Genetically modified living bacteria and methods for constructing them

Genetically engineered bacteria with controlled lifespan and effector genes address safety and efficacy challenges, providing effective treatment with reduced risk of mutation and improved safety.

JP7836794B2Active Publication Date: 2026-03-27NEW PORTAL LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-07-05
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

There is a high need for genetically modified bacteria that are effective in treating diseases while ensuring biological safety, as existing bacteria used for medical purposes face challenges in efficacy and safety.

Method used

Genetically engineered bacteria with a short lifespan are developed, allowing them to survive long enough to exert a medical effect and then die to minimize onset mechanisms, using effector genes and genetic modifications such as deletions or mutations to control their survival time.

Benefits of technology

The short-lived bacteria maintain effector molecule integrity and functionality, achieving therapeutic efficacy with reduced risk of mutation and improved safety, effective in treating conditions like cancer with minimal side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007836794000010
    Figure 0007836794000010
  • Figure 0007836794000011
    Figure 0007836794000011
  • Figure 0007836794000012
    Figure 0007836794000012
Patent Text Reader

Abstract

The present invention relates to a genetically engineered, live bacterium comprising at least one effector gene encoding a medical effector and at least one genetic modification that shortens the lifespan of the bacterium. After administration to a subject, the bacterium survives for a sufficient time to allow the medical effector to exert at least one medical effect and dies for a sufficient time to minimize pathogenic mechanisms in the subject. The bacterium provides an effective treatment for disease or amelioration of a condition while ensuring biosafety for medical use.
Need to check novelty before this filing date? Find Prior Art

Description

Sequence listing reference

[0001] This application includes a computer-readable sequence listing, which is incorporated herein by reference in its entirety. [Technical Field]

[0002] The present invention relates to genetically modified living bacteria and methods for constructing them. In particular, the present invention relates to providing genetically modified living bacteria that can effectively treat and / or prevent diseases or medical conditions. [Background technology]

[0003] Naturally occurring or artificially modified bacteria have been used as vaccines or drugs for various diseases, including infectious diseases and, more recently, cancer. Beyond efficacy, safety is the most crucial issue when using bacteria for medical purposes. Therefore, much effort has been made to genetically modify bacteria to either kill target bacteria or to give them the ability to preferentially or selectively proliferate within lesions.

[0004] There is a high need for novel bacteria that are effective in treating diseases or improving patient symptoms, while ensuring biological safety. [Overview of the project]

[0005] In light of the above background, the objective is to provide alternative bacteria in several exemplary embodiments to overcome at least one of the shortcomings of the prior art.

[0006] In one aspect, there is provided a genetically engineered, living bacterium, said genetically engineered, living bacterium comprising at least one effector gene encoding a medical effector and at least one genetic modification that, by shortening the lifespan of the bacterium, enables the bacterium to survive within a time sufficient for the medical effector to exert at least one medical effect after being administered to a subject and to die within a time sufficient to minimize the onset mechanism to the subject. In some embodiments, the bacterium is derived from a virulent strain.

[0007] In some exemplary embodiments, the medical effector is an antigen capable of inducing at least one immune response sufficient to treat a target disease or condition in a subject.

[0008] In some exemplary embodiments, the medical effector is a therapeutic agent capable of inducing at least one immune response and / or reducing the size of a target lesion in a subject to a sufficient extent to treat a target disease or condition.

[0009] In some exemplary embodiments, the immune response is induced by CD4+ and / or CD8+ T cells.

[0010] In some exemplary embodiments, the medical effector is an antigen or a therapeutic agent expressed from a homologous gene of the bacterium.

[0011] In some exemplary embodiments, the medical effector is an antigen or a therapeutic agent expressed from a heterologous gene.

[0012] In some exemplary embodiments, the heterologous gene further comprises a leader sequence and / or a terminator region that improves heterologous expression in the bacterium.

[0013] In some exemplary embodiments, the therapeutic agent is a cytotoxin that causes cell lysis in a target lesion.

[0014] In some exemplary embodiments, the target disease or condition is cancer or tumor, and the medical effector induces tumor suppression or lysis in the subject.

[0015] In some exemplary cases, the time required to minimize the onset mechanism is less than 48 hours.

[0016] In some exemplary cases, bacteria are unable to copy or colonize within the subject.

[0017] In some exemplary cases, the genetic modification is the deletion or mutation of at least one essential gene or nutrient requirement gene from the bacterial chromosome.

[0018] In some exemplary examples, bacteria are nutrient requirements for diaminopimelic acid.

[0019] In some exemplary cases, the genetic modification involves the deletion of aspartate-semialdehyde dehydrogenase (ASD) from the bacterial chromosome.

[0020] In some exemplary embodiments, the bacteria have a survival time that can be controlled by exposure of the bacteria to one or more modulating effectors that regulate the survival time of the bacteria when administered in vivo.

[0021] In some exemplary embodiments, the regulating effector is diaminopimelic acid.

[0022] In several exemplary cases, the medical effector is a homologous peptide expressed by a gene selected from the group consisting of chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks islands.

[0023] In some exemplary embodiments, the medical effector is a cytotoxin selected from the group consisting of exolysin A (ExlA) from Pseudomonas aeruginosa, nonhemolytic enterotoxin (Nhe) from Bacillus cereus, hemolysin, vacuolated toxin from Helicobacter pylori, and combinations thereof.

