coronavirus treatment

Abstract

The present invention provides peptides or derivatives or analogs thereof, or nucleic acids encoding said peptides or derivatives or analogs thereof, for use in treating, preventing, or ameliorating coronavirus infection or symptoms in infected subjects.

Description

[Technical Field]

[0001] The present invention relates to coronavirus therapeutics, and particularly, but not exclusively, to novel compositions, therapies, and methods for treating, preventing, or ameliorating coronavirus infection or symptoms in infected subjects. [Background technology]

[0002] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes 2019-nCoV or COVID-19 disease, is a member of the coronavirus (CoV) group of pathogens, which includes severe acute respiratory syndrome coronavirus (SARS) and Middle East respiratory syndrome-related coronavirus (MERS). Coronaviruses are typically restricted to their wild hosts (e.g., bats). However, both SARS and MERS, and more recently SARS-CoV-2, have been transferred to humans, resulting in the SARS, MERS, and SARS-CoV-2 pandemics of 2003, 2012, and 2019, respectively.

[0003] The emergence of the novel pathogenic SARS-CoV-2 in China in late 2019 led to a pandemic of devastating proportions, resulting in human suffering in terms of both loss of life and social and economic disruption. Currently, treatment of confirmed cases is symptomatic, and no targeted therapies are available to prevent or reduce the severity of the virus, including hospitalizations and deaths. Vaccine development presents inherent challenges, and even if successfully developed, benefits may be transient, delayed, or perhaps inapplicable to future pandemics. Furthermore, vaccination of individuals already diagnosed with COVID-19 disease is unlikely to have a disease-modifying effect because protective immunity takes time to develop after vaccination.

[0004] According to a report by the CDC COVID-19 Response Team (1), the highly infectious characteristics of SARS-CoV-2 clearly indicate that the severity of this disease is related to both age and chronic conditions. Preliminary data from 7,162 patients with COVID-19 infection indicate that 37.6% had one or more underlying conditions. Furthermore, 78% of COVID-19 patients in the intensive care unit (ICU) were reported to have at least one underlying condition: 32% had diabetes, 29% had cardiovascular disease, 21% had chronic lung disease, and 12% had long-term renal disease (1).

[0005] It has been noted that underlying conditions such as type 1 or type 2 diabetes, hypertension, cardiovascular disease, renal disease, and pulmonary disease all contribute to the severity of SARS-CoV-2 infection. However, until now, the severity of COVID-19 has been thought to be the result of increased vulnerability due to the co-occurrence of these underlying conditions.

[0006] It has been observed that type 1 and type 2 diabetes, as well as diabetes-associated conditions such as cardiovascular, renal, and pulmonary diseases, which are risk factors for severe COVID-19 infection and death, all share two underlying metabolic features: ACE2 overexpression and dysregulation of glucose, which manifest overtly as elevated blood glucose and glucagon, as in type 1 and type 2 diabetes, or covertly as impaired glucose tolerance (IGT) or elevated fasting plasma glucose (FPG) in the absence of diabetes (2, 3, 4).

[0007] Dysregulation of glucose regulation has been observed in numerous conditions, including type 1 and type 2 diabetes, hypertension, cardiovascular disease, renal disease, and pulmonary disease. For example, abnormalities in glucose metabolism, manifested as hyperinsulinemia, elevated FPG, and an abnormal response to the oral glucose tolerance test (OGTT), have all been shown to be important risk factors for cardiovascular disease (CVD) (5, 6, 7). Furthermore, Qiao et al. demonstrated that impaired glucose tolerance is an independent predictor of the incidence of chronic heart disease (CHD), premature death from chronic vascular disease (CVD), and all-cause mortality unconfounded by the development of clinically diagnosed diabetes (8). Similarly, Sechi LA et al. reported that 321 hypertensive patients were found to have hyperinsulinemia when compared with 92 matched normotensive subjects (9).

[0008] Hyperinsulinemia, also known as insulin resistance, is usually attributed to elevated plasma glucose levels because there is no concomitant measurement of glucagon levels. Based on OGTT tests, differences exist between subjects with normal and elevated fasting glucose levels before a glucose load. These tests result in classification of subjects as having normal glucose tolerance (NGT), impaired glucose tolerance (IGT), or impaired fasting glucose (IFG). Progression outcomes for IGT and IFG vary, with approximately 25% progressing to diabetes, while others remain in a dysglycemic state or revert to NGT (10, 11).

[0009] Faerch K et al. investigated glucagon and insulin measurements in their OGTT study and reported that diabetic individuals had 30% higher fasting glucagon levels and attenuated early glucagon suppression when compared with individuals with normal glucose tolerance. Insulin resistance, i.e., hyperinsulinemia, was also associated with higher fasting glucagon levels and reduced early glucagon suppression (12). Furthermore, Itchikawa R et al. emphasized the role of glucagon hypersecretion in an OGTT study in which subjects with prediabetes and mild type 2 diabetes showed higher fasting plasma glucagon levels than subjects with normal glucose tolerance (13).

[0010] Reaven GM et al. demonstrated that both obese and non-obese non-insulin-dependent type 2 diabetes mellitus (NIDDM) patients were hyperglucagonemic, i.e., had excess glucagon, compared with normal subjects (14). Plasma glucose, insulin, and free fatty acid (FFA) concentrations were all higher than normal in NIDDM patients, both obese and non-obese. Furthermore, diurnal plasma glucagon concentrations were elevated in both NIDDM groups, and a direct relationship was observed between the total plasma glucagon response and total plasma glucose levels (14).

[0011] Because glucagon stimulates endogenous glucose production through gluconeogenesis and glycogenolysis, elevated glucagon levels are clearly the underlying cause of both hyperglycemia and hyperinsulinemia (15). Furthermore, glucagon acts directly on β-cells via the glucagon receptor to induce insulin secretion (16). Therefore, glucagon levels directly correlate with insulin resistance in normal subjects (17).

[0012] Yang JK et al. conducted a retrospective analysis of patients with SARS-CoV-2 infection (135 deceased, 385 survived) compared with 19 patients with non-SARS pneumonia to examine glucagon levels and COVID-19. Results demonstrated that fasting plasma glucose (FPG) levels were significantly higher in the deceased group compared with the survived and non-SARS pneumonia groups (9.7 + / - 5.2 vs. 6.5 + / - 3.0 vs. 5.1 + / - 1.0 mmol / L, p<0.01). In this study, survival analysis showed that elevated FPG levels were independently associated with an increased hazard ratio (HR) for COVID-19 mortality (6).

[0013] Angiotensin-converting enzyme 2 (ACE2), the target receptor for SARS-CoV-2, has been observed to be significantly overexpressed in patients with such underlying diseases. For example, ACE2 protein expression has been shown to be elevated in both type 1 and type 2 diabetes, including diabetic nephropathy, as observed in seven separate studies involving a total of 961 patients (5). Therefore, the higher the expression of this ACE2 receptor, the higher the viral load and the more severe the infection. Summary of the Invention [Problem to be solved by the invention]

[0014] Therefore, there is an urgent need to provide new, fast-acting therapies that can reduce ACE2 expression and thereby reduce or prevent coronavirus infection itself, as well as treat or ameliorate the onset of symptoms in subjects infected with the virus. [Means for solving the problem]

[0015] The present inventors investigated the efficacy of a peptide known as "NDX-90" (SEQ ID NO: 1) for preventing, treating, and / or ameliorating coronavirus infection or coronavirus symptoms. This is based on the inventors' hypothesis that reducing glucagon levels in a subject will result in reduced expression of ACE2 receptors in the subject's "host" cells. Accordingly, the inventors investigated the effect of the NDX-90 peptide on glucagon levels and surprisingly demonstrated that the addition of NDX-90 reduced stress-induced hypersecretion of glucagon from freshly isolated pancreatic islet cultures. Furthermore, the inventors observed that subjects treated with NDX-90 had significantly reduced fasting plasma glucagon levels for a period of time compared to the placebo group.

[0016] Therefore, the inventors believe that NDX-90 may be used as a therapeutic agent to first prophylactically reduce or prevent the occurrence of coronavirus infection by reducing ACE2 expression levels and thereby reducing the concentration of ACE2 receptors on host cells, and further to treat or ameliorate symptoms in subjects infected with the virus.

[0017] Thus, in a first aspect of the present invention there is provided a peptide comprising an amino acid sequence substantially as set out in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or a derivative or analogue thereof, for use in the treatment, prevention or amelioration of coronavirus infection or symptoms in an infected subject.

[0018] In a second aspect of the present invention, there is provided a method of treating, preventing or ameliorating coronavirus infection or symptoms in an infected subject, the method comprising administering or having administered to a subject in need of such treatment a therapeutically effective amount of a peptide comprising an amino acid sequence substantially as set forth in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or derivative or analogue thereof.

[0019] As described in the Examples, the inventors surprisingly demonstrated that glucagon secretion from isolated rat pancreatic islet cultures was significantly reduced in islets cultured in the presence of NDX-90 (i.e., SEQ ID NO: 1) compared with isolated islets cultured in culture medium alone. Even more surprisingly, the inventors observed that the normalizing effect on glucagon secretion began almost immediately after addition of the NDX-90 peptide, reaching a 32% reduction after 4 hours and reaching near-normal levels after 24 hours. Furthermore, as shown in Table 2, the inventors were surprised to observe that NDX-90 had a long-term glucagon-normalizing effect over several months. This was demonstrated by a reduction in fasting plasma glucagon levels. Thus, the inventors' studies demonstrated that the NDX-90 peptide reduces glucagon levels, which in turn reduces ACE2 expression, thereby demonstrating that the NDX-90 peptide can be used not only to treat coronavirus infection, but also to prevent or even prevent the onset of the disease.

[0020] Previously, the association between high ACE2 expression and underlying diseases such as diabetes and hypertension was thought to be a reactive defensive response resulting in increased anti-inflammatory outcomes that suppress the pro-inflammatory arm of the renin-angiotensin system (RAS), which is characterized by angiotensin-converting enzyme (ACE) and angiotensin type 1 receptor (AT1R), which are associated with fibrosis, insulin resistance, inflammation, and vasoconstriction (18).

