NO: 1, or human FUBP1 mature mRNA containing exon 14 (or exon 20), such as SEQ ID NO: 2 or 3. For experimental evaluation, target cells expressing a nucleic acid containing a target sequence can be used. The polyA tail of FUBP1 mRNA is typically not considered in antisense oligonucleotide targeting.

[0218] Antisense oligonucleotides of the invention are typically capable of inhibiting expression of a FUBP1 target nucleic acid in a target cell expressing the FUBP1 target nucleic acid, for example, either in vivo or in vitro.

[0219] Additionally, the target cells may be hepatocytes. In one embodiment, the target cells are primary human hepatocytes infected with HBV, either derived from an HBV-infected individual or from HBV-infected mice with humanized livers (PhoenixBio, PXB mice).

[0220] In one embodiment, the target cell may be infected with HBV. Furthermore, the target cell may contain HBV cccDNA. Thus, the target cell preferably contains FUBP1 mRNA, such as FUBP1 pre-mRNA or FUBP1 mature mRNA, and HBV cccDNA.

[0221] Additionally, the target cells may be cancer cells, such as hepatocellular carcinoma cells.

[0222] Naturally occurring variants The term "naturally occurring variant" refers to a variant of the FUBP1 gene or transcript that originates from the same locus as the target nucleic acid, but may differ due to, for example, the degeneracy of the genetic code, which causes multiple codons to code for the same amino acid, or alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants.Based on the presence of a sufficiently complementary sequence to the oligonucleotide, the oligonucleotide of the present invention can therefore target the target nucleic acid and its naturally occurring variants.

[0223] In some embodiments, the naturally occurring variant has at least 95%, e.g., at least 98% or at least 99% homology to a mammalian FUBP1 target nucleic acid, e.g., a target nucleic acid selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, or 5. In some embodiments, the naturally occurring variant has at least 99% homology to the human FUBP1 target nucleic acid of SEQ ID NO: 1.

[0224] Inhibition of expression The term "inhibition of expression" as used herein should be understood as a general term for the ability of an oligonucleotide to inhibit the amount or activity of FUBP1 in a target cell. Inhibition of activity can be determined by measuring the level of FUBP1 pre-mRNA or FUBP1 mRNA, or by measuring the level of FUBP1 or FUBP1 activity in the cell. Thus, inhibition of expression can be determined in vitro or in vivo.

[0225] Typically, inhibition of expression is determined by comparing the inhibition of activity by administering an effective amount of antisense oligonucleotide to target cells and comparing that level to a reference level obtained from target cells without administration of the antisense oligonucleotide (a control experiment) or a known reference level (e.g., the expression level before administration of an effective amount of the antisense oligonucleotide, or a predetermined or other known expression level).

[0226] For example, control experiments can be animal or human or target cells treated with a saline composition or a reference oligonucleotide (often a scrambled control).

[0227] The terms "inhibition" or "inhibiting" may also be referred to as downregulating, decreasing, suppressing, reducing or decreasing the expression of FUBP1.

[0228] Inhibition of expression can occur, for example, by degradation of the pre-mRNA or mRNA (eg, using RNase H recruiting oligonucleotides, such as gapmers).

[0229] High-affinity modified nucleosides High-affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, increase the affinity of the oligonucleotide for its complementary target, as measured, for example, by melting temperature (Tm). The high-affinity modified nucleosides of the present invention preferably provide an increase in melting temperature of +0.5 to +12°C per modified nucleoside, more preferably +1.5 to +10°C, and most preferably +3 to +8°C. Numerous high-affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0230] sugar modification Oligomers of the invention may comprise one or more nucleosides having modified sugar moieties, ie, sugar moieties modified compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with modifications in the ribose sugar moiety have been created primarily with the goal of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0231] Such modifications include those in which the ribose ring structure has been modified, for example, by replacing it with a hexose ring (HNA), or a bicyclic ring, typically having a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring, typically lacking the bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0232] Sugar modifications also include modifications made by changing the substituent on the ribose ring to a group other than hydrogen or to the 2'-OH group naturally occurring in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' position.

[0233] 2' sugar-modified nucleosides A 2' sugar modified nucleoside is a nucleoside having a substituent other than H or -OH at the 2' position (2' substituted nucleoside), or a nucleoside containing a 2' linked biradical that can form a bridge between the 2' carbon and a second carbon of the ribose ring, such as an LNA (2'-4' biradical bridge) nucleoside.

[0234] Indeed, much attention has been focused on the development of 2'-sugar-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can confer enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavy and Damha, Chemistry and Biology 2012, 19, 937. Below are examples of some 2'-substituted modified nucleosides. [ka]

[0235] In the context of the present invention, 2'-substituted sugar modified nucleosides do not include 2'-bridged nucleosides such as LNA.

[0236] Locked nucleic acid nucleosides (LNA nucleosides) "LNA nucleosides" are 2'-modified nucleosides containing a biradical (also referred to as a "2'-4' bridge") linking the C2' and C4' ends of the ribose sugar ring of the nucleoside, which restricts or fixes the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). The fixation of the ribose conformation is associated with improved hybridization affinity (duplex stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0237] Non-limiting exemplary LNA nucleosides include those described in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al. al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667. Further non-limiting exemplary LNA nucleosides are disclosed in Scheme 1. Scheme 1: [ka]

[0238] Particular LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA. A particularly preferred LNA is β-D-oxy-LNA.

[0239] Nuclease-mediated degradation Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.

[0240] In some embodiments, oligonucleotides can function through nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the invention can recruit nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that act via a nuclease-mediated mechanism are oligonucleotides that typically contain a region of at least five or six consecutive DNA nucleosides and are flanked on one or both sides by affinity-enhancing nucleosides, e.g., gapmers.

[0241] RNase H activity and recruitment RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when duplexed with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity that can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered to be capable of recruiting RNase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate measured in pmol / l / min that is at least 5%, e.g., at least 10% or more than 20% of the initial rate determined when using an oligonucleotide that has the same base sequence as the modified oligonucleotide being tested but contains only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and employs the methodology provided in Examples 91-95 of WO 01 / 23613 (incorporated herein by reference). For use in determining RHase H activity, recombinant human RNase H1 is available from Creative Biomart® (recombinant human RNase H1 fused to a His tag expressed in E. coli).

[0242] Gapmar The antisense oligonucleotide or its contiguous nucleotide sequence of the present invention may be a gapmer, also referred to as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used to inhibit target nucleic acids via RNase H-mediated degradation. Gapmer-type oligonucleotides contain at least three distinct structural regions, a 5'-flank, a gap, and a 3'-flank, FG-F', in the 5'→3' direction. The "gap" region (G) contains a stretch of contiguous DNA nucleotides that enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-flanking region (F) containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides, and a 3'-flanking region (F') containing one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides. The one or more sugar-modified nucleosides in regions F and F' improve the affinity of the oligonucleotide for the target nucleic acid (i.e., are affinity-enhancing sugar-modified nucleosides). In some embodiments, one or more sugar-modified nucleosides of regions F and F' are 2' sugar-modified nucleosides, such as high affinity 2' sugar modifications, independently selected from, for example, LNA and 2'-MOE.

[0243] In a gapmer design, the 5'- and 3'-most nucleosides of the gap region are DNA nucleosides, positioned adjacent to sugar-modified nucleosides in the 5' (F) or 3' (F') regions, respectively. Flanks may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., at the 5'-end of the 5' flank and at the 3'-end of the 3' flank.

[0244] The region FG-F' forms a contiguous nucleotide sequence. The antisense oligonucleotide of the invention or its contiguous nucleotide sequence can include a gapmer region of the formula FG-F'. In some embodiments, all internucleoside linkages between nucleosides in the gapmer region of the formula FG-F' are phosphorothioate internucleoside linkages.

[0245] The total length of the gapmer design FG-F' can be, for example, 12 to 32 nucleosides, for example, 13 to 24, for example, 14 to 22 nucleosides, for example, 15 to 20, for example, 16 to 18 nucleosides. In some embodiments, the total length is 17 nucleosides. In some embodiments, the total length is 17 nucleosides.

[0246] By way of example, a gapmer oligonucleotide of the invention can be represented by the following formula: F 1-8 -G 5-16 -F' 1-8 ,for example F 1-8 -G 7-16 -F' 2-8、 or F 4-8 -G 7-12 -F' 2-8 , or F 4-6 -G 7-11 -F' 2-6 However, the total length of the gapmer region FG-F' is at least 12, for example at least 14, nucleotides in length.

[0247] In one embodiment, the gapmer oligonucleotide of the invention can be represented by the following formula: F 4-6 -G 7-11 -F' 2-6 Preferably, the total length of the gapmer region FG-F' is at least 16 nucleotides, such as 17 or 18 nucleotides.

[0248] In one embodiment of the present invention, the antisense oligonucleotide or its contiguous nucleotide sequence consists of or comprises a gapmer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise 1 to 8 nucleosides, 1 to 4 of which are 2'-sugar modified, defining the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides, e.g., a region of 7 to 12 nucleosides, capable of recruiting RNase H. In some embodiments, all modified nucleosides in regions F and F' are β-D-oxy LNA nucleosides. Furthermore, regions F or F', or F and F', optionally comprise DNA nucleosides. Optionally, flanking region F or F', or both flanking regions F and F', can comprise one or more DNA nucleosides (alternating flanks, see the definition of alternating flanks for more details).

[0249] Regions F, G, and F' are further defined below and can be combined into the FG-F' formula.

[0250] Gapmer region G The region G (gap region) of a gapmer is a region of nucleosides, typically DNA nucleosides, that allows the oligonucleotide to recruit RNase H, e.g., human RNase H1. RNase H is a cellular enzyme that recognizes duplexes between DNA and RNA and enzymatically cleaves RNA molecules. Preferably, a gapmer can have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, e.g., 5 to 16 consecutive DNA nucleosides, e.g., 6 to 15 consecutive DNA nucleosides, e.g., 7 to 14 consecutive DNA nucleosides, e.g., 8 to 12 consecutive DNA nucleotides, e.g., 8 to 12 consecutive DNA nucleotides in length. In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides.

[0251] In some embodiments, the gap region G can consist of 12 or fewer consecutive DNA nucleosides, such as 7. 8. 9, 10, or 11 consecutive DNA nucleosides, for example 9, 10, or 11 consecutive DNA nucleosides.

[0252] One or more cytosine (C) DNA residues within the gap region may be methylated in some cases (e.g., when DNA c is followed by DNA g). Any such residues may be methylated as 5-methyl-cytosine ( me In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-linked DNA nucleosides.

[0253] In some embodiments, all internucleoside linkages within the gap are phosphorothioate linkages.