[0024] In some exemplary cases, the medical effector is an anti-cancer factor selected from the group consisting of CpGs, cyclic dinucleotides, and tumor antigens.

[0025] In some exemplary examples, the bacteria are derived from the genera Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0026] In some exemplary cases, the bacterial strain is derived from Escherichia coli.

[0027] In some exemplary cases, the bacteria are derived from strain SH3, deposit number 19836, deposited with the China General Microbiological Culture Collection Center (CGMCC).

[0028] In some exemplary examples, the bacteria express a sequence that has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0029] In some exemplary cases, the bacteria are derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0030] In some exemplary embodiments, the bacteria are administered intravenously. In some exemplary embodiments, the bacteria are formulated for intravenous administration.

[0031] In several exemplary cases, the time required to minimize the onset mechanism after intravenous administration is less than 48 hours.

[0032] In some exemplary embodiments, the bacteria are administered topically. In some exemplary embodiments, the bacteria are formulated for topical administration.

[0033] In some exemplary cases, when administered locally at the injection site, the bacteria survive at the injection site for up to 5 days, but are killed within 48 hours elsewhere. In some examples, the bacteria are removed from normal tissues and organs.

[0034] In some exemplary cases, the bacteria measured 7.5 × 10⁻⁶ 9 The bacteria are administered at an equivalent dose of cfu / kg for mice. In some exemplary examples, the bacteria were 7.5 × 10⁻⁶. 9 It is administered intravenously at an equivalent dose of cfu / kg for mice.

[0035] In some exemplary cases, the disease is cancer or a tumor, and the bacteria are administered intratumorally.

[0036] In some exemplary cases, bacteria are found in tumors of 1 gram (approximately 100-200 mm). 3 ) 5 x 10 8 The bacteria are administered intratumorally in an equivalent dose of CFU. In some exemplary cases, the bacteria are distributed in a 1 gram (approximately 100-200 mm) dose to the tumor. 3 ) 4 x 10 9The bacteria are administered intratumorally in an equivalent dose of CFU. In some exemplary cases, the bacteria are distributed in a 1 gram (approximately 100-200 mm) dose to the tumor. 3 ) at least 5 x 10 8 It is administered intratumorally at an equivalent dose of CFU.

[0037] In another embodiment, a living bacterium of the genus Escherichia coli is provided, wherein the living bacterium contains a gene deletion of aspartic acid semialdehyde dehydrogenase (ASD) in the bacterial chromosome, and the bacterium is derived from a toxic strain.

[0038] In some exemplary cases, bacteria express at least one effector gene that encodes a medical effector.

[0039] In some exemplary cases, the bacteria are derived from strain SH3, deposit number 19836, deposited with the China General Microbiological Culture Collection Center (CGMCC).

[0040] In some exemplary cases, the bacteria further include the gene encoding exolysin A (ExlA) of Pseudomonas erginosa.

[0041] In some exemplary examples, the gene has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0042] In some exemplary cases, the bacteria are derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0043] In another embodiment, an immunogenic composition comprising the bacteria described in any one of the prior claims was provided.

[0044] In another embodiment, a live bacterial vaccine was provided comprising the bacteria described in any one of the exemplary embodiments and an optional adjuvant.

[0045] In another embodiment, a method for treating a disease or medical condition was provided, comprising administering to a subject a composition containing a bacterial bacterium described in any one of the exemplary examples in an effective amount.

[0046] In some exemplary cases, the disease is a tumor or cancer.

[0047] In another embodiment, a method is provided for constructing a genetically engineered, living bacterium, the method comprising the step of genetically engineering the bacterium to shorten its lifespan so that the bacterium survives for a sufficient time after administration to a subject to enable a medical effector to produce at least one medical effect, and dies for a sufficient time to minimize the mechanism of disease development in the subject, wherein the bacterium is derived from a toxic strain.

[0048] In some exemplary embodiments, the method further includes the step of genetically engineering the bacteria to express at least one medical effector.

[0049] This specification also discusses other exemplary embodiments.

[0050] The contents of this disclosure have many advantages. In some embodiments, the provided bacteria are living bacteria in vivo in the subject, thus ensuring medical efficacy by maintaining the integrity and functionality of their effector molecules.

[0051] In some exemplary cases, short-lived bacteria are superior to killed or inactivated bacteria because they can survive in the body for a certain period after administration, thus achieving better medical effects.

[0052] In some embodiments, the provided bacteria are derived from toxic or pathogenic strains and retain all or at least some of their toxic factors for use as medical effectors, resulting in treatment efficacy far superior to that of non-pathogenic strains. Many antigens and toxic factors of these toxic strains offer various treatment possibilities, such as inducing immunity against disease or directly killing cancer cells. In some embodiments, small amounts of short-lived bacteria, administered intratumor or intravenously, are sufficient to effectively suppress tumor progression or cure tumors.

[0053] In several examples, the short lifespan of the provided bacteria minimized the potential risk of gene mutations and ensured biosafety for medical use.

[0054] In some embodiments, the provided bacteria have a short lifespan and high immunogenicity and therapeutic efficacy, allowing them to achieve sufficient therapeutic effects even when administered intravenously. In some embodiments, small amounts of short-lived bacteria administered intravenously or systemically are sufficient to achieve adequate tumor suppression. The bacteria do not need to be designed to specifically target targets such as tumors or to colonize such targets, nor do they need to be limited to local or intratumor administration, yet they can still achieve good efficacy in treating diseases.

