5'-UTR with improved translation efficiency, synthetic nucleic acid molecules containing the same, and vaccine or therapeutic compositions containing the same.

A 5'-UTR polynucleotide with optimized sequences and structures addresses inefficiencies in mRNA translation and stability, enhancing vaccine efficacy by improving translation efficiency and stability for effective mRNA delivery and expression.

JP7830648B2Active Publication Date: 2026-03-16MOGAM INST FOR BIOMEDICAL RES +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2024533226
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-12-03
Filing Date
2022-12-02
Publication Date
2026-03-16
Estimated Expiration
2042-12-02

AI Technical Summary

Technical Problem

Current mRNA vaccines face challenges with inefficient translation due to premature antigen degradation and limited cellular access, necessitating improved translation efficiency and stability to reduce dosage and enhance immune response.

Method used

Development of a 5'-UTR polynucleotide with specific base sequences (AG[N 22 ]GCCACC or AGGA[N 19 RGCCACC) that lacks secondary structures, low uridine content, and enhances translation efficiency, integrated with a 5'-CAP structure, coding regions, 3'-UTR, and poly(A) tail for improved stability and cellular uptake.

Benefits of technology

The 5'-UTR polynucleotide significantly enhances translation efficiency and stability, allowing for effective mRNA delivery and expression, reducing the dosage required for immune response induction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007830648000004
    Figure 0007830648000004
  • Figure 0007830648000005
    Figure 0007830648000005
  • Figure 0007830648000006
    Figure 0007830648000006
Patent Text Reader

Abstract

The present invention relates to a synthetic nucleic acid molecule containing a 5'-UTR with improved translation efficiency and a vaccine / therapeutic composition containing the same, more specifically, to a 5'-UTR polynucleotide prepared containing a specific motif and with improved translation efficiency, a synthetic nucleic acid molecule containing the same, and a vaccine / therapeutic composition containing the synthetic nucleic acid molecule. The 5'-UTR polynucleotide according to the present invention has improved translation efficiency and can effectively induce expression of a target protein, and is therefore useful in various RNA-based applications, such as vaccines and in vivo / ex vivo gene therapy agents.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a synthetic nucleic acid molecule containing 5'-UTR with improved translation efficiency and a vaccine / therapeutic composition containing the same, and more specifically, to a 5'-UTR polynucleotide manufactured containing a specific motif and having improved translation efficiency, a synthetic nucleic acid molecule containing the same, and a vaccine / therapeutic composition containing the synthetic nucleic acid molecule. [Background technology]

[0002] Untranslated regions (UTRs) within mRNA have been reported to play a central role in regulating both mRNA stability and mRNA translation. UTRs have been shown to influence translation initiation, elongation, and termination, as well as mRNA stabilization and intracellular distribution through their interactions with RNA-binding proteins (Jackson RJ, et al., Nat Rev Mol Cell Biol. Vol. 11(2), pp. 113-127, 2010). Depending on specific motifs within the UTR, it can either enhance or decrease mRNA turnover (Barrett LW, et al., Cell Mol Life Sci. Vol. 69(21), pp. 3613-34, 2012). Furthermore, data on mRNA half-life and corresponding UTR sequences have been published ('t Hoen PA, et al., Nucleic Acids Res. Vol. 39(2), pp. 556-566, 2012).

[0003] UTRs are sections of an mRNA molecule located upstream of the start codon and downstream of the stop codon; i.e., they are untranslated sequences. These regions are transcribed along with the coding region, and therefore, because they are present in mature mRNA, they are exons. The UTR upstream of the start codon of mRNA is called the 5' UTR, and once transcribed, it contains the so-called Kozak sequence, along with a sequence corresponding to a portion of the promoter (residual 3').

[0004] The Kossack common sequence, also known as the Kossack sequence or Kossack sequence, is a sequence known to be present in eukaryotic mRNA and contains the common (gcc)gccRccAUGG sequence. The Kossack common sequence plays a crucial role in the initiation of translation. The sequence is named after Marilyn Kossack, who highlighted its importance. This sequence within the mRNA molecule is recognized by ribosomes at the translation initiation site, from which the mRNA molecule encodes a protein. Ribosomes require this sequence or a possible variant of it to initiate translation.

[0005] The sequence is identified by the notation (gcc)gccRccAUGG, which summarizes the data analyzed by Kozak from a very diverse range of sources (approximately 699 in total), as follows: Lowercase letters represent the most common bases at positions where the bases may still vary; uppercase letters indicate highly conserved bases, i.e., the "AUGG" sequence is immutable or changes only rarely, if at all; "R" indicates that a purine (adenine or guanine) is always observed at this position (Kozak claims adenine is more frequent); sequences in parentheses ((gcc)) are of unclear significance.

[0006] While many means and methods have been published to increase mRNA stability, reduce immunogenic responses caused by mRNA administered to cells or organisms, and increase expression efficiency (i.e., transcription and / or translation efficiency) (US 10080809, US 2018-0353618, US 2019-0144883), there is still a need for improvement, particularly regarding additional or alternative means to increase expression efficiency (i.e., transcription and / or translation efficiency), as it is an essential parameter for anticipated medical applications, as it determines, for example, the administration and administration interval of mRNA drugs and ultimately the bioavailability of the final product, i.e., the encoded peptide or protein. At the same time, there is still a need to further reduce the manufacturing cost of mRNA drugs, increase the yield of the resulting mRNA molecules, and increase the available space within the resulting mRNA molecules for the actual transplanted gene, i.e., the coding region encoding the target polypeptide.

[0007] On the other hand, gene vaccines began to be developed after it was reported that when DNA and RNA encoding a target gene are directly injected into animals, the target gene is expressed in living animals, and this expression enables immunity (Wolff JA et al. Science, 247:1465-8, 1990).

[0008] Genetic vaccination allows for the elicitation of a desired immune response against selected antigens, such as characteristic components of bacterial surfaces, viral particles, or tumor antigens. Overall, vaccination is one of the central achievements of modern medicine. However, effective vaccines are currently available for only a limited number of diseases. Therefore, infectious diseases that cannot be prevented by vaccination still affect millions of people every year.

[0009] In gene therapy or gene vaccination, DNA and RNA can be used as nucleic acid molecules for gene delivery, and DNA is known to be relatively more stable and easier to handle than RNA. However, with DNA, there is a potential risk if the administered DNA section is inserted at an undesirable location within the patient's genetic material, damaging the gene. Furthermore, there is a possibility of unwanted anti-DNA antibodies appearing, and another problem is that the expression levels of peptides or proteins expressed by DNA delivery and subsequent transcription / translation are limited. The presence or absence of specific transcription factors that regulate DNA transcription has a major impact on the expression level of the administered DNA, and in the absence of these specific transcription factors, insufficient amounts of RNA are produced by DNA transcription, resulting in limited levels of peptides or proteins produced through translation.