[0021] The balance between the proinflammatory and defensive arms of the renin-angiotensin system (RAS) is regulated by the activation of adenine monophosphate kinase (AMPK) (19), which is known to be activated by elevated glucagon levels (20). Pharmacological activation of AMPK, which inhibits ACE and AT1R (18), is widely recognized as beneficial in ameliorating various diseases. For example, it has been demonstrated that activation of AMPK can improve cardiometabolic diseases, protect cardiac function, delay heart failure, inhibit cardiac hypertrophy and cardiomyopathy, and treat atherosclerosis by improving endothelial function (21-25). Thus, activation of AMPK is generally considered beneficial in numerous pathological conditions.

[0022] However, we counterintuitively hypothesized that suppressing glucagon levels, and thus simultaneously reducing AMPK activation, would increase the levels of the proinflammatory ACE / AT1R arm of the RAS, thereby decreasing the levels of the protective ACE2 / Ang1-7 arm. This would rebalance the balance toward reducing ACE2 levels, thereby acting both preventatively and therapeutically against coronaviruses such as SARS-CoV-2, the cause of COVID-19. For example, as seen in Figure 1a, normal glucagon levels are associated with higher AT1R expression (represented by seven AT1Rs) and lower ACE2 expression (represented by three ACEs), reducing targets for SARS-CoV-2 viral entry. Thus, free virus particles without receptors to bind to cells cannot successfully infect cells and are therefore killed in the circulation by the innate immune response. In contrast, as illustrated in Figure 1b, high glucagon levels activate AMPK, thereby suppressing AT1R expression (represented by four AT1Rs), resulting in elevated ACE2 expression (represented by six ACEs), increasing targets for viral entry and leading to more severe viral infection of host cells.

[0023] Based on this, without being bound by any hypothesis, the inventors believe that the most likely cause of increased mortality from coronavirus infection is increased glucagon levels in patients with such underlying diseases, resulting in overexpression of ACE2, which increases the severity of the disease.

[0024] However, our hypothesis is counterintuitive and therefore unobvious for several reasons. First, ACE2 is recognized as a protective mechanism against disease. Therefore, considering lowering ACE2 levels in subjects suffering from such conditions would be clearly counterintuitive. Furthermore, the current understanding of the severity and mortality of COVID-19 observed in patients with cardiovascular, pulmonary, and nephrotic conditions is based solely on the concomitant vulnerability induced by these underlying diseases. Currently, no relationship has been found between excessive glucagon levels and elevated ACE2 expression in such conditions. Furthermore, due to the high priority given to glucose and insulin measurements, glucagon is a parameter rarely considered by experts in glucose dysregulation-related diseases. Therefore, there are currently no diseases that can be treated with glucagon-lowering drugs. It is therefore unexpected and unknown to link a previously unlinked multistep process that results in increased levels of the pro-inflammatory arm of the RAS system (ACE / AT1R) and reduced levels of the disease-protective arm (ACE2), thereby reducing ACE2 receptors and conferring protection against COVID-19 infection.

[0025] Furthermore, a newly emerging concept is that excessive glucagon levels result from autoantibodies that increase glucagon as a result of viral infection. T cells proliferate as a defensive immune response to viral infection, and the natural death of these T cells is accompanied by the development of primary anti-T cell receptor (anti-TCR) antibodies. In certain individuals, this is followed by the development of second-generation autoantibodies against the primary anti-TCR, i.e., anti-anti-T cell receptor (anti-TCR) antibodies. These anti-anti-TCR antibodies bind to α cells in the human pancreas and induce continuous glucagon secretion. For example, it has been shown that anti-anti-TCR antibodies added to cultures of isolated pancreatic islets increased glucagon levels by more than 50% compared to controls within two days of culture. The presence of these anti-anti-TCR antibodies could explain the hyperglucagonemia observed in subjects with type 2 diabetes.

[0026] During the acute phase of SARS-CoV-2 infection in humans, T lymphocyte infection occurs via spike protein-mediated membrane fusion, and evidence suggests that T cell infection can lead to significant lymphopenia of both CD4 and CD8 T cells in over 80% of patients. Therefore, it appears that T cell destruction caused by SARS-CoV-2 infection may further stimulate anti-TCR antibody levels, tipping the glucagon / insulin balance toward ketoacidosis. The production of these autoantibodies can be blocked by the NDX-90 peptide, which binds to specific B cell receptors and switches off autoantibody-producing B cells. Therefore, suppression of such autoantibodies and normalization of glucagon levels are expected to improve the severity of coronavirus infection and the severity of symptoms and pathology of viral infection.

[0027] Thus, preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of reducing and / or inhibiting the production of anti-anti-T cell receptor antibodies in a subject compared to the level of anti-anti-T cell receptor antibodies in an untreated subject.

[0028] It is understood that normal subjects have physiologically "normal" concentrations (or levels) of anti-anti-T cell receptor antibodies, and that subjects suffering from an underlying disease characterized by abnormal glucose regulation have elevated concentrations of anti-anti-T cell receptor antibodies compared to the "normal" antibody concentrations of normal subjects. Therefore, administration of the present peptide, its derivative or analog, or the present nucleic acid preferably results in a concentration of anti-anti-T cell receptor antibodies that is reduced by at least 70% relative to the normal antibody concentration in a normal subject. Preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a concentration of anti-anti-T cell receptor antibodies that is reduced by at least 75%, 80%, 85%, 90%, or 95% relative to the normal antibody concentration in a normal subject. Most preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a concentration of anti-anti-T cell receptor antibodies that is reduced toward the normal antibody concentration for a normal subject.

[0029] Alternatively, the concentration of anti-T cell receptor antibodies is preferably maintained at a "normal" concentration in a normal subject.

[0030] Preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of reducing and / or inhibiting glucagon secretion in a subject compared to the level of glucagon secretion in an untreated subject.

[0031] It is understood that normal subjects have a physiologically "normal" concentration (or level) of glucagon, and that subjects suffering from an underlying disease characterized by abnormal glucose regulation have a higher concentration of glucagon compared to the "normal" glucagon concentration in normal subjects. Therefore, it is preferred that administration of the present peptide, its derivative or analog, or the present nucleic acid results in a glucagon concentration that is reduced by at least 70% compared to the normal glucagon concentration in a normal subject. Preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a glucagon concentration that is reduced by at least 75%, 80%, 85%, 90%, or 95% compared to the normal glucagon concentration in a normal subject. Most preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a glucagon concentration that is reduced compared to the normal glucagon concentration in a normal subject.

[0032] Alternatively, glucagon levels are preferably maintained at "normal" glucagon levels in normal subjects.

[0033] Due to the enzyme digestion procedure that separates intact pancreatic islets from pancreatic tissue, it has been observed that isolated pancreatic islets secrete higher levels of glucagon than normal (Lee HB and Blaufox MD, J Nucl Med, 1985;25:72-76).Therefore, preferably, the glucagon secretion in the pancreatic islets of subject can be reduced and / or inhibited compared with the level of glucagon secretion in untreated subject.

[0034] Glucagon secretion from pancreatic alpha cells is accompanied by the stoichiometric co-secretion of glutamate. (26) Glutamate acts as a positive autocrine signal for glucagon release, and thus, the co-secretion of glutamate generates a continuous signal for further glucagon release. (27) This increases the severity of coronavirus infection.

[0035] Thus, preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of reducing and / or inhibiting glutamate secretion in a subject compared to the level of glutamate secretion in an untreated subject.

[0036] It is understood that normal subjects have a physiologically "normal" concentration (or level) of glutamate, and that subjects suffering from an underlying disease characterized by abnormal glucose regulation have elevated glutamate concentrations compared to the "normal" glutamate concentration in normal subjects. Thus, administration of the present peptide, its derivative or analog, or the present nucleic acid preferably results in a glutamate concentration that is reduced by at least 70% relative to the normal glutamate concentration in a normal subject. Preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a glutamate concentration that is reduced by at least 75%, 80%, 85%, 90%, or 95% relative to the normal glutamate concentration in a normal subject. Most preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a glutamate concentration that is reduced relative to the normal glutamate concentration in a normal subject.

[0037] Alternatively, the concentration of glutamate is preferably maintained at the "normal" glutamate concentration in a normal subject.

[0038] Most preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of reducing and / or inhibiting glucagon and glutamate secretion in a subject compared to the levels of glucagon and glutamate secretion in an untreated subject.

[0039] Preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of reducing and / or inhibiting ACE2 overexpression in a subject compared to the level of ACE2 expression in an untreated subject.

[0040] It will be understood that normal subjects have a physiologically "normal" level of ACE2 expression, and that subjects suffering from an underlying disease characterized by glucose dysregulation have a higher level of ACE2 expression compared to the "normal" ACE2 expression level in normal subjects. Therefore, administration of the present peptide, its derivative or analog, or the present nucleic acid preferably results in a level of ACE2 expression that is at least 70% reduced relative to the normal ACE2 expression level in normal subjects. Preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a level of ACE2 expression that is at least 75%, 80%, 85%, 90%, or 95% reduced relative to the normal ACE2 expression level in normal subjects. Most preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a reduced ACE2 expression level relative to the normal ACE2 expression level in normal subjects.

[0041] Alternatively, the level of ACE2 expression is preferably maintained at the "normal" ACE2 expression level in a normal subject.

[0042] Advantageously, NDX-90 targets glucagon secretion, thus reducing ACE2 expression. Reducing the number of ACE2 receptors present on the surface of cells in a subject reduces the ability of coronaviruses to infect host cells and is therefore preventative in nature. In contrast, many current therapies used to treat diabetes and related conditions actually increase the number of ACE2 receptors. Current therapies include SGLT2 inhibitors, pioglitazone, metformin, GLP-1 receptor agonists, and insulin, all of which have been shown to upregulate ACE2 (28). Therefore, treatment with NDX-90 offers significant advantages over previous therapies that may increase the risk of infection with coronaviruses (e.g., SARS-CoV-2) and even worsen the prognosis of symptoms in subjects infected with coronaviruses (e.g., COVID-19).

