Factors for direct cross-differentiation of motor neurons

The Gsta4 protein or nucleic acid enhances direct cross-differentiation efficiency into motor neurons, addressing low efficiency in conventional methods and providing a therapeutic approach for neurological disorders.

JP7828619B2Active Publication Date: 2026-03-12STANDUP THERAPEUTICS INC +2
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-12-29
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Conventional direct cross-differentiation methods for converting mature somatic cells into motor neurons have low efficiency, and existing stem cell-based approaches face ethical and stability issues.

Method used

A novel differentiation factor, Gsta4 protein or its encoding nucleic acid, is used to directly convert somatic cells into induced motor neurons, potentially combined with other proteins like Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1, utilizing vectors such as retroviruses or adenoviruses for delivery.

Benefits of technology

Enhances the direct cross-differentiation efficiency into motor neurons, offering a potential therapeutic solution for neurological diseases by improving conversion rates and reducing the time required for differentiation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007828619000002
    Figure 0007828619000002
  • Figure 0007828619000003
    Figure 0007828619000003
  • Figure 0007828619000004
    Figure 0007828619000004
Patent Text Reader

Abstract

The present application relates to novel differentiation factors for direct cross-differentiation of somatic cells into motor neural cells and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present application relates to a novel differentiation factor for direct cross-differentiation of motor neurons.

[0002] The present application relates to compositions containing the novel differentiation factors.

[0003] The present application relates to a method for direct cross-differentiation utilizing the above-mentioned composition.

[0004] The present application relates to various uses of the novel differentiation factors described above. [Background technology]

[0005] Stem cells are widely used in regenerative medicine. Stem cells are pluripotent cells that can differentiate into any cell type that makes up the human body. In theory, they can differentiate into any type of functional cell and proliferate indefinitely. Depending on their origin, stem cells are classified as embryonic stem cells, adult stem cells, garden stem cells, and dedifferentiated stem cells (or induced pluripotent stem cells).

[0006] However, stem cells have ethical issues, stability issues, and low differentiation efficiency depending on the type. Furthermore, dedifferentiated stem cells have problems such as the possibility of teratoma formation and low differentiation efficiency.

[0007] Because stem cells have such various problems, new technologies are required in the field of regenerative medicine.

[0008] Direct cross-differentiation technology has recently been gaining attention. Direct cross-differentiation is different in that it directly induces transformation into the target cells without first reprogramming induced pluripotent stem cells and then redifferentiating them into the target cells.

[0009] In other words, it is a method to induce the conversion between mature (completely differentiated) cells that have completely different cell types. However, the conventional direct cross-differentiation method has the limitation of low efficiency, so a new method that can overcome this limitation is currently required. Summary of the Invention [Problem to be solved by the invention]

[0010] One objective of the present application is to provide a novel differentiation factor for direct crossing of motor neurons. In particular, the novel differentiation factor relates to Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding the same.

[0011] Another object of this application is to provide a composition containing the novel differentiation factor described above.

[0012] Another object of this application is to provide a direct cross-differentiation method using the above composition.

[0013] Another objective of this application is to provide diverse applications for the aforementioned novel differentiation factors. [Means for solving the problem]

[0014] This application aims to solve the aforementioned problems, In one embodiment, the present application provides a composition for direct cross-differentiation of somatic cells into induced motor neurons, the composition comprising Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid encoding the same.

[0015] The composition may further comprise ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid encoding the same.

[0016] The composition is characterized in that Hb9 and Lhx3 are selected from ii).

[0017] In this case, the Ascl1 protein can be SEQ ID NO: 17, and the nucleic acid encoding the Ascl1 protein can have the sequence of SEQ ID NO: 18; The Brn2 protein can be SEQ ID NO: 19, and the nucleic acid encoding the Brn2 protein can have the sequence of SEQ ID NO: 20; The Myt1L protein can be SEQ ID NO: 21, and the nucleic acid encoding the Myt1L protein can have the sequence of SEQ ID NO: 22; The Hb9 protein can be SEQ ID NO: 13, and the nucleic acid encoding the Hb9 protein can have the sequence of SEQ ID NO: 14; The Isl1 protein can be SEQ ID NO: 23, and the nucleic acid encoding the Isl1 protein can have the sequence of SEQ ID NO: 24; The Lhx3 protein can be SEQ ID NO: 15, and the nucleic acid encoding the Lhx3 protein can have the sequence of SEQ ID NO: 16; The Ngn2 protein can be SEQ ID NO: 25, and the nucleic acid encoding the Ngn2 protein can have the sequence of SEQ ID NO: 26; The NeuroD1 protein can be SEQ ID NO:27, and the nucleic acid encoding the NeuroD1 protein can have the sequence of SEQ ID NO:28.

[0018] In another embodiment of the present application, a method for expressing differentiation factors for direct cross-differentiation is provided. vector The direct cross-differentiation is a transformation of a somatic cell into an induced motor neuron, vector teeth i) Nucleic acid encoding the Gsta4 protein ; and ii) promoter; including, In this case, the i) and ii) are operably linked. vector can be provided.

[0019] The aforementioned vectormay further comprise iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0020] For direct cross-differentiation of differentiation factor expression vector The direct cross-differentiation is a transformation of a somatic cell into an induced motor neuron, vector At least the first vector and the second vector and The first vector teeth, i) Nucleic acid encoding the Gsta4 protein ; and ii) promoter; including, At this time, i) and ii) are operably connected, The second vector teeth, iii) nucleic acids coding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; and iv) a promoter; At this time, iii) and iv) are operably connected, The above ii) and iv) may be the same promoter or different promoters. The above iii) is one vector Included in or two or more vector Features that can be included vector can be provided.

[0021] The aforementioned Vector of is a virus vector or non-viral vector It may be a virus SpektorThese include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), vexinia viruses, poxviruses, HIV (Human Immunodeficiency Virus), MLV (Murineleukemia Virus), ASLV (Aviansarcoma / leukosis), SNV (Spleennecirosis Virus), RSV (Rous sarcoma Virus), MMTV (Mouse Mammary Tumor Virus), herpes simplex virus, and epizomals. Herpes simplex virus It could be one or more of the following.

[0022] Another specific example of this application is a method for direct cross-differentiation, in which somatic cells are converted into motor neurons, the method comprising introducing a composition comprising the Gsta4 protein or nucleic acid coding thereon into somatic cells, wherein the method does not generate induced pluripotent stem cells (iPSCs).

[0023] The somatic cells mentioned above include fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericyte It may be one or more selected from astrocytes, blood cells, or rare dendritic glial progenitor cells.

[0024] With the aforementioned introduction, somatic cells can differentiate into induced motor neurons within one to seven weeks.

[0025] As another embodiment of the present application, there is provided a pharmaceutical composition for preventing or treating nervous system diseases, comprising a Gsta4 protein for direct cross-differentiation of somatic cells into induced motor neurons.

[0026] Also provided is a pharmaceutical composition for preventing or treating nervous system diseases, comprising somatic cells into which Gsta4 protein or a nucleic acid encoding the same has been introduced for direct cross-differentiation of somatic cells into induced motor neurons.

[0027] The pharmaceutical composition may further comprise a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0028] A pharmaceutical composition for the prevention or treatment of neurological diseases can be provided, comprising motor neurons in which differentiation factors for direct cross-differentiation into motor neurons induced from somatic cells are overexpressed. In this case, the motor neurons may overexpress one or more differentiation factors selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1).

[0029] In another embodiment of the present application, a method for preventing or treating a nervous system disease includes: administering to a subject i) a Gsta4 protein; or ii) a Gsta4 protein; and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; A method can be provided that includes the above, and is characterized in that the direct cross-differentiation does not generate induced pluripotent stem cells (iPSCs).

[0030] A method for preventing or treating a nervous system disease may be provided, which comprises administering to a subject somatic cells into which a composition containing a Gsta4 protein or a nucleic acid encoding the same has been introduced.

[0031] A method can be provided for preventing or treating a neurological disease, comprising introducing a composition containing the Gsta4 protein or a nucleic acid coding therein into somatic cells and administering the resulting mixture to motor neurons.

[0032] The aforementioned neurological disorders may be one or more selected from spinal cord injury, Parkinson's disease, stroke, amyotrophic spinal lateral sclerosis, motor nerve injury, traumatic peripheral nerve injury, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable diseases, Alzheimer's disease, congenital metabolic neurological disorders, traumatic brain injury, motor neuron injury, or diseases induced thereby. [Effects of the Invention]

[0033] According to the present application, the following effects are obtained.

[0034] Firstly, this application provides a novel differentiation factor for direct cross-differentiation of motor neurons. This novel differentiation factor enables the effective differentiation of somatic cells into motor neurons and may be useful in the treatment of neurological diseases. [Brief explanation of the drawings]

[0035] [Figure 1]Figure 1 shows schematic diagrams of the AAV vectors used in this embodiment. (a) is a schematic diagram of the AAV vector including Gsta4; (b) is a schematic diagram of the AAV vector including Ascl1, Isl1, Lhx3 and Ngn2 (also called Neurog2); (c) is a schematic diagram of the AAV vector including Brn2, Hb9 (also called Mnx1) and NeuroD1; (d) is a schematic diagram of the AAV vector including Gsta4 and Myt1l; and (e) is a schematic diagram of the AAV vector including Gsta4, Hb9 and Lhx3. [Figure 2] Figure 2 shows the results of introducing a novel differentiation factor, Gsta4, into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by the expression of neuronal markers (ChaT, Map2). (a) is the result of immunofluorescence staining, and (b) is a quantification of the results of (a). [Figure 3] Figure 3 shows the results of introducing conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into human-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Figure 4] Figure 4 shows the results of introducing the novel differentiation factor Gsta4 and conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Figure 5] Figure 5 shows the results of immunofluorescence staining of mouse fibroblasts, which were transfected with differentiation factors and then directly cross-differentiated into motor neurons, by confirming the expression of neuronal markers (ChaT, Map2). The differentiation factors used were Gsta4 alone and a combination of Gsta4 and conventional differentiation factors. [Figure 6] FIG. 6 is a graph showing the numerical values ​​of the number of immunofluorescently stained cells in FIG. [Figure 7]Figure 7 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were conventional differentiation factors alone, and combinations of Gsta4 and conventional differentiation factors. [Figure 8] Figure 8 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which is used to confirm the expression of neuronal markers (ChaT, Map2). The differentiation factors used were a combination of Mnx1 and Lhx3, and a combination of Gsta4, Mnx1, and Lhx3. (a) shows the results of immunofluorescence staining, and (b) shows the results of (a) quantified. [Figure 9] Figure 9 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by examining the expression of neuronal markers (Synapsin, Map2, Hb9). The differentiation factors used were Gsta4 alone; Mnx1 and Lhx3 combination; and Gsta4, Mnx1, and Lhx3 combination. [Figure 10] Figure 10 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct differentiation of motor neurons by examining the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were a combination of Ascl1, Brn2, and Myt1L; and a combination of Gsta4, Ascl1, Brn2, and Myt1L. [Figure 11] Figure 11 shows the results of introducing differentiation factors into human-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). The differentiation factors used were combinations of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and combinations of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1, and Gsta4. [Figure 12]Figure 12 shows the results of introducing differentiation factors into mouse character cells and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which identified neuronal markers (vChaT, Map2). The differentiation factors used were combinations of Hb9, Isl1, Lhx3, and Ascl1; combinations of Hb9, Isl1, Lhx3, Ascl1, Brn2, Myt1L, and Ngn2 (listed under known factors); and combinations of known factors and Gsta4. [Figure 13] Figure 13 shows the results of introducing differentiation factors into human fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which indicates the expression of neuronal markers (NEUN, Map2). [Figure 14] Figure 14 shows the overall experimental design for administering differentiation factors (indicated as "injection") to L5, the spinal cord injury site in a spinal cord injury (SCI) mouse model, which is a model of lower body paralysis due to spinal cord injury, in order to perform morphological changes, physiological analyses, and behavioral analyses. [Figure 15] Figure 15 shows the results of crystal violet staining to confirm morphological changes in the spinal cord injury site after administering differentiation factors to the SCI mouse model. In this case, "Mock" refers to the group administered AAV (Adeno-associated virus); "Control" refers to the group administered AAV into which conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1) were introduced; and "+Gsta4" refers to the group administered AAV into which the aforementioned conventional differentiation factors and Gsta4 were introduced. [Figure 16] Figure 16 shows the results of immunofluorescence staining of motor neuron markers (ChaT, Map2) after administering differentiation factors to an SCI mouse model. In this case, "Mock" refers to the group administered AAV (Adeno-associated virus); "Control" refers to the group administered AAV containing conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and "+Gsta4" refers to the group administered AAV containing the aforementioned conventional differentiation factors and Gsta4. [Figure 17] Figure 17 shows the results of checking the rectangular box area enclosed by the white dotted line in Figure 16. [Figure 18] Figure 18 shows the quantification of the immunofluorescence staining results shown in Figure 16. [Figure 19] Figure 19 shows the electrophysiological changes in motor neurons after administration of differentiation factors to SCI mouse models. (a) shows patch-clamped neurons; (b) shows action potential measurements; and (c) shows signals from presynaptic neurons. Sham refers to a normal group with no spinal cord injury; mock refers to a group of SCI mouse models administered AAV; control refers to a group administered AAV containing conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and +Gsta4 refers to a group administered AAV containing the conventional differentiation factors and Gsta4. [Figure 20] Figure 20 shows the results of analyzing the therapeutic effect of lower body paralysis at the spinal cord injury site (L5) after administration of differentiation factors to an SCI mouse model using the BBB score (Basso Beatie and Bresnahan score). (a) is a graph quantifying the observation results in (b). Here, Sham refers to a normal group with no spinal cord injury; Mock refers to a group of SCI mouse models administered AAV; -Gsta4 refers to a group administered conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and +Gsta4 refers to a group administered the conventional differentiation factors and Gsta4. [Figure 21] Figure 21 shows the results of behavioral analysis of the therapeutic effect of differentiation factors on paraplegia in SCI mouse models. (a) Forced swimming test; (b) Self-urination; (c) Numerical values ​​of (a) and (b); (d) Foot printing test. DETAILED DESCRIPTION OF THE INVENTION

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or identical to those described herein can be used in the practice or testing of this application, suitable methods and materials are described below. All publications, patent applications, papers, and other references mentioned in this application are incorporated by reference in their entirety. Furthermore, the materials, methods, and practices are merely illustrative and not intended to be limiting.