[0010] On the other hand, when RNA is used as a tool for gene delivery, it does not require transcription, does not need to enter the nucleus like DNA, and can synthesize proteins directly in the cytoplasm, thus avoiding the risk of entering cell chromosomes and causing unwanted gene damage. Furthermore, it has a shorter half-life than DNA and does not induce long-term gene modification (Sayour EJ, et al., J Immunother Cancer Vol. 3, 13, 2015). Conventional RNA vaccines are activated only for a short period after being delivered into cells, causing the target protein to be expressed, and are destroyed by enzymatic reactions within a few days, leaving a specific immune response to the expressed target antigen (protein).

[0011] Furthermore, when RNA is used as a tool for gene delivery, it does not need to cross the nuclear membrane and only needs to pass through the cell membrane to act. Therefore, using a smaller amount of RNA than DNA can express the same amount of target protein. Also, because RNA itself possesses immunoconjugative properties, administering a smaller amount than DNA can achieve the same immune effect. By using RNA instead of DNA for gene vaccination, the risk of unwanted genome integration and the production of anti-DNA antibodies is minimized or prevented. However, RNA is considered a very unstable molecular species that can be easily degraded by ubiquitous RNases.

[0012] Despite significant advancements in recent years, inefficient mRNA translation due to premature antigen degradation or inefficient release of mRNA in cells remains a persistent problem in the field of mRNA vaccination, which aims to induce adaptive immune responses. Furthermore, there is a pressing need to reduce the dosage of mRNA vaccines to mitigate potential safety concerns and to enable vaccination in developing countries.

[0013] There are many challenges in delivering nucleic acids to produce desired responses in biological systems. Nucleic acid-based therapies, such as vaccines, hold great potential, but realizing this potential still requires more effective delivery of nucleic acids to the appropriate sites within cells or organisms.

[0014] However, the use of nucleic acids for therapeutic and preventive purposes currently faces two problems. First, free RNA is vulnerable to nuclease digestion in plasma. Second, free RNA has a limited ability to access intracellular compartments where the associated translational mechanisms reside. Lipid nanoparticles formed from cationic lipids and other lipid components such as neutral lipids, cholesterol, PEG, pegylated lipids, and oligonucleotides are being attempted to block RNA degradation in plasma and promote cellular absorption of nucleic acids.

[0015] Therefore, the inventors diligently worked to solve the aforementioned problems and develop a 5-UTR with improved translation efficiency. As a result, they confirmed that by selecting artificial nucleic acid molecules that do not generate a secondary structure, have low uridine content, and do not contain sequences that reduce stability, it is possible to obtain a 5'-UTR with improved translation efficiency, thus completing the present invention. [Overview of the Initiative] [Problems that the invention aims to solve]

[0016] The objective of the present invention is to provide a 5'-UTR polynucleotide with improved translation efficiency. Another object of the present invention is to provide synthetic nucleic acid molecules containing 5'-UTR polynucleotides with improved translation efficiency. Another object of the present invention is to provide a vaccine composition comprising synthetic nucleic acid molecules. [Means for solving the problem]

[0017] To achieve the above objective, the present invention provides isolated 5'-UTR (untranslated region) polynucleotides comprising a base sequence represented by the nucleic acid sequence of chemical formula (I): [C1] AG[N 22 ]GCCACC.

[0018] The present invention also provides isolated 5'-UTR (untranslated region) polynucleotides consisting of a base sequence represented by the nucleic acid sequence of chemical formula (II): [C2] AGGA[N 19 RGCCACC Here, R means either A or G.

[0019] This invention also applies to the order from 5' to 3', a) 5'-CAP structure; b) the 5'-UTR polynucleotide; c) one or more coding regions; d) 3'-untranslated region (3'-UTR); and e) a poly(A) tail or poly(A)-like sequence of 10 to 1000; provided is a synthetic nucleic acid molecule comprising the same. The present invention also provides a vaccine composition comprising the synthetic nucleic acid molecule. The present invention also provides a use of the vaccine composition for disease prevention. The present invention also provides a method for preventing a disease, comprising the step of administering the vaccine composition. The present invention also provides a use of the vaccine composition for the manufacture of a medicament for disease prevention.

Brief Description of the Drawings

[0020] [Figure 1] It is a diagram schematically showing the process of selecting a 5'-UTR candidate group according to an embodiment of the present invention. [Figure 2] It is a vector map of a vector produced for confirming the performance of in vitro transcription synthesis of mRNA containing a 5'-UTR selected in an embodiment of the present invention. [Figure 3] It is a diagram schematically showing the structure of mRNA containing a 5'-UTR selected in an embodiment of the present invention. [Figure 4] (A) and (B) are the results of confirming the expression efficiency of mRNA containing a 5'-UTR selected in an embodiment of the present invention in the HEK293T cell line, and (C) and (D) are the results of confirmation in the HeLa cell line. [Figure 5] (A) and (B) are the results of confirming the expression efficiency of mRNA containing a 5'-UTR selected in an embodiment of the present invention in the Huh7 cell line, and (C) and (D) are the results of confirmation in the SNU423 cell line.

Modes for Carrying Out the Invention

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by skilled experts in the art to which this invention pertains. Generally, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

[0022] In this invention, instead of extracting 5'-UTR with improved translation efficiency from naturally occurring genes, we aimed to confirm that selecting and determining it from a total combination using a certain logic results in superior performance compared to 5'-UTR found in nature.

[0023] In other words, in one embodiment of the present invention, it was confirmed that the translation efficiency of the selected 5'-UTR polynucleotide was improved by performing the following steps from a combination of 30 polynucleotides: removing combinations that may have a secondary structure as shown in Figure 1; selecting sequences to improve capping efficiency; removing UUU and UUUU motifs; removing 15% or more uridine; and removing sequences with low stability (Figure 1). Therefore, in one view, the present invention is, Regarding isolated 5'-UTR (untranslated region) polynucleotides consisting of the base sequence shown by the nucleic acid sequence of chemical formula (I): [C1] AG[N 22 ]GCCACC

[0024] In other respects, Regarding isolated 5'-UTR (untranslated region) polynucleotides consisting of the base sequence shown by the nucleic acid sequence of chemical formula (II): [C2] AGGA[N 19 RGCCACC Here, R means either A or G. In the present invention, the 5'-UTR can be characterized by being one of the base sequences shown in SEQ ID NOs: 1 to 33. [Table 1]

[0025] In the present invention, the term "UTR" refers to an "untranslated region" located upstream (5') and / or downstream (3') of the coding region of a nucleic acid molecule described herein, thereby typically meaning an "untranslated region" on the side of the coding region. Accordingly, the term "UTR" generally includes the 3'-untranslated region ("3'-UTR") and the 5'-untranslated region ("5'-UTR"). A UTR typically contains, or can consist of, a nucleic acid sequence that is not translated into a protein. Typically, a UTR contains a "regulatory element."