[0043] Furthermore, in severe cases of coronavirus infection, mitochondrial damage occurs, leading to the release of mitochondrial DNA (mtDNA) and, concomitantly, cardiolipin, resulting in acute respiratory distress syndrome (ARDS), cytokine storm, and multiple organ failure. High circulating mtDNA levels have also been shown to be an early indicator of unfavorable COVID-19 outcomes (29). As shown in Table 4, we demonstrated that NDX-90 has the ability to bind to cardiolipin, thereby holding the cardiolipin dimer arms together, improving the thickness of the mitochondrial membrane bilayer and preventing the release of mtDNA, thereby preventing the cardiolipin chains from moving apart.

[0044] Thus, preferably, the peptide, derivative or analogue thereof, or the nucleic acid is capable of binding to cardiolipin.

[0045] Even more preferably, the peptide, derivative or analog thereof, or nucleic acid is capable of reducing and / or inhibiting the release of mitochondrial DNA (mtDNA) from mitochondria in a subject compared to the level of mtDNA release from mitochondria in an untreated subject.

[0046] It is understood that normal subjects have physiologically "normal" levels of mtDNA release, and that subjects suffering from coronavirus infection have elevated levels of mtDNA release compared to "normal" mtDNA release in normal subjects. Therefore, administration of the present peptide, its derivative or analog, or the present nucleic acid preferably results in a level of mtDNA release that is reduced by at least 70% relative to the normal level of mtDNA release in normal subjects. Preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a level of mtDNA release that is reduced by at least 75%, 80%, 85%, 90%, or 95% relative to the normal level of mtDNA release in normal subjects. Most preferably, administration of the present peptide, its derivative or analog, or the present nucleic acid results in a level of mtDNA release that is reduced relative to the normal level of mtDNA release in normal subjects.

[0047] Alternatively, the level of mtDNA release is preferably maintained at the "normal" level of mtDNA release in a normal subject.

[0048] The coronavirus may be any virus belonging to the coronavirus group of pathogens that targets the angiotensin-converting enzyme 2 (ACE2) receptor on host cells for infection. Thus, preferably, a peptide comprising SEQ ID NO: 1 or a derivative or analog thereof, or a nucleic acid encoding the peptide or a derivative or analog thereof, prevents coronavirus infection or treats or ameliorates symptoms in a subject infected with any coronavirus that targets and infects host cells via the ACE2 receptor.

[0049] Preferably, the coronavirus is selected from MERS, SARS-CoV-1, and SARS-CoV-2. However, most preferably, the coronavirus is SARS-CoV-2 and any future strains with ACE2 targeting selectivity. It will be understood that SARS-CoV-2 is the causative agent of COVID-19.

[0050] A feature of the highly infectious SARS-CoV-2 is that the severity of the disease is associated with underlying diseases such as type 1 or type 2 diabetes, hypertension, cardiovascular disease, renal disease, and pulmonary disease, among others. In particular, these underlying diseases and any other conditions are characterized by glucose dysregulation.

[0051] Thus, in one embodiment, the peptide, derivative or analog thereof, or nucleic acid can treat, prevent, or ameliorate coronavirus infection or symptoms in an infected subject with an underlying disease. In particular, the underlying disease may be characterized by impaired glucose regulation. Preferably, the underlying disease is associated with impaired glucose tolerance or high fasting glucose levels. Even more preferably, the underlying disease is associated with elevated glucagon levels (i.e., hyperglucagonemia) or insulin resistance (i.e., hyperinsulinemia). Preferably, the subject is glucose intolerant.

[0052] Preferably, the underlying disease is selected from the group consisting of diabetes, type 1 diabetes, type 2 diabetes, hypertension, cardiovascular disease, renal disease, and pulmonary disease. The subject may be a diabetic patient infected with a coronavirus, preferably a diabetic patient infected with SARS-CoV-2.

[0053] In another embodiment, the subject does not have an underlying disease. In other words, the subject is a healthy individual. Thus, the subject may be a non-diabetic patient. The subject may be a non-diabetic patient infected with a coronavirus, preferably a non-diabetic patient infected with SARS-CoV-2.

[0054] Preferably, the peptide, derivative or analog thereof, or nucleic acid is capable of treating, preventing, or ameliorating coronavirus infection or symptoms in an infected subject who is in their 20s, 30s, 40s, 50s, 60s, 70s, 80s, or 90s.

[0055] As described in the Examples, the inventors have shown that the NDX-90 peptide (SEQ ID NO: 1) reduces glucagon secretion, indicating that this peptide may be used as an effective treatment for hyperglucagonemia and / or hyperinsulinemia in all conditions where hyperglucagonemia is an underlying condition.

[0056] Thus, in another aspect of the present invention there is provided a peptide comprising an amino acid sequence substantially as set forth in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or derivative or analogue thereof, for use in the treatment, prevention or amelioration of conditions characterised by hyperglucagonemia, hyperinsulinemia and / or high or excessive glutamate.

[0057] In a further aspect of the invention, there is provided a method of treating, preventing or ameliorating a condition characterized by hyperglucagonemia, hyperinsulinemia and / or high or excessive glutamate in a subject, the method comprising administering or having administered to a subject in need of such treatment a therapeutically effective amount of a peptide comprising an amino acid sequence substantially as set forth in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or derivative or analogue thereof.

[0058] Preferably, the peptide, derivative or analogue thereof, or the nucleic acid is as defined herein.

[0059] For example, a condition characterized by hyperglucagonemia may be type 2 or type 1 diabetes, and may initially be accompanied by hyperinsulinemia due to elevated glucagon. As the disease progresses, high or excessive co-secreted glutamate blocks mature insulin secretion by approximately 50% / more than 50% in type 2 diabetes and approximately 95% / more than 95% in type 1 diabetes. Glutamate is transported to secretory granules in B cells, where it contributes to insulin maturation. Glutamate acidifies the secretory granules, stimulating the conversion of proinsulin to insulin. Excess glutamate promotes more rapid secretion, favoring proinsulin secretion and insufficient time for acidification / proinsulin maturation into insulin. High proinsulin and trace amounts of mature insulin secretion are characteristic of type 1 diabetes and, to a lesser extent, also present in type 2 diabetes. Underlying conditions of hyperglucagonemia and hyperinsulinemia also include hypertension, chronic heart disease, cardiovascular disease, kidney disease, chronic lung disease, obesity, and cancer. Impaired glucose tolerance (IGT) and impaired fasting glucose / glucagon (IFG) are also underlying conditions that can be treated prophylactically to prevent progression to serious disease.

[0060] Diseases in which plasma or blood glutamate levels are elevated include Alzheimer's disease, chronic schizophrenia, major depressive disorder (MDD), autism spectrum disorders, multiple sclerosis, Parkinson's disease, and neuromuscular degenerative disorders.

[0061] Preferably, the peptide, derivative or analogue thereof, or the nucleic acid may be used in the effective prevention of, amelioration of, or treatment of coronavirus infection or symptoms in an infected subject, preferably by reducing and / or inhibiting ACE2 expression in the subject, compared to the level of ACE2 expression in an untreated subject.

[0062] In one embodiment, the protein sequence of the peptide designated "NDX-90" is 9 amino acids in length and is set forth herein as SEQ ID NO: 1, as follows: QQYNSYPLT [SEQ ID NO: 1] In one embodiment, the peptide is linked together with a second peptide to form a dimer. Preferably, the second peptide also comprises an amino acid sequence substantially as set forth in SEQ ID NO: 1, or a derivative or analog thereof. Preferably, the peptides are linked by a cysteine ​​residue at the N-terminus of each peptide.

[0063] The peptide may be reduced in size by the removal of amino acids, which may be achieved by removing residues from the C-terminus and / or N-terminus of the peptide, or by deleting one or more amino acids from within the core of the peptide.

[0064] The term "derivative or analog thereof" can refer to a peptide in which an amino acid residue is replaced by a residue (whether a natural amino acid, an unnatural amino acid, or an amino acid mimetic) having similar side chain or peptide backbone properties. Furthermore, the termini of such peptides may be protected by N- and / or C-terminal protecting groups having properties similar to acetyl or amide groups.

[0065] Derivatives and analogs of peptides of the present invention can also include derivatives and analogs that increase the half-life of the peptides in vivo. For example, derivatives and analogs of peptides of the present invention can include peptoid and retropeptoid derivatives of peptides, peptide-peptoid hybrids, and D-amino acid derivatives of peptides.

[0066] Peptoids, or poly-N-substituted glycines, are a class of peptidomimetics in which the side chains are attached to the nitrogen atom of the peptide backbone rather than to the alpha carbon, within the amino acid. Peptoid derivatives of the peptides of the present invention can be easily designed from knowledge of the peptide's structure. Retropeptoids (in which all amino acids are replaced by peptoid residues in reverse order) are also suitable derivatives according to the present invention. Retropeptoids are predicted to bind in the opposite orientation in the ligand-binding groove compared to peptides or peptoid-peptide hybrids containing a single peptoid residue. As a result, the side chains of the peptoid residues can point in the same direction as the side chains of the original peptide.

[0067] Preferred nucleic acid molecules according to the present invention may include: TGTCAGCAATATAACAGCTATCTTCTCACG [SEQ ID NO: 2] TGCCAACAGTACAATAGTTACCCCCTTACA [SEQ ID NO: 3] Thus, preferably, the nucleic acid molecule comprises a nucleotide sequence substantially as set forth in any one of SEQ ID NOs: 2 or 3, or a variant or fragment thereof.

[0068] The nucleic acid molecule may be an isolated or purified nucleic acid sequence. The nucleic acid sequence may be a DNA sequence. The nucleic acid molecule may include synthetic DNA. The nucleic acid molecule may include cDNA. The nucleic acid may be operably linked to a heterologous promoter. The nucleic acid sequence encoding the peptide, its derivative or analog may be incorporated into a gene construct for use in gene therapy or for cloning.