[0037] Term definition ● Direct reprogramming / direct cell-conversion / transdifferentiation

[0038] As used herein, the terms "direct reprogramming, direct conversion, and transdifferentiation" refer to the conversion of terminally differentiated cells into target cells by introducing differentiation factors. In particular, direct reprogramming induces the conversion between mature cells of completely different cell types; that is, the conversion of somatic cells into target cells without passing through a pluripotent state. The terms direct reprogramming, direct differentiation, and direct transdifferentiation can be used interchangeably.

[0039] ● Direct cross-differentiation factor (Direct cell-Conversion factor, converting factor)

[0040] In this application, the term "direct cell-conversion factor" refers to a factor involved in the above-mentioned direct cross-differentiation. In this case, the differentiation factor may be a gene, a compound, a protein, a nucleic acid, etc. The term "direct cell-conversion factor" can be used interchangeably with "converting factor."

[0041] ● Induced motor neurons (iMNs)

[0042] In this application, the term "induced motor neurons" refers to motor neurons induced by direct cross-differentiation. The induced motor neurons refer to motor neurons artificially produced by direct cross-differentiation of somatic cells using the novel differentiation factors of this application. The term "induced motor neurons" can be used interchangeably with motor neurons (iMNs).

[0043] ● Treatment The term "treatment" as used in this application means to alleviate or inhibit the progression of a disease, illness, symptom, etc. The treatment refers to any action that improves or favorably alters symptoms using the composition of the present invention, direct cross-differentiation factors, etc. Substances that exhibit such therapeutic effects are commonly referred to as "treatment agents" or "pharmaceutical compositions." In particular, a gene therapy agent refers to genetic material that delivers genes into the human body in various forms and methods for the purpose of treating a disease, etc. Furthermore, a cell therapy agent refers to the delivery of a therapeutic material in the form of cells into the human body for the purpose of treating a disease, etc.

[0044] ● About As used in this application, the term “drug” means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by approximately 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% with respect to the reference quantity, level, value, number, frequency, percentage, size, amount, or length.

[0045] 1. Novel factor for direct cross-differentiation: Gsta4 (glutathione S-transferase alpha 4)

[0046] Characteristics of direct cross differentiation

[0047] Direct cross-differentiation is the process of turning fully differentiated cells into cells of another lineage without the need for a stem cell reprogramming step. This process effectively converts fully differentiated cells into specific cells of another lineage without going through the stem cell stage.

[0048] To date, two methodologies have been proposed for direct cross-differentiation: SDR (Somatic cell-specific factor-mediated Direct Reprogramming) and PDR (Pluripotent cell-specific factor-mediated Direct Reprogramming). SDR induces direct cross-differentiation into the target cell type by overexpressing factors that are highly expressed in the target cell type in the target cells. PDR uses factors OCT4, SOX2, KLF4, and C-Myc, which are used in the reprogramming of induced pluripotent stem cells, to dedifferentiate them into an incomplete intermediate cell type (a cell similar to a stem cell), and then directly cross-differentiates them into the target cell type through the creation of a culture medium. In the case of PDR, even when directly cross-differentiating into various cell types, four reprogramming factors (OCT4, SOX2, KLF4, and C-Myc) are commonly used to overexpress them in the initial stages.

[0049] Known Direct Cell-Conversion Factors

[0050] Known differentiation factors used for direct cross-differentiation include Ascl1 (Achaete-scute homolog 1), Nurr1 (Nuclear Receptor Subfamily 4 Group A Member 2), Lmx1a (LIM Homeobox Transcription Factor 1 Alpha), Foxa2 (Forkhead box protein A2), Brn2 (POU Class 3 Homeobox 2), Sox2 (sex determining region Y-box 2), Foxg1 (Forkhead Box G1), Lhx3 (LIM homeobox 3), HB9 (Homeobox HB9), IsL1 (ISL LIM homeobox 1), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), Myt1l (Myelin Transcription Factor 1 Like), and NeuroD2 (Neuronal Differentiation 2), miR-9 (microRNA-9), miR-124 (microRNA-124), Zic1 (Zic Family Member 1), Gata5 (GATA Binding Protein 5), Hnf4α (Hepatocyte nuclear factor 4 alpha), HNF1α (hepatocyte nuclear factor 1 alpha), Foxa1 (Forkhead Box A1), Foxa3 (Forkhead Box A3), Tbx5 (T-Box Transcription Factor 5), Mef2c (Myocyte Enhancer Factor 2C), Oct4 (Octamer-binding transcription factor 4), PRDM16 (PR / SET Domain 16), MyoD (myoblast determination protein 1), Klf4 (Kruppel-like factor 4), and c-Myc (cellular Myc) are known (Mol Cell. 2012 Sep 28;47(6):827-838.).

[0051] In particular, differentiation factors used for direct cross-differentiation into motor neurons include Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0052] Problems with conventional direct cross-reactivity factors Direct cross-differentiation has the advantage of enabling the conversion of differentiated cells into completely different cell types without going through the induced pluripotent stem cell stage. However, the problems with currently known differentiation factors are that the conversion efficiency between cells is low or non-existent when used alone or in combination.

[0053] Overview of Gsta4, a novel factor for direct cross-differentiation The present application discloses a novel factor for direct cross-differentiation, Gsta4 (glutathione S-transferase alpha 4).

[0054] The aforementioned Gsta4 can effectively and directly cross-differentiate somatic cells into motor neurons even when used alone. Furthermore, when Gsta4 is used in conjunction with conventional direct cross-differentiation factors, the differentiation efficiency into motor neurons can be further enhanced compared to when conventional differentiation factors are used alone.

[0055] The novel differentiation factor Gsta4 will be explained in more detail below.

[0056] Previously known features of Gsta4 Gsta4 is glutathione-S- Transferase It is an enzyme belonging to the glutathione S-transferases (GST) family. Eight types of GSTs are known to be produced in the cytoplasm of mammals: alpha, kappa, mu, omega, pi, sigma, theta, and zeta. Of these, alpha is located on chromosome 6, and other GSTAs include GSTA1, GSTA2, GSTA3, GSTA4, and GSTA5.

[0057] Gsta4, also known as GTA4, is known to be involved in cellular defense mechanisms, toxin degradation, and anti-cancer effects. It is also known to play a significant role in reducing cellular stress by decreasing reactive oxygen species. Furthermore, the absence of Gsta4 is known to be negatively associated with diseases such as Parkinson's disease and Alzheimer's disease. However, its function as a direct cross-differentiation factor between cells has not been reported.

[0058] What's new in Gsta4? This application discloses a novel function of Gsta4 that enables direct cross-differentiation. Specifically, it discloses Gsta4 as a novel differentiation factor for direct cross-differentiation.

[0059] In particular, the fact that Gsta4 in this application has the function of converting somatic cells into motor neurons (direct cross-differentiation) has never been reported before and was discovered through experimental confirmation by the inventors. The term Gsta4 used below should be understood as referring to its novel function as a direct cross-differentiation factor. Also, when Gsta4 is written below for convenience, it should be interpreted as referring to the Gsta4 protein or the nucleic acid that codes for it, depending on the context.

[0060] Forms of Gsta4 (1) - Gsta4 protein In one manner, this application discloses a Gsta4 protein for direct cross-differentiation.

[0061] The Gsta4 protein can be wild-type or mutant. The mutant may have one or more deletions, substitutions, or insertions in the wild-type amino acid sequence. The Gsta4 mutant may also have a sequence identity with the wild-type amino acid sequence. In this case, the sequence identity may be 50% to 99%. Preferably, the Gsta4 protein can have 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more of sequence identity with the wild-type amino acid sequence.

[0062] As an optional embodiment, the Gsta4 protein for direct crossover in this application may be the amino acid sequence shown in SEQ ID NO: 1.

[0063] SEQ ID NO: 1: maarpklhyp ngrgrmesvr wvlaaagvef deefletkeq lyklqdgnhl lfqqvpmvei dgmklvqtrs ilhyiadkhn lfgknlkert lidmyvegtl dllellimhp flkpddqqke vvnmaqkaii ryfpvfekil rghgqsflvg nqlsladvil lqtilaleek ipnilsafpf lqeytvklsn iptikrflep gskkkpppde iyvrtvynif rp

[0064] In other embodiments, the Gsta4 protein can have a sequence that has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:1.

[0065] Forms of Gsta4 (2) - Nucleic acid encoding the Gsta4 protein

[0066] As another example, this application discloses a nucleic acid coding for the Gsta4 protein for direct cross-differentiation. The nucleic acid may be DNA or RNA.

[0067] The nucleic acid coding the Gsta4 protein may be wild-type or a mutant. The mutant may have one or more wild-type nucleic acid sequences that have been compounded, substituted, or inserted. The Gsta4 mutant may also have a sequence identity with the nucleic acid sequence coding the wild-type protein. In this case, the sequence identity may be 50% to 99%. Preferably, the nucleic acid coding the Gsta4 protein may have a sequence that has 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the wild-type nucleic acid sequence.

[0068] The nucleic acid sequence coding the Gsta4 protein could be a known sequence.

[0069] The nucleic acid sequence may include intron and exon sequences.

[0070] The nucleic acid sequence may contain only exon sequences.

[0071] For example, the nucleic acid sequence coding the Gsta4 protein may include a CDS (Coding Sequence) sequence from which introns have been removed.

[0072] The nucleic acid sequence may be a DNA sequence coding for the Gsta4 protein and a corresponding mRNA sequence (which is the result of the transcription).

[0073] The nucleic acid sequence may be an mRNA sequence that corresponds to the exon sequence of the Gsta4 gene (the result of transcription).

[0074] In one specific example, the nucleic acid coding the Gsta4 protein may contain SEQ ID NO: 2, which is the full DNA sequence of the Gsta4 gene.

[0075] Accession number 2: gctttgtgcg gctccaggcc tccgagtgga ctccagaaag cctgaaaagc tatcatggca gcaaggccca agctccacta tcccaacgga agaggccgga tggagtccgt gagatgggtt ttagctgccg ccggagtcga gtttgatgaa gaatttctgg aaacaaaaga acagttgtac aagttgcagg atggtaacca cctgctgttc caacaagtgc ccatggttga aattgacggg atgaagttgg tacagacccg aagcattctc cactacatag cagacaagca caatctcttt ggcaagaacc tcaaggagag aaccctgatt gacatgtacg tggaggggac actggatctg ctggaactgc ttatcatgca tcctttctta aaaccagatg atcagcaaaa ggaagtggtt aacatggccc agaaggctat aattagatac tttcctgtgt ttgaaaagat tttaaggggt cacggacaaa gctttcttgt tggtaatcag ctgagccttg cagatgtgat tttactccaa accattttag ctctagaaga gaaaattcct aatatcctgt ctgcatttcc tttcctccag gaatacacag tgaaactaag taatatccct acaattaaga gattccttga acctggcagc aagaagaagc ctccccctga tgaaatttat gtgagaaccg tctacaacat ctttaggcca taaaacaaca catccatgtg tgagtgacag tgtgttccta gagatggtat tgtctacagt catgtcttaa tggatcccag ctctgtcatg gtgctatcta tgtattaagt tgggtcctaa gttgggtctt ttgtgtcaac gagatcatct cttctagaaa tatcaacctt ttttgtccagtaaataattg ttaggggatc tttattggaa aacttttttg gagaggctgg tatttaagtt agatctgatt gggctactca tgtcctgtag ccagttcatc ctcataataa gaatgggcag gatctcttgt tctctcctga gtgtctttct actctcctga gcgtctttct gctctcctta tcctgttctc ttatccttat cccctccagt ctctgcctaa tttttagtgt ttaataacaa ccgaatgtct agtaaatgac tctcctctga gctgtaataa ataaaatggt agtaatgaat gcaatcagta ttagccaaaa taaagaattt atgagtcatt

[0076] In another embodiment, the nucleic acid encoding the Gsta4 protein can have the CDS sequence SEQ ID NO:12.

[0077] SEQ ID NO: 12: Atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggtttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaa gtgcccatggttgaaattgacgggatgaagttggtacagaccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctt tcttaaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctct agaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa

[0078] In another example, the nucleic acid coding the Gsta4 protein may have a sequence with 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the DNA sequence represented by Sequence ID No. 2.

[0079] In another example, the nucleic acid coding the Gsta4 protein may have a CDS sequence represented by SEQ ID NO: 12 and a sequence with 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity.

[0080] Features of Gsta4 (1) The novel direct cross-differentiation factor Gsta4 of the present application can directly convert somatic cells into motor neurons. For example, Gsta4 can convert fibroblasts into motor neurons. For another example, Gsta4 can convert astrocytes into motor neurons.

[0081] Features of Gsta4 (2) A problem with conventional differentiation factors is that they have low or almost no direct cross-differentiation efficiency. In contrast, Gsta4, a novel differentiation factor of the present application, has a higher direct cross-differentiation efficiency than conventional differentiation factors. For example, when used alone, Gsta4 can have a differentiation efficiency approximately 2 to 10 times higher than conventional differentiation factors.

[0082] Features of Gsta4 (3) Gsta4 has a boosting function that enhances the differentiation efficiency of conventional differentiation factors that have low or no differentiation efficiency. The boosting function refers to the ability to significantly increase differentiation efficiency when conventional differentiation factors are used in combination with Gsta4 compared to when conventional differentiation factors are used alone. For example, when Gsta4 is used in combination with conventional differentiation factors, it can increase direct cross-differentiation efficiency by approximately 2 to 10 times compared to when it is not used.

[0083] Features of Gsta4 (4) Gsta4 has the effect of directly inducing somatic cells into motor neurons, so it can be used to treat nervous system diseases caused by motor neuron damage. In addition, Gsta4 can be used together with conventional direct cross-differentiation factors to improve the therapeutic effect of nervous system diseases.

[0084] For example, administering Gsta4 to a subject undergoing treatment for a nervous system disease can result in a decrease in inflammatory cell-mediated scavenging, an increase in action potentials, and increased signal transmission between presynaptic neurons.

[0085] 2. Differentiation factors that can be combined with Gsta4 Overview of differentiation factors that can be combined with Gsta4 In one aspect of this application, the Gsta4 protein or the nucleic acid coding it, which is a novel differentiation factor for direct cross-differentiation as described above, can be used not only alone but also in combination with known differentiation factors (known Direct cell-Conversion factors, known DC factors).

[0086] When Gsta4 is used in combination with conventionally known differentiation factors, not only is the efficiency of direct cross-differentiation improved, but the time required for differentiation during direct cross-differentiation can also be reduced.