[0055] In some examples, short-lived bacteria do not readily mutate to lose their short-lived survival characteristics, while lesion-specific bacteria readily mutate to lose their lesion-targeting ability; therefore, short-lived bacteria are superior to genetically modified lesion-specific bacteria.

[0056] In some embodiments, short-lived bacteria may be used as vectors or media for vaccines or therapeutic agents to treat or prevent various diseases or to improve certain medical conditions. In some embodiments, short-lived bacteria may be used for diagnostic purposes. [Brief explanation of the drawing]

[0057] [Figure 1A] The number of viable cells of short-lived bacteria grown in vitro in LB medium for 0, 24, and 48 hours, as in exemplary examples, is shown. [Figure 1B] The number of viable cells of short-lived bacteria grown in vitro for 0, 24, and 48 hours in LB medium supplemented with diaminopimelic acid (DAP) is shown in exemplary examples. [Figure 1C] The number of viable cells of short-lived bacteria ex vivo grown for 0, 24, and 48 hours in a homogenized mixed organ suspension is shown in exemplary examples. [Figure 1D] The number of viable cells of short-lived bacteria after subcutaneous injection into mice, as in exemplary cases, is shown for days 1, 2, 5, and 11. [Figure 2A] The killing rates of the short-lived bacterium mp107 and the control strain MG1655 against mouse Lewis lung cancer cell lines (LLC) are shown in exemplary examples. [Figure 2B] The killing rates of the short-lived bacterium mp107 and the control strain MG1655 against human lung cancer cell lineage (A549) in exemplary cases are shown. [Figure 2C] Exemplary examples demonstrate the suppression of mouse tumor volume by intratumor (it) injection of the control strain MG1655, the short-lived bacterium SH3, and the short-lived bacterium mp107 expressing ExlA (using two different doses). (*P<0.05, ***P<0.001). Error bars, SEM. [Figure 3A] Exemplary examples demonstrate the suppression of mouse lung cancer by intravenous (iv) injection of PBS and the short-lived bacterium mp107 expressing ExlA (at a dose of 7.5 × 10⁹ cfu / kg of mice). (***P<0.001). Error bars, SEM. [Figure 3B] Flow cytometry results for the percentage of CD4+ T cells in mouse tumors treated with mp107 or the control strain MG1655, as in an exemplary example, are shown (***P<0.001). Error bars, SEM. [Figure 3C] Flow cytometry results for the percentage of CD8+ T cells in mouse tumors treated with mp107 or the control strain MG1655, as in an exemplary example, are shown. (***P<0.001). Error bars, SEM. [Figure 4] This is a schematic chart of plasmid pExlA according to an exemplary example. [Figure 5] This is a schematic chart of plasmid pExlA2 according to an exemplary example. [Figure 6A] The hemolysis analysis of Escherichia coli strains SH3 and SH4 in exemplary cases is shown. [Figure 6B] The hemolysis analysis of the E. coli control strains MG1655 and MG1655 / pExlA2 using exemplary examples is shown. [Figure 7] The percentage of mouse weight loss after intravenous injection of mp105, mp106, or mp107 at a dose of 2 × 10⁸ cfu / mouse, as in exemplary examples, is shown. PBS is used as a negative control. Error bars, SEM. [Figure 8] Exemplary examples show increased tumor volume (mm3) in mice carrying subcutaneous LLC tumors after intravenous injection of mp105, mp106, or mp107. PBS is used as a negative control. Error bars, SEM. [Figure 9] Exemplary examples show increased tumor volume (mm3) in mice carrying subcutaneous LLC tumors administered intravenously with mp105 (iv) or a combination of intravenous and intratumor injection of mp105 (iv+it). PBS was used as a negative control. Error bars, SEM. [Figure 10A] This example demonstrates the quantitative determination of Salmonella typhimurium in the liver 14 days after subcutaneous injection of either mp105 (at a dose of 1 × 10⁸ cfu / mouse) or PBS. Bacteria in organs are quantified by counting colony-forming units and verified by colony PCR. [Figure 10B]This example demonstrates the quantitative determination of Salmonella typhimurium in the lungs 14 days after subcutaneous injection of either mp105 (at a dose of 1 × 10⁸ cfu / mouse) or PBS. Bacteria in organs are quantified by counting colony-forming units and verified by colony PCR.

[0058] microbial storage Bacterial strain SH2 was deposited on June 10, 2021, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 22685. Bacterial strain SH3 was deposited on May 18, 2020, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 19836. Bacterial strain mp107 was deposited on May 18, 2020, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 19835. Bacterial strain SH4 was deposited on May 18, 2021, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 22557. Bacterial strain mp105 was deposited on May 18, 2021, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 22555. Bacterial strain mp106 was deposited on May 18, 2021, at the China Center for the Preservation and Management of Common Microorganisms and Species (CGMCC) at No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with deposit number 22556. The China Center for the Preservation and Management of Common Microbial Species (CGMCC) is recognized as an international depositary organization under the provisions of the Budapest Convention. [Modes for carrying out the invention]

[0059] As used in this specification and claims, “comprising” means including the following elements but not excluding other elements:

[0060] As used herein and in the claims, the singular forms “a / an” and “the” refer to multiple subjects unless the context explicitly indicates otherwise. For example, as used herein, “a gene” means one or more genes which may be the same or different.