[0254] Gapmer-flanking regions, F and F' Region F is positioned immediately adjacent to the 5' DNA nucleoside of region G. The 3'-most nucleoside of region F is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2'-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0255] Region F' is positioned immediately adjacent to the 3' DNA nucleoside of region G. The 5'-most nucleoside of region F is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2'-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0256] Region F is 1 to 8 contiguous nucleotides in length, e.g., 2 to 6, e.g., 4 to 6 contiguous nucleotides in length. In some embodiments, region F is 4 contiguous nucleotides in length. In some embodiments, region F is 5 contiguous nucleotides in length. In some embodiments, region F is 6 contiguous nucleotides in length.

[0257] Advantageously, the 5'-most nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two 5'-most nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5'-most nucleoside of region F is an LNA nucleoside. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides.

[0258] Region F' is 1 to 8 contiguous nucleotides in length, e.g., 2 to 6, e.g., 2 to 5 contiguous nucleotides in length. In some embodiments, region F' is 2 contiguous nucleotides in length. In some embodiments, region F' is 3 contiguous nucleotides in length. In some embodiments, region F' is 4 contiguous nucleotides in length. In some embodiments, region F' is 5 contiguous nucleotides in length.

[0259] Advantageously, the 3'-most nucleoside of region F' is a sugar-modified nucleoside. In some embodiments, the two 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the 3'-most nucleoside of region F' is an LNA nucleoside.

[0260] It should be noted that if the length of region F is 1, it is advantageously an LNA nucleoside. Furthermore, it should be noted that if the length of region F and / or F' is 2, the nucleosides of both regions F and / or F' are advantageously LNA nucleosides.

[0261] In some embodiments, the sugar-modified nucleosides in regions F and F' consist of only one type of sugar-modified nucleoside, for example, only MOE, or only β-D-oxy LNA, or only ScET. Such a design is also referred to as a uniform flank or uniform gapmer design.

[0262] In some embodiments, all nucleosides of regions F or F', or F and F', are LNA nucleosides, e.g., β-D-oxy LNA nucleosides. In alternative embodiments, all sugar-modified nucleosides of regions F and F' are LNA nucleosides, e.g., β-D-oxy LNA nucleosides, and regions F or F', or both regions F and F', can comprise DNA nucleosides (alternating flanks, see these definitions for details).

[0263] In some embodiments, the 5'-most and 3'-most nucleosides of regions F and F' are LNA nucleosides, such as β-D-oxyLNA nucleosides.

[0264] In some embodiments, the internucleoside linkage between region F and region G and / or the internucleoside linkage between region F' and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between the nucleosides of regions F or F', F and F' is a phosphorothioate internucleoside linkage.

[0265] LNA gapmers An LNA gapmer is a gapmer which comprises or consists of LNA nucleosides in one or both of regions F and F'. A β-D-oxy gapmer is a gapmer which comprises or consists of β-D-oxy LNA nucleosides in one or both of regions F and F'.

[0266] In some embodiments, the LNA gapmer has the formula: [LNA] 1-5 -[Area G]-[LNA] 1-5 where region G is or comprises a region of consecutive DNA nucleosides that can recruit RNase H.

[0267] MOE Gapmar An MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, an MOE gapmer has the design [MOE]1-8 -[Area G] 5-16 -[MOE] 1-8 , e.g. [MOE] 2-7 -[Area G] 6-14 -[MOE] 2-7 , e.g. [MOE] 3-6 -[Area G] 8-12 -[MOE] 3-6 where region G is as defined in the gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0268] Mixed Wing Gappa A mixed-wing gapmer is an LNA gapmer in which one or both of regions F and F' comprise 2'-substituted nucleosides, e.g., MOE nucleosides, independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments in which at least one of regions F and F', or both of regions F and F', comprise at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F', or both of regions F and F', comprise at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further comprise one or more DNA nucleosides.

[0269] Alternating Flank Gap Mar The flanking regions may contain both LNA and DNA nucleosides and are referred to as "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing at least one alternating flank are referred to as "alternating flank gapmers." Thus, an "alternating flank gapmer" is an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains one or more DNA nucleotides in addition to an LNA nucleoside. In some embodiments, at least one of regions F or F', or both regions F and F', contains both LNA nucleosides and DNA nucleosides. In such embodiments, flanking region F or F', or both F and F', contains at least three nucleosides, and the 5'-most and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides. Alternating flank LNA gapmers are disclosed in International Publication No. WO 2016 / 127002.

[0270] The alternating flanking regions can include up to three consecutive DNA nucleosides, for example, from 1 to 2, or 1 or 2 or 3 consecutive DNA nucleosides.

[0271] The alternating flanking regions are a series of integers representing the number of LNA nucleosides (L) followed by the number of DNA nucleosides (D), e.g., [L] 1-3 -[D] 1-3 -[L] 1-3 or [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2として注釈を付けることができる。In oligonucleotide design, these are often represented as numbers such that 2-2-1 represents 5'[L]2-[D]2-[L]3' and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The length of the flanks (regions F and F') in oligonucleotides with alternating flanks can be, for example, 4 to 8, e.g., 5 to 6, nucleosides, e.g., 4, 5, 6, or 7 modified nucleosides, as described herein above for these regions. It can be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F') to confer additional exonuclease resistance.

[0272] In one embodiment, the gapmer oligonucleotide of the invention can be represented by the following formula: F 4-6 -G 7-11 -F' 2-6、 In the formula, F is [L] 1-3 -[D] 1-3 -[L] 1-3 F' has a design of [L] 1-2 -[D] 1-2 -[L] 2-4、 or [L] 2-6 It has a design.

[0273] However, the total length of the gapmer region FG-F' is at least 16 nucleotides, for example 17 or 18 nucleotides in length.

[0274] Thus, gapmer oligonucleotides of the present invention can comprise at least one alternating flank. Typically, at least the F region is an alternating flank. In some embodiments, both the F region and the F' region are alternating flanks. In some embodiments, the F region is an alternating flank and the F' region is a uniform flank (i.e., F' is composed of only one type of sugar-modified nucleoside, such as only β-D-oxyLNA).

[0275] In some embodiments, the design of region F is selected from 3-2-1 (i.e., LLLDDL), 3-1-1 (i.e., LLLDL), 2-1-2 (LLDLL), 2-1-1 (LLDL), and 1-3-1 (i.e., LDDDL) designs.

[0276] In some embodiments, the design of region F' is 1-1-3 (i.e., LDLLL) or 1-1-2 (i.e., LDLL). In some embodiments, the design of region F is LL, LLL, or LLLL.

[0277] Region D' or D'' within the oligonucleotide Oligonucleotides of the invention, in some embodiments, can comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to a target nucleic acid, e.g., a gapmer region FG-F', and additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.

[0278] The addition of region D' or D" can be used for the purpose of linking a contiguous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used for linking, the conjugate moiety and the conjugate moiety can serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacturing.

[0279] Regions D' and D'' can be attached to the 5' end of region F or the 3' end of region F', respectively, to generate designs of the following formula: D'-FG-F', FG-F'-D'', or D'-FG-F'-D'', where FG-F' is the gapmer portion of the oligonucleotide and regions D' or D'' constitute separate portions of the oligonucleotide.

[0280] Region D' or D" independently comprises or consists of 1, 2, 3, 4, or 5 additional nucleotides and may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA, or base-modified versions thereof. The D' or D' region can serve as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO 2014 / 076195, including, by way of example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in WO 2015 / 113922, where they have been used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0281] In one embodiment, the oligonucleotide of the present invention comprises regions D' and / or D'' in addition to the contiguous nucleotide sequence that constitutes the gapmer.

[0282] In some embodiments, the oligonucleotides of the invention can be represented by the following formula: FG-F';especially 1-8 -G 5-16 -F' 2-8 , e.g., F 4-6 -G 7-11 -F' 2-6 D'-FG-F', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 , e.g., D' 1-3 -F 4-6 -G 7-11 -F' 2-6 FG-F'-D'', especially F 1-8 -G 5-16 -F'2-8 -D'' 1-3 D'-FG-F'-D'', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D'' 1-3 . In some embodiments, the internucleoside linkage located between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside linkage located between region F' and region D'' is a phosphodiester bond.

[0283] Conjugates The term conjugate, as used herein, refers to an oligonucleotide covalently attached to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalently attached to the antisense oligonucleotide, optionally via a linker group such as region D' or D".

[0284] Oligonucleotide conjugates and their synthesis are also reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0285] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug substance, a hormone, a lipophile, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0286] Exemplary conjugate moieties include those that can bind to asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, WO 2014 / 076196, WO 2014 / 207232, and WO 2014 / 179620. Such conjugates are useful for enhancing the uptake of oligonucleotides into the liver.

[0287] In some embodiments, the conjugate is an antibody or antibody fragment with specific affinity for the transferrin receptor, e.g., as disclosed in WO 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, e.g., an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment that targets the transferrin receptor.

[0288] Linker A bond or linker is a connection between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest through one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently attach a third region, such as the conjugate moiety (region C), to the first region, such as the oligonucleotide or consecutive nucleotide sequence (region A) that is complementary to the target nucleic acid.

[0289] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

[0290] The biocleavable linker (region B) comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in a mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions, or drugs, as well as salt concentrations similar to those found or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In some embodiments, the physiologically labile linker (biocleavable) comprises 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides, wherein at least two consecutive linkages are biocleavable, e.g., phosphodiester linkages, e.g., at least three or four or five consecutive phosphodiester linkages. Preferably, the nucleosides are DNA or RNA.

[0291] In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically labile linker composed of 2 to 5 consecutive phosphodiester-linked nucleosides, including at least two consecutive phosphodiester bonds at the 5' or 3' end of the consecutive nucleotide sequence of the antisense oligonucleotide.

[0292] In some embodiments, the physiologically labile linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein there is a phosphodiester bond between the two DNA nucleosides and at least one additional phosphodiester is present at the 5' or 3' end of the dinucleotide that links an oligonucleotide of the nucleic acid molecule to the dinucleotide or that links a conjugate moiety to the dinucleotide. For example, the linker can be a CA dinucleotide. In some embodiments, the physiologically labile linker comprises or consists of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, wherein there are phosphodiester bonds between the DNA nucleosides and, potentially, an additional phosphodiester bond at the 5' or 3' end of the trinucleotide. Biocleavable linkers comprising phosphodiesters are described in more detail in WO2014 / 076195 (herein incorporated by reference). In the conjugate compound having a biocleavable linker, when compared with a standard, at least about 50% of the conjugate moiety is cleaved from the oligonucleotide, for example, at least about 60% is cleaved, for example, at least about 70% is cleaved, for example, at least about 80% is cleaved, for example, at least about 85% is cleaved, for example, at least about 90% is cleaved, for example, at least about 95% of the conjugate moiety is cleaved from the oligonucleotide.

[0293] Region Y refers to a linker that is not necessarily biocleavable but primarily serves to covalently attach the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). Region Y linkers may comprise chain structures or oligomers of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups.