[0087] The aforementioned known differentiation factors are not limited to those known to be directly involved in cross-differentiation. Furthermore, variants of conventional differentiation factors may also be included. In this case, the variant may have one or more amino acid sequences or nucleic acid sequences of the wild type deleted, substituted, or inserted.

[0088] For example, the conventional differentiation factor may be one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0089] In one embodiment, the present application discloses a combination of Gsta4 and one or more known differentiation factors.

[0090] Possible combinations of Gsta4 and conventional differentiation factors are described in more detail below.

[0091] Example of combining Gsta4 with conventional differentiation factors (1) The Gsta4 can be used in combination with one conventional differentiation factor selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0092] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2 (referring to the combination of Gsta4 and Brn2); Gsta4+Ascl1; Gsta4+Hb9; Gsta4+Lhx3; Gsta4+Myt1L; Gsta4+Isl1; Gsta4+Ngn2; Gsta4+NeuroD1; etc.

[0093] Example of combining Gsta4 with conventional differentiation factors (2) The Gsta4 can be used in combination with two conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0094] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9 (referring to the combination of Gsta4, Brn2, and HB9); Gsta4+Ascl1+Hb9; Gsta4+Lhx3+Hb9; Gsta4+Ngn2+Hb9; Gsta4+Ngn2+NeuroD1; Gsta4+Lhx3+Ngn2; Gsta4+Lhx3+NeuroD1, etc.

[0095] Example of combining Gsta4 with conventional differentiation factors (3) The Gsta4 can be used in combination with three conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0096] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1 (referring to the combination of Gsta4, Brn2, Hb9, and Ascl1); Gsta4+Brn2+Hb9+NeuroD1; Gsta4+Ascl1+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+Ngn2; Gsta4+Lhx3+Ngn2+NeuroD1; Gsta4+Hb9+Ngn2+NeuroD1; etc.

[0097] Example of combining Gsta4 with conventional differentiation factors (4) The aforementioned Gsta4 can be used in combination with four conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0098] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1, and Isl1); Gsta4+Ascl1+Brn2+Myt1L+Hb9; Gsta4+Brn2+Hb9+NeuroD1+Isl1; Gsta4+Ascl1+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1; and the like.

[0099] Examples of combinations of Gsta4 and conventional differentiation factors (5) The aforementioned Gsta4 can be combined with five conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0100] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1, Isl1, and NeuroD1); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Lhx3+Hb9+NeuroD1+Isl1+Ascl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1+NeuroD1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1+Ascl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1+Ascl1; and the like.

[0101] Example of combining Gsta4 with conventional differentiation factors (6) The aforementioned Gsta4 can be combined with six conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0102] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1+Lhx3 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1, Isl1, NeuroD1 and Lhx3); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3+Myt1L; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; etc.

[0103] Example of combining Gsta4 with conventional differentiation factors (7) The aforementioned Gsta4 can be combined with seven conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0104] In this case, the aforementioned combinations are, for example, Gsta4+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1 (referring to the combination of Gsta4, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1); Gsta4+Ascl1+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+Brn2+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+B You can choose from options such as rn2+Myt1L+Isl1+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2; etc.

[0105] Example of combining Gsta4 with conventional differentiation factors (8) The Gsta4 can be combined with eight conventional differentiation factors: Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0106] Combination ratio of Gsta4 and conventional differentiation factors As mentioned above, Gsta4 and conventional differentiation factors can be used in a variety of combinations.

[0107] In this case, Gsta4 and conventional differentiation factors can be used in the same ratio for direct cross-differentiation.

[0108] For example, when Gsta4 and one conventional differentiation factor are used, they can be used in a ratio of 1:1.

[0109] As another example, when Gsta4 and two conventional differentiation factors are used, they can be used in ratios such as 1:1:1, 2:1:1, 2:1:2, and 1:2:1.

[0110] As another example, when Gsta4 and three conventional differentiation factors are used, they can be used in a ratio of 1:1:1:1.

[0111] Alternatively, Gsta4 and conventional differentiation factors can be used in different ratios for direct cross-differentiation.

[0112] As a specific example, when Gsta4, Hb9 and Lhx3 are used, they can be used in a ratio of 1:1:1, 2:1:1, 2:1:2 or 1:2:1.

[0113] 3. Compositions containing Gsta4 Overview of Gsta4-Containing Compositions The present application discloses a composition essentially comprising Gsta4, a novel differentiation factor as described above.

[0114] As an example, the composition may contain only Gsta4 alone.

[0115] As another example, the composition may contain a combination of Gsta4 and conventional differentiation factors. Examples of these combinations include those described in combination examples (1) to (8) above.

[0116] In this case, each differentiation factor can be contained in the composition as an amino acid sequence constituting each protein.

[0117] Alternatively, each differentiation factor can be included in the composition as a nucleic acid sequence encoding the respective protein.

[0118] As a specific example, the amino acid sequence of the Gsta4 protein can be sequence number 1, and the nucleic acid coding the Gsta4 protein can have sequence number 2 or 12.

[0119] As a specific example, the amino acid sequence of the Ascl1 protein can be sequence number 17, and the nucleic acid coding the Ascl1 protein can have the sequence of sequence number 18.

[0120] As a specific example, the amino acid sequence of the Brn2 protein can be sequence number 19, and the nucleic acid coding the Brn2 protein can have the sequence of sequence number 20.

[0121] As a specific example, the amino acid sequence of the Myt1L protein can be sequence number 21, and the nucleic acid coding the Myt1L protein can have the sequence of sequence number 22.

[0122] As a specific example, the amino acid sequence of the Hb9 protein can be sequence number 13, and the nucleic acid coding the Hb9 protein can have the sequence of sequence number 14.

[0123] As a specific example, the amino acid sequence of the Isl1 protein can be sequence number 23, and the nucleic acid coding the Isl1 protein can have the sequence of sequence number 24.

[0124] As a specific example, the amino acid sequence of the Lhx3 protein can be sequence number 15, and the nucleic acid coding the Lhx3 protein can have the sequence of sequence number 16.

[0125] In one embodiment, the Ngn2 protein can be SEQ ID NO:25, and the nucleic acid encoding the Ngn2 protein can have the sequence of SEQ ID NO:26.

[0126] As a specific example, the amino acid sequence of the NeuroD1 protein can be sequence number 27, and the nucleic acid coding the NeuroD1 protein can have the sequence of sequence number 28.

[0127] The composition will be described in more detail below.

[0128] Composition examples Composition (1): Contains Gsta4 alone The compositions of the present application can include a Gsta4 protein or a nucleic acid encoding the same.

[0129] Furthermore, the composition of the present application can contain the protein variant or the nucleic acid variant.

[0130] Composition (2): Contains Gsta4 + 1 conventional differentiation factor The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) a protein selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid encoding the selected protein; may include:

[0131] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Ascl1 protein or a nucleic acid encoding the same;

[0132] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Brn2 protein or a nucleic acid encoding the same;

[0133] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Myt1L protein or a nucleic acid encoding the same;

[0134] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Hb9 protein or a nucleic acid encoding the same;

[0135] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Isl1 protein or a nucleic acid encoding the same;

[0136] At this time, For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Lhx3 protein or a nucleic acid encoding the same;

[0137] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Ngn2 protein or a nucleic acid encoding the same;

[0138] For example, the composition may comprise: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) NeuroD1 protein or nucleic acid coding therefor; may include

[0139] Composition (3): Contains Gsta4 + 2 conventional differentiation factors

[0140] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Two proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the two selected proteins; may include:

[0141] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Lhx3 protein or nucleic acid coding therefor; may include:

[0142] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Ngn2 protein or nucleic acid coding it; may include:

[0143] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Ngn2 protein or nucleic acid coding it; may include:

[0144] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Isl1 protein or nucleic acid coding for it; may include:

[0145] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Isl1 protein or nucleic acid coding for it; may include:

[0146] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Ngn2 protein or nucleic acid coding it; and iii) Isl1 protein or nucleic acid coding for it; may include:

[0147] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Ascl1 protein or nucleic acid coding for it; may include:

[0148] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Ascl1 protein or nucleic acid coding for it; may include:

[0149] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Ngn2 protein or nucleic acid coding it; and iii) Ascl1 protein or nucleic acid coding for it; may include:

[0150] Composition (4): Contains Gsta4 + 3 conventional differentiation factors

[0151] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) three proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids encoding the three selected proteins; may include:

[0152] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Brn2 protein or a nucleic acid encoding the same; iii) Hb9 protein or a nucleic acid encoding the same; and iv) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0153] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) Ngn2 protein or a nucleic acid encoding it; may include:

[0154] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) Isl1 protein or a nucleic acid encoding it; may include:

[0155] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) Ascl1 protein or a nucleic acid encoding the same; may include:

[0156] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) Brn2 protein or a nucleic acid encoding the same; may include:

[0157] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) Myt1L protein or a nucleic acid encoding same; may include:

[0158] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or a nucleic acid encoding the same; and iv) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0159] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Isl1 protein or a nucleic acid encoding it; may include:

[0160] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Ascl1 protein or a nucleic acid encoding the same; may include:

[0161] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Isl1 protein or a nucleic acid encoding it; may include:

[0162] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Ascl1 protein or a nucleic acid encoding the same; may include:

[0163] Composition (5): Contains Gsta4 + 4 conventional differentiation factors

[0164] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) four proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding the four selected proteins; may include:

[0165] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or a nucleic acid encoding the same; iii) Brn2 protein or a nucleic acid encoding the same; iv) Myt1L protein or a nucleic acid encoding the same; and v) Hb9 protein or a nucleic acid encoding the same; may include:

[0166] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; and v) Isl1 protein or a nucleic acid encoding it; may include:

[0167] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; and v) Ascl1 protein or a nucleic acid encoding the same; may include:

[0168] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; and v) Brn2 protein or nucleic acid coding it; may include:

[0169] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; and v) Myt1L protein or nucleic acid coding it; may include:

[0170] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; and v) NeuroD1 protein or nucleic acid coding for it; may include:

[0171] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; and v) Ascl1 protein or a nucleic acid encoding the same; may include:

[0172] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Ascl1 protein or a nucleic acid encoding it; and v) Brn2 protein or nucleic acid coding it; may include:

[0173] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or nucleic acid coding it; and v) Ascl1 protein or a nucleic acid encoding the same; may include:

[0174] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iii) Lhx3 protein or nucleic acid coding therefor; v) Brn2 protein or nucleic acid coding it; may include:

[0175] Composition (6): Contains Gsta4 + 5 conventional differentiation factors

[0176] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Five proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the five selected proteins; may include:

[0177] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or a nucleic acid encoding the same; iii) Brn2 protein or a nucleic acid encoding the same; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or nucleic acid coding it; and vi) Lhx3 protein or nucleic acid coding it; may include:

[0178] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or nucleic acid coding it; and vi) Ascl1 protein or nucleic acid coding it; may include:

[0179] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; may include:

[0180] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; may include:

[0181] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; may include:

[0182] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; may include:

[0183] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; may include:

[0184] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; may include:

[0185] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; may include:

[0186] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; may include:

[0187] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; may include:

[0188] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; may include:

[0189] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; ii) Hb9 protein or a nucleic acid encoding the same; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; may include:

[0190] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; may include:

[0191] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; may include:

[0192] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; may include:

[0193] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; may include:

[0194] Composition (7): Contains Gsta4 + 6 conventional differentiation factors

[0195] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) six proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids encoding the six selected proteins; may include:

[0196] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or a nucleic acid encoding the same; iii) Brn2 protein or a nucleic acid encoding the same; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Lhx3 protein or a nucleic acid encoding it; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0197] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or a nucleic acid encoding it; and vii) Brn2 protein or a nucleic acid encoding the same; may include:

[0198] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or a nucleic acid encoding it; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0199] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; iv) Ngn2 protein or a nucleic acid encoding it; vi) Ascl1 protein or a nucleic acid encoding it; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0200] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0201] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0202] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Brn2 protein or a nucleic acid encoding the same; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0203] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0204] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0205] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0206] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0207] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) Myt1L protein or a nucleic acid encoding same; may include:

[0208] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or a nucleic acid encoding the same; and vii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0209] Composition (8): Contains Gsta4 + 7 conventional differentiation factors

[0210] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Seven proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the seven selected proteins; may include:

[0211] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Brn2 protein or a nucleic acid encoding the same; iii) Myt1L protein or nucleic acid coding it; iv) Hb9 protein or nucleic acid coding it; v) Isl1 protein or a nucleic acid encoding it; vi) Lhx3 protein or nucleic acid coding it; vii) Ngn2 protein or nucleic acid coding it; and viii) Ascl1 protein or nucleic acid coding it; may include:

[0212] For example, the composition may comprise: i) Gsta4 protein or nucleic acid encoding it ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or nucleic acid coding it; vii) Brn2 protein or a nucleic acid encoding the same; and viii) Myt1L protein or a nucleic acid encoding same; may include:

[0213] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or nucleic acid coding it; vii) Brn2 protein or a nucleic acid encoding the same; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0214] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0215] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0216] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0217] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or a nucleic acid encoding it; v) Isl1 protein or a nucleic acid encoding it; vi) Ascl1 protein or nucleic acid coding it; vii) Brn2 protein or a nucleic acid encoding the same; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0218] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0219] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or a nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0220] For example, the composition may comprise: i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or a nucleic acid encoding it; v) Ascl1 protein or a nucleic acid encoding the same; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or a nucleic acid encoding the same; may include:

[0221] Composition (9): Contains Gsta4 + 8 conventional differentiation factors

[0222] The arguments of this application are i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Proteins of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding for them; may include:

[0223] The composition may include, but is not limited to, a protein, a nucleic acid, or a mixture of protein and nucleic acid. In this case, the nucleic acid may be DNA, RNA, or a mixture of DNA and RNA.

[0224] For example, the composition may contain all of its components in the form of proteins.

[0225] In other examples, the aforementioned composition may contain all factors in the form of nucleic acids.

[0226] In another example, the composition may contain some of the factors in protein form and other factors in nucleic acid form.

[0227] At this time, the nucleic acid form is vector It can be in a certain form. At this time, the above vector one or more vector It can be composed of

[0228] The composition can also include a viral capsid.

[0229] In this case, the differentiation factors can be delivered in the viral capsid.

[0230] As an example, the pharmaceutical composition of the present application can include a viral capsid containing a Gsta4 gene alone.

[0231] In another embodiment, the composition comprises a viral capsid containing Gsta4; and The viral capsid may contain one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0232] For differentiation factor expression vector (Vector for expression of converting factor) As an example, the above composition, differentiation factor expression Vector for In this case, the vector teeth Nucleic acid encoding the Gsta4 protein Alternatively, the above Nucleic acid encoding the Gsta4 protein In addition to the above, it may further comprise nucleic acids encoding conventional differentiation factors.