[0061] As used herein, the term “about” is understood to mean within the normal tolerances of the art and not exceeding ±10% of a specified value. For example, “about 50” means between 45 and 55, including all values ​​in that range. As used herein, the phrase “about” a specific value also includes the said specific value; for example, “about 50” includes 50.

[0062] As used herein and in claims, “immunogenic composition” is a composition that effectively induces an immune (immunological) response to a disease or condition (e.g., in an appropriate form and amount). In some examples, the immunogenic composition is a vaccine that effectively prevents cancer or tumor.

[0063] As used herein and in the claims, “effective amount” means an amount that effectively delivers at least a measurable amount of the desired effect. For example, such an amount can effectively induce an immune response and / or it can effectively induce a protective response against a pathogen carrying the target polypeptide. In some examples, such an amount can effectively induce an immune response against cancer or tumors.

[0064] As used herein and in the claims, “subject” refers to animals such as mammals, including but not limited to primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, and the like.

[0065] As used herein and in the claims, a bacterial “pathogenesis” is one or more biological mechanisms that cause a diseased state in a host or subject.

[0066] As used herein and in the claims, a “non-toxic” strain (e.g., non-invasive, commensal, or mutually beneficial) is a strain that does not cause disease or have harmful pathogenic effects in a subject. Such bacteria may be naturally occurring bacteria, GRAS (“recognized as safe”) bacteria, or probiotics. In another embodiment, a “toxic” strain has at least one toxic factor, may cause disease or have harmful pathogenic effects in a subject, and is not generally considered safe.

[0067] In some exemplary examples, “toxic” strains may be genetically modified so that they do not cause disease or have harmful pathogenic effects on subjects or hosts, even if they possess or have some additional toxic factors.

[0068] "Toxic factors" are molecules produced by bacteria that can enhance the ability of bacteria to damage a host or cells within a host (e.g., tumors within a host). Examples of toxic factors include cytotoxins, toxins, hemolysins, proteases, destructive enzymes, and factors that aid in bacterial colonization, cell entry and exit, and nutrient acquisition.

[0069] As used herein, the terms “treat,” “treating,” or “treatment” include methods for preventing, eliminating, or relieving symptoms of a disease or condition, preventing another symptom, relieving or preventing the underlying metabolic cause of a symptom, suppressing a disease or condition, preventing the onset of a disease or condition, reducing a disease or condition, causing regression of a disease or condition, reducing a condition caused by a disease or condition, or terminating the symptoms of a disease or condition.

[0070] As used herein and in the claims, “short-lived” bacteria or bacteria having a “short lifespan” refer to bacteria that survive for only a short period, e.g., a few hours (e.g., 1 to 3 hours) to a few days (e.g., 1 to 3 days), after being administered in vivo to a subject, depending on the number of bacteria administered and the method of administration. In some examples, the “short-lived” bacteria are unable to copy in vivo or colonize in the subject after administration.

[0071] As used herein and in the claims, "death" of a bacterium means that the life of the bacterium is permanently ceased.

[0072] As used herein and in the claims, “attenuated” bacteria refer to bacteria that have reduced toxicity or infectivity compared to the parent form or strain.

[0073] As used herein and in the claims, “medical effector” means an agent that produces at least one medical effect on a disease or condition. Examples of medical effectors include, but are not limited to, therapeutic factors, antigens, peptides and cytotoxins.

[0074] As used herein and in the claims, “to produce a medical effect” on a subject’s disease or condition means to cause a biological change that treats the subject’s disease or condition. Examples of medical effects include, but are not limited to, inducing an immune response, inducing cell lysis within a diseased lesion, inhibiting a biological pathway, binding to a receptor, inhibiting a receptor, inhibiting a target cell or cellular process in vivo, and inhibiting or reducing the production of one or more factors that cause or maintain a disease or condition. Cellular processes include, but are not limited to, DNA copying, RNA translation, cell division, and maintenance of cellular homeostasis.

[0075] In some exemplary cases, it is extremely necessary to develop novel bacteria that possess the advantages of both killed and living bacteria, while avoiding the disadvantages of each.

[0076] In some exemplary embodiments, the provided bacteria are short-lived bacteria. When short-lived bacteria are administered in vivo, they survive for a timescale of several hours. The lifespan of short-lived bacteria can be artificially altered by supplementing the bacterial suspension with specific compounds or molecules. Because the short-lived bacteria are alive at the time of administration, the effector molecules they produce maintain their integrity and functionality. Since the short-lived bacteria die in the body within hours or days after administration, the mechanism of disease onset is minimized.

[0077] In several exemplary examples, drug compositions containing genetically modified bacteria were provided.

[0078] In some exemplary cases, short-lived bacteria can be produced by deleting one or more essential genes. Alternatively, the bacterial trophoblast can be genetically constructed by mutations or deletions of relevant trophoblastic genes. The resulting mutant bacteria may have altered, relatively short lifespans. Some of these mutant bacteria may die rapidly in the body, depending on the nutrients in the growth environment to which they are administered. If the growth environment contains residual amounts of nutrients or compounds necessary for the bacteria to survive temporarily, the bacteria may survive for longer periods.