[0294] Oligonucleotide conjugates of the invention can be constructed from the following domain elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group, including a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0295] Pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the free base or free acid, without being biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. Additionally, these salts can be prepared by adding an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins.The compounds of the present invention may also exist in zwitterionic form.Particularly preferred pharmaceutically acceptable salts of compounds of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0296] treatment As used herein, the terms "treatment," "treating," "treating," and the like generally refer to obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in that it partially or completely cures the disease and / or adverse effects caused by the disease. The term "treatment," as used herein, encompasses any treatment of a disease in a subject, including: (a) inhibiting the disease; or (b) ameliorating (i.e., alleviating) the disease, i.e., causing regression of the disease. A compound that ameliorates and / or inhibits HBV infection is a compound that treats HBV infection. Preferably, the term "treatment," as used herein, relates to medical intervention of an already manifested disorder, such as the treatment of a previously defined manifested HBV infection or cancer.

[0297] prevention As used herein, the terms "preventing," "prevention," or "preventing" refer to prophylactic treatment, i.e., measures or measures the purpose of which is to prevent rather than cure a disease. Prevention means that the desired pharmacological and / or physiological effect is obtained prophylactically, in terms of completely or partially preventing a disease or its symptoms. Thus, "preventing HBV infection" as used herein includes preventing the occurrence of HBV infection in a subject and preventing the occurrence of symptoms of HBV infection. The present invention particularly contemplates the prevention of HBV infection in children of HBV-infected mothers. It also contemplates preventing acute HBV infection from transforming into chronic HBV infection.

[0298] patient For the purposes of the present invention, a "subject" or "patient" may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and other animals, particularly mammals, and other organisms. Thus, the means and methods provided herein are applicable to both human therapy and veterinary applications. Thus, as used herein, a subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the patient is suffering from a disease referred to herein, such as HBV infection or cancer. In some embodiments, the patient is susceptible to said disease. DETAILED DESCRIPTION OF THE INVENTION

[0299] One aspect of the present invention is an enhanced antisense oligonucleotide or conjugate thereof targeting FUBP1 for use in the treatment and / or prevention of HBV infection, e.g., chronic HBV infection, and proliferative diseases, e.g., cancer, particularly hepatocellular carcinoma.

[0300] One embodiment of the present invention is the antisense oligonucleotide or a conjugate thereof of the present invention, which is capable of reducing HBV DNA, such as cccDNA, and HBV RNA transcripts, such as pgRNA, in infected cells, such as HBV-infected cells.

[0301] In a further embodiment, the antisense oligonucleotides of the present invention or conjugates thereof are capable of reducing HBsAg and / or HBeAg in vivo in HBV-infected individuals.

[0302] Another aspect of the present invention is the use of the antisense oligonucleotide of the present invention or a conjugate thereof in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection, or in the treatment of cancer in which FUBP1 is overexpressed.

[0303] The antisense oligonucleotides of the present invention The enhanced antisense oligonucleotides or conjugates thereof of the present invention are potentially excellent FUBP1 inhibitors because they can target FUBP1 transcripts and promote their degradation via RNase H cleavage.

[0304] One aspect of the present invention is an enhanced antisense oligonucleotide or a conjugate thereof for use in the treatment and / or prevention of HBV infection or in the treatment of cancer.

[0305] This section describes enhanced antisense oligonucleotides or conjugates thereof suitable for use in the treatment and / or prevention of HBV infection or in the treatment of cancer.

[0306] The antisense oligonucleotides of the present invention or their conjugates can inhibit the expression of FUBP1 in vitro and in vivo. Inhibition is achieved by hybridizing the antisense oligonucleotide to a target nucleic acid encoding FUBP1 or involved in the regulation of FUBP1. The target nucleic acid can be a mammalian FUBP1 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and / or 5.

[0307] Thus, the oligonucleotides of the present invention are antisense oligonucleotides that target FUBP1.

[0308] In some embodiments, the antisense oligonucleotides or conjugates thereof of the present invention can modulate target expression by inhibiting or downregulating it. Preferably, such modulation results in at least 20% inhibition compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the normal expression level of the target. In some embodiments, the antisense oligonucleotides or conjugates thereof of the present invention can inhibit FUBP1 mRNA expression levels by at least 50% or 60% in vitro in PXB-PHH cells at 25 μM. In some embodiments, the antisense oligonucleotides or conjugates thereof of the present invention can inhibit FUBP1 protein expression levels by at least 50% in vitro in PXB-PHH cells at 25 μM. This range of target reduction is advantageous in selecting antisense oligonucleotides that correlate well with cccDNA reduction. Appropriately, the Examples provide assays that can be used to measure FUBP1 RNA inhibition (e.g., Examples 1 or 2). Target inhibition is caused by hybridization between the consecutive nucleotide sequence of the antisense oligonucleotide and the target nucleic acid. In some embodiments, the antisense oligonucleotide of the present invention contains a mismatch between the antisense oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to exhibit the desired inhibition of FUBP1 expression. The decrease in binding affinity resulting from the mismatch can be advantageously compensated for by increasing the number of nucleotides in the oligonucleotide and / or the number of modified nucleosides, such as 2' sugar-modified nucleosides containing LNA, present in the antisense oligonucleotide sequence, which can increase the binding affinity to the target.

[0309] One aspect of the present invention relates to enhanced antisense oligonucleotides of 12 to 30, e.g., 12 to 22, e.g., 16 to 20 nucleotides in length, comprising a contiguous nucleotide sequence of at least 12 nucleotides in length, e.g., 14, 15, 16, or 17 nucleotides in length, having at least 90% complementarity, e.g., 100% complementarity, to a target sequence from nucleotides 16184 to 16205, such as a target sequence selected from nucleotides 16184 to 16200, 16186 to 16203, 16188 to 16205, and 16189 to 16205 of SEQ ID NO: 1. In particular, antisense oligonucleotides capable of inhibiting the expression of FUBP1, i.e., reducing FUBP1 nucleic acid, such as FUBP1 mRNA, are considered part of the present invention.

[0310] In some embodiments, the antisense oligonucleotides of the present invention comprise a contiguous nucleotide sequence of 12 to 22 nucleotides, e.g., 15 to 20 nucleotides, that has at least 90% complementarity, e.g., perfect complementarity, to the target nucleic acid of SEQ ID NO: 10.

[0311] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides, e.g., 17 to 18 nucleotides, that has at least 90% complementarity, e.g., perfect complementarity, to the target nucleic acid of SEQ ID NO:11.

[0312] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides, e.g., 17 to 18 nucleotides, that has at least 90% complementarity, e.g., perfect complementarity, to a target nucleic acid of SEQ ID NO:18.

[0313] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, such as 15 to 18 nucleotides, for example 17 or 18 nucleotides, that has at least 90% complementarity, e.g., complete complementarity, to a target nucleic acid selected from the following regions of SEQ ID NO: 1: 16184-16205, 16184-16200, 16186-16203, 16188-16205, and 16189-16205 of SEQ ID NO: 1. It also comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, for example 15 to 18 nucleotides, for example 17 or 18 nucleotides, that has at least 90% complementarity, e.g., complete complementarity, to a target nucleic acid selected from the following regions of SEQ ID NO: 1: 30536-30553.

[0314] In some embodiments, the antisense oligonucleotide comprises a contiguous sequence of 12 to 30 nucleotides in length that is at least 90% complementary to a region of a target nucleic acid or target sequence, such as at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary.

[0315] The antisense oligonucleotides of the present invention, or their contiguous nucleotide sequences, are advantageous if they are perfectly complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0316] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid region of SEQ ID NO:1.

[0317] In some embodiments, the antisense oligonucleotides or contiguous nucleotide sequences of the invention are at least 95% complementary, eg, completely (or 100%) complementary, to the target nucleic acids of SEQ ID NO:1 and SEQ ID NO:4.

[0318] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15-22 nucleotides in length that is at least 90% complementary, e.g., 100% complementary, to a corresponding target sequence present in SEQ ID NO:1, wherein the target sequence is selected from nucleotides 16184-16205, 16184-16200, 16186-16203, 16188-16205, 16189-16205, and 30536-30553 of SEQ ID NO:1.

[0319] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:10.

[0320] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:11.

[0321] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:15.

[0322] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:19.

[0323] In some embodiments, the contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9 and 18, or at least 14 contiguous nucleotides thereof, such as 17 or 18 contiguous nucleotides thereof.

[0324] In some embodiments, the antisense oligonucleotide of the present invention, or its contiguous nucleotide sequence, comprises or consists of a length of 10 to 30 nucleotides, such as 12 to 25, such as 11 to 22, such as 12 to 20, such as 14 to 18 or 16 to 18 contiguous nucleotides.

[0325] In some embodiments, the antisense oligonucleotide, or its contiguous nucleotide sequence, comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer, or 18 or fewer nucleotides. For example, the antisense oligonucleotide, or its contiguous nucleotide sequence, can comprise 14, 15, 16, or 17 nucleotides. Any range provided herein should be understood to include the endpoints of the range. Thus, when an oligonucleotide is described as comprising 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.

[0326] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO:6.

[0327] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO:7.

[0328] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO:8.

[0329] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO:9.

[0330] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, such as at least 13, for example at least 14, for example at least 15, at least 16, at least 17 or 18 contiguous nucleotides present in SEQ ID NO: 18.

[0331] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length, for example 16, 17, or 18 contiguous nucleotides.

[0332] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NOs: 6, 7, 8, 9 and 18.

[0333] In an advantageous embodiment, the antisense oligonucleotide comprises one or more sugar-modified nucleosides, such as one or more 2'-sugar-modified nucleosides, for example, one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleosides is / are locked nucleic acid (LNA).

[0334] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.

[0335] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0336] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides.

[0337] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides and DNA nucleosides.

[0338] Advantageously, the 3'-most nucleoside of the antisense oligonucleotide, or of the contiguous nucleotide sequence thereof, is a 2'-sugar modified nucleoside.

[0339] Advantageously, the oligonucleotide contains at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0340] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0341] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0342] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0343] In some embodiments, all internucleoside linkages within a contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0344] In some embodiments, at least 75% of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0345] In some embodiments, all of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0346] In advantageous embodiments of the invention, the antisense oligonucleotide of the invention is capable of recruiting RNase H, such as RNase H1. In some embodiments, the antisense oligonucleotide of the invention or its contiguous nucleotide sequence is a gapmer.

[0347] In some embodiments, the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, consists of or comprises a gapmer of the formula 5'-FG-F'-3'.

[0348] In some embodiments, region G consists of 6 to 16 DNA nucleosides, e.g., 7 to 12 DNA nucleosides. In some embodiments, region F comprises 4 to 6 nucleosides and / or region F' comprises 2 to 6 nucleosides.

[0349] In some embodiments, regions F and F' each comprise at least one LNA nucleoside.