[0233] The aforementioned vectorhas the function of effectively expressing the desired differentiation factor in the target cells, and may further contain other additional components necessary for this purpose, such as a promoter and an enhancer.

[0234] vector Required configuration for - Nucleic acid encoding the Gsta4 protein The aforementioned vector It contains nucleic acids that code for the Gsta4 protein as an essential component.

[0235] The nucleic acid to be encrypted may be the full-length sequence or a partial sequence of the Gsta4 gene.

[0236] For example, the partial sequence may be an exon sequence of Gsta4, which may be a CDS (Coding Sequence) sequence excluding introns from the Gsta4 gene sequence.

[0237] For example, vector This can include the DNA sequence of SEQ ID NO: 2 or SEQ ID NO: 12.

[0238] vector Selective composition of nucleic acids encoding conventional differentiation factors The aforementioned vector teeth, Nucleic acid encoding the Gsta4 protein In addition, it may selectively further include nucleic acids that encode conventional differentiation factors. The Gsta4 and nucleic acids that encode conventional differentiation factors are one vector Included in or two or more vector It can be included in this.

[0239] In one example, the above vector This can include nucleic acids that encode a differentiation factor selected from among the examples of Gsta4 and conventional differentiation factor combinations (1) to (8).

[0240] for example, vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) One array selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may include this.

[0241] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) Two arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0242] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) It may contain three arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28.

[0243] For example, Current Vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) Four arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0244] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) Five arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0245] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) Six arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0246] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) seven sequences selected from SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0247] For example, expression vector teeth, i) A sequence selected from sequence number 2 and sequence number 12; and ii) the sequences of SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26 and 28;

[0248] vector Additional component (1)

[0249] The aforementioned vector In addition to the essential and optional components of the target protein, the vector may contain additional components necessary for the expression of differentiation factors in cells.

[0250] For example, the additional components may include expression regulatory elements, selection elements, and the like.

[0251] The expression regulatory element may be a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a 2A self-cleaving peptide, or the like.

[0252] For example, the promoter could be the SV40 initial promoter, the LTR (mouse mammary tumor virus long terminal repeat) promoter, the Ad MLP (adenovirus major late) promoter, the HSV (herpes simplex virus) promoter, the CMV (cytomegalovirus) promoter, the RSV (roussarcoma virus) promoter, the U6 promoter, and so on.

[0253] For example, the 2A self-cleaving peptide can be T2A, P2A, E2A, F2A, etc. vector It may contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptide generates multiple proteins from the same transcript. Therefore, vector The 2A self-cleaving peptide can be positioned between two or more different proteins that are intended to be expressed within the vector.

[0254] The selection element can be a fluorescent protein gene, a tag, a reporter gene, an antibiotic resistance gene, or the like.

[0255] For example, the fluorescent protein gene may be a GFP gene, a YFP gene, an RFP gene, or an mCherry gene.

[0256] For example, the tags may include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.

[0257] For example, the reporter gene is glutathione-S- Transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyl Transferase(CAT) beta-galactosidase, beta-glucuronidase, and the like.

[0258] For example, the aforementioned antibiotic resistance genes may include hygromycin-resistant genes, neomycin-resistant genes, kanamycin-resistant genes, blasticidin-resistant genes, and zeocin-resistant genes.

[0259] The present application vector can be used to effectively express the desired differentiation factors, including selective, selective and additive constructs.

[0260] As a specific example, vector but Nucleic acid encoding the Gsta4 protein If it contains vector can consist of the sequence of SEQ ID NO:36.

[0261] In one embodiment, expression vector contains a nucleic acid encoding a Gsta4 protein and a nucleic acid encoding a Myt1l protein, vector can be carried out with the sequence of SEQ ID NO:5.

[0262] In another embodiment, expression vector but Nucleic acid encoding the Gsta4 protein a nucleic acid encoding an MNX1 protein; and a nucleic acid encoding an LHX3 protein; vector can be carried out with the sequence of SEQ ID NO:29.

[0263] vector Additional configuration (2) (knock-in configuration)

[0264] In other embodiments, the expression vector can further comprise an additional component (2) for knocking in differentiation factors into the genome of a subject.

[0265] The aforementioned knock-in refers to the insertion of a differentiation factor into the genome of a target cell. In such cases, the expression of the inserted differentiation factor is sustained within the cell, which can further enhance the differentiation efficiency of the target cell (e.g., somatic cell) into motor neurons.

[0266] In one embodiment, the differentiation factor can be knocked into a safe harbor region in the genome of the target cell.

[0267] The aforementioned safe harbor refers to a gene locus in the target genome where, even if an exogenous differentiation factor is inserted into a specific region, it does not induce side effects, and the expression of the differentiation factor can be sustained.

[0268] For example, the safe harbor may be a locus region encoding AAVS1, ROSA26, etc. in the genomic sequence of the target cell.

[0269] The knock-in of the differentiation factor can be carried out by methods known in the art.

[0270] As a specific example, the method can utilize a transposable element (TE) system, a CRISPR / Cas system, or the like.

[0271] The transposable element system utilizes DNA fragments that can translocate within a dielectric.

[0272] For example, the transposable element system can include a piggyBac transposable element, a Sleeping Beauty transposable element, and the like.

[0273] The CRISPR / Cas system can consist of a Cas protein, guide RNA, and a donor. In this case, the donor may include (i) a differentiation factor to be expressed, and (ii) a sequence homologous to a portion of the safe harbor gene in the target cell genome. In this case, the sequence homologous to the portion of the safe harbor gene in (ii) can function as homology arms at both ends of the donor.

[0274] For example, the Cas protein and guide RNA form a complex, causing a double-strand break (DSB) cleavage within the safe harbor gene sequence in the target cell genome. At this time, a differentiation factor (donor) sequence having homologous cancers at both ends can be inserted into the cleavage site by homologous recombination (HDR). In this case, the two homologous cancers are sequences homologous to a portion of the upstream sequence and a portion of the downstream sequence, centered around the cleavage site.

[0275] vector Types of In one example, vector is a virus vector It can be.

[0276] As an example, the virus vector This includes retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), velcinia viruses, fox viruses, HIV (Human Immunodeficiency Virus), MLV (Murineleukemia Virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), herpes simplex virus, epizomals, or Herpes simplex virusetc. Preferably, it is an adenovirus or an adeno-associated virus (AAV).

[0277] In other examples, vector is nonviral vector It could be.

[0278] As an example, the aforementioned nonviral vector can be a plasmid, a phage, naked DNA, a DNA-lipid complex, a DNA-polymer complex, or mRNA.

[0279] 4. Direct cross-differentiation method Overview of direct cross-differentiation methods In another aspect of the present invention, there is provided a method for direct cross-differentiation of somatic cells into motor neurons using the composition for expression of the differentiation factors.

[0280] Thus, the present application discloses a method for direct cross-differentiation utilizing a composition comprising Gsta4.

[0281] By using the composition, target cells can be directly cross-differentiated, particularly converted into motor neurons, without a retrodifferentiation step. The direct cross-differentiation method can be carried out by a skilled artisan by appropriately selecting a publicly available method, and is not particularly limited as long as it can achieve the intended purpose.

[0282] In one embodiment, the direct cross-differentiation method includes introducing one of compositions (1) to (9) into target cells.

[0283] At this time, the composition is characterized by essentially containing Gsta4,

[0284] The direct cross-differentiation method does not induce the retrodifferentiation of target cells into induced pluripotent stem cells (iPSCs).

[0285] In an optional embodiment, the direct cross differentiation method of the present application includes a nucleic acid encoding a Gsta4 protein. vector into the cells of interest.

[0286] In any embodiment, the direct cross-differentiation method of the present application Gsta4 protein; or a nucleic acid encoding the same; and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid encoding said selected protein; vector into the cells of interest;

[0287] In one embodiment, the direct cross-differentiation method of the present application includes a nucleic acid encoding a Gsta4 protein, a nucleic acid encoding an Lhx3 protein, and a nucleic acid encoding an Hb9 protein. vector into a cell of interest.

[0288] Target cells for direct cross-differentiation (starting cells) The direct cross-differentiation that the present application aims to achieve involves introducing the factors of the present application into "differentiated cells" to directly convert them into the desired cells.

[0289] The differentiated cells used in the direct cross-differentiation method of the present application can be somatic cells, which means all cells except germ cells.

[0290] For example, the somatic cells may be fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericyte , astrocytes, blood cells, rare dendritic precursor cells, etc.

[0291] The somatic cells can be derived from or isolated from mammals such as humans, dogs, cats, horses, sheep, rabbits, pigs, mice, and camels.

[0292] As an example, the direct cross differentiation method of the present application includes: introducing into the somatic cells a composition for expression of a differentiation factor for said direct cross-differentiation.

[0293] In this case, the somatic cells may be somatic cells that have been cultured for a certain period of time before the introduction of the composition.

[0294] The differentiation method can further include a step of culturing the somatic cells into which the composition has been introduced in a culture medium for neural cell differentiation.

[0295] The following describes the culture medium for somatic cell culture, the culture medium for neural cell differentiation, the differentiation period (i.e., the period for culturing somatic cells into which the composition has been introduced), the introduction method, etc., used in the differentiation method.

[0296] Culture medium The culture medium may be a culture medium for somatic cell culture or a culture medium for neural cell differentiation depending on the purpose.

[0297] Culture media for somatic cell culture and neural cell differentiation may be any culture media known in the art. Furthermore, the culture media may be appropriately modified for a specific purpose. For example, to increase the efficiency of direct cross-differentiation, which is the objective of the present application, carbon sources, nitrogen sources, trace elements, growth factors, and the like known in the art may be appropriately adjusted and used.

[0298] For example, the culture medium can be DMEM, MEM, RPMI-1640, Ham's F-10, or Ham's F-12, etc.

[0299] Cell confluence, culture period, and large-scale chicken culture In the culture of somatic cells, the confluence of the cells can be adjusted to facilitate experiments.

[0300] In this case, the confluence of the somatic cells can be appropriately adjusted depending on the state before the introduction of the composition or the state after the introduction of the composition.

[0301] The somatic cells can be cultured until the cell confluence reaches about 60% to 100%, preferably about 80% to 100%.

[0302] The somatic cell culture can be cultured for about 12 to 60 hours to reach a suitable confluence for easy experimentation, but is not limited thereto.

[0303] The somatic cell culture may be subcultured 1 to 3 times to achieve the appropriate confluence, but is not limited thereto.

[0304] Order of introduction of components of composition for expression of differentiation factors In the direct cross-differentiation method, the order in which the compositions selected from Compositions (1) to (9) are introduced into the target cells is not particularly limited. For example, when the composition contains two or more differentiation factors, they may be introduced into the target cells simultaneously or sequentially.

[0305] For example, the direct cross-differentiation method of the present application can be carried out using an expression vector containing a nucleic acid encoding a Gsta4 protein. vector , expression of a nucleic acid encoding the Lhx3 protein vector and a gene encoding the Hb9 protein. Current Vector , can be introduced simultaneously or sequentially.

[0306] Method for introducing a composition for expressing a differentiation factor into target cells

[0307] In the direct cross-differentiation method, a composition for expressing a differentiation factor for direct cross-differentiation can be introduced into target cells by a person skilled in the art using a known technique.

[0308] For example, electroporation, gene gun, sonoporation, Magnetic nanoparticle-based transfection Methods that can be used include, but are not limited to, magnetofection, microinjection, temporary cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, DEAE-dextran-mediated transfection, and the like.

[0309] Characteristics of somatic cells transfected with compositions for the expression of differentiation factors

[0310] Somatic cells into which the composition for expression of differentiation factors provided in the present application has been introduced are in a state in which the expression of differentiation factors and neuronal markers increases over the course of the culture period.

[0311] The neuronal markers can be NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, SMI-32, etc.

[0312] For example, somatic cells into which the composition for expression of the differentiation factors of the present application has been introduced may show increased expression of one or more neuronal markers selected from NEUN, ChAT, Map2, Hb9, and Synapsin on day 3 of the culture period compared to day 1.

[0313] differentiation period

[0314] When differentiation factors are introduced into somatic cells using the direct cross-differentiation method described above, the somatic cells are transformed into motor neurons after an appropriate period of time. The differentiation environment can be maintained by modifying the medium until the somatic cells are transformed into motor neurons. The appropriate period of time can be determined depending on the target cells.

[0315] For example, fibroblasts transfected with compositions for expression of differentiation factors can be transformed into motor neurons within about 7 to 30 days.

[0316] As another example, astrocytes transfected with compositions for expression of differentiation factors can be transformed into motor neurons within about 7 to 30 days.

[0317] Results of the direct cross-differentiation method

[0318] Using the direct cross-differentiation method of the present application, it is possible to obtain motor neurons induced by direct cross-differentiation of somatic cells. Motor neurons are nerve cells that transmit motor stimuli generated in the brain and spinal cord to muscles and glands.

[0319] In particular, the induced motor neurons induced by direct transduction of the cross-differentiation factors of the present application into somatic cells have the expression characteristics of over-expression of the differentiation factors in the cells, and therefore, due to the over-expression environment of such differentiation factors, the induced motor neurons can also have the characteristics of over-expression of neuronal markers.

[0320] The direct cross-differentiation factors may be, but are not limited to, Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), etc.

[0321] For example, Gsta4 is overexpressed in motor neurons obtained by the above-mentioned direct cross-differentiation.

[0322] For example, the motor neurons obtained by the direct cross-differentiation overexpress Gsta4 and one or more direct cross-differentiation factors selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Neuren(2), and NeuroD1 (Neuronal Differentiation 1).

[0323] Moreover, overexpression of such differentiation factors leads to increased expression of neuronal marker proteins in motor neurons, including, but not limited to, NEUN, ChAT, Map2, Synapsin, HB9, Tuj1, IsL1, Notch1, HES1, HES3, E-cadherin, occludin, PAX6, N-cadherin, and SOX2.

[0324] For example, the motor neurons obtained by the direct cross-differentiation may overexpress one or more neuronal markers among ChAT, Map2, Hb9, and Synapsin.

[0325] For another example, motor neurons obtained by the above-described direct cross-differentiation may be induced to overexpress one or more of Tuj1, IsL1, and NEUN.

[0326] Confirmation of direct cross differentiation results The direct cross-differentiation method of the present application may additionally include a step of selectively confirming conversion to motor neurons.