[0079] Numbered Examples - Set 1 1. A genetically modified, living bacterium, At least one effector gene that codes for at least one medical effector, The bacteria include at least one genetic modification that shortens the lifespan of the bacteria such that, after being administered to a subject, the bacteria survive for a sufficient time to allow the medical effector to produce at least one medical effect, and die within a sufficient time to minimize the mechanism of disease development in the subject. Here, the bacteria in question are genetically modified, living bacteria derived from a toxic strain.

[0080] 2. The bacterium according to Example 1, wherein the medical effector is an antigen capable of inducing at least one immune response sufficient to treat the target disease or condition in the subject.

[0081] 3. The bacterium according to Example 1, wherein the medical effector is a therapeutic factor capable of inducing at least one immune response and / or reducing the size of a target lesion in the subject to a degree sufficient to treat the target disease or condition.

[0082] 4. The bacterium described in Example 2 or 3, wherein the immune response is induced by CD4+ and / or CD8+ T cells.

[0083] 5. The bacterium described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a homologous gene of the bacterium.

[0084] 6. The bacterium described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a heterologous gene.

[0085] 7. The bacterium according to Example 6, wherein the heterologous gene further comprises a leader sequence and / or terminator region that improves heterologous expression in the bacterium.

[0086] 8. The bacterium according to Example 3 or 6, wherein the therapeutic factor is a cytotoxin that causes cell lysis in the target lesion.

[0087] 9. The subject disease or condition is cancer or tumor, and the medical effector is the bacterium described in Example 2 or 3 that causes tumor suppression in the subject.

[0088] 10. The bacteria described in Example 1, wherein the bacteria cannot copy or colonize within the subject.

[0089] 11. The bacterium according to Example 1, wherein the gene modification is a deletion or mutation of at least one essential gene or nutrient requirement gene from the chromosome of the bacterium.

[0090] 12. The bacterium is a nutrient requirement for diaminopimelic acid, as described in any one of the prior examples.

[0091] 13. The bacterium according to any one of the prior examples, wherein the gene modification is the deletion of aspartate semialdehyde dehydrogenase (ASD) from the chromosome of the bacterium.

[0092] 14. The bacteria according to any one of the prior examples, wherein the bacteria have a survival time that can be controlled by exposure of the bacteria to one or more modulating effectors, the modulating effectors modulate the survival time of the bacteria when administered in vivo.

[0093] 15. The bacterium described in Example 14, wherein the modulating effector is diaminopimeric acid.

[0094] 16. The bacterium according to any one of the prior examples, wherein the medical effector is a homologous peptide expressed by a gene selected from the group consisting of chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks island.

[0095] 17. The bacterium described in any one of the prior examples, wherein the medical effector is a cytotoxin selected from the group consisting of exolysin A (ExlA) of Pseudomonas aeruginosa, nonhemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, vacuolated toxin of Helicobacter pylori, and combinations thereof.

[0096] 18. The bacterium according to any one of the prior examples, wherein the medical effector is an anticancer factor selected from the group consisting of CpG, cyclic dinucleotides, and tumor antigens.

[0097] 19. The bacteria described in any one of the prior examples are derived from the genera Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0098] 20. The bacteria described in any one of the prior examples, wherein the bacteria are derived from Escherichia coli.

[0099] 21. The bacterium described in any one of the prior examples is derived from strain SH3, deposit number 19836, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0100] 22. The bacterium according to any one of the prior examples, wherein the bacterium expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0101] 23. The bacterium described in any one of the prior examples, derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0102] 24. The bacteria described above are the bacteria described in any one of the prior examples, formulated for intravenous administration.

[0103] 25. The bacterium according to any one of the preceding embodiments, wherein when administered intravenously, a time sufficient to minimize the mechanism of onset is less than a day or 48 hours.

[0104] 26. The bacterium according to any one of the preceding embodiments, which is formulated for topical administration.

[0105] 27. The bacterium according to any one of the preceding embodiments, which survives for a maximum of 5 days at the injection site when topically administered at the injection site, but dies within 48 hours outside the injection site.

[0106] 28. The bacterium according to Example 24, which is administered at an equivalent dose of 7.5×10 9 cfu / kg mouse.

[0107] 29. The bacterium according to any one of the preceding embodiments, wherein the disease is cancer or a tumor, and the bacterium is administered into the tumor.

[0108] 30. The bacterium according to Example 29, which is administered at an equivalent dose of at least 5×10 8 cfu per gram of tumor at about 100 - 200 mm 3 .

[0109] 31. A live bacterium of the genus Escherichia coli, wherein the live bacterium contains a gene deletion in the chromosome of the bacterium of aspartate-semialdehyde dehydrogenase (asd), wherein the bacterium is derived from a virulent strain.

[0110] 32. The bacterium according to Example 31, which expresses at least one effector gene encoding a medical effector.

[0111] 33. The bacterium according to Example 31, which is derived from the strain SH3 with the deposit number 19836 deposited at the China General Microbiological Culture Collection Center (CGMCC).

[0112] 34. The bacterium described in Example 31, further comprising the gene encoding exolysin A (ExlA) of Pseudomonas erginosa.

[0113] 35. The bacterium according to Example 34, wherein the gene has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0114] 36. The bacterium described in Example 31 is derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0115] 37. An immunogenic composition comprising the bacteria described in any one of the prior examples.