[0069] In a preferred embodiment, therefore, the nucleic acid molecule encoding the peptide, derivative or analogue thereof is a genetic construct. More preferably, the nucleic acid molecule or genetic construct is provided within a recombinant vector.

[0070] The gene construct of the present invention may be in the form of an expression cassette suitable for expression of the encoded peptide, derivative, or analog thereof in a host cell. The gene construct may be introduced into a host cell without being incorporated into a vector. For example, the gene construct, which may be a nucleic acid molecule, may be incorporated into a liposome or viral particle. Alternatively, a purified nucleic acid molecule (e.g., histone-free DNA or naked DNA) may be inserted directly into a host cell by a suitable means, such as direct endocytosis. In cloning, the gene construct may be directly introduced into a host subject's cells (e.g., bacterial cells, eukaryotic cells, or animal cells) by transfection, infection, electroporation, microinjection, cell fusion, protoplast fusion, or particle bombardment. Alternatively, the gene construct of the present invention may be directly introduced into a host cell using a particle gun. Alternatively, for expression in a suitable host cell, the gene construct may be maintained in a recombinant vector. For administration to a subject under treatment, the gene construct may be contained in a phage delivery system, such as AAV.

[0071] The recombinant vector may be a plasmid, cosmid, or phage. Such recombinant vectors are useful for transforming host cells with the genetic construct and for replicating an expression cassette within the vector. Those skilled in the art will appreciate that the genetic constructs of the present invention can be combined with a wide variety of backbone vectors for expression applications. The recombinant vector may contain a variety of other functional elements, including a suitable promoter for initiating gene expression. For example, the recombinant vector may be designed to replicate autonomously in the cytosol of the host cell. In this case, elements that induce or regulate DNA replication may be required in the recombinant vector. Alternatively, the recombinant vector may be designed to integrate into the genome of the host cell. In this case, DNA sequences that favor targeted integration (e.g., by homologous recombination) are contemplated.

[0072] To facilitate cloning, recombinant vectors may also contain DNA encoding genes that can be used as selectable markers in the cloning process, i.e., to allow for the selection of transfected or transformed cells and to allow for the selection of cells that carry a vector incorporating heterologous DNA. Alternatively, the selectable marker gene may be in a different vector so that it is used simultaneously with the vector containing the gene of interest. Vectors may also contain DNA involved in regulating the expression of coding sequences or DNA for targeting the expressed polypeptide to a specific part of the host cell.

[0073] It will be understood that the peptides, derivatives, or analogs thereof according to the present invention can be used in medicine to treat, prevent, or ameliorate coronavirus infection or symptoms in infected subjects, and can be used as monotherapy (i.e., use of the peptides, derivatives, or analogs thereof, or the nucleic acids alone). Alternatively, the peptides, derivatives, or analogs thereof, or nucleic acids according to the present invention can be used as an adjunct to or in combination with known therapies for treating, preventing, or ameliorating coronavirus infection or symptoms in infected subjects. For example, the subject may additionally be treated with remdesivir (RTM), aspirin, dexamethasone, and / or vitamin D.

[0074] The peptides or nucleic acids according to the present invention may be combined in compositions having many different forms, depending in particular on the method for which the composition is intended to be used. For example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposomal suspension, or any other suitable dosage form that can be administered to an individual or animal in need of treatment. It will be understood that the vehicle of the pharmaceutical according to the present invention should be one that is well tolerated by the subject to which it is administered.

[0075] The medicament comprising the peptide of the present invention can be used in many ways.For example, oral administration may be necessary when the peptide can be contained in a composition that can be taken orally, for example, in the form of a tablet, capsule, or liquid.As shown in Tables 5 and 6, the peptide of the present invention (NDX-90) has been demonstrated to be effectively taken up by buccal tissue cells, indicating that oral administration is an effective method for delivering NDX-90 to a subject.

[0076] Thus, preferably, the peptides of the present invention are administered orally, most preferably sublingually. The peptides may be formulated with a mucoadhesive agent for attachment to the buccal mucosa.

[0077] The peptides of the present invention may be formulated with cell membrane permeability enhancers, penetration enhancers and / or absorption enhancers.

[0078] The peptides according to the present invention may also be incorporated into sustained- or delayed-release devices. Such devices may be inserted, for example, on or under the skin, and the drug may be released over a period of weeks or even months. The device may be positioned adjacent to the treatment site. Such devices may be particularly advantageous when long-term treatment with the peptides used according to the present invention is required, which would normally require frequent administration (e.g., daily injections).

[0079] In a preferred embodiment, the medicament according to the present invention can be administered to a subject by direct injection into the bloodstream or into the site that requires treatment.For example, the medicament can be injected near or at least adjacent to pancreatic islets.Injection can be intravenous (bolus or infusion), intramuscular (bolus or infusion), subcutaneous (bolus or infusion), or intradermal (bolus or infusion).

[0080] It will be understood that the amount of peptide required is determined by its biological activity and bioavailability, which in turn depends on the method of administration, the physicochemical properties of the peptide, and whether it is used as a monotherapy or a combination therapy. The frequency of administration will also be affected by the half-life of the peptide in or on the body of the subject being treated. The optimal dose to be administered can be determined by those skilled in the art and will vary depending on the specific peptide being used, the strength of the pharmaceutical composition, and the method of administration. Additional factors depending on the individual subject being treated, including the subject's age, weight, sex, diet, and time of administration, may require adjustment of the dose.

[0081] The optimal dose can be determined depending on the severity of the coronavirus infection. The peptide can be administered once or twice daily to hospitalized infected subjects. Non-hospitalized infected subjects may require less frequent administration of the peptide, such as once or twice weekly, and / or at lower doses than hospitalized subjects. Alternatively, when used as a preventative treatment, the peptide can be administered even less frequently. For example, non-infected subjects with pre-existing conditions that contribute to the severity of coronavirus infection may require weekly or monthly administration of the peptide. Alternatively, the peptide can be administered monthly, every three months, or every six months to non-infected subjects with normal or impaired glucose tolerance.

[0082] Generally, a daily dose of between 0.001 μg / kg body weight and 10 mg / kg body weight or between 0.01 μg / kg body weight and 1 mg / kg body weight of a peptide according to the present invention may be used to treat, prevent, or ameliorate coronavirus infection or symptoms in an infected subject.

[0083] The peptides may be administered before, during, or after the onset of symptoms associated with coronavirus infection. The daily dose may be administered as a single dose (e.g., a once-daily application). Alternatively, the peptides may require administration more than once per day. By way of example, the peptides may be administered as two (or more) daily doses of between 0.07 μg and 700 mg (i.e., assuming a body weight of 70 kg). Patients undergoing treatment may take one dose upon waking, followed by a second dose in the evening (if a two-dose regimen) or three or four hours later. Alternatively, sustained-release devices may be used to provide an optimal dose of the peptides according to the invention without requiring repeated administration to the patient.

[0084] Known procedures, such as those commonly used in the pharmaceutical industry (e.g., in vivo experimental methods, clinical trials, etc.), can be used to formulate the specific formulation of the peptides according to the present invention and the exact treatment regimen (e.g., daily dose of drug and frequency of administration). The present inventors believe that they are the first to propose a coronavirus treatment composition based on the use of the peptides of the present invention.

[0085] Thus, in a third aspect of the present invention there is provided a pharmaceutical composition for the prevention, treatment or amelioration of coronavirus infection, the pharmaceutical composition comprising a therapeutically effective amount of a peptide comprising an amino acid sequence substantially as set forth in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or derivative or analogue thereof, and a pharmaceutically acceptable vehicle.

[0086] The present invention also provides, in a fourth aspect, a method of making a pharmaceutical composition for preventing, treating or ameliorating a coronavirus infection according to the third aspect, the method comprising the step of combining a therapeutically effective amount of a peptide comprising an amino acid sequence substantially as set forth in SEQ ID NO: 1 or a derivative or analogue thereof, or a nucleic acid encoding said peptide or derivative or analogue thereof, with a pharmaceutically acceptable vehicle.

[0087] A "subject" may be a vertebrate, a mammal, or a livestock animal. Thus, the medicament according to the present invention may be used to treat any mammal, such as livestock (e.g., horses), pets, or other veterinary applications. However, most preferably, the subject is a human.

[0088] A "therapeutically effective amount" of a peptide is any amount that, when administered to a subject, is the amount of active agent needed to treat, ameliorate, or prevent coronavirus infection, or to produce a desired effect. The peptide, its derivative, or analog may be used as an adjunct for the prevention or treatment of coronavirus infection. This means that lower doses of other prophylactic or therapeutic treatments may be required.

[0089] For example, the therapeutically effective amount of peptide used may be from about 0.001 mg to about 800 mg, preferably from about 0.01 mg to about 500 mg.

[0090] A "pharmaceutically acceptable vehicle" as referred to herein is any known compound or combination of known compounds known to those skilled in the art to be useful in formulating pharmaceutical compositions.

[0091] In one embodiment, the pharmaceutically acceptable vehicle may be solid, and the composition may be in the form of a powder or tablet. A solid pharmaceutically acceptable vehicle may contain one or more substances that may also act as flavoring agents, lubricants, solubilizers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, coating agents, or tablet disintegrating agents. The vehicle may also be an encapsulating material. In a powder, the vehicle is a finely divided solid that is admixed with a finely divided active agent according to the present invention. In a tablet, the active agent (i.e., the peptide or nucleic acid) is mixed with a vehicle having the necessary compression properties in suitable proportions and can be tightly bound to the desired shape and size. Suitable solid vehicles include, for example, calcium phosphate, magnesium stearate, talc, sugar, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low-melting waxes, and ion exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.