[0026] The term “regulatory element” refers to a nucleic acid sequence having the ability to influence gene regulatory activity, the expression of a operably linked (cis or trans) transcribed, transcription, or translation of a nucleic acid sequence. The term includes promoters, enhancers, internal ribosome entry sites (IRESs), introns, leaders, transcription termination signals, e.g., polyadenylation signals and poly-U sequences, and other expression regulatory elements. Regulatory elements can act constitutively or in a time- and / or cell-specific manner. Selectively, regulatory elements can exert their function through interactions (e.g., recruitment and binding) of regulatory proteins that can regulate (induce, enhance, reduce, discard, or prevent) gene expression, particularly gene transcription.

[0027] The UTR is preferably "operably linked" to the coding region, i.e., arranged in a functional relationship, and controls (i.e., arbitrate or modulate, preferably enhance) the expression of the coding sequence.

[0028] In this invention, the term "5'-UTR" refers to a portion of a nucleic acid molecule located at the 5' (i.e., "upstream") of the open reading frame, which is not translated into protein. In the context of this invention, the 5'-UTR begins at the transcription start site and terminates one nucleotide before the start codon of the open reading frame.

[0029] The 5'-UTR may contain elements that regulate gene expression, known as "regulatory elements." Such regulatory elements may be, for example, ribosome binding sites. The 5'-UTR can be modified by post-transcriptional modifications, such as the addition of a 5'-CAP. Therefore, the 5'-UTR may preferably correspond to a nucleic acid located between the 5'-CAP and the start codon, particularly a sequence of mature mRNA, and more specifically, a nucleotide located at 3' of the 5'-CAP, preferably an extended sequence from the nucleotide immediately following 3' of the 5'-CAP to the nucleotide located at 5' of the start codon (transcription start site) of the proteincoding sequence, preferably a nucleotide immediately following 5' of the start codon (transcription start site) of the proteincoding sequence.

[0030] The nucleotide located immediately 3' from the 5'-CAP of mature mRNA typically corresponds to the transcription start site. The length of the 5' UTR generally has 500, 400, 300, fewer than 250, or fewer than 200 nucleotides. In some examples, this length may range from 10, 20, 30, or 40 or more nucleotides, preferably 10 or 50 or fewer.

[0031] In another aspect, the present invention also states that, in order from 5' to 3', a) 5'-CAP structure; b) The isolated 5'-UTR polynucleotide; c) One or more coding areas; d) 3'-Untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like arrays; This relates to synthetic nucleic acid molecules, including those containing this substance.

[0032] The 5'-CAP of natural mRNA increases mRNA stability upon nuclear efflux and binds to mRNA cap-binding protein (CBP), which forms a mature circular mRNA species. Through the association of poly(A)-binding protein and CBP, this contributes to mRNA stability at the cellular and translational stages. The cap further assists in the removal of 5' proximal introns during mRNA splicing.

[0033] In the present invention, 5'-CAP is typically a modified nucleotide (CAP analog), particularly a guanine nucleotide attached to the 5' end of an mRNA molecule. Preferably, 5'-CAP is attached using a 5'-5'-triphosphate bond (also named m7GpppN). Further examples of 5'-CAP structures include glyceryl, an inverted deoxy-abasic residue (moyety), 4',5'-methylene nucleotide, 1-(β-D-erythrofuranosyl) nucleotide, 4'-thionucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, α-nucleotide, modified base nucleotide, threopentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, and acyclic 3,4-dihydroxybutyl nucleotide. The material comprises acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moisture, 3'-3'-inverted non-base moisture, 3'-2'-inverted nucleotide moisture, 3'-2'-inverted non-base moisture, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, or bridging or non-bridging methylphosphonate moisture. These modified 5'-CAP structures can be used to modify the mRNA sequence of the synthetic nucleic acid molecule of the present invention.

[0034] Additional modified 5'-CAP structures that can be used in the present invention are CAP1 (additional methylation of ribose at the adjacent nucleotide of m7GpppN), CAP2 (additional methylation of ribose at the second downstream nucleotide of m7GpppN), CAP3 (additional methylation of ribose at the third downstream nucleotide of m7GpppN), CAP4 (additional methylation of ribose at the fourth downstream nucleotide of m7GpppN), ARCA (anti-reverse CAP analogue), modified ARCA (e.g., phosphothioate-modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0035] In the present invention, the 5'-CAP structure can be formed by chemical RNA synthesis or RNA in vitro transcription (co-transcription capping) using a cCAP analog, or the CAP structure can be formed in vitro using a capping enzyme (e.g., a commercially available capping kit).

[0036] In the present invention, a CAP analog refers to a non-polymerizable dinucleotide that, when introduced to the 5' end of an RNA molecule, has a CAP function that promotes translation or localization and / or prevents the degradation of the RNA molecule. Non-polymerizable means that the CAP analog does not have a 5' triphosphate and is bound only at the 5' end, and therefore cannot be extended in the 3' direction by template-dependent RNA polymerase.

[0037] CAP analogues are m7GpppA, m7GpppA mThe chemical structures include, but are not limited to, those selected from the group consisting of pG, unmethylated CAP analogs; dimethylated CAP analogs, trimethylated CAP analogs (e.g., m2,2,7GpppA), dimethylated symmetric CAP analogs (e.g., m7Gpppm7A), or anti-rebellious CAP analogs (e.g., ARCA; m7,2'OmeGpppA, m7,2'dGpppA, m7,3'OmeGpppA, m7,3'dGpppA, and their tetraphosphate derivatives).

[0038] Additional CAP analogues have been previously described (US7,074,596, WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347, and WO2013 / 059475).

[0039] In the present invention, the 5'-CAP structure is m7GpppA m The selection can be characterized by being chosen from the group consisting of pG, m7,3'OmeApppG, and m7GpppA, but is not limited to these.

[0040] In the present invention, the coding region may be characterized by encoding one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, variants, or derivatives of said proteins, but is not limited to these.

[0041] In the present invention, the antigenic protein may be one or more selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, alloantigens, and allergic antigens, but is not limited to these.