[0116] 38. A live bacterial vaccine comprising the bacteria described in any one of the prior examples and an optional adjuvant.

[0117] 39. A method for treating a disease or medical condition, comprising administering to a subject a composition containing a bacterial bacterium described in any one of the prior examples in an effective amount.

[0118] 40. The method according to Example 39, wherein the disease is a tumor or cancer.

[0119] 41. A method for constructing genetically modified, living bacteria, A method comprising the step of genetically modifying a bacterium to shorten its lifespan so that, after administration to a subject, the bacterium survives for a sufficient time to allow a medical effector to produce at least one medical effect and dies for a sufficient time to minimize the mechanism of disease development in the subject, wherein the bacterium is derived from a toxic strain.

[0120] 42. The method according to Example 41, further comprising the step of genetically engineering the bacteria to express at least one medical effector.

[0121] Numbered Examples - Set 2 1. A genetically modified, living bacterium, At least one effector gene that codes for at least one medical effector, The invention includes at least one genetic modification that shortens the lifespan of the bacteria so that the living bacteria survive for a sufficient amount of time after being administered to a subject to enable the medical effector to produce at least one medical effect, and die after a time that minimizes the mechanism of disease development in the subject. Here, the bacteria in question are genetically modified, living bacteria derived from a toxic strain.

[0122] 2. The bacterium according to Example 1, wherein the medical effector is an antigen capable of inducing at least one immune response sufficient to treat the target disease or condition in the subject.

[0123] 3. The bacterium according to Example 1, wherein the medical effector is a therapeutic factor capable of inducing at least one immune response and / or reducing the size of a target lesion in the subject to a degree sufficient to treat the target disease or condition.

[0124] 4. The bacterium described in Example 2 or 3, wherein the immune response is induced by CD4+ and / or CD8+ T cells.

[0125] 5. The bacterium described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a homologous gene of the bacterium.

[0126] 6. The bacterium described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a heterologous gene.

[0127] 7. The bacterium according to Example 6, wherein the heterologous gene further comprises a leader sequence and / or terminator region that improves heterologous expression in the bacterium.

[0128] 8. The bacterium according to Example 3 or 6, wherein the therapeutic factor is a cytotoxin that causes cell lysis in the target lesion.

[0129] 9. The subject disease or condition is cancer or tumor, and the medical effector is the bacterium described in Example 2 or 3 that causes tumor suppression in the subject.

[0130] 10. The bacteria described in Example 1, wherein the bacteria cannot copy or colonize within the subject.

[0131] 11. The bacterium according to Example 1, wherein the gene modification is a deletion or mutation of at least one essential gene or nutrient requirement gene from the chromosome of the bacterium.

[0132] 12. The bacterium is a nutrient requirement for diaminopimelic acid, as described in any one of the prior examples.

[0133] 13. The bacterium according to any one of the prior examples, wherein the gene modification is the deletion of aspartate semialdehyde dehydrogenase (ASD) from the chromosome of the bacterium.

[0134] 14. The bacteria according to any one of the prior examples, wherein the bacteria have a survival time that can be controlled by exposure of the bacteria to one or more modulating effectors, the modulating effectors modulate the survival time of the bacteria when administered in vivo.

[0135] 15. The bacterium described in Example 14, wherein the modulating effector is diaminopimeric acid.

[0136] 16. The bacterium according to any one of the prior examples, wherein the medical effector is a homologous peptide expressed by a gene selected from the group consisting of chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks island.

[0137] 17. The bacterium described in any one of the prior examples, wherein the medical effector is a cytotoxin selected from the group consisting of exolysin A (ExlA) of Pseudomonas aeruginosa, nonhemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, vacuolated toxin of Helicobacter pylori, and combinations thereof.

[0138] 18. The bacterium according to any one of the prior examples, wherein the medical effector is an anticancer factor selected from the group consisting of CpG, cyclic dinucleotides, and tumor antigens.

[0139] 19. The bacteria described in any one of the prior examples are derived from the genera Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0140] 20. The bacteria described in any one of the prior examples, wherein the bacteria are derived from Escherichia coli.

[0141] 21. The bacterium described in any one of the prior examples is derived from strain SH3, deposit number 19836, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0142] 22. The bacterium according to any one of the prior examples, wherein the bacterium expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0143] 23. The bacterium described in any one of the prior examples, derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0144] 24. The bacteria described above are the bacteria described in any one of the prior examples, formulated for intravenous administration.

[0145] 25. The bacteria described in any one of the prior examples, wherein, when administered intravenously, the time required to minimize the pathogenesis is less than 2 days, less than 5 days, or less than 11 days.

[0146] 26. The bacteria described above are the bacteria described in any one of the prior examples, formulated for topical administration.

[0147] 27. The bacteria described in any one of the prior examples, which, when administered locally at the injection site, survives at the injection site for up to 5 days but dies within 48 hours outside the injection site.

[0148] 28. The bacteria measured 7.5 × 10 9 The bacteria described in Example 24, administered at an equivalent dose of cfu / kg for mice.

[0149] 29. The disease is cancer or a tumor, and the bacterium is the bacterium described in any one of the prior examples, administered intratumorally.

[0150] 30. The bacteria present in a quantity of at least 5 × 10⁶ per gram of tumor 8 With an equivalent dose of CFU, approximately 100-200 mm 3 The bacteria described in Example 29 are administered.