[0092] However, the pharmaceutical vehicle may also be a liquid, and the pharmaceutical composition is in the form of a solution. Liquid vehicles are used in the preparation of solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The active agent (i.e., the peptide or nucleic acid) according to the present invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle, such as water, an organic solvent, a mixture of both, or a pharmaceutically acceptable oil or fat. The liquid vehicle may contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavorings, suspending agents, thickeners, colorants, viscosity regulators, stabilizers, or osmolality regulators. Suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing the above-mentioned additives, e.g., cellulose derivatives, preferably sodium carboxymethylcellulose solution), alcohols (including monohydric and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionated coconut oil and peanut oil). For parenteral administration, the liquid vehicle may also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration. The liquid vehicle for pressurized compositions may be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.

[0093] Liquid pharmaceutical compositions that are sterile solutions or suspensions can be utilized by, for example, intramuscular, intrathecal, epidural, intraperitoneal, intravenous, and especially subcutaneous injection. The peptides can also be prepared as sterile solid compositions that can be dissolved or suspended at the time of administration using sterile water, physiological saline, or other suitable sterile injectable solvents.

[0094] The peptides and compositions of the present invention may be orally administered in the form of a sterile solution or suspension containing other solutes or suspending agents (e.g., sufficient saline or glucose to render the solution isotonic), bile salts, acacia, gelatin, sorbitan monooleate, and polysorbate 80 (the oleic acid ester of sorbitol and its anhydride copolymerized with ethylene oxide). The peptides used in accordance with the present invention may also be orally administered in the form of either a liquid or solid composition. Compositions suitable for oral administration include solid dosage forms such as pills, capsules, granules, tablets, and powders, as well as liquid dosage forms such as solutions, syrups, elixirs, and suspensions. Preferably, orally administrable formulations do not dissolve in the stomach but preferentially dissolve in the duodenum. Orally administrable formulations may also be enterically coated, such as enteric-coated tablets or capsules. Dosage forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.

[0095] It will be understood that the present invention extends to any nucleic acid or peptide comprising substantially the amino acid or nucleic acid sequence of any of the sequences referred to herein, or variants, derivatives, or analogs thereof, as well as functional variants or functional fragments thereof. The terms "substantially amino acid / nucleotide / peptide sequence," "functional variant," and "functional fragment" can refer to a sequence having at least 40% sequence identity with the amino acid / nucleotide / peptide sequence of any one of the sequences referred to herein, such as a sequence having 40% identity with the sequence identified as SEQ ID NOs: 1-3.

[0096] Also contemplated are amino acid / polynucleotide / polypeptide sequences that have a sequence identity to any of the sequences mentioned that is greater than 65%, more preferably greater than 70%, even more preferably greater than 75%, even more preferably greater than 80% sequence identity. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity to any of the sequences mentioned herein, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity, and most preferably at least 99% identity to any of the sequences mentioned herein.

[0097] Those skilled in the art will understand how to calculate the percent identity between two amino acid / polynucleotide / polypeptide sequences. To calculate the percent identity between two amino acid / polynucleotide / polypeptide sequences, the two sequences must first be aligned and then the sequence identity value calculated. Different values ​​for the percent identity of two sequences can be obtained depending on: (i) the method used to align the sequences, e.g., ClustalW, BLAST, FASTA, Smith-Waterman (as implemented in various programs), or structural alignment by 3D comparison; and (ii) the parameters used by the alignment method, e.g., local alignment vs. global alignment, the pair-scoring matrix used (e.g., BLOSUM62, PAM250, Gonnet, etc.), and the gap penalty, e.g., function form and constant.

[0098] When two sequences are aligned, there are various ways to calculate the percent identity between them. For example, the number of identities can be divided by (i) the length of the shortest sequence, (ii) the length of the alignment, (iii) the average length of the sequences, (iv) the number of non-gap positions, or (iv) the number of matching positions excluding overhangs. Furthermore, it will be understood that percent identity is also strongly length-dependent. Thus, the shorter the sequence pair, the higher the sequence identity that can be expected to occur by chance.

[0099] It will be appreciated, therefore, that accurate alignment of protein or DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, pp. 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, pp. 4876-4882) is a preferred means for generating multiple alignments of proteins or DNA according to the present invention. Suitable parameters for ClustalW may be as follows: for DNA alignments: gap opening penalty = 15.0, gap extension penalty = 6.66, and matrix = identity; for protein alignments: gap opening penalty = 10.0, gap extension penalty = 0.2, and matrix = Gonnet; for DNA and protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will recognize that these and other parameters may need to be varied for optimal sequence alignment.

[0100] Preferably, the percent identity between two amino acid / polynucleotide / polypeptide sequences can then be calculated from such an alignment as (N / T)*100, where N is the number of positions where the sequences share identical residues, and T is the total number of positions compared, including gaps, and with or without overhangs. Preferably, overhangs are included in the calculation. Thus, the most preferred method for calculating the percent identity between two sequences includes (i) generating a sequence alignment, for example, using the ClustalW program with a suitable set of parameters as described above, and (ii) inserting the values ​​of N and T into the formula: sequence identity = (N / T)*100.

[0101] Other methods for identifying similar sequences will be known to those of skill in the art. For example, a substantially similar nucleotide sequence would be encoded by a sequence that hybridizes to a DNA sequence or its complement under stringent conditions. Stringent conditions refer to hybridization of nucleotides to filter-bound DNA or RNA in 3× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by at least one wash in 0.2× SSC / 0.1% SDS at approximately 20-65°C. Alternatively, a substantially similar peptide may differ from the sequences set forth in SEQ ID NOS: 1-3 by at least one, two, three, four, or five amino acids.

[0102] Due to the degeneracy of the genetic code, it is clear that any of the nucleic acid sequences described herein can be modified or altered to obtain functional variants thereof without substantially affecting the sequence of the protein encoded by the nucleic acid sequence. Preferred nucleotide variants are those having sequences altered by substituting different codons encoding the same amino acid within the sequence, i.e., resulting in silent mutations. Other preferred variants are those containing the entire sequence or a portion of a sequence that has a homologous nucleotide sequence but has been modified by substituting different codons encoding amino acids with side chains with similar biophysical properties to the replaced amino acid, resulting in conservative changes. For example, small nonpolar hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large nonpolar hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It is therefore understood that amino acids can be substituted with amino acids having similar biophysical properties, and one skilled in the art would know the nucleotide sequences encoding these amino acids.

[0103] All of the features described in this specification (including all accompanying claims, abstracts, and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination with any of the above aspects, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0104] For a better understanding of the present invention and to show how embodiments thereof may be put into effect, reference will now be made, by way of example, to the accompanying drawings in which: [Brief explanation of the drawings]

[0105] [Figure 1a] Figure 1a illustrates the effect of normal glucagon levels on the severity of infection with SARS-CoV-2. Normal glucagon levels are associated with higher expression of AT1R (represented by seven AT1Rs) and lower expression of ACE2 receptors (represented by three ACE2s). As a result, there are fewer targets for SARS-CoV-2 viral entry, and free viral particles without binding receptors die in the blood circulation. [Figure 1b] Figure 1b shows the effect of elevated glucagon levels on the severity of SARS-CoV-2 infection. High glucagon levels activate AMPK, which suppresses AT1R expression (i.e., fewer than those present in Figure 1a, as represented by four AT1Rs) and increases ACE2 expression (i.e., more than those present in Figure 1a, as represented by six ACE2s). This increases targets for viral entry and thus leads to more severe SARS-CoV-2 infection. [Figure 2] FIG. 1 shows glucagon secretion in rat pancreatic islet cells cultured in the presence of cell culture medium alone (blue) and in the presence of cell culture medium and anti-anti-TCR antibody (green). [Figure 3] FIG. 1 shows the concomitant increase in glucagon secretion (green bars) and glutamate secretion (orange bars) from rat islet cells cultured in the presence of anti-anti-TCR antibodies compared to rat islet cells cultured in cell culture medium alone (blue bars). [Example]

[0106] The inventors sought to test the hypothesis that NDX-90 peptides can reduce glucagon levels in a subject, thereby reducing the expression of ACE2 receptors in the subject's "host" cells, and therefore may provide a novel therapeutic approach for treating, preventing, or ameliorating coronavirus infection or symptoms in infected subjects. material and method Measurement of secreted glucagon levels from isolated rat pancreatic islet cultures Isolated islets were suspended in RPMI 1640 containing 11 mmol / L (200 mg / dL) glucose and 10% FCS. The glucose concentration simulates a diabetic environment. NDX-90 was dissolved in culture medium and added to the appropriate wells at a final concentration of 1 μg / ml. After incubation for the indicated time, samples were removed and glucagon was measured using a Quantikine ELISA Immunoassay (R&D Systems). Cell penetration experiments Buccal tissue culture inserts were transferred under sterile conditions from the original 24-well tissue culture plate (maintained at 4°C in a sealed bag containing 5% CO2) to the wells of a new 24-well plate containing 1.0 ml of serum-free medium preheated to 37°C. The plate was incubated for 1 hour in a humidified incubator at 37°C and 5% CO2 as a pre-equilibration procedure prior to administration. After removal from the incubator, all culture medium covering the tissue surface was carefully removed and replaced with 40 μL of peptide solution appropriately diluted in serum-free culture medium. The plate was then incubated for an additional 30 minutes at 37°C in a 5% CO2 atmosphere. After removal from the incubator, supernatant samples were collected and analyzed by HPLC. The area of ​​the major peaks in the supernatant was compared with that of the stored sample before incubation.

[0107] Example 1 Effect of NDX-90 peptide on secreted glucagon levels from isolated rat pancreatic islet cultures To determine whether NDX-90 can reduce glucagon levels, the inventors measured secreted glucagon levels from isolated rat pancreatic islet cultures.

[0108] [Table 1] As shown in Table 1, the inventors surprisingly discovered that the hypersecretion normalizing effect began almost immediately after addition of the NDX-90 peptide: after 4 hours, a 32% reduction in glucagon secretion was observed, and after 24 hours, glucagon secretion was reduced by 40.9%, which was close to normal levels.