[0042] In this invention, the term “tumor antigen” means an antigenic (poly-)peptide or protein derived from or associated with a (preferably malignant) tumor or cancerous disease. As used in this application, the terms “cancer” and “tumor” are used interchangeably to refer to a neoplasm that invades surrounding tissues, tends to metastasize to distant parts of the body, whose cells are uncontrolled, and which is generally characterized by rapid growth. This term includes both benign and malignant neoplasms. Malignant tumors of cancer are usually characterized by anaplasia, invasiveness, and metastasis; benign malignant tumors usually do not have these characteristics. The terms “cancer” and “tumor” refer to cancers of the blood and lymphatic systems, as well as neoplasms characterized in particular by tumor growth. “Tumor antigen” is usually derived from tumor / cancer cells, preferably mammalian tumor / cancer cells, and preferably mammalian, preferably human-derived tumor cells, tumors, e.g., systemic or solid tumors, which may be located inside or on the surface of such tumors. "Tumor antigens" generally include tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs usually result from tumor-specific mutations and are specifically expressed by tumor cells. Furthermore, typical TAAs are generally presented by both tumor and "normal" (healthy, non-tumor) cells.

[0043] In the present invention, a tumor antigen may be a tumor-related protein or nucleic acid sequence, each nucleic acid sequence encoding another peptide or protein; and at least one nucleic acid sequence may be 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, α-5-β-1-integrin, α-5-β-6-integrin, α-actinin-4 / m, α-methylacyl-coenzyme A racemase, A T-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, β-catenin / m, BING-4, BRCA1 / m, BRCA2 / m, CA15-3 / CA27-29, CA19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B B) Cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m, CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactosin-like protein, collage XXIII, COX-2, CT-9 / BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTU D2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, G AGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST-2, hepsin, Her2 / neu, HERVK-MEL, HLA-A*0201-R1 7I, HLA-A11 / m, HLA-A2 / m, HNE, homeobox NKX3.1, HOM-TES-14 / SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, kallikrein-2, kallikrein-4, i67, KIAA0205, KIAA0205 / m, KK-LC-1, K-Ras / m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAG E-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C 3, MAGE-D1, MAGED2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-HI, MAGEL2, mammaglobin A, MART-1 / melan-A, MART-2, MART-2 / m, substrate protein 22, MC1 R, M-CSF, ME 1 / m, mesothelin, MG50 / PXDN, MMP1-1, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, myosin class l / m, NA88-A, N-acetylglucosaminyltransferase-V, neo-PAP, neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESOB, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS-9 / m, osteocalcin, osteopontin, pi5, p190 minor bcr-abl, p53, p53 / m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1-kinase, Pin-1, Pml / PARα, POTE, PRAME, PRDX5 / m, prostein, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD1 68, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2 / m, Sp1 7, SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, Survivin, Survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGF-β, TGF-β RII, TGM-4, TPI / m, TRAG-3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2 / FLK-1, WT1, and immunoglobulin genotypes of lymphoid blood cells, or T cell receptor genotypes of lymphoid blood cells, or homologs, fragments, variants or derivatives of the tumor antigen can be encoded.

[0044] In the present invention, the tumor antigen may be selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, α-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, Survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, Mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1, but is not limited to these. In the present invention, the pathogenic antigen can be selected from the group consisting of bacteria, viruses, fungi, and protist antigens.

[0045] In the present invention, the pathogenic antigen may be derived from influenza virus, respiratory syncytial virus (RSV), coronavirus, herpes simplex virus (HSV), human papillomavirus (HPV), human immunodeficiency virus (HIV), Plasmodium, Staphylococcus aureus, dengue virus, Chlamydia trachoma, cytomegalovirus (CMV), hepatitis B virus (HBV), Mycobacterium tuberculosis, rabies virus, and yellow fever virus, or any isomorph, homolog, fragment, variant, or derivative of these proteins. In the present invention, the viral antigen may be a coronavirus, but is not limited thereto.

[0046] In the present invention, the coronavirus may be human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63), New Haven coronavirus, human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV), or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0047] In the present invention, the 3'-UTR may be selected from the group consisting of β-globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 α1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; β-subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; β-F1-ATPase 3'UTR; and combinations thereof, but is not limited to these.

[0048] In this invention, the term "3'-UTR" typically refers to the portion of mRNA located between the protein-encoding region (i.e., the open reading frame, coding region) and the poly(A) sequence. The 3'-UTR of mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is generally encoded by the gene that is transcribed into each mRNA during gene expression. This genomic sequence is first transcribed into immature mRNA containing alternative introns. The immature mRNA is further processed into mature mRNA during the subsequent maturation process. Such a maturation process includes steps such as 5'-capping, splicing of immature mRNA to remove alternative introns, and 3'-end modifications such as polyadenylation of the 3' end of immature mRNA, as well as alternative endo- or exonuclease cleavage.

[0049] In the present invention, the 3'-UTR corresponds to a sequence of mature mRNA located 3' to the stop codon of the protein coding region, preferably 3' immediately adjacent to the stop codon of the protein coding region, and extending to the 5' side of the poly(A) sequence, preferably to the nucleotide immediately adjacent to 5' to the poly(A) sequence. The term "corresponds" means that the 3'-UTR sequence may be an RNA sequence, or a DNA sequence corresponding to such RNA sequences, as is the mRNA sequence used to define the 3'-UTR sequence.

[0050] In the present invention, the synthetic nucleic acid molecule further comprises a poly(A) tail or a poly(A) tail-like sequence. In further embodiments, terminal groups on the poly-A tail may be added for stabilization. In other embodiments, the poly-A tail comprises a des-3' hydroxyl tail.

[0051] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to polynucleotides, such as mRNA molecules, to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to release the 3' hydroxyl. Subsequently, poly-A polymerase adds the adenine nucleotide chain to the RNA. This process, called polyadenylation, adds a poly-A tail that can be, for example, about 80 to about 250 residues in length (including lengths of about 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues). The poly-A tail can also be added after the product has leached out of the nucleus.

[0052] According to the present invention, terminal groups on the poly(A) tail can be added for stabilization. The polynucleotides of the present invention may contain a des-3' hydroxyl tail. They may also contain structural moieties or 2'-O-methyl modifications as taught by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the full text of which is incorporated herein by reference).

[0053] The unique length of the poly-A tail provides certain advantages to the polynucleotides of the present invention. Generally, the length of the poly-A tail is, if present, more than 30 nucleotides. In other embodiments, the poly-A tail is more than 35 nucleotides (for example, at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500 and more than 3,000 nucleotides).

[0054] In some embodiments, the polynucleotide or region consists of approximately 30 to approximately 3,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-750, 30-1,000, 30-1,500, 30-2,000, 30-2,500, 50-100, 50-250, 50-500, 50-750, 50-1,000, 50-1,500, 50-2,000, 50-2,500, 50-3,000, 100-500, 100-750, 100-1,000, 1 This includes the ranges 00-1,500, 100-2,000, 100-2,500, 100-3,000, 500-750, 500-1,000, 500-1,500, 500-2,000, 500-2,500, 500-3,000, 1,000-1,500, 1,000-2,000, 1,000-2,500, 1,000-3,000, 1,500-2,000, 1,500-2,500, 1,500-3,000, 2,000-2,500, 2,000-3,000, and 2,500-3,000).