[0350] In some embodiments of the oligonucleotides of the present invention, all LNA nucleosides are β-D-oxy LNA nucleosides.

[0351] In some embodiments, the oligonucleotides of the invention are LNA gapmers with uniform flanks.

[0352] In some embodiments of the invention, the LNA gapmer is an alternating flank LNA gapmer. In some embodiments, the alternating flank LNA gapmer comprises at least one alternating flank (such as flank F). In some embodiments, the alternating flank LNA gapmer comprises one alternating flank (such as flank F) and one uniform flank (such as flank F'). In some embodiments, the alternating flank LNA gapmer comprises two alternating flanks. For example, the LNA gapmer can have a design selected from the following designs: 3-2-1-9-2, 3-1-1-10-2, 2-1-2-10-3, 2-1-1-11-3, 2-1-1-10-1-1-2, 2-1-1-10-4, 1-3-1-7-1-1-3, and 3-2-1-9-3. Alternatively, the LNA gapmer can have the following design: 1-1-3-9-1-1-2.

[0353] Table 6 lists the preferred designs for each motif sequence.

[0354] The present invention provides the following oligonucleotide compounds (Table 6): [Table 6]

[0355] The heading "Oligonucleotide Compound" in the table refers to the specific design of the motif sequence. Capital letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. The heading "Design" refers to the gapmer design, FG-F'. In gapmers with alternating flank designs, the flanks of the oligonucleotide are annotated as a series of integers, representing the number of β-D-oxy LNA nucleosides (L) followed by the number of DNA nucleosides (D). For example, a flank with a 2-2-1 motif represents LLDDL. Both flanks have β-D-oxy LNA nucleosides at the 5' and 3' ends. The gap region (G) consists of several DNA nucleosides located between the flanks.

[0356] For some embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1, and 9_1 (see Table 6). For example, the compound can be a compound having CMP number 7_3.

[0357] In an alternative embodiment, the oligonucleotide is the oligonucleotide of the compound having CMP number 18_1 (see Table 6).

[0358] In all cases, the FG-F' design may further comprise regions D' and / or D" as described in the "Definition" section of "Region D' or D" in an Oligonucleotide." In some embodiments, the oligonucleotides of the invention have one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5'- or 3'-end, e.g., 5'-end, of the gapmer region. In some embodiments, the oligonucleotides of the invention consist of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined above. Oligonucleotides comprising phosphodiester-linked DNA units at the 5'- or 3'-end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly advantageous as the conjugate moiety. See conjugate moiety for further details.

[0359] Conjugates Because HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the enhanced antisense oligonucleotides of the present invention to a conjugate moiety that increases delivery of the antisense oligonucleotide to the liver compared to unconjugated antisense oligonucleotides. In one embodiment, the liver-targeting moiety is selected from a moiety containing cholesterol or other lipids, or a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPR).

[0360] In some embodiments, the present invention provides a conjugate comprising an antisense oligonucleotide of the present invention covalently attached to a conjugate moiety.

[0361] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with an affinity equal to or greater than that of galactose. The affinity of numerous galactose derivatives for the asialoglycoprotein receptor has been studied (see, e.g., Jobst, ST and Drickamer, K. JB.C. 1996, 271, 6686) or can be readily determined using methods typical in the art.

[0362] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0363] To generate an ASGPR conjugate moiety, an ASPGR targeting moiety (preferably, GalNAc) can be attached to the conjugate scaffold. Generally, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties attached to a spacer that connects each GalNAc moiety to a brancher molecule that can be attached to an antisense oligonucleotide.

[0364] In further embodiments, the conjugate moiety is monovalent, bivalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety. Advantageously, the asialoglycoprotein receptor targeting moiety comprises an N-acetylgalactosamine (GalNAc) moiety.

[0365] GalNAc conjugate moieties can include, for example, those described in WO 2014 / 179620 and WO 2016 / 055601 and PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides with GalNAc moieties attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3 (YEE(ahGalNAc)3); glycotripeptides that bind to the asialoglycoprotein receptor on hepatocytes, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297; lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholan-based galactose clusters (e.g., carbohydrate recognition motifs for the asialoglycoprotein receptor).

[0366] The ASGPR-conjugate moiety, particularly the trivalent GalNAc-conjugate moiety, can be attached to the 3' or 5' end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR-conjugate moiety is attached to the 5' end of the oligonucleotide.

[0367] In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) such as those shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1 and 9L2, or the conjugate moiety is a mixture of 9A1 and 9A2; a mixture of 9C1 and 9C2 or a mixture of 9D1 and 9D2, particularly the trivalent N-acetylgalactosamine (GalNAc) shown in Figure 9D1 or 9D2 or mixtures thereof.

[0368] In some embodiments, the conjugate is selected from the group consisting of: 5'-GN2-C6 o c o a o m C s T s T s as t s G s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t st s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o c o a o G s c s t s t s T s t s t s a s t s g s g s t s T s ts m C s A s m C, and 5’-GN2-C6 o c o a o T s A s T s g s c s T s t s t s t s t<00003二2>a s t s g s g s t s T s T s m C, 5’-GN2-C6 o c o a o A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S ​​​Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is a 5-methylcytosine, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D, e.g., as shown in Figure 9D-1 or Figure 9D-2, or a mixture of both, preferably linked via a phosphodiester bond at the 5' end of the oligonucleotide. Chemical diagrams representing some molecules are shown in Figures 1-8 and 8.1.

[0369] In some embodiments, the conjugate is the conjugate shown in FIG.

[0370] In some embodiments, the conjugate is the conjugate shown in FIG.

[0371] In some embodiments, the conjugate is the conjugate shown in FIG.

[0372] In some embodiments, the conjugate is the conjugate shown in FIG.

[0373] In some embodiments, the conjugate is the conjugate shown in FIG.

[0374] In some embodiments, the conjugate is the conjugate shown in FIG.

[0375] In some embodiments, the conjugate is the conjugate shown in FIG.

[0376] In some embodiments, the conjugate is the conjugate shown in FIG.

[0377] In some embodiments, the conjugate is the conjugate shown in Figure 8.1.

[0378] The compounds depicted in Figures 1-8 and 8.1 are shown in protonated form, i.e., the S atom on the phosphorothioate linkage is protonated. It will be understood that the presence of a proton will depend on the acidity of the molecule's environment and the presence of an alternative cation (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomeric forms.

[0379] Pharmaceutically acceptable salts The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid or base addition salts that retain the biological effectiveness and properties of the compounds of the present invention and are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutical compounds into salts is a technique well known to medicinal chemists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of the compound provided herein can be a sodium salt.

[0380] In a further aspect, the present invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide or conjugate thereof, for example a pharmaceutically acceptable sodium salt, ammonium salt or potassium salt.

[0381] Manufacturing method In a further aspect, the present invention provides a method for producing an oligonucleotide of the present invention, comprising reacting nucleotide units to form covalently linked consecutive nucleotide units comprising the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al. (1987) Methods in Enzymology, vol. 154, pp. 287-313). In a further embodiment, the method further comprises reacting the consecutive nucleotide sequence with a conjugate moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect, there is provided a method for producing a composition of the present invention, comprising mixing an oligonucleotide or conjugated oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0382] Pharmaceutical Composition In a further aspect, the present invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium, ammonium, and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. Alternatively, the diluent may be water or a sodium chloride solution. In some embodiments, the oligonucleotide is used at a concentration of 50-300 μM solution in the pharmaceutically acceptable diluent.

[0383] Formulations suitable for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of drug delivery methods, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007 / 031091 provides further examples of suitable and preferred pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO 2007 / 031091.

[0384] In some embodiments, the antisense oligonucleotide or conjugate thereof, or a pharmaceutically acceptable salt thereof of the present invention is in a solid form, such as a powder, for example, a lyophilized powder.

[0385] In some embodiments, the antisense oligonucleotides or conjugates thereof of the present invention can be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for preparing pharmaceutical compositions depend on many criteria, including but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0386] These compositions may be sterilized by conventional sterilization techniques or sterile filtered. The resulting aqueous solutions may be packaged for immediate use or lyophilized, with the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparation will typically be 3 to 11, more preferably 5 to 9 or 6 to 8, and most preferably 7 to 8, e.g., 7 to 7.5. The resulting solid form compositions may be packaged in a plurality of single-dose units, each containing a fixed amount of the agent or agents, such as a sealed package of tablets or capsules. The solid form compositions may also be packaged in flexible volume containers, such as squeezable tubes designed for topically applied creams or ointments.

[0387] In some embodiments, the antisense oligonucleotides or conjugates thereof of the present invention are prodrugs. Particularly with respect to antisense oligonucleotide conjugates, once the prodrug is delivered to the site of action, e.g., a target cell, the conjugate moiety is cleaved from the oligonucleotide.

[0388] Purpose The enhanced antisense oligonucleotides of the present invention can be utilized, for example, as research reagents for diagnostic, therapeutic and prophylactic methods.

[0389] In research, such antisense oligonucleotides can be used to specifically regulate the synthesis of FUBP1 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention.Typically, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting a modulator of the gene or mRNA that produces the protein.

[0390] When the antisense oligonucleotides of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0391] The present invention also encompasses an in vivo or in vitro method for regulating FUBP1 expression in a target cell expressing FUBP1, comprising administering to the cell an effective amount of an antisense oligonucleotide, a conjugate thereof, or a pharmaceutical composition of the present invention.

[0392] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells that form part of a mammalian tissue. In a preferred embodiment, the target cells are present in the liver. The target cells may be hepatocytes.

[0393] One aspect of the present invention relates to the antisense oligonucleotide, a conjugate thereof, or a pharmaceutical composition of the present invention for use as a pharmaceutical.

[0394] In one aspect of the present invention, the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention can reduce cccDNA levels in infected cells, thereby inhibiting HBV infection. In particular, the antisense oligonucleotide or its conjugate can affect one or more of the following parameters in infected cells: (i) reduction of cccDNA, and / or (ii) reduction of pgRNA, and / or (iii) reduction of HBV DNA, and / or (iv) reduction of HBV viral antigens.

[0395] For example, an antisense oligonucleotide or conjugate thereof that inhibits HBV infection can (i) reduce cccDNA levels in infected cells by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control, or (ii) reduce pgRNA levels by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control. The control can be untreated cells or animals, or cells or animals treated with an appropriate control.

[0396] Inhibition of HBV infection can be measured in vitro using HBV-infected primary human hepatocytes or in vivo using the humanized hepatocyte PXB mouse model (available from PhoenixBio; see also Kakuni et al. (2014) Int. J. Mol. Sci. 15:58-74). Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, for example, using a CLIA ELISA kit (Autobio Diagnostic), according to the manufacturer's instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the Materials and Methods section. A further method for assessing whether a test compound inhibits HBV infection is to measure HBV DNA secretion by qPCR, or using Northern blot, in situ hybridization, or immunofluorescence, for example, as described in WO 2015 / 173208.