[0109] Thus, the data clearly and surprisingly demonstrate that addition of NDX-90 peptide to isolated islet cultures reduces this stress-induced hypersecretion of glucagon from freshly isolated islets very soon after addition of the peptide.

[0110] Example 2 Effect of NDX-90 peptide treatment on fasting plasma glucagon The inventors then measured the effect of NDX-90 peptide treatment over several months on fasting plasma glucagon levels in subjects with type 2 diabetes.

[0111] [Table 2] As shown in Table 2, mean fasting plasma glucagon levels were significantly reduced in subjects receiving NDX-90 peptide (9.61 pg / ml, P=0.009) compared to the placebo group (1.29 pg / ml, P=0.0843). These results demonstrate that NDX-90 peptide has a long-term glucagon-normalizing effect over several months.

[0112] It has also been reported that mean fasting glucagon concentrations in type 2 diabetes were 3.5 pmol / L (12.2 pg / ml) higher than in nondiabetic control subjects (P=0.012) (Menge B, Gruber L, et al., Diabetes, 2011;60:2160-2168). Thus, the mean improvement of 9.61 pg / ml in fasting glucagon levels in type 2 diabetes patients shown in Table 2 represents a 78.8% improvement toward normal.

[0113] The importance of normalizing glucagon levels extends beyond normalizing glucagon secretion, providing benefits for the prevention or treatment of coronavirus infection. Glucagon secretion from pancreatic alpha cells is accompanied by stoichiometric co-secretion of glutamate (26). First, glutamate acts as a positive autocrine signal for glucagon release; therefore, co-secretion of glutamate generates a continuous signal for further glucagon release (27). Unless this cycle is interrupted, it increases the severity of coronavirus infection. Second, elevated glutamate levels (also called glutamic acid) have been shown to correlate with increased severity of COVID-19 disease (30). Furthermore, plasma glutamate levels in 132 patients with type 2 diabetes were significantly higher (P<0.01) than those in 137 control subjects (31).

[0114] Therefore, hypersecretion of glucagon, co-secreted with glutamate, has a dual impact on the severity of COVID-19 disease, which involves metabolic dysregulation and neurological complications. In particular, glutamate is an important neurotransmitter whose imbalance can contribute to neurological abnormalities. Furthermore, excess glutamate and glutamate transporters have been demonstrated to be associated with SARS-Cov-2 infection and disease severity. Furthermore, because glutamate is utilized by the virus for replication, elevated glutamate levels in COVID-19-infected patients have been linked to disease severity (32).

[0115] As mentioned above, excessive glucagon levels are caused by autoantibodies (anti-anti-TCR antibodies) that increase glucagon as a result of viral infection. As illustrated in Table 3 and Figure 2, the present inventors demonstrated that glucagon secretion in rat pancreatic islet cell cultures significantly increased when cultured in the presence of anti-anti-TCR antibodies compared with culture medium alone.

[0116] [Table 3] Furthermore, rat islet cells cultured in culture medium alone or in culture medium supplemented with anti-anti-TCR antibodies were examined for co-secretion of glucagon and glutamate. Within 4 hours, culture in the presence of anti-anti-TCR antibodies significantly increased both glucagon and glutamate secretion compared with control cells cultured in medium alone. Notably, glutamate levels, co-secreted from the same secretory granules as glucagon, were significantly higher than glucagon levels, measured from the same culture supernatant as glucagon levels (see Figure 3).

[0117] After infection and viral entry into the central nervous system (CNS), the ACE2 receptor mediates the development of neurotoxicity, neuroinflammation, and neurodegeneration through viral entry and replication. Excessive glutamate accumulation promotes inflammatory neurodegeneration by increasing oxidative stress (33). Neurological symptoms frequently occur in hospitalized patients with COVID-19. Brain complications can occur via several pathways, including the bloodstream, infected neurons, olfactory nerves, ocular epithelium, and an impaired blood-brain barrier. Therefore, reducing glutamate levels and thereby reducing glutamate excitotoxicity may prevent or ameliorate neurological symptoms in coronavirus infection.

[0118] In two studies involving 214 and 841 hospitalized Covid-19 patients, neurological findings were observed in 36.4% and 57.4% of cases, respectively (34). Furthermore, a cross-sectional study reported that elevated glutamate levels were associated with higher body mass index (BMI), hypertension, and insulin resistance, including diabetes (35). In a clinical trial involving 980 participants, men and women aged 55–80 years with type 2 diabetes or at least three cardiovascular disease (CVD) risk factors were treated with a Mediterranean diet compared with a regular control diet. Zeng et al. reported that baseline glutamate was associated with a 43% and 81% increased risk of combined CVD or stroke alone, respectively. Several years of follow-up on the Mediterranean diet reduced CVD risk by 37% compared with the control diet. Because conditions associated with high glutamate, namely higher BMI, hypertension, and insulin resistance, are also associated with the severity of Covid-19 infection, reducing glucagon and co-secreted glutamate levels within hours of administering NDX-90 would be highly effective in preventing or ameliorating Covid-19 disease as well as underlying conditions that predispose to severe Covid-19 outcomes.

[0119] Example 3 Cardiolipin-binding ability of NDX-90 peptide Cardiolipin plays a significant role in mitochondrial bioenergetics because it is almost exclusively bound to the mitochondrial membrane and is designed to generate ATP via the electrochemical gradient generated by the electron transport chain. Mitochondrial respiratory chain complexes, called respiratory supercomplexes, are involved in oxidative phosphorylation and maintain their structural integrity and activity through the unique dimeric cross-linked structure of cardiolipin. Cardiolipin contains unsaturated fatty acyl chains, which are oxidizable targets. Peroxidation of cardiolipin is thought to alter its structural integrity, leading to mitochondrial dysfunction associated with age and various pathophysiological conditions, including diabetes and cardiovascular disease (36).

[0120] Detailed analysis revealed that cardiolipin oxidation leads to conformational changes in the backbone / head and chain regions of the oxidized cardiolipin molecule. The oxidized backbone / head groups have been observed to migrate independently, which increases the area per lipid chain and reduces the bilayer thickness, thereby altering the functionality of the inner mitochondrial membrane (37).

[0121] [Table 4] As shown in Table 4, NDX-90 (which is a dimer) has the ability to bind to cardiolipin (also a dimer). The inventors believe that NDX-90 may function by holding the dimeric arms of cardiolipin together, i.e., preventing them from moving separately within the inner mitochondrial membrane and maintaining cardiolipin-dependent bioenergetic processes. By binding to cardiolipin, NDX-90 has therapeutic effects in subjects suffering from diabetes or other conditions characterized by insulin resistance and elevated glucagon levels associated with mitochondrial dysfunction. Therefore, the surprising cell-permeability ability of NDX-90 described above is thought to contribute to its therapeutic function. In severe cases of COVID-19 infection, mitochondrial damage occurs, resulting in the release of mitochondrial DNA (MT-DNA) along with the release of cardiolipin, which in turn leads to acute respiratory distress syndrome (ARDS), cytokine storm, and multiple organ failure. MT-DNA, an endogenous inflammatory molecule, was found at very high levels in the plasma of patients. High circulating MT-DNA levels have also been shown to be an early indicator of unfavorable Covid-19 outcomes. Multivariate regression analysis revealed that high circulating MT-DNA was an independent risk factor for ICU admission, intubation, vasopressor use, or renal replacement therapy (29).

[0122] Cardiolipin is known to bind to various mitochondrial proteins, thereby contributing to their integrity and function. (37) Binding of NDX-90 dimers to cardiolipin chains prevents the oxidatively modified cardiolipin chains from migrating separately, improving the thickness of the mitochondrial membrane bilayer and preventing the release of MT-DNA.

[0123] Example 4 NDX-90 peptide permeability The inventors then measured the buccal tissue permeability of the NDX-90 peptide to determine its uptake. Table 5 summarizes the preliminary permeability analysis of the three peptides A, B, and NDX-90, and Table 6 shows the triplet analysis for peptide A and NDX-90. Peptide A is a dimer of 17 amino acids per monomer, and the peptides are linked by a cysteine ​​residue at the N-terminus of each peptide (i.e., peptide A is approximately twice the size of NDX-90). Peptide B is a dimer of 8 amino acids per monomer, and the peptides are also linked by a cysteine ​​residue at the N-terminus of each peptide.

[0124] [Table 5]

[0125] [Table 6] As can be seen in Table 5, peptide B did not exhibit any permeability across the tissue surface under the experimental conditions. However, NDX-90 clearly demonstrated efficient uptake by buccal tissue cells in triplicate cultures. Comparison of NDX-90 with peptides A and B demonstrates that peptide membrane permeability is an intrinsic property of the peptide, rather than a size effect, which cannot be predicted or expected.

[0126] Example 5 The ability of NDX-90 peptide to reduce ACE2 levels The inventors next measured the effect of NDX-90 peptide on soluble ACE2 levels in cultures of human islet cells from type 2 diabetic tissue donors. Human islet cells were cultured in 24-well tissue culture plates. Two series of cultures were configured. NDX-90 peptide solution was added to one series, and an equal volume of culture medium was added to the second series. Supernatant samples were removed from test and control cultures 4, 24, and 48 hours after addition of the treatment. Supernatant samples were removed only once per time point from each test and control well. Samples were tested for soluble ACE2 using a commercially available ELISA kit according to the manufacturer's instructions. Tests were performed in triplicate, and the average optical density (OD) data are shown in Table 7 below.

[0127] [Table 7] The data show that 4 hours after addition of the peptide to the cultures, a 5.3% reduction in soluble ACE2 levels was observed, and after 24 hours, a further reduction to 6.25% was observed. No further reduction was observed at a longer incubation time of 48 hours. This reflects homeostatic control in a physiological system to maintain normality in the absence of a dominant disease process.