[0327] The confirmation process can be performed using neuronal markers known in the art, and can be performed through various molecular biology techniques known in the art, such as, but not limited to, immunofluorescence staining, Western blot, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), etc.

[0328] Characteristics of the direct cross-differentiation method of the present application (1) The direct cross-differentiation method disclosed in the present application is characterized in that it does not generate induced pluripotent stem cells (iPSCs), i.e., it directly induces the conversion of somatic cells into the desired motor neurons without going through the induced pluripotent stem cell stage that is the process of reverse differentiation of somatic cells.

[0329] For example, when somatic cells such as fibroblasts or astrocytes are treated with Gsta4 alone or with Gsta4 together with conventional differentiation factors, the fibroblasts or astrocytes can be directly differentiated into motor neurons.

[0330] Characteristics of the direct cross-differentiation method of the present application (2) Furthermore, as described above, the method of the present application does not go through the induced pluripotent stem cell stage, which has the advantage of reducing the possibility of teratoma formation in the target cells. In other words, this method significantly reduces the probability of teratoma formation, which is a problem with conventional stem cell use. These advantages suggest that the method of the present application may be more useful for treating nervous system diseases.

[0331] Characteristics of the direct cross-differentiation method of the present application (3) The direct cross-differentiation method disclosed in this application significantly contributes to improving differentiation efficiency, a problem that has been hindered by conventional differentiation factors. In particular, treating fibroblasts or astrocytes with both Gsta4 and conventional differentiation factors significantly improves the efficiency of direct differentiation into motor neurons compared to treating fibroblasts or astrocytes with conventional differentiation factors alone.

[0332] 5. Pharmaceutical composition for direct cross-differentiation containing Gsta4 Overview of pharmaceutical compositions containing Gsta4 for direct cross-differentiation In addition, the present application discloses a pharmaceutical composition selected from the above compositions (1) to (9) for the treatment of neurological disorders. The components that the pharmaceutical composition may contain and specific indications for therapeutic use are disclosed below.

[0333] Active ingredients of pharmaceutical compositions The active ingredient of the pharmaceutical composition of the present application can be any one or more of the following:

[0334] (1) Differentiation Factor of the Present Application (2) Somatic cells containing the differentiation factor of the present application (3) Motor neurons induced using the differentiation factors of the present application

[0335] In this case, the differentiation factor may be Gsta4 alone or a combination of Gsta4 and a conventional differentiation factor, wherein the conventional differentiation factor is one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0336] The differentiation factor (1) may be in the form of a protein or a nucleic acid.

[0337] For example, the pharmaceutical composition for preventing or treating nervous system diseases of the present application may contain Gsta4 protein or a nucleic acid encoding the same.

[0338] As another example, the pharmaceutical composition for preventing or treating nervous system diseases of the present application may include Gsta4 protein or a nucleic acid encoding the same; Hb9 protein or a nucleic acid encoding the same; and Lhx3 protein or a nucleic acid encoding the same.

[0339] As another example, the pharmaceutical composition for preventing or treating nervous system diseases of the present application may include Gsta4 protein or a nucleic acid encoding the same; Hb9 protein or a nucleic acid encoding the same; Lhx3 protein or a nucleic acid encoding the same; and Ngn2 protein or a nucleic acid encoding the same.

[0340] In this case, the differentiation factor (1) can be delivered contained in a viral capsid. For example, the pharmaceutical composition of the present application can contain a viral capsid containing a Gsta4 gene alone. For another example, the composition can contain a viral capsid containing Gsta4, a viral capsid containing Hb9, and a viral capsid containing Lhx3. When the pharmaceutical composition of the present application contains a viral capsid containing the differentiation factor, it can be used as a type of gene therapy agent.

[0341] The (2) somatic cells containing a differentiation factor include i) a nucleic acid encoding the differentiation factor. vectoror ii) somatic cells into which a differentiation factor protein has been introduced. When the somatic cells containing the differentiation factor of the present application are used as an active ingredient, they can be used as a type of cell therapy agent. A cell therapy agent refers to a therapeutic agent that uses autologous, allogenic, or xenogenic "cells" as an active ingredient to restore tissue function.

[0342] As an example, the pharmaceutical composition for preventing or treating a nervous system disease of the present application includes a nucleic acid encoding a Gsta4 protein. vector The pharmaceutical composition for preventing or treating a nervous system disease of the present application may comprise a somatic cell into which a Gsta4 protein has been introduced.

[0343] In another example, the pharmaceutical composition for preventing or treating a nervous system disease of the present application comprises a nucleic acid encoding a Gsta4 protein; a nucleic acid encoding an Hb9 protein; and a nucleic acid encoding an Lhx3 protein. vector The pharmaceutical composition for preventing or treating a nervous system disease of the present application may comprise a somatic cell into which a Gsta4 protein, an Hb9 protein, and an Lhx3 protein have been introduced.

[0344] In addition, the motor neurons induced using the differentiation factors in (3) above are motor neurons generated by direct cross-differentiation of somatic cells using the above-mentioned [4. Direct Cross-Differentiation Method]. When the induced motor neurons of the present application are contained as an active ingredient, they can be used as another type of cell therapy agent.

[0345] Pharmaceutically acceptable extra components

[0346] The pharmaceutical composition may further contain pharmaceutically acceptable additional components in addition to the active ingredient, such as, but not limited to, carriers, excipients, diluents, preservatives, etc.

[0347] For example, the carrier, excipient, and diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, distilled water, saline, glycerol, ethanol, HSA (humanserumalbumin), and the like.

[0348] For example, the preservative is benzoic acid, sodium benzoate, sorbic acid, parahydroxybenzoic acid, chlorobutanol, or the like.

[0349] When the pharmaceutical composition is formulated, it may further include a filler, an extender, a binder, a wetting agent, and the like.

[0350] Formulation of Pharmaceutical Compositions The pharmaceutical composition can be formulated for oral or parenteral use.

[0351] For example, when formulated for oral administration, it can be prepared in the form of a solid, liquid, capsule, semi-solid, or the like.

[0352] As another example, when formulated for parenteral use, it may be produced as an injection, aerosol, etc. Preferably, it can be formulated as an injection.

[0353] Target diseases of pharmaceutical compositions

[0354] The pharmaceutical composition can be applied to nervous system diseases. In particular, the pharmaceutical composition can be used for treating or preventing nervous system diseases. The nervous system diseases of the present application can be caused by nerve cell damage or diseases induced thereby.

[0355] For example, the nervous system disease may be, but is not limited to, spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal developmental disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, traumatic brain injury, motor neuron injury or diseases induced thereby, etc. Preferably, the nervous system disease is selected from spinal cord injury, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, peripheral paralysis, central paralysis, quadriplegia, and diplegia.

[0356] 6. Treatment of nervous system diseases Overview of treatment methods for nervous system diseases A method for treating nervous system diseases using the above-mentioned [5. Pharmaceutical composition for direct cross-differentiation containing Gsta4] is disclosed.

[0357] As described above, the pharmaceutical composition comprises: Gsta4 or Gsta4 and one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; Includes.

[0358] The method for treating nervous system disorders of the present application can be carried out by (i) administering the composition directly to a subject (patient), (ii) administering somatic cells transfected with the composition to a subject, or (iii) generating ex vivo induced motor neurons and then administering the generated motor neurons to a subject. In this case, the method (i) can have the effect of generating in vivo induced motor neurons within the subject's body.

[0359] Treatment method (1) The method for treating a nervous system disease can utilize a method in which the "pharmaceutical composition" of the present application is administered to a subject in need of treatment or prevention of a nervous system disease, thereby generating induced motor neurons in vivo.

[0360] As an example, the method of treating a nervous system disorder of the present application comprises: The method can include administering to a subject a composition containing a Gsta4 protein or a nucleic acid encoding the same;

[0361] As another example, the method of treating a nervous system disorder of the present application may include: i) Gsta4 protein; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; administering to a subject a composition comprising:

[0362] Treatment method (2) A method for treating a nervous system disease comprises administering to a subject "somatic cells" transfected with a pharmaceutical composition of the present application.

[0363] As an example, the method of treating a nervous system disorder of the present application comprises: administering to a subject somatic cells transfected with a composition containing a Gsta4 protein or a nucleic acid encoding the same; may include:

[0364] As another example, the method of treating a nervous system disorder of the present application may include: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid encoding said protein; administering to a subject the transfected somatic cells in a composition comprising the compound; may include:

[0365] As described above, when somatic cells transfected with the composition of the present application are administered to a subject, the differentiation factors introduced into the somatic cells directly cross-differentiate the somatic cells into motor neurons within the subject's body, thereby allowing the proliferation of motor neurons within the subject, thereby treating or preventing nervous system disorders.

[0366] Treatment method (3) A method for treating nervous system diseases can be used by introducing the composition of the present application into isolated somatic cells to directly obtain cross-differentiated motor neurons ex vivo, and then administering the "motor neurons" to a subject in need of treatment or prevention of a nervous system disease. In other words, the induced motor neurons of the present application can be administered to a subject as a direct active ingredient of a therapeutic agent.

[0367] As an example, the method of treating a nervous system disorder of the present application comprises: administering to a subject motor neurons induced by introducing a composition containing a Gsta4 protein or a nucleic acid encoding the same into somatic cells; may include:

[0368] As another example, the method of treating a nervous system disorder of the present application may include: In somatic cells i) a Gsta4 protein or a nucleic acid encoding the same; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid encoding said protein; administering to a subject a composition comprising: may include:

[0369] Target for administration The subject of the method for treating nervous system diseases may be, but is not limited to, a subject whose motor neuron function is reduced compared to a healthy subject or a subject whose disease is caused by a decrease in motor neurons.

[0370] The subjects requiring treatment or prevention of neurological disorders may be mammals. For example, such mammals may include humans, dogs, horses, cats, mice, rabbits, sheep, and monkeys.

[0371] The administration method, dosage, concentration of the pharmaceutical composition, and administration cycle described below may be determined considering the age, weight, general health status, diet, severity of neurological disorders, whether other medications are being taken, and the duration of treatment.

[0372] Administration method The aforementioned treatment methods for neurological disorders can be administered via various routes depending on the patient's condition.

[0373] Administration can be by oral or parenteral administration. In this case, parenteral administration may be by injection.

[0374] The injection site may be, but is not limited to, muscle, intradermal, subcutaneous, vein, abdominal cavity, artery, mucous membrane, spinal cord, bone marrow, intraspinal cavity, or percutaneous.

[0375] For example, if the administration site is the spinal cord, it may be L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 (cervical 4), C5 (cervical 5), etc.

[0376] Another example is that it can be administered directly to the site where the neurological disorder has occurred. An arbitrary specific example would be direct administration to the brain affected by Parkinson's disease.

[0377] Concentration of pharmaceutical composition

[0378] The concentration of the pharmaceutical composition may be as follows based on the total composition: vector Forms including, vector a form containing purified virus from vector The form of the cell containing the protein, the form of the protein, the form of the cell containing the protein, etc., but is not limited thereto.

[0379] As an example, a virus comprising the pharmaceutical composition of the present application vector When purified with a virus, it can be contained at the following concentrations based on the total composition.

[0380] For example, 1 x 10 based on the entire pharmaceutical composition 5 vg (viral genome) / mL or 1x10 20 May contain virus at concentrations of vg (viral genome) / mL.

[0381] For example, 1 x 10 based on the entire pharmaceutical composition 5 GC (genome copies) / mL or 1x10 20 The virus may be contained in a concentration of vg (genome copies) / mL.

[0382] In another example, 1 x 10 based on the entire pharmaceutical composition 5 VP (viral particle) / mL or 1x10 20 May contain virus at a concentration of VP (viral particle) / mL.

[0383] Dosage

[0384] The dosage of the pharmaceutical composition can be determined appropriately in consideration of the administration method, the subject, etc.

[0385] For example, the dosage can be 1 μL to 20 mL per administration, but it is not limited to this.

[0386] For example, when administered via spinal injection, it can be given in doses of 1 uL / kg to 20 uL / kg. When administered intravenously, it can be given in doses of 0.5 mL / kg to 10 mL / kg.

[0387] Administration cycle

[0388] The administration cycle of the aforementioned pharmaceutical composition may vary depending on the target disease, its severity, and other factors.

[0389] The dosage may be once or several times a day, or may be administered several times over a long period of time, with the dosages being spaced apart at regular intervals.

[0390] The aforementioned administration interval may be 1 day to 60 days, etc. During this time, the administration can be continuous or non-continuous.

[0391] Confirmation of treatment effectiveness

[0392] After administering the above-described method for treating nervous system diseases to a subject, the effect of alleviating, improving, or treating the nervous system disease can be confirmed by various methods.

[0393] For example, this can be confirmed through measures such as a decrease in scar cells, changes in neuronal marker expression, BBB score, action potentials, and spontaneous responses.

[0394] For example, by using the aforementioned treatment methods for neurological disorders, the incidence of scalculia can be reduced by approximately 2 to 50 times.

[0395] As another example, using the aforementioned treatment methods for neurological diseases may increase the expression of neuronal cell markers by approximately 2 to 50 times.

[0396] As another example, the use of the above-described methods for treating nervous system disorders may result in an increase in BBB score of approximately 2- to 50-fold.

[0397] As another example, when the above-mentioned methods for treating nervous system disorders are used, action potentials or spontaneous responses may appear similar to those of normal individuals.

[0398] 7. Applications of Induced Motor Neurons Overview of uses of induced motor neurons

[0399] This application discloses diverse applications of motor neurons obtained by the direct cross-differentiation method described above. The following describes applications of these motor neurons, including drug screening and biomaterial applications.

[0400] Uses of Motor Neurons (1) - Drug Screening As an example, the application of this patent application for drug screening using induced motor neurons is disclosed. In particular, it can be used for the prevention of neurological diseases and the screening of therapeutic drugs.

[0401] Methods such as confirming the responsiveness of the motor neurons before and after administration of the candidate drug to the induced motor neurons can be usefully used for screening drugs for the prevention and / or treatment of neurological diseases.

[0402] Applications of Motor Neurons (2) - Artificial Organs

[0403] Another example disclosed in this application is an artificial organ containing induced motor neurons. Organoids, which are artificial organs created by inducing stem cells into specific organs and then replicating them in vitro, are also a type of artificial organ. Because this application does not involve the induced pluripotent stem cell stage, it can be used for artificial organs with fewer side effects compared to organoids that utilize stem cells.

[0404] The motor neurons of this application can be applied to 3D bioprinting, which involves building up bioinks containing living cells layer by layer, similar to 3D printing, to create artificial organs such as nerves, corneas, livers, skin, and blood vessels. Therefore, the induced motor neurons of this application can be 3D bioprinted to create artificial organs for treating nervous system diseases and injuries.