[0055] In some embodiments, the poly-A tail is designed for the length of the entire polynucleotide or for the length of a specific region of the polynucleotide. This design may be based on the length of the cryptographic region, the length of a specific feature or region, or the length of the ultimate product expressed from the polynucleotide.

[0056] In this regard, the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the polynucleotide or this feature. The poly-A tail can also be designed as a fraction of the polynucleotide to which it belongs. In this regard, the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the artifact, the region of the artifact, or the total length of the artifact-poly-A tail. Furthermore, the manipulated binding sites and conjugation of polynucleotides to poly-A binding proteins can improve expression.

[0057] Furthermore, multiple distinct polynucleotides can be bound together via PABP (poly-A binding protein) through the 3' end using nucleotides modified at the 3' end of the poly-A tail. Transfection experiments can be performed in appropriate cell lines, and protein production can be assessed by ELISA at 12, 24, 48, 72, and 7 days after transfection.

[0058] In some embodiments, the polynucleotides of the present invention are designed to include a poly-AG quartet region. A G-quartet is a cyclic hydrogen-bonded assay of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this experiment, the G-quartet is introduced into the end of a poly-A tail. The resulting polynucleotides are tested for stability, protein production, and other parameters including half-life at various time points. We found that the poly-AG quartet results in protein production from mRNA equivalent to at least 75% of what can be known using a poly-A tail of 120 nucleotides alone.

[0059] In the present invention, the poly(A)tail-like sequence can be used without limitation as long as it is a nucleic acid sequence capable of performing the function of a poly(A)tail. Preferably, it is characterized in that one or more nucleotides other than adenine, selected from the group consisting of uracil (U), cytosine (C), and guanine (G), are inserted between multiple adenines or at the poly(A)tail end, but is not limited thereto. In the present invention, the synthetic nucleic acid molecule can be characterized as RNA.

[0060] In the present invention, the RNA may be selected from the group consisting of mRNA, viral RNA, self-replicating RNA, and replicon RNA, but is not limited to these.

[0061] In the present invention, the synthetic nucleic acid molecule may be characterized by containing one or more backbone-modified, sugar-modified, or base-modified nucleic acids, but is not limited thereto.

[0062] Sugar modification: Modified nucleosides and nucleotides that can be incorporated into modified mRNA compounds containing mRNA sequences as described herein can be modified with sugar moieties. For example, the 2'-hydroxyl group (OH) can be modified or substituted with multiple different "oxy" or "deoxy" substituents. Examples of "oxy"-2'-hydroxyl group modifications include, but are not limited to, alkoxy or allyloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, alphaalkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH2O)nCH2CH2OR; "locked" nucleic acids (LNA) in which the 2'-hydroxyl is bonded to the 4' carbon of the same ribose sugar, for example, by a methylene crosslink; and amino groups (-O-amino, where the amino group, e.g., NRR, may be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy.

[0063] The "deoxy" modification may include hydrogen and an amino acid (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); the amino group may be attached to the sugar via a linker, in which case the linker includes one or more atoms C, N, and O.

[0064] A sugar group can also contain one or more carbon atoms having the opposite stereochemical configuration to the corresponding carbon in ribose. Therefore, modified mRNA can contain nucleotides containing sugars such as arabinose.

[0065] Backbone modification: The phosphate backbone can be further modified with modified nucleosides and nucleotides, which can be incorporated into modified mRNA compounds containing mRNA sequences as described herein. The phosphate group of the backbone can be modified by substituting one or more oxygen atoms with other substituents. The modified nucleosides and nucleotides may also include the complete substitution of the unmodified phosphate moiety for the modified phosphate described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotryesters. Phosphorothioates have sulfur-substituted non-bonded oxygen atoms on both sides.

[0066] Phosphorate linkers can also be modified by substituting the bound oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate).

[0067] Base modification: Modified nucleosides and nucleotides that can be incorporated into modified mRNA compounds containing mRNA sequences as described herein can be further modified with nucleic acid base moieties. Examples of nucleic acid bases found in mRNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified with major groove faces. In some embodiments, the chemical modification of the major groove may include amino groups, thiol groups, alkyl groups, or halo groups.

[0068] In preferred embodiments of the present invention, the nucleotide analogs / modifications are preferably 2-amino-6-chloropurine riboside-5'-triphosphorate, 2-aminopurine-riboside-5'-triphosphorate; 2-aminoadenosine-5'-triphosphorate, 2'-amino-2'-deoxycytidine-triphosphorate, 2-thiocytidine-5'-triphosphorate, 2-thiouridine-5'-triphosphorate, 2'-fluorothymidine-5'-triphosphorate, 2'-O-methylinosine-5'-triphosphorate, 4-thiouridine- 5'-Triphosphonate, 5-Aminoallylcytidine-5'-Triphosphonate, 5-Aminoallyluridine-5'-Triphosphonate, 5-Bromocytidine-5'-Triphosphonate, 5-Bromouridine-5'-Triphosphonate, 5-Bromo-2'-Deoxycytidine-5'-Triphosphonate, 5-Bromo-2'-Deoxyuridine-5'-Triphosphonate, 5-Iodocytidine-5'-Triphosphonate, 5-Iodo-2'-Deoxycytidine-5'-Triphosphonate, 5-Iodouridine-5'-Triphosphonate, 5-Iodo-2 '-deoxyuridine-5'-triphosphorate, 5-methylcytidine-5'-triphosphorate, 5-methyluridine-5'-triphosphorate, 5-propynyl-2'-deoxycytidine-5'-triphosphorate, 5-propynyl-2'-deoxyuridine-5'-triphosphorate, 6-azacitidine-5'-triphosphorate, 6-azacitidine-5'-triphosphorate, 6-chloropurine riboside-5'-triphosphorate, 7-deazaadenosine-5'-triphosphorate, 7-deazaguanosine-5'-triphosphorate, 8- The base modification is selected from azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, or puromycin-5'-triphosphate, xanthosine-5'-triphosphate.

[0069] Preferably, the nucleotide is selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphorate, 7-deazaguanosine-5'-triphosphorate, 5-bromocytidine-5'-triphosphorate, and pseudouridine-5'-triphosphorate for base modification.

[0070] In some embodiments, the modified nucleoside is pyridine-4-onribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, pseudouridine, 2-thiouridine, 4-thio-pseudridine, 2-thio-pseudridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudridine, 2'-O-methyluridine, 5-methyluridine, 5-propynyluridine, 1-propynyl-pseudridine, 5-taurinomethyluridine, 2-thiouridine, 5-methoxyuridine, 1-taurinomethyl-pseudridine, 5-taurinomethyl-2-thiouridine, 1-taurinomethyl-4-thio-uridine This includes lysine, 5-methyluridine, 1-methylpseuduridine, 4-thio-1-methylpseuduridine, 2-thio-1-methylpseuduridine, 1-methyl-1-deazapseuduridine, 2-thio-1-methyl-1-deazapseuduridine, dihydrouridine, dihydropseuduridine, 2-thio-dihydrouridine, 2-thio-dihydropseuduridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxypseuduridine, and 4-methoxy-2-thiopseuduridine.