[0128] The impact of reducing soluble ACE2 by NDX-90, as outlined above, becomes clear when considering a paper by Kragstrup TW (38). In this paper (Figure 2), plasma ACE2 levels from 305 hospitalized Covid-19 patients were expressed as relative protein values ​​using Normalized Protein Expression (NPX) on a scale of 0 to 8, with one data point ranging from 0 to 6. Patients were categorized into five groups based on disease severity, ranging from death within 28 days (group 1) to less severe groups 2 to 5, regardless of oxygen requirement. For each group, the median plasma ACE2 level on day 0 of hospitalization was determined. Subdividing the range of plasma ACE2 levels within the 0-6 range into 0 to 60 reveals that the median difference between group 1 (death within 28 days) and groups 2 to 5 (survivors, both with and without oxygen) was only 4 units higher in the 0-60 range. Within this range, where 60 units represent 100%, 4 units represent 6.6% (4 / 60 x 100).

[0129] This is strikingly similar to the 6.25% reduction in soluble ACE2 levels obtained from human type 2 diabetic islet cell cultures in the presence of NDX-90 compared to control cultures (see Table 7 above). Therefore, this clearly demonstrates that early NDX-90 treatment, within 4–24 hours, can sufficiently reduce soluble ACE2 to halt the progression of COVID-19 infection and prevent death. Unlike the culture conditions described above, in vivo dosing can be repeated depending on the severity of the condition. Repeated dosing should prevent an increase in plasma ACE2 levels, as seen in Figure 3 of Kragstrup TW's paper on day 7 after hospitalization (38). It is also a corollary that individuals with underlying conditions involving diabetes, hyperinsulinemia, hyperglucagonemia, cardiovascular disease, and insulin resistance may benefit from NDX-90 treatment, both for their specific condition and as a treatment or prophylaxis for COVID-19 disease. Summary SARS-coronavirus 2 has caused a severe pandemic in human suffering, especially in individuals with underlying conditions associated with impaired glucose tolerance. If an effective treatment could be hypothesized to reduce glucagon levels, thereby reducing ACE2 expression, this treatment would have the potential to prophylactically prevent coronavirus infection or treat or ameliorate symptoms in infected subjects.

[0130] As described herein, the inventors administered the peptide NDX-90 to isolated rat pancreatic islet cultures and observed a significant decrease in glucagon secretion very soon after the addition of the peptide (4 hours) compared to controls. The inventors also found that NDX-90 has a long-term glucagon-normalizing effect over several months and effectively reduces fasting plasma glucagon levels in subjects with type 2 diabetes. This study therefore demonstrates that the NDX-90 peptide reduces glucagon secretion, thereby indicating that this peptide, by reducing ACE2 receptor expression, can be used as an effective treatment for hyperglucagonemia and / or hyperinsulinemia, as well as for preventing, ameliorating, or treating coronavirus infection and symptoms in infected subjects in all conditions where hyperglucagonemia is present.

[0131] Furthermore, NDX-90 demonstrated two additional mechanisms by which it halts Covid-19 infection and disease progression within hours of administration. Glucagon is co-secreted with glutamate from the same pancreatic islet alpha cell secretory vesicles. This pancreatic glutamate accounts for the majority of excess glutamate in patients with insulin resistance, diabetes, cardiovascular disease, hypertension, obesity, and other underlying conditions that predispose to severe Covid-19 outcomes. Glutamate levels are elevated during Covid-19 infection and are responsible for neurological symptoms that exacerbate disease severity. Because glutamate is co-secreted with glucagon from the same secretory granules, glutamate secretion is reduced concomitantly with glucagon secretion.

[0132] However, the effects of glutamate are distinct from those of glucagon. Glutamate is utilized by viruses during their replication process; therefore, high glutamate levels contribute to viral load and are associated with COVID-19 severity and poor survival outcomes. In two studies of hospitalized COVID-19 patients, neurological findings were observed in 36.4% and 57.4% of cases, respectively. Therefore, reducing glutamate levels by administering NDX-90 should be both preventive and therapeutic for COVID-19 disease.

[0133] Furthermore, NDX-90 has the ability to bind to cardiolipin, a unique phospholipid located almost exclusively in the inner mitochondrial membrane. In severe cases of COVID-19, mitochondrial damage occurs, resulting in the release of mitochondrial DNA (MT-DNA), which is accompanied by cardiolipin release, leading to acute respiratory distress syndrome (ARDS), cytokine storm, and multiple organ failure. MT-DNA is an endogenous inflammatory molecule and has been shown to be present at very high levels in the plasma of patients. High circulating MT-DNA levels have also been shown to be an early indicator of unfavorable COVID-19 outcomes. Therefore, binding of NDX-90 dimers to cardiolipin chains may prevent oxidatively modified cardiolipin chains from moving apart, improving the thickness of the mitochondrial membrane bilayer and preventing MT-DNA release.

[0134] Thus, three mechanisms that may allow NDX-90 to be preventative and therapeutic are as follows:

[0135] 1) First, reducing glucagon levels to normal reduces ACE2 levels sufficiently to prophylactically prevent Covid-19 infection or therapeutically prevent disease progression and death.

[0136] 2) Second, glucagon and glutamate are co-secreted stoichiometrically, so a reduction in glucagon secretion is accompanied by a stoichiometric reduction in glutamate secretion. Glutamate promotes viral proliferation, and glutamate excitotoxicity is responsible for neurological complications in COVID-19 disease. Therefore, by reducing both glucagon and glutamate secretion, NDX-90 may be highly effective in preventing or ameliorating coronavirus infection.

[0137] 3) Third, the leakage of mitochondrial DNA and cardiolipin from damaged mitochondria observed in severe Covid-19 disease is proinflammatory, leading to acute respiratory distress syndrome (ARDS), cytokine storm, and multiple organ failure. NDX-90 dimers bind to dimeric cardiolipin and stabilize damaged cardiolipin-rich mitochondrial membranes. Cell-permeable NDX-90 has already shown highly significant therapeutic effects in type 2 diabetes, a mitochondrial dysfunction-associated disease that predisposes to severe Covid-19 infection outcomes.

[0138] Thus, NDX-90, a comprehensive, fast-acting treatment, addresses early infection levels (glucagon and ACE2) as well as disease-exacerbating factors (high glutamate) involved in viral proliferation, neurotoxicity, and mitochondrial destabilization, which releases pro-inflammatory mitochondrial DNA and cardiolipin. Therefore, NDX-90 peptide can be used to effectively prevent, ameliorate, or treat coronavirus infection and symptoms in infected subjects. References 1. CDC COVID-19 Response Team. Preliminary Estimates of the Prevalence of Selected Underlying Health Conditions Among Patients with Coronavirus Disease 2019-United States, February 12-March 28,2020. MWMR, April 3,2020, Vol 69, No 13. 2. Ramchand J., Patel S.K., et al. Elevated plasma angiotensin converting enzyme 2 activity is an independent predictor of major cardiac events in patients with obstructive coronary artery disease. PLOS ONE journal.pone.0198144 June 19 2018. 3. Soro-Paavonen A, Gordin D, Forsblom C et al. Circulating ACE2 activity is increased with type 1diabetes and vascular complications. J Hypertens 30: 375-383, 2012. 4. Anguiano L, Riera M,Pascual J et. al. Circulating angiotensin-converting enzyme 2 activity in patients with chronic kidney disease without previous history of cardiovascular disease. Nephrol Dial Transplant 30:1176-1185, 2015. 5. Gilbert A., Liu J., Cheng G., etal. A review of urine angiotensin converting enzyme 2 in diabetes and diabetic nephropathy. Biochem Med (Zagreb) 2019;29(1): 010501. 6. Yang JK, Feng Y, Yuan MY et. al. Plasma glucose levels and diabetes are independent predictors for mortality and morbidity in patients with SARS. Diabetic Medicine, 23 (6): 623-628, 2006. 7. Jia HP, Look DC, Shi L, Hickey M et. al. ACE2 receptor expression and Severe Acute Respiratory syndrome Coronavirus Infection depend on differentiation of human airway epithelia. Journal of Virology, 79:14614-14621, 2005. 8. Qiao Q, Jousilahti P, ErikssonJ et.al, Predictive properties of Impaired Glucose Tolerance for Cardiovascular risk are not explained by the development of overt diabetes during follow-up. Diabetes Care, 26: 2910-2914, 2003. 9. Sechi LA, Catena C, Zingaro L, et. al. Abnormalities of glucose metabolism in patients with early renal failure. Diabetes, 51:1226-1232, 2002. 10. Nathan DM, Davidson MB, DeFronzo RA et. al. Impaired fasting glucose and impaired glucose tolerance. Diabetes Care, 30:753-759, 2007. 11. Abdul-Ghani MA, Tripathy D, De Fronzo RA. Contribution of β-cell dysfunction and insulin resistance to the pathogenesis of impaired glucose tolerance and impaired fasting glucose. Diabetes Care, 29:1130-1139, 2006. 12. Faerch K, Vistsen D, Pacini G et. al. Insulin resistance is accompanied by increased fasting glucagon and delayed glucagon suppression in individuals with normal and impaired glucose regulation. Diabetes, 65: 3473-3481, 2016. 13. Ichikawa R, Takano K, Fujimoto K, et.al. Basal glucagon hypersecretion and response to oral glucose load in prediabetes and mild type2 diabetes. Endocrine Journal,66:663-675, 2019. 14. Reaven GM, Chen YD, Golay A, et. al. Documentation of hyperglucagonemia throughout the day in nonobese and obese patients with noninsulin-dependent diabetes mellitus. J Clin. Endocrinol.Metab. 64:106-110, 1987. 15. Estall JL , Drucker DJ. Glucagon and Glucagon-Like Peptide Receptors as Drug Targets. Current Pharmaceutical Design 2006; 12: 1731- 1750 16. Huypens P, Ling Z, Pipeleers D, Schuit F. Glucagon receptors on human islet cells contribute to glucose competence of insulin release. Diabetologia 2000; 43:1012-1019 17. Ahren B. Glucagon secretion in relation to insulin sensitivity in healthy subjects. Diabetologia 2006 Jan;49(1):117-22. Epub 2005 Dec 17 18. Liu J, Li X, Lu Q et al. AMPK: a balancer of the renin-angiotensin system. Bioscience Reports , 2019, 39 BSR 20181994. 19. Hardie, DG. Minireview: the AMPK-activated protein kinase cascade: the key sensor of cellular energy status. Endocrinology, 2003; 144:5179-5183. 20. Longuet C, Sinclair EM, Maida A et.al. The glucagon receptor is required for the adaptive metabolic response to fasting. Cell Metabolism 8:359-371, 2008. 21. Hardie, DG. AMP-activated protein kinase: a key regulator of energy balance with many roles in human disease. J. Intern. Med., 2014; 276: 543-559. 22. Meng RS, Pei ZH et al. Adenosine-monophosphate- activated protein kinase inhibits cardiac hypertrophy through reactivating peroxisome-activated receptor-alpha signaling pathway. Eur.J. Pharmacol., 2009; 620: 63-70. 23. Li X., Liu J. et al., AMPK: a therapeutic target of heart failure-not only metabolism regulation. 2019; Biosci. Rep. 39, BSR20181767. 24. Kim SG., Kim JR. et al., Quercetin-induced AMP-activated protein kinase activation attenuates vasoconstriction through LKB1-AMPK signaling pathway. J.Med.Food, 2018; 21:146-153. 25. Gao F., Chen J. et al. A potential strategy for treating atherosclerosis: improving endothelial function via AMP-activated protein kinase. Sci. China Life Sci.,2018; 61: 1024-1029. 26. Hyashi M, Yamada H et al. Secretory Granule-mediated Co-secretion of L-Glutamate and Glucagon Triggers Glutamatergic Signal Transmission in Islets of Langerhans, JBC,2003; 278:1966-1974. 27. Cabrera O, Jacques-Silva MC et al. Glutamate Is a Positive Autocrine Signal for Glucagon Release, Cell Metabolism, 2008; 7:1-10. 28. Ceriello A, Standl E, et al.Issues of Cardiovascular Risk Management in People With Diabetes in The Covid-19 Era. Diabetes Care, 2020; 43(7): 1427-1432. 29. Scozzi D, Cano M et al. Circulating mitochondrial DNA is an early indicator of severe illness and mortality from COVID-19. JCI Insight, 2021:6(4):e143299 https: / / doi.org / 10.1172 / jci.insght.143299 30. Paez-Franco JC, Torres-Ruiz J et al, Metabolomics analysis reveals a modified amino acid metabolism that correlates with altered oxygen homeostasis in COVID-19 patients, Nature Scientific Reports, 2021; 11:6350. 31. Chen T, Zang X, Long Y, Yu H, Ran X, Gao Y, Lu H, Xie X, Chen X, et al. The association of plasma free amino acids with liver enzymes in type 2 diabetes patients. J Endocrinol Invest. 2012, 35:772-775. 32. Krishnan S, Nordqvist H et al. Implications of central carbon metabolism in SARS-C0v-2 replication and disease severity. bioRxiv , 2021; doi:https: / / doi.org / 10.1101 / 2021.02.24.432759 33. Engin AB, Engin ED et al. Current opinion in neurological manifestations of SARA-CoV-2 infection. Current Opinion in Toxicology, 2021; 25: 49-56. 34. Romero-Sanchez CM, Diaz-Maroto I et al. Neurologic manifestations in hos;ilazed patients with COVID-19: the ALBACOVID registry. Neurology, 2020; 95: e1060-e1070. 35. Zeng Y, Hu FB et al. Metabolites of Glutamate Metabolism Are Associated With Incident Cardiovascular Events in the PREDIMED PREvencion con DIeta MEDiterranea (PREDIMED) Trial. J Am Heart Assoc. 2016; 5:e003755. 36. Paradies G, Paradies V, De Benedictis V et al. Functional role of cardiolipin in mitochondrial bioenergetics. Biochimica and Biophysica Acta, 2014; 1837: 408-417. 37. Vahaheikkila M, Peltomaa T, Rog T et al. How cardiolipin peroxidation alters the properties of the inner mitochondrial membrane. Chemistry and Physics of Lipids, 2018; 214: 15-23. 38. .Kragstrup TW, Sing HS et al., Plasma ACE2 predicts outcome of COVID-19 in hospitalized patients PLOS ONE, 2021; 16(6):e0252799.