[0397] By reducing FUBP1 levels, the onset or treatment of HBV infection can be inhibited using the antisense oligonucleotides, conjugates thereof, or pharmaceutical compositions of the present invention. In particular, the destabilization and reduction of cccDNA, antisense oligonucleotides, conjugates thereof, or pharmaceutical compositions of the present invention more efficiently inhibits or treats the onset of chronic HBV infection compared to compounds that only reduce HBsAg secretion.

[0398] Thus, one aspect of the present invention relates to the use of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention to reduce cccDNA and / or pgRNA in an HBV-infected individual.

[0399] A further aspect of the present invention relates to the use of the antisense oligonucleotide, a conjugate thereof, or a pharmaceutical composition of the present invention for inhibiting or treating the development of chronic HBV infection.

[0400] A further aspect of the present invention relates to the use of the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention to reduce infectivity in an HBV-infected individual. In a specific aspect of the present invention, the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention inhibits the development of chronic HBV infection.

[0401] The subject to be treated with the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention (or one that prophylactically receives the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention) is preferably a human, more preferably an HBsAg-positive and / or HBeAg-positive human patient, more preferably an HBsAg-positive and HBeAg-positive human patient.

[0402] Therefore, the present invention relates to a method for treating HBV infection, which comprises administering an effective amount of the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention. The present invention further relates to a method for preventing liver cirrhosis and hepatocellular carcinoma resulting from chronic HBV infection.

[0403] The present invention also provides use of the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention for the manufacture of a medicament, particularly a medicament for use in treating HBV infection or chronic HBV infection, or reducing the infectivity of HBV-infected individuals. In a preferred embodiment, the medicament is prepared in a dosage form for subcutaneous administration.

[0404] The present invention also provides use of the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention for producing a medicament, wherein the medicament is in a dosage form for intravenous administration.

[0405] Combination therapy In some embodiments, the enhanced antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention is for use in combination treatment with another therapeutic agent, which may be, for example, a standard therapeutic agent for the disease or disorder described above.

[0406] By way of example, the antisense oligonucleotide, its conjugate, or pharmaceutical composition may be used in combination with other active agents, such as oligonucleotide-based antivirals, e.g., sequence-specific oligonucleotide-based antivirals, that act via either antisense (including other LNA oligomers), siRNA (such as ARC520), aptamers, morpholinos, or any other antiviral, nucleotide sequence-dependent mode of action.

[0407] As a further example, the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition can be used in combination with other active agents, such as interferons (e.g., pegylated interferon alpha), TLR7 agonists (e.g., GS-9620), or immunostimulatory antiviral compounds, such as therapeutic vaccines.

[0408] As a further example, the antisense oligonucleotides, conjugates thereof, or pharmaceutical compositions can be used in combination with other active agents, such as small molecules, that have antiviral activity. These other active agents can be, for example, nucleoside / nucleotide inhibitors (e.g., entecavir or tenofovir disoproxil fumarate), inclusion inhibitors, or entry inhibitors (e.g., Myrcludex B).

[0409] In certain embodiments, the additional therapeutic agent may be an HBV drug, a hepatitis C virus (HCV) drug, a chemotherapy drug, an antibiotic, an analgesic, a nonsteroidal anti-inflammatory drug (NSAID), an antifungal drug, an antiparasitic drug, an antiemetic drug, an antidiarrheal drug, or an immunosuppressant drug.

[0410] In particular, in related embodiments, the additional HBV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alfacon-1 (pegylated and non-pegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or HBV antibody therapy (monoclonal or polyclonal).

[0411] In certain other related embodiments, the additional HCV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and non-pegylated); ribavirin; Pegasys; HCV RNA replication inhibitors (e.g., ViroPharma VP50406 series); HCV antisense agents; HCV therapeutic vaccines; HCV protease inhibitors; HCV helicase inhibitors; or HCV monoclonal antibody therapy or HCV polyclonal antibody therapy.

[0412] Administration The enhanced antisense oligonucleotides, conjugates thereof, or pharmaceutical compositions of the present invention are formulated, dosed, and administered in a manner consistent with good medical practice. Factors to consider in this regard include the particular mammal being treated, the clinical condition of the individual patient, the drug delivery site, administration method, administration schedule, the age and sex of the patient, and other factors known to medical professionals. As used herein, an "effective amount" (also known as a "therapeutically effective dose") refers to the amount of a compound that elicits the biological or medical response of the subject sought by a physician or other clinician. The "effective amount" of the oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention will depend on such considerations and is the minimum amount necessary to inhibit HBsAg and / or HBeAg. For example, such an amount may be less than an amount that is toxic to the recipient's cells or the entire mammal.

[0413] In some embodiments, the antisense oligonucleotide, conjugate thereof, or pharmaceutical composition of the present invention is administered at a dose of 0.1 to 15 mg / kg, for example, 0.2 to 10 mg / kg, for example, 0.25 to 5 mg / kg, and may be administered once a week, once every two weeks, once every three weeks, or once a month.

[0414] The antisense oligonucleotides, conjugates thereof or pharmaceutical compositions of the present invention may be administered topically (e.g., to the skin, by inhalation, to the eye or ear, etc.) or enterally (e.g., orally or through the digestive tract) or parenterally (e.g., intravenously, subcutaneously, or intramuscularly).

[0415] In a preferred embodiment, the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention is administered parenterally, including intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion. In one embodiment, the active oligonucleotide or oligonucleotide conjugate is administered intravenously. For GalNAc conjugate compounds, subcutaneous administration may be advantageous to delay saturation of ASGP receptors.

[0416] Embodiments of the present invention The following embodiments of the present invention can be used in combination with any other embodiment described herein. The definitions and explanations provided above, especially in the "Summary of the Invention", "Definitions" and "Detailed Description of the Invention" sections, apply mutatis mutandis below.

[0417] 1. An antisense oligonucleotide comprising a contiguous nucleotide sequence that is at least 90% complementary, for example, completely complementary, to a FUBP1 nucleic acid, and that is capable of inhibiting the expression of FUBP1, such as human FUBP1, in a cell.

[0418] 2. The antisense oligonucleotide of embodiment 1, a) the contiguous nucleotide sequence is at least 90% complementary, e.g., perfectly complementary, to a region within exon 14 of human FUBP1 (see Table 3); or b) An antisense oligonucleotide whose contiguous nucleotide sequence is at least 90% complementary, for example, completely complementary, to a region within exon 20 of human FUBP1 (see Table 3).

[0419] 3. The antisense oligonucleotide according to embodiments 1 and 2, a) the contiguous nucleotide sequence is completely complementary to the region of nucleotides 16184 to 16205 of human FUBP1 pre-mRNA shown in SEQ ID NO: 1, for example, a region selected from the region of nucleotides 16184 to 16200, nucleotides 16186 to 16203, nucleotides 16188 to 16205, and nucleotides 16189 to 16205 of SEQ ID NO: 1; or b) An antisense oligonucleotide whose contiguous nucleotide sequence is perfectly complementary to the region from nucleotides 30536 to 30553 of human FUBP1 pre-mRNA shown in SEQ ID NO:1.

[0420] 4. An antisense oligonucleotide described in any one of embodiments 1 to 3, wherein a) the consecutive nucleotide sequence is perfectly complementary to SEQ ID NO: 10 and / or SEQ ID NO: 11, or b) the consecutive nucleotide sequence is perfectly complementary to SEQ ID NO: 19.

[0421] 5. The antisense oligonucleotide according to any one of embodiments 1 to 4, which is 12 to 30 nucleotides in length, such as 12 to 22 nucleotides in length, such as 16 to 20 nucleotides in length.

[0422] 6. The antisense oligonucleotide of any one of embodiments 1 to 4, wherein the contiguous nucleotide sequence is a contiguous sequence of at least 12 nucleotides, for example, 14, 15, 16, 17, or 18 nucleotides.

[0423] 7. The antisense oligonucleotide of embodiment 6, wherein the contiguous nucleotide sequence is a contiguous sequence of 17 or 18 nucleotides.

[0424] 8. The antisense oligonucleotide of any one of embodiments 1 to 7, wherein the consecutive nucleotide sequence is 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9 and 18, or at least 15 consecutive nucleotides thereof.

[0425] 9. The antisense oligonucleotide of any one of embodiments 1 to 8, comprising one or more modified nucleosides in the consecutive nucleotide sequence.

[0426] 10. The antisense oligonucleotide of embodiment 9, wherein one or more modified nucleosides in the contiguous nucleotide sequence are 2' sugar-modified nucleosides.

[0427] 11. The antisense oligonucleotide of embodiment 10, wherein the one or more 2'-sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

[0428] 12. The antisense oligonucleotide of any one of embodiments 9 to 11, wherein the one or more modified nucleosides are LNA nucleosides, such as oxy-LNA, having the following 2'-4' bridge: -O-CH2-.

[0429] 13. The antisense oligonucleotide of embodiment 12, wherein one or more modified nucleosides is β-D-oxy-LNA.

[0430] 14. The antisense oligonucleotide of any one of embodiments 1 to 13, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0431] 15. The antisense oligonucleotide of any one of embodiments 1 to 14, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0432] 16. The antisense oligonucleotide of any one of embodiments 1 to 15, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0433] 17. The antisense oligonucleotide of embodiment 16, wherein all internucleoside linkages in the consecutive nucleotide sequence are phosphorothioate internucleoside linkages.

[0434] 18. The antisense oligonucleotide of any one of embodiments 1 to 17, wherein the antisense oligonucleotide is an antisense oligonucleotide capable of recruiting RNase H, such as RNase H1.

[0435] 19. The antisense oligonucleotide of embodiment 18, wherein the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, consists of or comprises a gapmer of the formula 5'-FG-F'-3'.

[0436] 20. The antisense oligonucleotide of embodiment 19, wherein region G has a length of 6 to 16 DNA nucleosides, such as 7 to 12 DNA nucleosides, such as 7 to 11 DNA nucleosides.

[0437] 21. The antisense oligonucleotide of any one of embodiments 18 to 20, wherein regions F and F' each comprise at least one LNA nucleoside, e.g., regions F and F' each comprise at least one LNA nucleoside.

[0438] 22. The antisense oligonucleotide of any one of embodiments 18 to 21, wherein region F has a length of 1 to 8 DNA nucleosides, for example 4 to 6 DNA nucleosides.

[0439] 23. The antisense oligonucleotide of any one of embodiments 18 to 22, wherein region F' has a length of 1 to 8 DNA nucleosides, for example 2 to 6 DNA nucleosides.