[0071] In some embodiments, the modified nucleosides are 5-aza-cytidine, pseudoisocytidine, 3-methylcytidine, 5-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl This includes ru-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebraline, 5-methyl-zebraline, 5-aza-2-thio-zebraline, 2-thio-zebraline, 2-methoxy-cytidine, 2-methoxy-5-methylcytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine.

[0072] In other embodiments, the modified nucleosides are 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentyladenosine This product contains N6-(cis-hydroxyisopentyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxyadenine.

[0073] In other embodiments, the modified nucleosides include inosine, 1-methylinosine, viosine, wibutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-8-aza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methylguanosine, 6-thio-7-methylguanosine, 7-methylinosine, 6-methoxyguanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thioguanosine, N2-methyl-6-thioguanosine, and N2,N2-dimethyl-6-thioguanosine.

[0074] In some embodiments, the nucleotide can be modified at the major groove face, and this may include substitution of a hydrogen atom at C-5 of uracil with a methyl or halo group. In certain embodiments, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine.

[0075] In further embodiments, the modified mRNA may be 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thiouridine, 4-thiouridine, 6-aza-uridine, 5-hydroxyuridine, deoxythymidine, 5-methyluridine, pyrrolo-cytidine, inosine, It may contain nucleoside modifications selected from α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, and 7-deaza-adenosine. In another aspect, the present invention relates to a vaccine composition comprising a synthetic nucleic acid molecule.

[0076] In the present invention, “vaccine” is typically understood to be a preventive or therapeutic substance that provides at least one antigen, preferably an antigenic peptide or protein. “Providing at least one antigen” means, for example, that the vaccine contains an antigen or that the vaccine contains, for example, a molecule encoding an antigen. Therefore, the vaccines of the present invention are particularly expected to include, for example, tumor antigens, bacterial, viral, fungal or protozoan antigens, autoantigens, allergens, or allogeneic antigens, and preferably at least one synthetic nucleic acid (RNA) molecule encoding at least one antigenic (poly-)peptide or protein as defined herein, which, when expressed and presented to the immune system, induces an immune response to the respective antigen. However, synthetic nucleic acid (RNA) molecules encoding non-antigenic (poly-)peptides or proteins of interest may also be used in the vaccines of the present invention. In the present invention, the synthetic nucleic acid molecule may be complexed with one or more lipids to form lipid nanoparticles or liposomes.

[0077] In the present invention, the synthetic nucleic acid (RNA) molecule may be provided in a complexed form, i.e., in a form complexed or associated with one or more (poly-)cationic compounds, preferably (poly-)cationic polymers, (poly-)cationic peptides, or proteins, such as protamine, (poly-)cationic polysaccharides, and / or (poly-)cationic lipids. In this context, the terms “complexed” or “associated” mean, in this context, a combination that is essentially stable as a larger complex or assembly, in which at least one synthetic nucleic acid (RNA) molecule is not covalently bonded with the one or more compounds.

[0078] Lipids In preferred embodiments, the synthetic nucleic acid (RNA) molecule of the present invention is complexed or bound to a lipid (particularly cationic and / or neutral lipid) to form one or more lipid nanoparticles or liposomes. Accordingly, in some embodiments, the synthetic nucleic acid (RNA) molecule of the present invention can be provided in the form of a lipid-based dosage form, particularly in the form of liposomes and / or lipid nanoparticles containing the synthetic nucleic acid (RNA) molecule.

[0079] Lipid nanoparticles According to some preferred embodiments, the synthetic nucleic acid (RNA) molecule of the present invention is complexed or bound with lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles.

[0080] Preferably, the lipid nanoparticles (LNPs) may include: (a) at least one synthetic nucleic acid molecule (RNA) of the present invention, (b) a cationic lipid, (c) an anti-aggregation agent (e.g., polyethylene glycol (PEG) lipid or PEG-modified lipid), (d) selectively a non-cationic lipid (e.g., a neutral lipid), and (e) selectively a sterol.

[0081] In some embodiments, the LNP may contain, in addition to at least one synthetic nucleic acid molecule (RNA) of the present invention, (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, such as cholesterol; and PEG-lipids, in a molar ratio of about 20-60% cationic lipids: 5-25% neutral lipids: 25-55% sterols; and 0.5-15% PEG-lipids.

[0082] In some embodiments, the synthetic nucleic acid molecules (RNA) of the present invention can be formulated into aminoalcohol lipidoids. Aminoalcohol lipidoids that can be used in the present invention can be produced by the method described in U.S. Patent No. 8,450,298, the full text of which is incorporated herein by reference.

[0083] Liposomes In some embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are formulated into liposomes. Cationic lipid-based liposomes can form complexes with negatively charged nucleic acids (e.g., RNA) through electrostatic interactions, producing complexes that offer biocompatibility, low toxicity, and the potential for large-scale production necessary for in vivo clinical applications. The liposomes can fuse with the plasma membrane for absorption; first, within the cell, the liposomes are processed via the phagocytic pathway, and the nucleic acids are subsequently released from the endosome / carrier into the cytoplasm. Liposomes have long been recognized as drug delivery vehicles due to their excellent biocompatibility, as they are essentially analogues of biological membranes and can be produced from both natural and synthetic phospholipids.

[0084] Liposomes typically consist of a lipid bilayer surrounding an aqueous core, which can be composed of cationic, anionic, or neutral (phospho) lipids and cholesterol. Both the lipid bilayer and the aqueous space can contain hydrophobic or hydrophilic compounds, respectively. Liposomes can have one or more lipid membranes. Liposomes can be monolayers called unilamellae or multilayers called multilamellae.

[0085] In vivo, the properties and behavior of liposomes can be modified by applying a hydrophilic polymer coating, such as polyethylene glycol (PEG), to the liposome surface to provide steric stability. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to their surface or to the ends of attached PEG chains.

[0086] Liposomes typically exist as spherical vesicles, and their size can range from 20 nm to several microns. Liposomes may vary in size, but are not limited to these, including multilamellar vesicles (MLVs) with diameters of several hundred nanometers and containing a series of concentric bilayers separated by narrow aqueous compartments, small unicellular vesicles (SUVs) with diameters less than 50 nm, and large unilamellar vesicles (LUVs) with diameters between 50 and 500 nm. Liposome design may include, but are not limited to, opsonins or ligands to improve liposome adhesion to unhealthy tissues or to activate events such as endocytosis. Liposomes may contain low or high pH to enhance the delivery of pharmaceutical dosage forms. In the present invention, the vaccine composition may further comprise one or more adjuvants or activators.