Claims

1. 1. A pharmaceutical composition for use in the treatment, prevention, or amelioration of coronavirus infection or symptoms in an infected subject, comprising a peptide of the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid encoding said peptide, wherein said peptide is linked together to form a dimer with a second peptide of the amino acid sequence set forth in SEQ ID NO: 1, and wherein the peptides are linked by a cysteine ​​residue at the N-terminus of each peptide.

2. The pharmaceutical composition described in claim 1, wherein the peptide or nucleic acid is capable of reducing and / or inhibiting the production of anti-anti-T cell receptor antibodies in a subject compared to the level of anti-anti-T cell receptor antibodies in an untreated subject.

3. A pharmaceutical composition described in claim 1 or 2, wherein the peptide or nucleic acid is capable of reducing and / or inhibiting glucagon secretion in a subject compared to the level of glucagon secretion in an untreated subject.

4. 4. The pharmaceutical composition of claim 3, wherein glucagon secretion in the pancreatic islets of the subject is reduced and / or inhibited compared to the level of glucagon secretion in an untreated subject.

5. A pharmaceutical composition described in any one of claims 1 to 4, wherein the peptide or nucleic acid is capable of reducing and / or inhibiting glutamate secretion in a subject compared to the level of glutamate secretion in an untreated subject.

6. A pharmaceutical composition described in any one of claims 1 to 5, wherein the peptide or nucleic acid is capable of reducing and / or inhibiting ACE2 overexpression in a subject compared to the level of ACE2 expression in an untreated subject.

7. A pharmaceutical composition described in any one of claims 1 to 6, wherein the peptide or nucleic acid binds to cardiolipin, and optionally the peptide or nucleic acid is capable of reducing and / or inhibiting the release of mitochondrial DNA (mtDNA) from mitochondria in a subject compared to the level of mtDNA release from mitochondria in an untreated subject.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the coronavirus is a virus belonging to the coronavirus group of disease-causing pathogens, and infects host cells by targeting the angiotensin-converting enzyme 2 (ACE2) receptor on the host cell.

9. 9. The pharmaceutical composition of any one of claims 1 to 8, wherein the coronavirus is selected from MERS, SARS-CoV-1, and SARS-CoV-2.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the coronavirus is SARS-CoV-2.

11. The pharmaceutical composition of any one of claims 1 to 10, wherein the peptide or nucleic acid is capable of treating, preventing, or ameliorating coronavirus infection or symptoms in an infected subject with an underlying condition, the underlying condition being associated with impaired glucose tolerance or elevated fasting blood glucose levels.

12. 12. The pharmaceutical composition of claim 11, wherein the underlying disease is associated with elevated glucagon levels (i.e., hyperglucagonemia) or insulin resistance (i.e., hyperinsulinemia).

13. The pharmaceutical composition of claim 11 or 12, wherein the subject is glucose intolerant.

14. 14. The pharmaceutical composition according to any one of claims 11 to 13, wherein the underlying disease is selected from the group consisting of diabetes, type 1 diabetes, type 2 diabetes, hypertension, cardiovascular disease, renal disease, and pulmonary disease.

15. The pharmaceutical composition of claim 14, wherein the subject is a diabetic patient infected with SARS-CoV-2.

16. The pharmaceutical composition of any one of claims 1 to 10, wherein the subject does not have an underlying disease.

17. The pharmaceutical composition of claim 16, wherein the subject is a non-diabetic patient infected with SARS-CoV-2.

18. The pharmaceutical composition of any one of claims 1 to 17, wherein the peptide or nucleic acid is capable of treating, preventing, or ameliorating coronavirus infection or symptoms in an infected subject in their 20s, 30s, 40s, 50s, 60s, 70s, 80s, or 90s.

19. 19. The pharmaceutical composition of claim 1, wherein the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO: 2 or 3.

20. 20. The pharmaceutical composition according to any one of claims 1 to 19, wherein the nucleic acid molecule encoding the peptide is a genetic construct and / or said nucleic acid molecule or genetic construct is provided in a recombinant vector.

21. A pharmaceutical composition for use in the treatment, prevention, or amelioration of conditions characterized by hyperglucagonemia, hyperinsulinemia, and / or high or excessive glutamate, comprising a peptide of the amino acid sequence set forth in SEQ ID NO: 1, or a nucleic acid encoding said peptide, wherein said peptide is linked together with a second peptide of the amino acid sequence set forth in SEQ ID NO: 1 to form a dimer, and wherein said peptides are linked by a cysteine ​​residue at the N-terminus of each peptide.

22. 22. The pharmaceutical composition of claim 21 for use in the treatment, prevention, or amelioration of type 2 or type 1 diabetes, hypertension, chronic heart disease, cardiovascular disease, kidney disease, chronic lung disease, obesity, cancer, impaired glucose tolerance (IGT), impaired fasting blood glucose / glucagon (IFG), Alzheimer's disease, chronic schizophrenia, major depressive disorder (MDD), autism spectrum disorder, multiple sclerosis, Parkinson's disease, or a neuromuscular degenerative disorder.

23. 23. The pharmaceutical composition of claim 21 or 22, preferably for use in effectively preventing, ameliorating, or treating coronavirus infection or symptoms in an infected subject by reducing and / or inhibiting ACE2 expression in the subject compared to the level of ACE2 expression in an untreated subject.

24. A pharmaceutical composition according to any one of claims 1 to 23, further comprising a pharmaceutically acceptable vehicle.

25. 25. A method of making the pharmaceutical composition of claim 24, comprising combining a therapeutically effective amount of a peptide of the amino acid sequence set forth in SEQ ID NO: 1 or a nucleic acid encoding said peptide with a pharmaceutically acceptable vehicle, wherein said peptide is linked together with a second peptide of the amino acid sequence set forth in SEQ ID NO: 1 to form a dimer, and said peptides are linked by a cysteine ​​residue at the N-terminus of each peptide.

Images