[0405] [Possible embodiments of the invention]

[0406] Example 1: Gsta4 alone 1. A composition for direct cross-differentiation of somatic cells into motor neurons, said composition comprising: Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding it; wherein the motor neurons are motor neurons induced (differentiated) from the somatic cells.

[0407] (A composition characterized by direct cross-differentiation of somatic cells into induced motor neurons.)

[0408] Example 2: Gsta4 + 1 conventional factor In embodiment 1, The composition comprises: a protein selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0409] Example 3: Gsta4 + 2 conventional factors In embodiment 1, The composition comprises: two proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0410] Example 4: Gsta4 + 3 conventional factors In embodiment 1, The composition comprises: three proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0411] Example 5: Gsta4 + 4 conventional factors In embodiment 1, The composition comprises: four proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0412] Example 6: Gsta4 + 5 conventional factors In embodiment 1, The composition comprises: five proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0413] Example 7: Gsta4 + 6 conventional factors In embodiment 1, The composition comprises: six proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0414] Example 8: Gsta4 + 7 conventional factors In embodiment 1, The composition comprises: Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0415] Example 9: Gsta4 + 8 conventional factors In embodiment 1, The composition comprises: Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids encoding the proteins; The composition may further comprise:

[0416] Embodiment 10: Combination of Compositions In embodiment 2, The composition comprises: Gsta4 protein or a nucleic acid encoding same; and Brn2 protein or a nucleic acid encoding the same; or Ascl1 protein or a nucleic acid encoding the same; A composition comprising:

[0417] Embodiment 11: Combination of Compositions In embodiment 3, The composition comprises: Gsta4 protein or a nucleic acid encoding the same; Hb9 protein or a nucleic acid encoding the same; and Lhx3 protein or a nucleic acid encoding the same; A composition comprising:

[0418] Embodiment 12: Combination of Compositions In embodiment 4, The composition comprises: Gsta4 protein or a nucleic acid encoding the same; Brn2 protein or a nucleic acid encoding the same; Hb9 protein or a nucleic acid encoding the same; and NeuroD1 protein or nucleic acid encoding it A composition comprising:

[0419] Example 13: Combination of compositions In Example 5, The composition comprises: Gsta4 protein or a nucleic acid encoding the same; Brn2 protein or a nucleic acid encoding the same; Hb9 protein or nucleic acid coding for it; Ascl1 protein or nucleic acid coding it; and Myt1L protein or the nucleic acid that codes for it; A composition comprising:

[0420] Example 14: Combination of compositions In Example 6, The composition comprises: Gsta4 protein or a nucleic acid encoding the same; Brn2 protein or a nucleic acid encoding the same; Ascl1 protein or the nucleic acid coding for it; Ngn2 protein or nucleic acid coding for it; Isl1 protein or nucleic acid coding it; and Lhx3 protein or a nucleic acid encoding the same; A composition comprising:

[0421] Example 15: Combination of compositions There is a concrete example 7, The composition comprises: Gsta4 protein or a nucleic acid encoding the same; Brn2 protein or a nucleic acid encoding the same; Ascl1 protein or the nucleic acid coding for it; Ngn2 protein or nucleic acid coding for it; Isl1 protein or nucleic acid coding it; and Lhx3 protein or a nucleic acid encoding the same; Myt1L protein or the nucleic acid that codes for it; A composition comprising:

[0422] Embodiment 16: Gsta4 sequence In embodiment 1, The composition, wherein the Gsta4 protein has an amino acid sequence represented by SEQ ID NO: 1 or a sequence having 70% or more identity thereto.

[0423] Embodiment 17: Hb9 sequence In embodiment 2, The composition, wherein the Hb9 protein has an amino acid sequence represented by SEQ ID NO: 14 or a sequence having 70% or more identity thereto.

[0424] Example 18: Lhx3 arrangement In embodiment 2, The composition, wherein the Lhx3 protein has an amino acid sequence represented by SEQ ID NO: 15 or a sequence having 70% or more identity thereto.

[0425] Example 19: Array Restriction In embodiment 11, The Gsta4 protein has an amino acid sequence represented by SEQ ID NO: 1 or a sequence having 70% or more identity thereto; the Hb9 protein is an amino acid sequence represented by SEQ ID NO: 14 or a sequence having 70% or more identity thereto; The composition, wherein the Lhx3 protein has an amino acid sequence represented by SEQ ID NO: 15 or a sequence having 70% or more identity thereto.

[0426] Example 20: vector 1 For direct cross-differentiation of somatic cells into motor neurons vector As the above vector teeth, i) embodiment 1 or 16; and ii) promoters; Including, i) is operably connected to ii); The motor neurons are characterized in that they are motor neurons induced (differentiated) from the somatic cells. vector .

[0427] Example 21: vector 1 additional configuration In Example 20, The aforementioned vector is one selected from embodiment 2 to 9; may further comprise vector .

[0428] Example 22: vector 2 For direct cross-differentiation of somatic cells into motor neurons vector As the above vector teeth, i) Embodiment 3 or Embodiment 11; and ii) promoters; Including, i) is operably connected to ii); The motor neurons are characterized in that they are motor neurons induced (differentiated) from the somatic cells. vector .

[0429] Example 23: vector 3 For direct cross-differentiation of somatic cells into motor neurons vector As the above vector is two or more vector and At this time, two or more vector At least the first vector and second vector Including, The first vector teeth, i) embodiment 1 or 16; and ii) promoters; Including, i) is operably linked to ii), The second vector teeth, iii) The above vector is one or more selected from embodiment 2 to 9; and iv) promoters; Including, iii) is operably connected to iv); At this time, the iii) vector At least one selected from embodiment 2 to 9 is an individual vector can be included in The motor neurons are characterized in that they are motor neurons induced (differentiated) from the somatic cells. vector .

[0430] Example 24: vector Additional configuration In any one of Embodiments 21 to 23, The aforementioned vector Optionally, the above ii) promoter other than the promoter, enhancer, polyadenylation signal, Kozak consensus sequence, ITR (inverted terminal repeat), LTR (long terminal repeat), terminator, internal ribosome entry site (IRES), fluorescent protein gene, glutathione-S- Transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyl Transferase (CAT) beta-galactosidase, Beta-glucuronidase , luciferase, histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, 2A self-cleaving peptides, and antibiotic resistance gene. vector .

[0431] Example 25: vector Additional configuration limited In Example 24, The 2A self-cleaving peptide is one or more selected from T2A, P2A, E2A, and F2A. vector .

[0432] Example 26: vector Additional configuration limited In any one of Embodiments 21 to 23, The aforementioned vector The vector may further include one or more selected from the group consisting of a donor, a piggyBac transposable element, and a Sleeping Beauty transposable element. vector .

[0433] Example 27: vector Limited types In any one of Embodiments 21 to 23, The aforementioned vector is a virus vector Retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAV), venom viruses, foxviruses, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), Herpes simplex virus, episomal, and Herpes simplex virus It is characterized by being one or more of the above. vector .

[0434] Example 28: Differentiation Method (1) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons; The above method is a) introducing embodiment 1 or embodiment 16 or embodiment 20 into a somatic cell; A method comprising:

[0435] Example 29: Differentiation Method (1) In Example 28, In the aforementioned somatic cells b) introducing any one selected from embodiments 2 to 9, 21; The method can further include:

[0436] Example 30: Differentiation Method (1) In Implemented Example 28 or Implemented Example 29, The above introduction; after Somatic cells are cultured using a medium for neural differentiation; The method can further include:

[0437] Example 31: Differentiation Method (2) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons, The above method is a) mixing embodiment 1, embodiment 16, or embodiment 20 into a culture medium; b) culturing somatic cells using the mixture; A method comprising:

[0438] Example 32: Differentiation Method (3) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons; The above method is introducing embodiment 11 or embodiment 19 or embodiment 22 into a somatic cell; or introducing embodiments 16, 17 and 18 into somatic cells; A method comprising:

[0439] Example 33: Introduction method In any one of embodiments 28 to 32, The introduction can be by electroporation, gene gun, sonoporation, Magnetic nanoparticle-based transfection The method is characterized by being carried out by one or more selected from the group consisting of magnetofection, microinjection, temporary cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection.

[0440] Embodiment 34: Somatic cell types In any one of embodiments 28 to 32, The somatic cells include fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericyte , astrocytes, blood cells, and rare pontine progenitors.

[0441] Example 35: Differentiation Period In any one of embodiments 28 to 32, A method characterized in that the introduction causes the somatic cells to differentiate into motor neurons within 1 to 10 weeks.

[0442] Example 36: Differentiation Method Characteristics In any one of embodiments 28 to 32, The method is characterized in that the introduction causes the somatic cells to become induced motor neurons without generating induced pluripotent stem cells (iPSCs).

[0443] Example 37: Differentiation Method Results - Motor Neuron (Differentiation Factor Overexpression) In motor neurons overexpressing direct cross-differentiation factors, In this case, the direct cross-differentiation factor is one or more selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); The motor neuron is characterized in that it is directly cross-differentiated from a somatic cell.

[0444] Example 38: Differentiation Method Mastery - Motor Neuron (Neuron Marker Overexpression)

[0445] In motor neurons where neuronal markers are overexpressed, At this time, the neuronal marker is one or more selected from NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, and SMI-32; The motor neuron is characterized in that it is directly cross-differentiated from a somatic cell.

[0446] Example 39: Pharmaceutical composition (1) Includes 1, 16, or 20 of the Implemented Examples. A pharmaceutical composition for the prevention or treatment of nervous system diseases.

[0447] Example 40: Pharmaceutical Composition (2) Embodiment 1 or 16 or 20; and One example selected from examples 2 through 9 and 21; A pharmaceutical composition for the prevention or treatment of neurological disorders, including [the specified substance].

[0448] Example 41: Pharmaceutical Composition (3) Including embodiment 37 or 38 A pharmaceutical composition for the prevention or treatment of nervous system diseases.

[0449] Example 42: Indications In any of the embodiment examples selected from embodiment examples 39 to 41, The aforementioned neurological disorder is one or more selected from spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, traumatic peripheral nerve injury, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal developmental disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic neurological disorders, and traumatic brain injury, motor nerve injury, or diseases induced thereby.

[0450] Example 42: Additional configuration In any of the embodiment examples selected from embodiment examples 39 to 41, The pharmaceutical composition may further comprise one or more selected from the group consisting of an acceptable carrier, an excipient, a diluent, and a preservative.

[0451] Example 43: Treatment Method (1) In the treatment of neurological disorders, the aforementioned method is Administer to somatic cells as shown in Example 39 or 40; Including, In this method, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0452] Example 44: Treatment Method (2) In the treatment of neurological disorders, the aforementioned method is administering to a subject somatic cells transfected with the vector of embodiment 39 or 40; In this method, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0453] Example 45: Treatment Method (3) In the treatment of neurological disorders, the aforementioned method is Administering embodiment 41 to a subject; Including,

[0454] In this method, the subject's somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0455] Example 46: Limited Target (1) In any embodiment selected from embodiment 43, embodiment 44, and embodiment 45, The method, wherein the subject is a mammal.

[0456] Example 47: Limited Target (2) In embodiment 46, The method is characterized in that the mammal is one selected from the group consisting of a human, a mouse, a dog, and a cat.

[0457] Example 48: Administration Limited In any embodiment selected from embodiment 43, embodiment 44, and embodiment 45, The method is characterized in that the site of administration is one or more selected from the group consisting of muscle, intradermal, subcutaneous, venous, abdominal cavity, artery, mucosa, spinal cord, bone marrow, intraspinal cavity, and transdermal.

[0458] Example 49: Dosage

[0459] In any embodiment selected from embodiment 43, embodiment 44, and embodiment 45, The method is characterized in that the administration is performed at a dose of 1 uL / kg to 20 uL / kg per administration.

[0460] Example 50: Indications

[0461] In any embodiment selected from embodiment 43, embodiment 44, and embodiment 45,

[0462] The nervous system disease is one or more selected from the group consisting of spinal cord injury, Parkinson's disease, stroke, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, traumatic brain injury, motor neuron injury, and diseases induced thereby.

[0463] The present application will now be described in more detail through examples.

[0464] These examples are provided solely for the purpose of more specifically illustrating the present application, and it will be obvious to those skilled in the art to which the present application pertains that the scope of the present application is not limited by these examples.

[0465] Experimental materials ● vector design

[0466] Do the following: vector AAV vector(Cell Biolabs, INC., VPK-402) is used for AAV for differentiation factor introduction. vector A schematic diagram is shown in Figure 1.

[0467] Figure 1(a) corresponds to sequence number 36; Figure 1(b) corresponds to sequence number 3; Figure 1(c) corresponds to sequence number 4; Figure 1(d) corresponds to sequence number 5; Figure 1(e) corresponds to sequence number 29.

[0468] ● AAV production

[0469] 293T cells were used to produce AAV. 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Thermal Fisher, #12430112) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimycotic (Thermal Fisher, #15240096) at 37°C in 5% CO2. 293T cells were also transfected with AAV1. vector The cells were transfected with pHelper and pRapCap and cultured for 48 hours. After that, a virus extraction process was performed to extract the virus containing the differentiation factor.

[0470] ● Cell culture and intracellular AAV introduction

[0471] Human dermal fibroblasts (Sigma, 106-05A) were cultured in a badge of fibroblast growth medium (Sigma, 116-500) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimycotic (Thermal Fisher, #15240096) at 37°C in 5% CO2.

[0472] Humandermal fibroblasts are placed in 24 wells in a 0.025 x 10⁻¹⁵ 6Cells were prepared by seeding. 24 hours after cell seeding, differentiation factors were applied. 24 hours after differentiation factor application, the medium was replaced with fibroblast growth medium. 24 hours later, the medium was replaced with neural induction medium. The medium was replaced every two days. On days 14-17, the cells were subjected to fixation and immunofluorescence staining.

[0473] Mouse astrocytes (Abm, T0289) were cultured in Prigrow III medium (Abm, TM003) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% penicillin / streptomycin (Gibco) at 37°C in 5% CO2.

[0474] Mouse astrocytes are placed in 24 wells in a 0.025x10⁻¹⁴ arrangement. 6 Cells were prepared by seeding. 24 hours after cell seeding, differentiation factors were treated. 24 hours after differentiation factor treatment, the medium was replaced with Prigrow III medium. 24 hours later, it was replaced with neural induction medium. The medium was replaced every two days. On days 14-17, the cells were subjected to fixation and immunofluorescence staining.