[0087] In its broadest sense, “adjuvant” or “adjuvant component” is typically a pharmacological and / or immunological preparation that can modify, for example, enhance the effects of other activators, such as therapeutic agents or vaccines. In this context, “adjuvant” can be understood as any compound suitable for assisting the administration and delivery of the vaccine composition of the present invention. Specifically, adjuvants can preferably enhance the immunostimulatory properties of the vaccine to which they are added. Furthermore, such adjuvants can initiate or increase the immune response of the innate immune system, i.e., nonspecific immune responses, even if they are not bound to it.

[0088] Adjuvants typically do not induce an adaptive immune response. To date, adjuvants have not qualified as antigens. That is, when administered, the vaccine of the present invention typically initiates an adaptive immune response by antigenic peptides or proteins encoded by at least one coding sequence of synthetic nucleic acid (RNA) molecules contained in the vaccine.

[0089] Suitable adjuvants are known to those skilled in the art and can be selected from any adjuvant suitable in this case, i.e., any adjuvant that helps induce an immune response in mammals, such as TDM, MDP, Muramyl dipeptide, Pluronic®, vitiligo solution, aluminum hydroxide, ADJUMER TM (Polyphosphazene); Aluminum phosphate gel; Glucan from algae; Algamlin; Aluminum hydroxide gel (white spot); High protein-adsorbent aluminum hydroxide gel; Low viscosity aluminum hydroxide gel; AF or SPT (Emulsion of squalane (5%), Tween 80 (0.2%), Pluronic® L121 (1.25%), phosphate-buffered saline, pH 7.4); or AVRIDINE TM (Propanediamines) may be included, but are not limited to, these. In another aspect, the present invention relates to the disease prevention use of the vaccine composition.

[0090] In the present invention, "disease" means an abnormal phenomenon arising from tumor antigens, bacteria, viruses, fungi or protozoan antigens, autoantigens, allergens, or allogeneic antigens, and may include, but is not limited to, cancer, tumors, autoimmune diseases, inflammatory diseases, viral infections, bacterial infections, fungal infections, and protozoan infections. In the present invention, "prevention" means any action that suppresses or delays the progression of a disease by administering the vaccine composition of the present invention. In another aspect, the present invention relates to a method for preventing a disease, comprising the step of administering the vaccine composition. In another aspect, the present invention relates to the use of the vaccine composition for the manufacture of a drug for the prevention of disease. [Examples]

[0091] The present invention will be described in more detail below through examples. It will be obvious to those of ordinary skill in the art that these examples are solely for illustrative purposes and that the scope of the present invention should not be construed as being limited by these examples.

[0092] Example 1. Selection of 5'-UTR After constructing all possible 30bp 5'-UTR polynucleotide combinations, sequences with an average free energy of 0 that do not form specific structures such as secondary structures were selected, sequences beginning with an AGG sequence were selected for capping and improved transcription, some sequences were further removed as AUG-like sequences, and sequences containing UUU and UUUU motifs were removed because immunosensing of TLR7 / 8 by uridine-rich elements reduces protein translation efficiency. Uridine depletion was performed to remove 15% of uridine from the entire sequence to increase protein translation efficiency, and 5'-UTRs containing CGC sequences were removed to improve mRNA stability, resulting in a total of 33 selected 5'-UTR sequences (Figure 1).

[0093] Example 2. Production of 5'-UTR-containing mRNA synthetic nucleic acid 2-1. Linearization for template DNA production Linearize using a restriction enzyme that cuts the part behind the polyA site from the plasmid. Isolate the linearized DNA using AMICON. After this, confirm whether the plasmid DNA has been cut on a 1% agarose gel.

[0094] 2-2. In vitro transfer In vitro transcription is the process of synthesizing mRNA.

[0095] Together with the prepared template DNA, react at 37°C for 4 hours (hr) with T7 RNA polymerase, buffer, NTPs (including natural and chemically modified ones), and other necessary elements for IVT as shown in Table 2 (HiScribe TM T7 Quick High Yield RNA Synthesis Kit, NEB E2050S, US).

Table 2

[0096] When the reaction is complete, treat with 1 U of Dnase I per 1 μg of DNA, react at 37°C for 15 - 30 minutes (min), and remove the template DNA. After this, the completed IVT product is purified using Invitrogen's MEGAclear TM Kit (Austin, Tex.) according to the method presented by the manufacturer. After this, quantify the purified mRNA by nanodrop or UV / Vis absorption, and confirm the band pattern on an agarose gel.

[0097] 2-3. DsRNA purification Remove the double-stranded RNA (dsRNA) generated during the IVT reaction using cellulose. Cellulose pre-wash: Dissolve 0.2 g of cellulose per 1 ml of buffer A in a 50 ml tube, and then prepare a bench-top scale cellulose column. The compositions of buffer A and B are as shown in Table 3 below. [Table 3]

[0098] IVT mRNA loading: The IVT mRNA dissolved in 500 μl of buffer A is placed into the column prepared above. Use a rotator to ensure that cellulose and dsRNA bind, and allow the reaction to proceed at room temperature for 30 minutes. Centrifuge at 14,000g for 1 minute, collect the flow-through, and transfer it to a new column. After reacting again at room temperature for 30 minutes, the mixture is centrifuged under the same conditions and the flow-through is collected. mRNA precipitation: The pellets are recovered from the liquid using the isopropanol precipitation method and then dissolved in nuclease-free water.

[0099] Example 3. Confirmation of the purity of the prepared mRNA. 3-1. IP-RP UPLC To confirm the purity of the mRNA, analysis is performed using reverse-phase chromatography columns such as C18 and C8. During analysis, aqueous buffers containing alkylammonium acetate series ion-pairing additives including TEAA (e.g., TBAA, TPAA, DMBAA, HAA, etc.) and ACN-based buffers are used as the mobile phases for chromatography. Organic solvents such as acetonitrile and methanol are used for column washing and storage. A buffer with a high water content is used for weak washing, while a buffer containing 10-50% organic solvent is used for strong washing and sealing.

[0100] Connect the aqueous buffer containing TEAA to pump A, and the ACN-based buffer containing TEAA to pump B, then perform the initial priming process. Connect the column to the instrument and flow more than 5 CV through the column under the initial gradient conditions to maintain equilibrium. Confirm that the Δpsi value stabilizes during equilibrium. mRNA is injected, and the analysis reflects a gradient in which the organic solvent ratio increases from the initial stage. After the analysis is complete, run the column through an organic solvent such as acetonitrile and methanol for at least 10 CV for column washing and storage.