[0440] 24. The antisense oligonucleotide or its continuous nucleotide sequence is represented by the formula F 4-6 -G 7-11 -F' 2-6 24. The antisense oligonucleotide according to any one of embodiments 18 to 23, consisting of or comprising a gapmer of the formula:

[0441] 25. The following CTTatGctttttatgGT (SEQ ID NO: 6), CTTaTgctttttatgGT (SEQ ID NO: 6), CTtATgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatGgTT (SEQ ID NO: 7), CTtAtgctttttatGGTT (SEQ ID NO: 7), GcttTttatggtTtCAC (SEQ ID NO: 8), TATgcTttttatggtTTC (SEQ ID NO: 9), and AcCAAttttcatttCtAC (SEQ ID NO: 18) The antisense oligonucleotide according to any one of embodiments 1 to 24, selected from the group of antisense oligonucleotides consisting of: Antisense oligonucleotides in which uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0442] 26. A conjugate comprising an antisense oligonucleotide according to any one of embodiments 1 to 25 and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

[0443] 27. The conjugate of embodiment 27, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine.

[0444] 28. The conjugated compound of embodiment 27, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0445] 29. The conjugate compound of embodiment 27 or 28, wherein the conjugate moiety is monovalent, bivalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.

[0446] 30. The conjugate compound of embodiment 29, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer connecting each GalNAc moiety to a brancher molecule that can be conjugated to an antisense compound.

[0447] 31. The conjugate compound according to embodiment 30, wherein the spacer is a PEG spacer.

[0448] 32. The conjugate compound of any one of embodiments 26-31, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

[0449] 33. The conjugate compound of any one of embodiments 26-32, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1 and 9L2.

[0450] 34. The conjugate compound of embodiment 33, wherein the conjugate moiety is a trivalent GalNAc moiety of Figure 9D1 or 9D2, or a mixture thereof.

[0451] 35. A conjugate compound according to any one of embodiments 26 to 34, comprising a linker disposed between the antisense oligonucleotide and the conjugate moiety.

[0452] 36. The conjugate compound of embodiment 35, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester-linked nucleosides, such as 2 consecutive phosphodiester-linked nucleosides, such as phosphodiester-linked nucleosides.

[0453] 37. The conjugate of any one of embodiments 26-36, selected from the group consisting of: 5'-GN2-C6 o c o a o m C s T s T s a s t s G s c s t s t s t s t s t s as t s g s G s T、 5’-GN2-C6 o c o a o m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o c o a o G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、 5’-GN2-C6 o c o a o Ts A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C, and 5'-GN2-C6 o c o a o A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C Preferably, capital letters represent β-D-oxy LNA nucleosides and lower case letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m c is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D, e.g., a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D-1 or Figure 9D2, or a mixture of both, preferably linked via a phosphodiester bond at the 5' end of the oligonucleotide.

[0454] 38. The conjugate shown in Figure 1.

[0455] 39. The conjugate shown in Figure 2.

[0456] 40. The conjugate shown in Figure 3.

[0457] 41. The conjugate shown in Figure 4.

[0458] 42. The conjugate shown in Figure 5.

[0459] 43. The conjugate shown in Figure 6.

[0460] 44. The conjugate shown in Figure 7.

[0461] 45. The conjugate shown in Figure 8.

[0462] 46. ​​The conjugate shown in Figure 8.1.

[0463] 47. A pharmaceutically acceptable salt of the oligonucleotide of any one of embodiments 1 to 25 or the conjugate of any one of embodiments 26 to 46.

[0464] 48. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of embodiments 1 to 25, a conjugate according to any one of embodiments 26 to 46, or a pharmaceutically acceptable salt according to embodiment 48, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0465] 49. An in vivo or in vitro method for modulating FUBP1 expression in a target cell expressing FUBP1, comprising administering to the cell an effective amount of an antisense oligonucleotide described in any one of embodiments 1 to 25, a conjugate described in any one of embodiments 26 to 46, a pharmaceutically acceptable salt described in embodiment 48, or a pharmaceutical composition described in embodiment 48.

[0466] 50. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of the antisense oligonucleotide of any one of embodiments 1 to 25, the conjugate of any one of embodiments 26 to 46, the pharmaceutically acceptable salt of embodiment 47, or the pharmaceutical composition of embodiment 48, wherein the disease is hepatitis B virus (HBV) infection and / or cancer.

[0467] 51. An antisense oligonucleotide according to any one of embodiments 1 to 25, a conjugate according to any one of embodiments 26 to 46, a pharmaceutically acceptable salt according to embodiment 47, or a pharmaceutical composition according to embodiment 48, for use in medicine.

[0468] 52. The antisense oligonucleotide of any one of embodiments 1 to 25, the conjugate of any one of embodiments 26 to 46, the pharmaceutically acceptable salt of embodiment 47, or the pharmaceutical composition of embodiment 48 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer.

[0469] 53. Use of the antisense oligonucleotide according to any one of embodiments 1 to 25, the conjugate according to any one of embodiments 26 to 46, the pharmaceutically acceptable salt according to embodiment 47, or the pharmaceutical composition according to embodiment 48 for the preparation of a medicament for treating or preventing hepatitis B virus (HBV) infection and / or cancer.

[0470] 54. The method of embodiment 50, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use according to embodiment 52, or the use according to embodiment 53, wherein the disease is hepatitis B virus (HBV) infection, for example, chronic HBV infection.

[0471] 55. The method of embodiment 50, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use according to embodiment 52, or the use according to embodiment 53, wherein the disease is cancer, for example hepatocellular carcinoma.

[0472] 56. An antisense oligonucleotide according to any one of embodiments 1 to 25, a conjugate according to any one of claims 26 to 33 and 45, a pharmaceutically acceptable salt of embodiment 47, or a pharmaceutical composition according to embodiment 48, a use according to claim 53, or a method according to claims 54 and 54, wherein the antisense oligonucleotide is AcCAAttttcatttCtAC (SEQ ID NO: 18).

[0473] 57. An antisense oligonucleotide according to any one of embodiments 1 to 25, a conjugate according to any one of claims 26 to 33 and 42, a pharmaceutically acceptable salt of embodiment 47, or a pharmaceutical composition according to embodiment 48, a use according to claim 53, or a method according to claims 54 and 54, wherein the antisense oligonucleotide is CTtAtgctttttatGgTT (SEQ ID NO: 7). [Example]

[0474] Introduction Overexpression and mutation of FUBP1 have long been known to be associated with cancer. In particular, strong overexpression of FUBP1 in human hepatocellular carcinoma (HCC) supports tumor growth and correlates with poor patient prognosis.

[0475] HBV cccDNA in infected hepatocytes is involved in persistent chronic infection and reactivation and serves as the template for all viral subgenomic transcripts and pregenomic RNAs (pgRNAs), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling.

[0476] WO 2019 / 193165 showed that FUBP1 is involved in cccDNA stability. This knowledge provides an opportunity to destabilize cccDNA in HBV-infected subjects, opening up the opportunity for a complete cure for chronically infected HBV patients.

[0477] In this study, we screened over 2,000 antisense oligonucleotides targeting human FUBP1. This screening identified compounds that were particularly potent and effective at targeting human FUBP1. Specifically, we identified nine alternating flank gapmer LNA oligonucleotides that target a region within exon 14 of human FUBP1 and conferred strong downregulation of human FUBP1 in vitro. Additionally, we identified one alternating flank gapmer LNA oligonucleotide that targets a region within exon 20 of human FUBP1 and also conferred strong downregulation of human FUBP1. A summary of the nine identified compounds is shown in Table 6 above.

[0478] The target sequences of the identified compounds overlap with those of CMP Nos. 53_1 and 54_1 disclosed in WO 2019 / 193165. These two compounds inhibit FUBP1 in HeLa cells by approximately 70% at 5 μM. However, nine identified compounds are clearly more effective, inhibiting FUBP1 in HeLa cells by approximately 25%-35% at 3.3 μM or by approximately 27% at 5 μM (CMP No. 18_1). In addition, they are more efficient in targeting FUBP1 in HeLa cells than CMP No. 50_1, the best compound in WO 2019 / 193165 (see Example 1).

[0479] A summary of prior art compounds 35_1, 50_1, 53_1, 54_1, 78_1, and 79_1 from WO 2019 / 193165 is provided in Table 7 below. The compounds are gapmers with uniform flanks. CMP No. 50_1 was the best compound in PHH cells, and CMP No. 35_1 was the best compound in HeLa cells. CMP Nos. 53_1 and 54_1 are closest to CMP Nos. 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1, and 9_1. CMP Nos. 78_1 and 79_1 are closest to CMP No. 18_1.

[0480] [Table 7] For compounds: capital letters represent LNA nucleosides (β-D-oxyLNA nucleosides were used), all LNA cytosines are 5-methylcytosines, lowercase letters represent DNA nucleosides, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0481] Example 1: Testing the in vitro efficacy of antisense oligonucleotides targeting human FUBP1 mRNA in Hela cells Antisense oligonucleotides targeted to FUBP1 were tested for their ability to reduce FUBP1 mRNA expression in human Hela cells obtained from ECACC (catalog no. 93021013).

[0482] Hela cells were grown in cell culture medium (EMEM [Sigma, catalog no. M2279] supplemented with 10% fetal bovine serum [Sigma, catalog no. F7524], 2 mM glutamine [Sigma, catalog no. G7513], 0.1 mM NEAA [Sigma, catalog no. M7145], and 0.025 mg / ml gentamicin [Sigma, catalog no. G1397]. Cells were washed with phosphate-buffered saline (PBS) [Sigma, cat. no. 14190-094] and then trypsinized every 5 days by adding 0.25% trypsin-EDTA solution (Sigma, T3924), incubating at 37°C for 2–3 min, and triturating.

[0483] For experiments, 2500 cells were seeded per well in 190 μL of growth medium in a 96-well plate (Nunc catalog number 167008). Approximately 24 hours after seeding, ASOs dissolved in PBS were added to reach the final custom concentration. Cells were incubated for 3 days without changing the medium.

[0484] After incubation, cells were harvested by removing the medium followed by the addition of 125 μL of RLT Lysis buffer (Qiagen 79216) and 125 μL of 70% ethanol. RNA was purified according to the manufacturer's instructions (Qiagen RNeasy 96 kit) and eluted in a final volume of 200 μL of DNase / RNase-free water (Gibco).

[0485] The RNA was heat-shocked at 90°C for 40 seconds to melt the RNA:LNA duplex, transferred directly to ice, and spun down before use. For the one-step qPCR reaction, a master mix was generated by mixing qPCR mix (qScript™ XLE 1-Step RT-qPCR TOUGHMIX® Low ROX (QauntaBio, catalog number 95134-500)) with two IDT probes (final concentration 1X). Taqman probes were obtained from IDT:FUBP1:Hs.PT.58.26883775 (primer-to-probe ratio 2, FAM) or ThermoFisher Scientific:GUSB:4326320E. Next, the master mix (6 μL) and RNA (4 μL, 1–2 ng / μL) were mixed in a quantitative PCR plate (MICROAMP® Optical 384-well, 4309849). After sealing, the plate was rapidly spun (1000 g for 1 minute at room temperature) and transferred to a Viia™ 7 system (Applied Biosystems, Thermo) using the following PCR conditions: 50°C for 15 minutes; 95°C for 3 minutes; 40 cycles of: 95°C for 5 seconds, followed by a temperature decrease of 1.6°C / second, followed by 60°C for 45 seconds. Data were analyzed using QuantStudio™ Real_time PCR software.