[0475] Mouse embryonic fibroblasts were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% penicillin / streptomycin (Gibco) at 37°C under 5% CO2.

[0476] Mouse embryonic fibroblasts are placed in 24 wells at a rate of 0.025 x 10 6OCells were prepared by seeding. 24 hours after cell seeding, differentiation factors were treated. 24 hours after differentiation factor treatment, the medium was replaced with DMEM. 24 hours later, the medium was replaced with neural induction medium. The medium was replaced every two days. On days 14-17, the cells were subjected to fixation and immunofluorescence staining.

[0477] When introducing AAV into the SCI model, the injury site (Lumbar 5) of the mouse spinal cord injury model was finely scanned using a stereotaxic device (Stereotaxic, Harvard Apparatus) and then analyzed for 60 days.

[0478] ● Immunofluorescence staining

[0479] For cell fixation, the cells were washed twice with PBS (Gibco) for 5 minutes each time, then added with 4% paraformaldehyde (ThermoFisher) and incubated at room temperature for 10 minutes.

[0480] For permeabilization, PBS + 0.1% Triton-X was added and incubated at room temperature for 10 minutes. The cells were then washed three times with PBS for 5 minutes each.

[0481] For blocking and immunostaining, 1% BSA + PBST (PBS + 0.1% Tween20) was added and incubated at room temperature for 30 minutes. Primary antibodies used were ChAT (Invitrogen, 1:1000), Map2 (Millipore, 1:200), and NeuN (Merck Millipore, 1:100). The primary antibodies were placed in 1% BSA + PBST and incubated overnight at 4°C. After washing three times with PBS for 5 minutes each, the secondary antibodies Alexa Fluor™ 488 / 594 (Thermo Fisher, 1:1000) were placed in 1% BSA + PBST and incubated in a dark place at room temperature for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0482] ● RNA extraction and cDNA synthesis

[0483] cells 2x10 6 After removing the supernatant with trypsin (ThemoFisher), centrifugation was performed at 13,000 rpm for 10 seconds. After removing the supernatant, 1 ml of easy-Blue™ (iNtRON) was added, the port was extinguished for 10 seconds, then 200 μl of Choloroform was added, and the port was extinguished again. After centrifugation at 13,000 rpm for 10 minutes, 400 μl of upper fluid was transferred to a new 1.5 ml tube. 400 μl of 2-propanol (Sigma) was added, inverted 2-3 times, and then left in RT for 10 minutes. After centrifugation at 13,000 rpm for 5 minutes, the upper layer was removed. 1 ml of 75% EtOH (Sigma) was added, and inverted 2-3 times. After centrifugation at 10,000 rpm at 4°C for 5 minutes, the upper layer was removed. After drying at RT for 5 minutes, 20 μl of distilled water was added to dissolve the RNA. The final RNA was stored at -70°C.

[0484] cDNA synthesis was performed using AccuPower® CycleScrip® RT PreMix & Master Mix (Bioneer).

[0485] ● Real-time quantitative reverse transcription PCR (qRT-PCR)

[0486] qPCR (SYBRGreen Realtime PCR Master Mix, TOYOBO) was used. qRT-PCR confirmed the expression of Synapsin, Map2, and Hb9 in cells induced to differentiate from human fibroblasts into motor neurons. qRT-PCR confirmed the expression of Synapsin, Map2, and Hb9 in cells induced to differentiate from mouse fibroblasts into motor neurons.

[0487] The primers used are as shown in the table below.

[0488] [Table 1] JPEG0007828619000001.jpg116160

[0489] Example 1: Confirmation of direct cross-differentiation of Gsta4 into motor neurons within cells. GSTA4 was introduced into mouse-derived fibroblasts using AAV. Differentiation of somatic cells into neurons by Gsta4 was confirmed by immunofluorescence staining and qPCR (Figure 2). Immunofluorescence staining confirmed the expression of ChAT, a marker for motility neurons, and Map2, a marker for mature neurons. By qPCR, the degree of neuronal differentiation was confirmed by changes in the expression of Synapsin, a marker for synapse formation, Map2, a marker for mature neurons, and Hb9, a marker for mature neurons.

[0490] When Gsta4 was treated alone, synapsin expression increased by approximately four times compared to the control group (shown as "control"), Map2 expression increased by approximately five times compared to the control group (shown as "control"), and Hb9 expression increased by approximately two times compared to the control group (shown as "control"). These experimental results confirmed that Gsta4 alone can effectively convert somatic cells into neurons.

[0491] Example 2: Confirmation of direct cross-differentiation of intracellularly mediated differentiation factors into motor neurons.

[0492] To confirm the direct cross-differentiation effect of known factors, conventional differentiation factors were introduced into human-derived fibroblasts, and the degree of direct cross-differentiation into motor neurons was confirmed (Figure 3).

[0493] At this time, conventional differentiation factors were introduced as follows:

[0494] Administration of Ascl1 alone; administration of a combination of Ascl1, Brn2, and Myt1l (denoted by ABM); administration of a combination of Hb9, Isl1, and Lhx3 (denoted by HIL); administration of a combination of ABM and HIL; and administration of a combination of ABM, HIL, Ngn2, and NeuroD1 (denoted by HND).

[0495] In Example 1, when Gsta4 was administered alone, the expression levels of Synapsin, Map2, and Hb9 increased by approximately 4, 5, and 2 times, respectively, compared to the control group. In contrast, when Ascl1 was administered alone, the expression levels of Synapsin, Map2, and Hb9 increased by only about 1 to 1.5 times. This suggests that, compared to the previously published factor Ascl1 administration alone, Gsta4, the novel differentiation factor of this application, exhibits higher efficiency in direct cross-differentiation of motor neurons.

[0496] Furthermore, administration of ABM, a combination of three known factors, increased the expression of Synapsin, Map2, and Hb9 by only about 2-, 4-, and 1-fold, respectively. Furthermore, administration of HIL, a combination of three published factors, increased the expression of Synapsin, Map2, and Hb9 by only about 2-, 1.5-, and 1.5-fold, respectively. This confirms that the administration of a combination of three published factors results in a similar or lower efficiency of direct cross-differentiation into motor neurons compared to treatment with Gsta4 alone, a novel differentiation factor of the present application.

[0497] Meanwhile, the combination of six known factors (ABM+HIL) and eight known factors (ABM+HND) showed increased expression of neuronal markers compared to the combination of one or three known factors. In other words, combining six or more factors showed significant effects.

[0498] Example 3: Confirmation of direct cross-differentiation using a combination of Gsta4

[0499] After confirming the neuronal transformation effect of the factors disclosed in Example 2 alone, we attempted to confirm the effect of combining them with Gsta4 of the present invention.

[0500] To this end, we transduced mouse fibroblasts with AAV, Gsta4, and various combinations of conventional differentiation factors, and confirmed the degree of differentiation by qPCR, which measured the expression of neuronal markers (Synapsin, Map2, and Hb9) (Figure 4).

[0501] As a result, it was confirmed that the expression of neuronal markers in the group in which Gsta4 was combined with conventional differentiation factors increased by about 5-10 times compared to the control group (referred to as "Control"). Compared to the case in which conventional factors were used alone as confirmed in Example 2, the expression results (fold change) of each of the same markers were found to be even higher when combined with Gsta4 of the present invention.

[0502] Furthermore, immunofluorescence staining confirmed the expression of ChAT, a marker for motor neurons, and Map2, a marker for mature neurons (Figures 5 and 6). Immunofluorescence staining also confirmed the expression of ChAT and Map2 in the group treated with a combination of Gsta4 and conventional differentiation factors.

[0503] That is, as shown in Figures 4 to 6, it was found that somatic cells effectively and directly cross-differentiated into motor neurons even when Gsta4 was used in combination with conventional differentiation factors.

[0504] Example 4: Confirmation of direct cross-differentiation of conventional differentiation factors into motor neurons based on the presence or absence of Gsta4 in cells.

[0505] After confirming the results of Examples 2 and 3, we attempted to more specifically confirm the effect of combining Gsta4 of the present invention with known differentiation factors.

[0506] Comparison of a single conventional differentiation factor versus a combination of a single conventional differentiation factor and Gsta4. Conventional differentiation factors with or without Gsta4 were introduced into mouse-derived fibroblasts via AAV, and the degree of differentiation was confirmed by qPCR, as was the expression of neuronal markers (Synapsin, Map2) (Figure 7).

[0507] We confirmed that the expression of neuronal markers (Synapsin, Map2) increased approximately 2-5 times when Gsta4 and Ascl1 were administered in combination (Gsta4+Ascl1) and when Gsta4 and Brn2 were administered in combination (Gsta4+Brn2) compared to when the conventional differentiation factors Ascl1 and Brn2 were administered alone.

[0508] Comparison of two conventional differentiation factors vs. two conventional differentiation factors + Gsta4 combination

[0509] Conventional differentiation factors with or without Gsta4 were introduced into mouse-derived fibroblasts via AAV, and the degree of differentiation was confirmed by immunofluorescence staining to confirm the expression of neuronal markers (ChaT, Map2) (Figure 8).

[0510] We confirmed that the number of cells immunostained with neuronal cell markers increased by more than 40 times when Gsta4 was administered in combination with Mnx1 and Lhx3 (indicated as Gsta4+Mnx1+Lhx3) compared to when the conventional differentiation factors Mnx1 and Lhx3 were administered in combination (indicated as Mnx1+Lhx3).

[0511] In addition, the expression of neuronal markers (Synapsin, Map2) was confirmed by qPCR (Figure 9).

[0512] We confirmed that the expression of neuronal markers increased approximately 2-4 fold when Gsta4 was administered in combination with Mnx1 and Lhx3 (Gsta4+Mnx1+Lhx3) compared to the combination of conventional differentiation factors Mnx1 and Lhx3 (Mnx1+Lhx3). Furthermore, when Gsta4 was administered alone (Gsta4), the expression of neuronal markers increased approximately 2-4 fold compared to the control group (Control).

[0513] Comparison of conventional differentiation factors (3) vs. conventional differentiation factors (3) + Gsta4 combination Mouse-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (Synapsin, Map2) using qPCR (Figure 10).

[0514] It was confirmed that the expression of neuronal cell markers (Synapsin, Map2) increased by approximately 2 to 4 times when Gsta4 was administered in combination with Ascl1, Brn2, and Myt1L (represented as Gsta4+Ascl1+Brn2+Myt1l) compared to when the conventional differentiation factors Ascl1, Brn2, and Myt1L were administered in combination (represented as Ascl1+Brn2+Myt1l).

[0515] Comparison of the conventional 8 eruption factors vs. the conventional 8 eruption factors + Gsta4 combination Human-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (Synapsin, Map2, Hb9) using qPCR (Figure 11).

[0516] We confirmed that the expression of neuronal markers was increased approximately 2-5 fold when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (denoted as ABM+HND+Gsta4) compared to the combination of conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (denoted as ABM+HND+Ngn2+NeuroD1(HND)). Furthermore, we confirmed that the expression of neuronal markers was increased approximately 10-12 fold when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (denoted as Control) compared to the control group (denoted as Control).

[0517] Furthermore, conventional differentiation factors were introduced into human-derived fibroblasts using AAV, depending on the presence or absence of Gsta4, and the degree of differentiation was confirmed by the expression of neuronal cell markers (vChaT, Map2) using immunofluorescence staining (Figure 13).

[0518] When the conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 were introduced in combination (labeled "known factors"), approximately 15.51% of the cells differentiated into mature neurons. In contrast, when the conventional differentiation factors and Gsta4 were introduced in combination (labeled "known factors + Gsta4"), approximately 48.72% of the cells differentiated into mature neurons.

[0519] Comparison of conventional eruption factors (4) vs. conventional eruption factors (7) vs. conventional eruption factors (7) + Gsta4 combination Mouse astrocytes were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (vChaT, Map2) using immunofluorescence staining (Figure 12).

[0520] When conventional differentiation factors Hb9, Isl1, Lhx3, and Ascl1 were administered in combination, neuronal marker expression was approximately 20%. When conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, and Ngn2 were administered in combination (labeled "known factors"), neuronal marker expression was approximately 50%. However, when these known factors were administered in combination with Gsta4 (labeled "known factors + Gsta4"), neuronal marker expression was approximately 70%. In other words, the expression of ChaT and Map2 was increased when Gsta4 was administered in combination with seven conventional differentiation factors compared to when only the seven conventional differentiation factors were administered.

[0521] Based on the above results, it was found that Gsta4 of the present application is a differentiation factor that has the function of directly cross-differentiating somatic cells such as fibroblasts and stromal cells to convert them into induced motor neurons. Furthermore, it was found that Gsta4 has a higher differentiation efficiency than conventional direct cross-differentiation factors, and furthermore, when used together with conventional differentiation factors, it enhances the differentiation efficiency of conventional differentiation factors that have low differentiation efficiency.

[0522] Example 5: Confirmation of direct cross-differentiation into motor neurons and therapeutic effect in vivo Based on the results of Examples 1 to 4, which confirmed the neuronal differentiation efficacy of Gsta4 in cells, experiments were conducted based on the schematic diagram in Figure 14 to confirm direct cross-differentiation into motor neurons and therapeutic effects in vivo.

[0523] The effect of improving or treating spinal nerve damage was confirmed through morphological, physiological, and behavioral analyses in an SCI mouse model, an animal model of paraplegia.

[0524] 1) SCI (Spinal Cord Injury) Mouse Model To create a mouse SCI model, a model of paralysis of the lower body caused by spinal cord injury, ICR mice were anesthetized and injured at Lumbar 5 of the spinal cord (hereafter referred to as L5; corresponding to vertebrae T13-L1). After injury, the mice were used for experiments 5 weeks later.

[0525] 2) AAV administration to SCI mouse models

[0526] AAV2ul was microinjected into the L5 site of the SCI mouse model using a microsyringe (Hamilton, 705).

[0527] Example 5-1: Confirmation of morphological changes at the spinal cord injury site.

[0528] SCI mouse models were divided into three groups: one group (called Control) in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced; one group (called +Gsta4) in which eight conventional differentiation factors and Gsta4 were introduced together; and one group (called Mock) in which an AAV without differentiation factors was introduced. Crystal violet (Sigma) staining was performed to observe morphological changes at the spinal cord injury site (L5) in each group (Figure 15).