[0101] 3-2. Dot blot Dot blotting is performed to qualitatively identify impurities such as double-stranded RNA (dsRNA). As a probe, the J2 antibody is used to bind to these dsRNAs and to confirm their presence or absence. Add the IVT mRNA to be analyzed to a positively charged nylon membrane (Merck / 11417240001) in a 2 μL volume at a concentration of 100-200 ng / μL, and allow to dry completely at room temperature for at least 1 hour. Using a UV crosslinker, 1250 uJ / CM 2 After crosslinking the sample to the membrane under one cycle conditions, react it with a 4% skim milk (in 1X TBST) blocking solution in a room temperature shaker for 1 hour. Dilute the J2 primary antibody in blocking solution at a ratio of 1:5000 and allow it to react overnight at 4°C using a shaker.

[0102] Next, the mixture is washed three times for 10 minutes with 1X TBST solution in a room temperature shaker. Then, the horseradish peroxidase (HRP)-bound goat anti-mouse (IgG) secondary antibody is diluted 1:5000 in blocking solution and reacted in a room temperature shaker for 1 hour. Afterward, the samples were washed three times for 10 minutes each with 1X TBST solution using a room temperature shaker. The ECL reagents 1 and 2 were mixed in a 1:1 (v / v) ratio to moisten the membrane, exposed it to light for 10 seconds, and then the bands were visualized using a Chemi Doc instrument.

[0103] Example 4. Confirmation of the translation efficiency of the manufactured mRNA. The translation efficiency of the manufactured mRNA is evaluated by measuring its luciferase activity. Human fetal kidney HEK293T (human kidney embryonic cell line, ATCC CRL-3216) and HeLa (human cervix epitherlial cell, CCL2) cells were cultured in DMEM / Dulbecc's modified Eagle medium with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin, while Huh7 (human liver cancer cell line, Korea cell line bank, 60104) and SNU423 (human liver cancer cell line, Korea cell line bank, 00423) cells were cultured in RPMI-1640 (Gibco) with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. 250 ng of mRNA is transfected into a 12-well plate using lipofectamine 3000 (Invitrogen, Carlsbad, Calif).

[0104] As a control group, 1. Human α-globin A (sequence modified from WO2020 / 198337): AGTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC (Sequence ID 34) 2. Cytochrome b-245α chain CYBA (WO2020 / 198337): AGTGCGCGCCTAGCAGTGTCCCAGCCGGGTTCGTGTCGCC (Sequence No. 35) 3. Ref UTR no.1(US2020 / 0208145): AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC (Sequence No. 36) 4. Ref UTR no.2(US2020 / 0208145): GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC (Sequence No. 37) etc. were used.

[0105] Add 20 μL of Bright-glo luciferase assay reagent to a transfected 96-well plate, incubate at room temperature for 10 minutes, and then shake the 96-well plate for 1 minute. After setting the integration time of the GloMax Navigator Luminometer to 0.3 s, measure the luciferase activity of the prepared plate.

[0106] After dispensing 20 μL of the Dual-glo kit stop glo luciferase assay reagent onto the plate being measured, incubate at room temperature for 10 minutes, then shake the plate for 1 minute. Luciferase activity is measured using a GloMax Navigator Luminometer.

[0107] As a result, as shown in Figures 4 and 5, it was confirmed that the translation efficiency of mRNA containing the UTR of the present invention was significantly superior in all cell lines compared to the control group.

[0108] Although specific parts of the present invention have been described in detail above, it will be clear to those with ordinary skill in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Therefore, the substantial scope of the invention is defined by the appended claims and their equivalents. [Industrial applicability]

[0109] The 5'-UTR polynucleotide according to the present invention has improved translation efficiency and can effectively induce the expression of target proteins, making it useful for various RNA-based applications, such as vaccines and in vivo / ex vivo gene therapies.

Claims

1. An isolated 5'-UTR (untranslated region) polynucleotide containing a nucleotide sequence represented by one of the nucleotide sequences shown in SEQ ID NOs: 1 to 33.

2. From 5' to 3', a) 5'-CAP structure; b) The 5'-UTR polynucleotide according to claim 1; c) One or more coding areas; d) 3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like arrays; A synthetic nucleic acid molecule containing, The aforementioned poly(A)tail-like sequence is characterized in that one or more nucleotides other than adenine, selected from the group consisting of uracil (U), cytosine (C), and guanine (G), are inserted between multiple adenines or at the poly(A)tail end, making it a synthetic nucleic acid molecule.

3. The aforementioned 5'-CAP structure is m 7 GpppA m pG, m 7 The synthetic nucleic acid molecule according to claim 2, characterized in that it is selected from the group consisting of GpppApG and m7,3'OmeApppG.

4. The synthetic nucleic acid molecule according to claim 2, characterized in that the coding region encodes one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, variants, or derivatives of said proteins.

5. The synthetic nucleic acid molecule according to claim 4, characterized in that the antigenic protein is one or more selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, alloantigens, and allergic antigens.

6. The synthetic nucleic acid molecule according to claim 5, characterized in that the tumor antigen is selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, α-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, Survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, Mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1.

7. The synthetic nucleic acid molecule according to claim 5, characterized in that the pathogenic antigen is selected from the group consisting of bacteria, viruses, fungi, and protist antigens.

8. The synthetic nucleic acid molecule according to claim 7, characterized in that the virus is a coronavirus.

9. The synthetic nucleic acid molecule according to claim 2, characterized in that the synthetic nucleic acid molecule is RNA.

10. The synthetic nucleic acid molecule according to claim 9, characterized in that the RNA is selected from the group consisting of mRNA, viral RNA, self-replicating RNA, and replicon RNA.

11. The synthetic nucleic acid molecule according to claim 2, characterized in that the synthetic nucleic acid molecule comprises one or more backbone-modified, sugar-modified, or base-modified nucleic acids.

12. The synthetic nucleic acid molecule according to claim 2, characterized in that the 3'-UTR is selected from the group consisting of β-globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 α1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; β-subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; and β-F1-ATPase 3'UTR.

13. A vaccine composition comprising a synthetic nucleic acid molecule according to any one of claims 2 to 12.

14. The vaccine composition according to claim 13, characterized in that the synthetic nucleic acid molecule is complexed with one or more lipids to form one or more lipid nanoparticles or liposomes.

15. The vaccine composition according to claim 13, characterized in that it further comprises one or more adjuvants.

Citation Information

Patent Citations

  • Utrs increasing the translation efficiency of RNA molecules

    EP3112469A1

  • Artificial nucleic acid molecules comprising a 5'top utr

    US20150050302A1

  • High level expression of recombinant human erythropoietin having a modified 5′-UTR

    US7423139B2

  • Artificial nucleic acid molecules

    WO2016107877A1