[0151] 31. The bacterium according to any one of Examples 1 to 20, wherein the at least one effector gene comprises a cytotoxin gene and a DNA fragment of a portion of a hemolysin III coding gene.

[0152] 32. The bacterium described in Example 31, wherein the cytotoxin is exolycin A (ExlA) of Pseudomonas erginosa.

[0153] 33. The bacterium described in Example 31 or 32, derived from strain mp106, deposit number 22556, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0154] 34. The bacterium according to any one of the prior examples, further comprising at least one toxic gene modification that weakens the toxicity of the bacterium.

[0155] 35. The bacterium according to Example 34, wherein the at least one toxic gene modification is a deletion or mutation of at least one toxic gene from the chromosome of the bacterium.

[0156] 36. The bacterium according to Example 34 or 35, wherein the toxic gene modification is a deletion of the hlyCABD operon from the chromosome of the bacterium.

[0157] 37. The bacterium described in Example 36 is derived from strain SH4, deposit number 22557, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0158] 38. The bacterium according to any one of Examples 34 to 37, wherein the bacterium expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:40.

[0159] 39. The bacterium according to any one of Examples 34 to 37, wherein the bacterium expresses a first sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:41, and / or a second sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:42.

[0160] 40. The bacteria described in Example 38 or 39, derived from strain mp105, deposit number 22555, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0161] 41. The bacteria mentioned above are 2 × 10 8 The bacteria described in any one of Examples 31 to 40, administered in a cfu / mouse equivalent dose.

[0162] 42. The bacteria described in any one of Examples 34 to 40, which are formulated to be administered in combination by intravenous injection and intratumor injection.

[0163] 43. The intratumor injection is 7.5 × 10 7 The dose has an equivalent dose of cfu / mouse, and the intravenous injection is 3 × 10 7 The bacteria described in Example 42, having a cfu / mouse equivalent dose.

[0164] 44. A living bacterium of the genus Escherichia coli, This includes a gene deletion of aspartic acid semialdehyde dehydrogenase (ASD) in the chromosome of the bacterium, Here, the aforementioned bacteria are living bacteria of the genus Escherichia coli, derived from a toxic strain.

[0165] 45. The bacterium described in Example 44, wherein the bacterium expresses at least one effector gene encoding a medical effector.

[0166] 46. ​​The bacterium described in Example 44 is derived from strain SH3, deposit number 19836, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0167] 47. The bacterium described in Example 44, further comprising the gene encoding exolysin A (ExlA) of Pseudomonas erginosa.

[0168] 48. The bacterium described in Example 47, wherein the gene has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0169] 49. The bacterium described in Example 44 is derived from strain mp107, deposit number 19835, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0170] 50. The bacterium according to Example 44, wherein the at least one effector gene comprises a cytotoxin gene and a DNA fragment of a portion of a hemolysin III coding gene.

[0171] 51. The bacterium described in Example 50, wherein the cytotoxin is exolysin A (ExlA) of Pseudomonas erginosa.

[0172] 52. The bacterium described in Example 50 or 51, derived from strain mp106, deposit number 22556, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0173] 53. The bacterium according to any one of Examples 44 to 52, further comprising at least one toxic gene modification that weakens the toxicity of the bacterium.

[0174] 54. The bacterium according to Example 53, wherein the at least one toxic gene modification is a deletion or mutation of at least one toxic gene from the chromosome of the bacterium.

[0175] 55. The bacterium according to Example 53 or 54, wherein the toxic gene modification is a deletion of the hlyCABD operon from the chromosome of the bacterium.

[0176] 56. The bacterium described in Example 55 is derived from strain SH4, deposit number 22557, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0177] 57. The bacterium according to any one of Examples 53 to 56, wherein the bacterium expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:40.

[0178] 58. The bacterium according to any one of Examples 53 to 56, wherein the bacterium expresses a first sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:41, and / or a second sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:42.

[0179] 59. The bacteria described in Example 57 or 58, derived from strain mp105, deposit number 22555, deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC).

[0180] 60. The aforementioned bacteria are 2 × 10 8 The bacteria described in any one of Examples 50 to 59, administered in a cfu / mouse equivalent dose.

[0181] 61. The bacteria described in any one of Examples 53 to 59, which are formulated to be administered in combination by intravenous injection and intratumor injection.

[0182] 62. The intratumor injection is 7.5 × 10 7 The dose has an equivalent dose of cfu / mouse, and the intravenous injection is 3 × 10 7The bacteria described in Example 61, having a cfu / mouse equivalent dose.

[0183] 63. An immunogenic composition comprising the bacteria described in any one of the prior examples.

[0184] 64. A live bacterial vaccine comprising the bacteria described in any one of the prior examples and an optional adjuvant.

[0185] 65. A method for treating a disease or medical condition, comprising administering to a subject a composition containing a bacterium described in any one of the prior examples in an effective amount.

[0186] 66. The method according to Example 65, wherein the disease is a tumor or cancer.

[0187] 67. A method for constructing genetically modified, living bacteria, A method comprising the step of genetically modifying a bacterium to shorten its lifespan so that, after administration to a subject, the bacterium survives for a sufficient time to allow a medical effector to produce at least one medical effect and dies for a sufficient time to minimize the mechanism of disease development in the subject, wherein the bacterium is derived from a toxic strain.