[0529] As shown in Figure 15, the Mock group, which lacked differentiation factors that directly induce cross-differentiation, showed a large number of inflammatory cells gathering together and forming a dense scar (red dotted line). The Control group, which was transfected with eight conventional differentiation factors, showed a reduction in the scar where cells gathered compared to the Mock group. On the other hand, the group transfected with eight conventional differentiation factors and GSTA4 showed a reduction in the scar caused by inflammatory cells compared to the Control group.

[0530] Example 5-2: Confirmation of changes in the expression of motor neuron markers.

[0531] SCI mouse models were divided into three groups: a group in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced (referred to as Control); a group in which eight conventional differentiation factors and Gsta4 were introduced together (referred to as +Gsta4); and a group in which an AAV without differentiation factors was introduced (referred to as Mock). Immunofluorescence staining was performed at each spinal cord injury site (L5) to observe changes in the expression of motor neuron markers (Figures 16, 17, and 18).

[0532] Figures 16, 17, and 18 show that ChaT and Map2 expression increased approximately twice in the Control group compared to the Mock group. On the other hand, in the group to which eight conventional differentiation factors and GSTA4 were introduced together, ChaT and Map2 expression increased by more than five times compared to the Control group. This means that GSTA4 leads to higher differentiation efficiency in direct cross-differentiation from astrocytes to motor neurons compared to the Control group.

[0533] Example 5-3: Confirmation of therapeutic effect of lower body paralysis by electrophysiological analysis

[0534] Electrophysiological changes were observed in the spinal cord injury site (L5) of each of the following groups: a normal group with no spinal cord damage (referred to as Sham); a group administered AAV containing eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) to an SCI mouse model (referred to as Control); a group administered AAV containing the eight conventional differentiation factors plus Gsta4 (referred to as +Gsta4); and a group of SCI mice with AAV introduced (referred to as Mock) (Figure 19).

[0535] FIG. 19(a) is a photograph of a neuron subjected to patch clamp.

[0536] The action potential measurement results in Figure 19(b) show that the action potential in the sham group was 25 Hz, but in the mock group it was 2 Hz, a decrease of more than one-tenth. In contrast, the control group, which had been transfected with eight conventional differentiation factors, showed an increase in action potential at 6 Hz, and in the group transfected with both the eight conventional differentiation factors and Gsta4, it was 13 Hz, a increase of more than two-fold compared to the control group.

[0537] An increase in action potentials indicates the ability of neurons to transmit signals when they receive them. Signal transmission is not possible without action potentials. Action potentials are also the most representative characteristic of neurons. The occurrence and increase of action potentials indicates successful differentiation into neurons. Therefore, the group in which eight differentiation factors and Gsta4 were introduced together showed the highest differentiation into neurons, indicating that this combination is highly efficient at differentiating into neurons.

[0538] As shown in Figure 19(c), the signal from presynaptic neurons was measured at 1 Hz in the mock group, 6 Hz in the control group, and 47 Hz in the +Gsta4 group.

[0539] An increase in signals from presynaptic neurons indicates increased signal transmission between neurons. This suggests that the connections between neurons severed by SCI led to the regeneration of new motor neurons. Example 5-4: Direct confirmation of cross-differentiation by behavioral analysis

[0540] A group in which no spinal cord injury was performed (referred to as "Sham"); ​​a group in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced into an SCI mouse model (referred to as "-Gsta4"); a group in which eight conventional differentiation factors and Gsta4 were introduced together (referred to as "+Gsta4"); and a group in which AAV was administered to an SCI mouse model (referred to as "Mock"); changes in BBB scores were confirmed at each spinal cord injury site (L5) (Figure 20).

[0541] The BBB score (Basso Beattie, and Bresnahan score) in Figure 20 is a measurement method traditionally used in spinal cord injury models. It is calculated by comprehensively evaluating the shape and angle of the lower limbs, the angle of the knee, and the shape, angle, and position of the soles of the feet. The score ranges from a minimum of 0 to a maximum of 21, with a normal animal scoring 21.

[0542] The group transfected with only eight conventional differentiation factors (denoted as -Gsta4) showed no difference from the Mock group (BBB score of approximately 4 points). However, the group transfected with eight conventional differentiation factors and Gsta4 (denoted as +Gsta4) showed a BBB score that was more than double that of the -Gsta4 group at 3 weeks after AAV administration (approximately 8 points).

[0543] We also confirmed changes in the forced swimming test, self-reporting, foot printing test, etc. in each of the following groups: a normal group with no spinal cord damage (referred to as "Sham"); ​​a group in which AAV was introduced into an SCI mouse model (referred to as "Mock"); a group administered with AAV that introduced eight conventional differentiation factors and Gsta4 (referred to as "Gsta4+"); and a group administered with AAV that introduced only eight conventional differentiation factors (referred to as "Control") (Figure 21).

[0544] In the forced swimming test shown in Figure 21(a), the animal model was placed in a water tank for 3 minutes, and the number of leg movements was measured. In the mock group, leg movements were not observed due to spinal cord injury. However, when eight conventional differentiation factors were introduced together with Gsta4, leg movements increased by approximately 6 to 12 times.

[0545] Figures 21(b) and (c) show the results of measuring the ability to urinate independently. Mice with spinal cord injury are unable to urinate independently. However, it was confirmed that mice were able to urinate independently 14 or 16 days after administration of AAV in the group transfected with eight conventional differentiation factors and Gsta4.

[0546] Figure 21(d) shows the results of a foot printing test. Foot printing involves applying red ink to the soles of the mouse's lower paws to confirm their shape. In the case of Sham, the soles of the lower paws are clearly visible (number 11 / 20cm), but the shape of the soles of the feet in Mock could not be confirmed (number 11 / 20cm). In contrast, in the group in which eight conventional differentiation factors and Gsta4 were introduced together, the soles of the mouse's lower paws (number 5 / 20cm) were clearly visible.

[0547] Based on the above results, it was found that Gsta4, a novel differentiation factor discovered by the inventors of the present application, is an important factor for direct cross-differentiation of somatic cells into motor neurons. Furthermore, Gsta4 exhibits higher differentiation efficiency than conventional differentiation factors, and when conventional differentiation factors are used together with Gsta4, the differentiation efficiency is even higher than when conventional differentiation factors are used alone. Furthermore, the inventors have confirmed the therapeutic effect on a model of lower body paralysis caused by spinal cord injury, and it is expected that Gsta4 will play an important role in various nervous system diseases in the future. [Industrial Applicability]

[0548] This application can provide a novel differentiation factor for direct cross-differentiation from somatic cells to motor neurons and its applications. (Sequence List FreeText)

[0549] This relates to the Gsta4 (Glutathione S-Transferase Alpha 4) protein or the nucleic acid sequence that codes for it.

Claims

1. A composition for direct cross-differentiation from somatic cells into induced motor neurons (iMNs), The composition comprises: Gsta4 (Glutathione S-Transferase Alpha 4) protein or nucleic acid coding therefor; A composition comprising:

2. The composition according to claim 1, characterized in that the Gsta4 protein is the amino acid sequence shown in Sequence ID No. 1 or a sequence that is 90% or more identical thereto.

3. The composition according to claim 1, characterized in that the nucleic acid coding the Gsta4 protein has the sequence of sequence number 2 or 12.

4. The composition comprises: ii) one or more proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding the same; The composition according to claim 1, further comprising:

5. The composition according to claim 4, characterized in that Hb9, Lhx3, or Ngn2 is selected in ii).

6. The composition according to claim 4, characterized in that in ii) Hb9 and Lhx3; or Hb9 and Ngn2; or Lhx3 and Ngn2 are selected.

7. The composition according to claim 4, characterized in that Hb9, Lhx3 and Ngn2 are selected in ii).

8. The composition according to claim 4, characterized in that Hb9, Lhx3, Ngn2 and Isl1 are selected in ii).

9. The composition according to claim 4, characterized in that, in ii), Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 are selected.

10. The Ascl1 protein has the amino acid sequence shown in SEQ ID NO: 17, and the nucleic acid encoding the Ascl1 protein has the sequence shown in SEQ ID NO: 18; The Brn2 protein has the amino acid sequence shown in SEQ ID NO: 19, and the nucleic acid encoding the Brn2 protein has the sequence shown in SEQ ID NO: 20; The Myt1L protein has the amino acid sequence shown in SEQ ID NO:21, and the nucleic acid encoding the Myt1L protein has the sequence shown in SEQ ID NO:22; The Hb9 protein has the amino acid sequence set forth in SEQ ID NO: 13, and the nucleic acid encoding the Hb9 protein has the sequence set forth in SEQ ID NO: 14; The Isl1 protein has the amino acid sequence shown in SEQ ID NO:23, and the nucleic acid encoding the Isl1 protein has the sequence shown in SEQ ID NO:24; The Lhx3 protein has the amino acid sequence shown in SEQ ID NO: 15, and the nucleic acid encoding the Lhx3 protein has the sequence shown in SEQ ID NO: 16; The Ngn2 protein has the amino acid sequence set forth in SEQ ID NO:25, and the nucleic acid encoding the Ngn2 protein has the sequence set forth in SEQ ID NO:26; The composition according to claim 4, wherein the NeuroD1 protein has the amino acid sequence shown in SEQ ID NO: 27, and the nucleic acid encoding the NeuroD1 protein has the sequence shown in SEQ ID NO:

28.

11. As a vector for expressing differentiation factors for direct cross-differentiation, The direct cross-differentiation converts somatic cells into induced motor neurons (iMNs), The aforementioned vector is i) a nucleic acid encoding a Gsta4 protein; and ii) Promoter; including, In this case, the vector is characterized in that i) and ii) are operably linked.

12. The vector comprises: iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; The vector of claim 11, further comprising:

13. The vector according to claim 12, wherein Hb9 and Lhx3 are selected in iii).

14. As a vector for expressing differentiation factors for direct cross-differentiation, The direct cross-differentiation converts somatic cells into induced motor neurons (iMNs), The vectors include at least a first vector and a second vector, The first vector is, i) a nucleic acid encoding a Gsta4 protein; and ii) a promoter; At this time, i) and ii) are operably linked, The aforementioned second vector is iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and iv) a promoter; At this time, iii) and iv) are operatively connected, The promoters ii) and iv) are the same or different from each other; The vector is characterized in that the above iii) is contained in one vector or in two or more vectors.

15. The vector includes an enhancer, a polyadenylation signal, a Kozak common sequence, an ITR (inverted terminal repeat), an LTR (long terminal repeat), a terminal, an internal ribosome entry site (IRES), a fluorescent protein gene, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, and a 2A self-cleaving peptide.

15. The vector according to claim 11, further comprising one or more genes selected from the group consisting of a gene encoding a nucleotide sequence, ...

16. The vector according to claim 15, wherein the 2A self-cleaving peptide is one or more selected from the group consisting of T2A, P2A, E2A, and F2A.

17. the vector is a viral vector or a non-viral vector; The vector according to any one of claims 11 to 14, wherein the viral vector is one or more of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, foxvirus, HIV (human immunodeficiency virus), MLV (murine leukemia virus), ASLV (aviansarcoma / leukosis), SNV (spleen necrosis virus), RSV (rousarcoma virus), MMTV (mouse mammary tumor virus), herpes simplex virus, episomal virus, and herpes simplex virus.

18. A method for direct cross-differentiation in vitro or in vitro, This involves a switch from somatic cells to induced motor neurons (iMNs). The above method is A composition comprising the Gsta4 protein or nucleic acid coding therein is introduced into somatic cells; At this time, the method is characterized in that induced pluripotent stem cells (iPSCs) are not generated.

19. 19. The method of claim 18, wherein the somatic cells are one or more selected from the group consisting of fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, and rare dendritic precursor cells.

20. 20. The method of claim 19, wherein the somatic cells are derived from a mammal selected from the group consisting of humans, dogs, cats, horses, sheep, rabbits, pigs, mice, and camels.

21. The method according to claim 18, further comprising culturing the somatic cells into which the composition has been introduced in a culture medium for neuronal differentiation.

22. The method according to claim 18, characterized in that the introduction is carried out by one or more selected from among electroporation, gene gun, ultrasonic perforation, magnetic nanoparticle transfection, microinjection, transient cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection.

23. The method according to claim 18, characterized in that, by the introduction described above, somatic cells differentiate into induced motor neurons within one to seven weeks.

24. For direct cross-differentiation of somatic cells into induced motor neurons (iMNs), Contains Gsta4 protein, A pharmaceutical composition for the prevention or treatment of nervous system diseases.

25. The aforementioned pharmaceutical composition is The pharmaceutical composition according to claim 24, further comprising one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

26. For direct cross-differentiation of somatic cells into induced motor neurons (iMNs), Gsta4 protein or a nucleic acid encoding the same; A pharmaceutical composition for the prevention or treatment of nervous system diseases.

27. The aforementioned pharmaceutical composition is The pharmaceutical composition according to claim 26, further comprising nucleic acids coding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

28. A pharmaceutical composition for the prevention or treatment of neurological diseases, including motor neurons in which differentiation factors for direct cross-differentiation from somatic cells to induced motor neurons (iMNs) are overexpressed. The motor neurons may be used as differentiation factors for direct cross-differentiation. i) GSTA4, or ii) A pharmaceutical composition characterized by overexpression of Gsta4 and one or more differentiation factors selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1).

29. 29. The pharmaceutical composition according to any one of claims 24 to 28, further comprising one or more selected from the group consisting of acceptable carriers, excipients, diluents, and preservatives.

30. 29. The pharmaceutical composition according to any one of claims 24 to 28, wherein the nervous system disease is one or more selected from the group consisting of spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal developmental disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, and traumatic brain injury, motor neuron injury, or diseases induced thereby.

31. The pharmaceutical composition according to any one of claims 24 to 28, wherein the pharmaceutical composition is in one or more forms selected from the group consisting of a solid, a liquid, a capsule, and a semi-solid form.

32. The pharmaceutical composition according to any one of claims 24 to 28, characterized in that the pharmaceutical composition is administered to one or more sites selected from the group consisting of muscle, intradermal, subcutaneous, venous, peritoneal, arterial, mucosal, spinal cord, bone marrow, intrathecal, and transdermal.

33. The pharmaceutical composition according to any one of claims 24 to 28, wherein the pharmaceutical composition is administered at a dose of 1 uL / kg to 20 uL / kg at a time.

Citation Information

Patent Citations

  • Composition for direct Conversion from somatic cell to motor neuron and use thereof

    KR1020200129709A

  • Conversion of somatic cells into functional spinal motor neurons, and methods and uses thereof

    US20150023927A1

  • Method for direct transdifferentiation reprogramming into neurons using electromagnetic-induced metal nanoparticles

    US20190062702A1