[0486] qPCR data were captured and quality control of raw data was performed with Quantstudio 7 software.

[0487] The data was then imported into E-Workbook and the BioBook template was used to capture and analyze the data. The following steps were used to analyze the data: 1. Calculate the amount using the delta-delta Ct method (amount = 2^(-Ct) * 1000000000) 2. Normalize the amount to the amount calculated for a housekeeping gene assay run in the same well. Relative target amount = amount_target / amount_housekeeping 3. RNA knockdown was calculated for each well by dividing by the average of all PBS-treated wells on the same plate. Normalized target amount = (relative target amount / [average] relative target amount]_pbs_well) * 100 4. Final data is expressed as a percentage of untreated (PBS) wells.

[0488] 5. For concentration-response experiments, curves were fitted from the RNA knockdown values ​​(steps 3-4) for each compound (either 8 or 10 concentrations, depending on the dilution model). Curves were fitted using a 4-parameter sigmoidal dose-response model in Biobook.

[0489] The relative FUBP1 mRNA expression levels are shown in Table 8 as a percentage of the control, i.e., the lower the value, the greater the inhibition. Further results are shown in Figure 11.

[0490] [Table 8]

[0491] Example 2: Testing the in vitro efficacy of antisense oligonucleotides targeting human FUBP1 mRNA in primary human hepatocytes (PXB-PHH) Fresh primary human hepatocytes (PXB-PHH) harvested from humanized mice (uPA / SCID mice) (referred to herein as PHH) were obtained in a 96-well format from PhoenixBio Co., Ltd. (Japan) and cultured in modified hepatocyte clonal growth medium (dHCGM), a DMEM medium containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO3, 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS (Ishida et al., 2015).

[0492] Cells were cultured at 37°C in a humidified atmosphere containing 5% CO. Culture medium was changed twice a week until harvest.

[0493] Uninfected cells were treated once with 5 μM and harvested 7 days later. For all treatments, cells were dosed with oligonucleotide compounds in a final volume of 120 μL / well of dHCGM medium. Experiments for RNA measurements were performed in biological duplicate.

[0494] Real-time PCR of FUBP1 RNA was then performed. Total mRNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, #05467535001) according to the manufacturer's protocol. mRNA expression levels were quantified in technical duplicates by qPCR using a QuantStudio 12K Flex (Applied Biosystems), a TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems, #4392938), and a human GusB endogenous control (Applied Biosystems, #Hs00939627_m1). mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GusB and untreated cells. The TaqMan primers used for quantification of GusB RNA and FUBP1 RNA are listed in the table below.

[0495] [Table 9]

[0496] The relative FUBP1 mRNA expression levels of eight compounds (CMP Nos. 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1 and 9_1; CMP Nos. 78_1 and 79_1) in PXB-PHH cells are shown in Table 10 as % of the control; i.e., the lower the value, the greater the inhibition. The FUBP1 mRNA expression levels of CMP No. 18_1) in PXB-PHH cells are analyzed in Example 3.

[0497] [Table 10] Conclusions drawn from Examples 1 and 2 The data in Examples 1 and 2 demonstrate that targeting FUBP1 with LNA ASOs leads to efficient reduction of FUBP1, as shown in Table 6.

[0498] Example 3: Further analysis of CMP numbers 7_1 and 18_1 Below, we describe additional experiments using two of the nine identified compounds: CMP numbers 7_3 and 18_1. In these experiments, the two compounds were compared with the two previous compounds that gave the best results in WO 2019 / 193165.

[0499] Materials and Methods Primary human hepatocytes (PXB-PHH) Fresh primary human hepatocytes (PXB-PHH) were cultured as described in Example 2, except that a 24-well format was used.

[0500] ASO sequences and compounds Table 11 provides a summary of the compounds tested in Example 3.

[0501] [Table 11]

[0502] HBV infection and oligonucleotide treatment Upon arrival, PHH cells were infected at an MOI of 110 using purified inoculum (genotype C) from a chronic patient by incubating PHH cells with HBV in 4% (v / v) PEG in PHH medium for 16 hours. Cells were then washed three times with PBS and cultured in fresh PHH medium in a humidified atmosphere of 5% CO2. Four days after infection, cells were treated in duplicate with FUBP1 LNA (see Table 11) at a final concentration of 10 μM or with PBS as a no-drug control (NDC). On the day of treatment, the old medium was removed from the cells and replaced with 400 μl / well of fresh PHH medium. Per well, 100 μL of 50 μM of each FUBP1 LNA or PBS as an NDC was added to 400 μL of PHH medium. The same treatment was repeated three times on days 4, 11, and 18 postinfection. The cell culture medium was replaced with fresh medium every three days on days 7, 14, and 21 postinfection.

[0503] Real-time PCR of intracellular HBV pgRNA and FUBP1 mRNA After determining cell viability, cells were washed once with PBS. Total RNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, #05467535001) according to the manufacturer's protocol. FUBP1 mRNA and viral pgRNA expression levels were quantified in technical duplicates by qPCR using a QuantStudio 12K Flex (Applied Biosystems), a TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems, #4392938), and a human GusB endogenous control (Applied Biosystems, #Hs00939627_m1). Relative expression of FUBP1 mRNA and viral pgRNA was analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GusB and untreated cells. The TaqMan primers used for quantification of GusB RNA, FUBP1 RNA, and HBV pgRNA are listed in Table 12.

[0504] [Table 12]

[0505] result The relative FUBP1 mRNA expression levels of the tested compounds are shown in Table 13 and Figure 12. As can be deduced from Table and Figure 13, both compounds of the present invention (CMP Nos. 7_3 and 18_1) reduce target mRNA expression by about 80% compared to NDC. Their effect on FUBP1 mRNA levels is much stronger than that of the prior art compounds (CMP Nos. 50_1 and 35_1).

[0506] [Table 13]

[0507] Table 14 shows pgRNA in HBV-infected PHH cells treated with different concentrations of antisense compounds. As can be deduced from the table, downregulation was related to the concentration of the antisense compounds. At a concentration of 10 μM, the lowest pgRNA levels were observed for CMP No. 7_3. Furthermore, the highest pgRNA levels were observed for the prior art compound with CMP No. 35_1. CMP No. 18_1 downregulated HBV pgRNA in a manner similar to the prior art compound CMP No. 50_1.

[0508] [Table 14]

[0509] Cells were also tested at a concentration of 2 μM, once a week for 3 weeks. At 2 μM, CMP No. 7_3 demonstrated the best FUBP1 mRNA KD, showing a 50% reduction in mRNA expression. Thus, the effect was concentration-dependent (as an 80% reduction was observed at 2 μM). Furthermore, CMP No. 18_1 showed a similar effect on target mRNA expression levels (at 2 μM) compared to prior art oligos.

[0510] Example 4: In vivo PK / PD of FUBP1 ASO The in vivo hepatic PK / PD correlation of oligonucleotides with CMP numbers 7_3 and 18_1 conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide was evaluated in a single-dose mouse study using C57BL / 6 mice (see, e.g., Figures 5 and 8.1 for the structures of the conjugates). Mice were administered 3 mg / kg subcutaneously and terminated at different time points. Fubp1 mRNA knockdown, compound exposure, and PKPD were measured as described below.

[0511] Materials and Methods Processing of tissue samples [Table 15]

[0512] Liver samples were frozen in 2 ml round-bottom Eppendorf tubes and homogenized for 2 × 1.5 min in MagNa pure buffer (Roche) on a TissueLyser II (Qiagen) after adding 5 mm homogenization beads. After sample homogenization was complete, the homogenate was left at room temperature (RT) for 30 min to complete tissue lysis. All steps of the homogenization process were performed in a flow hood due to the buffer thiocyanate salt and mercaptoethanol content. After lysis, the homogenate was centrifuged at 17,000 g for 3 min.

[0513] To avoid overloading the MagNA pure instrument, the homogenate was diluted to approximately 20 mg tissue per 400 μL. 350 μL of the homogenate was used for RNA extraction in a MagNA pure 96 instrument for subsequent qPCR analysis. The remaining aliquot of homogenate was used for hELISA analysis.

[0514] Hybridization ELISA The following oligos and (all LNA phospho-diester) ELISA probes were used in the hELISA analysis, all of which were designed, synthesized and qualified at Roche Innovation Center Copenhagen A / S. [Table 16] [Table 17] [Table 18]

[0515] Prior to hELISA analysis, homogenates were brought to RT and vortexed before use. Samples were diluted at least 10-fold with 5x SSCT buffer.

[0516] Sample matrix and dilution factors matching appropriate standards were run on every plate, prepared in parallel with the samples using the relevant oligos (from quality and identity checked formulations). Standards for each compound were spiked into a sample pool derived from naïve samples. Spike-in concentrations were within approximately 10-fold of the oligo content of the samples.

[0517] Samples and standards were added to the dilution plate at the desired settings to create a dilution series: 300 μL of sample / standard + capture detection solution was added to the first well, and 150 μL of capture detection solution was added to the remaining wells.

[0518] Two-fold dilution series of standards and samples were made by sequentially transferring 150 μL of liquid. Two to four wells were reserved for blanks (capture detection solution only). For optimal results, a two-fold sample dilution series of at least six wells is recommended.

[0519] The samples in the dilution plate were incubated at room temperature for 30 minutes. 100 μL of liquid was transferred from the dilution plate to the streptavidin plate. The plate was incubated with gentle agitation (plate shaker) at room temperature for 1 hour. The wells were aspirated and washed three times with 300 μL of 2x SSCT buffer.

[0520] 100 μL of anti-DIG-AP diluted 1:4000 in PBST (prepared the same day) was added to each well and incubated for 1 hour at room temperature with gentle agitation. The wells were aspirated and washed three times with 300 μL of 2x SSCT buffer.

[0521] 100 μL of substrate (AP) solution (freshly prepared) was added to each well. After 30 minutes of incubation with gentle agitation, the color intensity was measured spectrophotometrically at 615 nm.

[0522] The raw data was exported from the reader (Gen5 2.0 software) into Excel format and further analyzed in Excel. Standard curves were generated using GraphPad Prism 8 software and a logistic 4PL regression model.

[0523] Data points were reported as the mean of technical replicates.

[0524] RNA purification All samples were purified using a MagNA Pure 96 Instrument (Roche) using the manufacturer's protocol. [Table 19]

[0525] 350 μL of tissue homogenate was transferred to a MagNaPure 96 processing cartridge. The remaining lysate was saved for later analysis in oligonucleotide exposure analysis. RNA was purified using the MagNaPure 96 with the Cellular RNA Large Volume Kit using protocol "RNA Tissue FF Standard LV 3.1." RNA was eluted with 50 μL of elution buffer (from the kit, 05467535001).

[0526] RNA concentrations and A260 / 280 ratios (approximately 2.0 for all samples) were determined using an Eon Microplate spectrophotometer (BioTek Instruments). Based on these concentrations, samples were normalized to 25 ng / μL by dilution in DNase / RNase-free water and further diluted to a working concentration of 2.5 ng / μL.

[0527] The samples were then used as input for one-step qPCR analysis. Assay details are provided below.

[0528] qPCR analysis qPCR was performed as a one-step qPCR format using the following materials: [Table 20]

[0529] Preparation of RNA for qPCR analysis To avoid unwanted RT enzyme activity, reactions were kept chilled throughout this protocol. The diluted RNA was then heat shocked at 90°C for 40 seconds to dissociate the RNA:ASO duplex and placed on ice. Prior to analysis, the RNA samples were spun to the bottom of the wells.

[0530] A standard curve was run on each plate and used for quantitation and amplification efficiency measurements. 4 uL of a 10 ng / uL PBS sample was used as input in a 10 uL reaction. A 2-fold dilution series was prepared in RNase-free water to generate a 7-point standard curve.

[0531] Two separate mouse Fubp1 assays and four control assays were performed in duplicate reactions with two technical replicates for each animal.

[0532] For qPCR, the following steps were followed: For each qPCR well, a stock master mix containing 5 μL of XLT 1-Step Mix, 0.5 μL of Probe Mix 1 (20x), and 0.5 μL of Probe Mix 2 (20x) was prepared. From this stock master mix, 6 μL was added to each well in a 384-well plate (MicroAmp Optical 384-well plate - Applied Biosystems 4309849).

[0533] From the RNA dilution plate, 4 μL of diluted RNA (2.5 ng / μL) was added to each well of the master mix. The plate was then sealed and vortexed. The plate was then centrifuged at high speed for 3 minutes. The qPCR reactions were kept cold until transferred to a qPCR instrument (Life Technology Viia7; software: QuantStudio v.1.3) configured to run the following program: 50°C for 15 minutes, then 95°C for 3 minutes, with a ramp rate of 1.9°C / second. This was followed by 40 cycles of 95°C for 5 seconds and 60°C for 45 seconds, with a ramp rate of 1.6°C / second.

[0534] All samples were analyzed in the same run limiting technical variation to a minimum.

[0535] qPCR data processing qPCR data were reviewed using QuantStudio software (Applied Biosystems). Potential outlier wells were identified and removed based on irregularities in the amplification curves. Following this review of each plate, export files were generated for each qPCR assay with calculated quantities for each sample based on the standard curve and analyzed using Excel.

[0536] In general, the standard curves were of high quality with efficiencies between the recommended 95-105%, indicating a high-performance assay.

[0537] Four different HK genes (Gusb, Rplp0, Rps29, and Tbp) were assayed, and their geometric means were used for normalization. HK gene stability was assessed prior to inclusion using methods published by Vandesompele et al. (Vandesompele et al., 2002). By using four HK genes, pairwise HK gene variation was below the recommended threshold of 0.15 for all tissues.

[0538] "% Fubp1 remaining" was calculated as follows: the amount from each Fubp1 qPCR assay was normalized to the geometric mean of the HK assay and then divided by the mean of the untreated group to obtain % remaining mRNA. The average of the two % remaining Fubp1 mRNA results was used as the final readout.

[0539] PKPD plots and calculations Liver tissue exposure values ​​were calculated as nmol of compound per gram of tissue (nmol / g). They were further log10 transformed and plotted against the remaining Fubp1 mRNA (%) (Figure 13). A nonlinear regression curve (4PL regression model, constrained by top = 100) was fitted using GraphPad Prism 8. The best-fit estimated PKPD IC50 was calculated by the software (regression IC50: conjugate with CMP number 18_1: 0.092 nmol / g; conjugate with CMP number 7_3: 0.068 nmol / g).

[0540] Results: Both conjugates tested have good PK profiles. Conjugate CMP No. 7_3 is slightly superior to conjugate CMP No. 18_1 in terms of early onset of target KD. Some aspects of the invention are described below. 1. Below CTtAtgctttttatGgTT (SEQ ID NO: 7), AcCAAttttcatttCtAC (SEQ ID NO: 18), CTTatGctttttatgGT (SEQ ID NO: 6), CTTaTgctttttatgGT (SEQ ID NO: 6), CTtATgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatGGTT (SEQ ID NO: 7), GcttTttatggtTtCAC (SEQ ID NO: 8), and TATgcTttttatggtTTC (SEQ ID NO: 9) an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of: Antisense oligonucleotides in which uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 2. A conjugate comprising the antisense oligonucleotide according to item 1 and at least one conjugate moiety covalently attached to the antisense oligonucleotide. 3. The conjugate according to item 2, wherein the at least one conjugate moiety is capable of binding to an asialoglycoprotein receptor. 4. The conjugate according to item 2 or 3, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figure 9. 5. The conjugate according to item 4, wherein the conjugate moiety is a trivalent GalNAc moiety of Figure 9D1 or 9D2 or a mixture thereof. 6. The conjugate according to any one of items 1 to 5, comprising a linker located between the antisense oligonucleotide and the conjugate moiety. 7. The conjugate according to item 6, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester-linked nucleosides. 8. A conjugate selected from the group of conjugates shown in Figure 1, Figure 2, Figure 3, Figure 4, Figure 5, Figure 6, Figure 7, Figure 8 and Figure 8.1. 9. A pharmaceutically acceptable salt of the oligonucleotide according to item 1 or the conjugate according to any one of items 2 to 8. 10. A pharmaceutical composition comprising the antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, or the pharmaceutically acceptable salt according to item 9, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant. 11. An in vivo or in vitro method for regulating FUBP1 expression in a target cell expressing FUBP1, comprising administering to the cell an effective amount of the antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, the pharmaceutically acceptable salt according to item 9, or the pharmaceutical composition according to item 10. 12. A method for treating or preventing a disease, the method comprising administering to a subject suffering from or susceptible to the disease a therapeutically effective amount or a prophylactically effective amount of the antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, the pharmaceutically acceptable salt according to item 9, or the pharmaceutical composition according to item 10, wherein the disease is hepatitis B virus (HBV) infection and / or cancer. 13. The antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, the pharmaceutically acceptable salt according to item 9, or the pharmaceutical composition according to item 10, for use in medicine. 14. The antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, the pharmaceutically acceptable salt according to item 9, or the pharmaceutical composition according to item 10, for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer. 15. Use of the antisense oligonucleotide according to item 1, the conjugate according to any one of items 2 to 8, the pharmaceutically acceptable salt according to item 9, or the pharmaceutical composition according to item 10, for the preparation of a medicament for treating or preventing hepatitis B virus (HBV) infection and / or cancer. 16. The method according to item 12, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use according to item 14, or the use according to item 15, wherein the disease is hepatitis B virus (HBV) infection, for example chronic HBV infection. 17. The method according to item 12, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use according to item 14, or the use according to item 15, wherein the disease is cancer, for example hepatocellular carcinoma.

Claims

1. below CTtAtgctttttatGgTT (SEQ ID NO: 7), AcCAAttttcatttCtAC (SEQ ID NO: 18), CTTatGctttttatgGT (SEQ ID NO: 6), CTTaTgctttttatgGT (SEQ ID NO: 6), CTtATgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatgGTT (SEQ ID NO: 7), CTtAtgctttttatGGTT (SEQ ID NO: 7), GcttTttatggtTtCAC (SEQ ID NO: 8), and TATgcTtttttatggtTTC (SEQ ID NO: 9) an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of: Antisense oligonucleotides in which uppercase letters are β-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

2. A conjugate comprising the antisense oligonucleotide of claim 1 and at least one conjugate moiety covalently attached to the antisense oligonucleotide.

3. The conjugate of claim 2 , wherein the at least one conjugate moiety is capable of binding to an asialoglycoprotein receptor.

4. The conjugate moiety is a trivalent GalNAc moiety shown below: 【Chemistry 1-1】 【Chemistry 1-2】 [Chemistry 1-3] [Chemistry 1-4] [Chemistry 1-5] [Chemistry 1-6] [Chemistry 1-7] [Chemistry 1-8] (wherein X is S or O, Y is S or O, and n is 2.) The conjugate of claim 2 or 3, wherein the conjugate is selected from one of the following:

5. The conjugate moiety is a trivalent GalNAc moiety of D1 or D2 shown below: 【Chemistry 2】 or a mixture thereof.

6. The conjugate of any one of claims 2 to 5, comprising a linker located between the antisense oligonucleotide and the conjugate moiety.

7. 7. The conjugate of claim 6, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester-linked nucleosides.

8. The group of conjugates shown below: 【Chemistry 3-1】 【Chemistry 3-2】 【Chemistry 3-3】 [Chemistry 3-4] [Transformation 3-5] 【Chemistry 3-6】 【Chemistry 3-7】 【Transformation 3-8】 【Chemistry 3-9】 A conjugate selected from:

9. A pharmaceutically acceptable salt of the oligonucleotide according to claim 1 or the conjugate according to any one of claims 2 to 8.

10. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, or the pharmaceutically acceptable salt of claim 9, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

11. The antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, the pharmaceutically acceptable salt of claim 9, or the pharmaceutical composition of claim 10, for use in an in vivo or in vitro method for modulating FUBP1 expression in a target cell expressing FUBP1.

12. 11. The antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, the pharmaceutically acceptable salt of claim 9, or the pharmaceutical composition of claim 10, for use in a method for treating or preventing a disease, the method comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition to a subject suffering from or susceptible to said disease, wherein the disease is hepatitis B virus (HBV) infection and / or cancer.

13. 11. The antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, the pharmaceutically acceptable salt of claim 9, or the pharmaceutical composition of claim 10, for use in medicine.

14. 11. The antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, the pharmaceutically acceptable salt of claim 9, or the pharmaceutical composition of claim 10, for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer.

15. Use of the antisense oligonucleotide of claim 1, the conjugate of any one of claims 2 to 8, the pharmaceutically acceptable salt of claim 9, or the pharmaceutical composition of claim 10, for the preparation of a medicament for treating or preventing hepatitis B virus (HBV) infection and / or cancer.

16. 13. The antisense oligonucleotide, conjugate, pharmaceutically acceptable salt, or pharmaceutical composition of claim 12, wherein the disease is hepatitis B virus (HBV) infection, such as chronic HBV infection.

17. 13. The antisense oligonucleotide, conjugate, pharmaceutically acceptable salt, or pharmaceutical composition of claim 12, wherein the disease is cancer, such as hepatocellular carcinoma.

Images