[0188] 68. The method of Example 67, further comprising the step of genetically engineering the bacteria to express at least one medical effector.

[0189] 69. Use of a composition comprising an effective amount of the bacteria described in any one of the prior examples in the manufacture of a drug for treating a disease or medical condition.

[0190] 70. The use described in Example 69, wherein the disease is a tumor or cancer.

[0191] In some embodiments, a genetically modified, living bacterium is provided, the genetically modified, living bacterium comprising at least one effector gene encoding a medical effector, and at least one genetic modification that shortens the lifespan of the bacterium so that the bacterium survives for a sufficient time after administration to a subject to allow the medical effector to exert at least one medical effect, and dies after a sufficient time to minimize the mechanism of disease development in the subject. The bacterium is derived from a toxic strain.

[0192] In some examples, toxic strains can offer higher immunogenicity and therapeutic potential at a baseline level compared to non-pathogenic or non-toxic bacteria.

[0193] In some embodiments, the time is sufficient to allow the medical effector to produce at least one medical effect against at least one disease or condition. The effect may persist for a long time even after the bacteria have been killed and removed from the subject's body.

[0194] In some exemplary cases, the medical effect is a preventive and / or therapeutic effect.

[0195] In some exemplary cases, the time required for a bacterial medical effector to initiate preventive and / or therapeutic effects is less than 48 hours.

[0196] Example 1 Materials and methods (1) Method for constructing short-lived bacteria Deletion or mutation of essential genes or nutrient requirement genes To produce short-lived bacteria, deletions or mutations may occur in at least one essential gene or nutrient requirement gene. In some exemplary examples, toxic bacterial strains were used for mutation.

[0197] In this exemplary example, the Escherichia coli (E. coli) strain SH2 was isolated and purified from fecal samples provided by healthy volunteers. The fecal samples were resuspended in PBS buffer and spread on LB agar supplemented with 1 mM isopropyl β-D-thiogalactoside (IPTG) and X-gal (0.06 mg / ml). The E. coli formed blue colonies and were distinguishable from other species. SH2 is one of the fecal E. coli isolates. Strain SH2 was deposited with the China Common Microbial Species Preservation and Management Center (CGMCC) on June 10, 2021, with deposit number 22685.

[0198] In this exemplary example, the asd gene, an essential gene encoding aspartate-semialdehyde dehydrogenase, was deleted from the chromosome of the E. coli strain SH2. The asd gene was deleted from the E. coli bacterial chromosome using the lambda(λ)-Red recombination system. Two primers were used to produce the deletion. asd-F (forward primer): TIFF0007836794000001.tif17161asd-R (reverse primer): TIFF0007836794000002.tif18161

[0199] Using the chloramphenicol resistance gene (cat) as a template, a DNA fragment containing the loxP-cat-loxP chloramphenicol resistance cassette was amplified by polymerase chain reaction (PCR), and the fragment had homology (45 nt) to a region directly adjacent to the asd gene. Primers asd-F and asd-R were used in the PCR. Electrocompetent E. coli were transformed using plasmid pSim6, and the expression of the λ recombinant protein was induced on the plasmid at 42°C. The PCR fragment was introduced into the E. coli carrying pSim6 by electroporation. After inducing λ-red, 37 oAfter incubation overnight in 1C, recombinant colonies were selected for chloramphenicol resistance. Resistant colonies were isolated and validated by colony PCR using primers designed to be adjacent to the asd gene: asd-F2 (forward) TAGGTTTCCGAGCGGATCCA (SEQ ID NO: 3) and Cm-R3 (reverse) CCTCTTACGTGCCGATCAACG (SEQ ID NO: 4). The PCR size was verified to be 505 bp. Further confirmation of asd deletion was achieved by phenotyping, in which accurate colonies did not grow on LB medium but readily grew on LB medium supplemented with DAP (50 μg / ml). After confirming asd deletion, a single colony was selected and transformed with a 705 Cre plasmid carrying the kanamycin resistance gene. Cre recombinase expression from the plasmid was induced at 37°C and spread on Luria-Bertani (LB) agar in the absence of any antibiotics. Then, single colonies were delineated on both LB agar and LB agar supplemented with chloramphenicol. A single colony that grew on LB agar but not on LB agar with chloramphenicol was selected. The mutant strain, which has an asd gene deletion but lacks the loxp-cat-loxp cassette, was named SH3. Strain SH3 was deposited with the China Common Microbial Species Preservation and Management Center (CGMCC) on May 18, 2020, with deposit number 19836.

[0200] Identification of toxic genes in mutant strains Toxic genes within SH3 were detected by colony PCR. To design primers, conserved sequence regions were first identified in different E. coli strains by evaluation of multiple sequence alignments. The primers were then designed to be specific to these conserved regions. All primers used are listed in Table 1. [Table 1]

[0201] In vitro bacterial growth assay A 10 μl overnight culture of bacterial SH3 was subcultured (time 0) in 1 ml of LB PLOS medium with or without 50 μg / ml DAP. After incubation for 24 and 48 hours, the bacteria were sequentially diluted, and viable bacteria were quantified by counting colony-forming units on both Luria-Bertani (LB) agar and LB agar supplemented with 50 μg / ml DAP.

[0202] Ex vivo bacterial survival assay Six to eight weeks old female C57BL / 6J mice were euthanized. Organs (including liver, lungs, heart, kidneys, and spleen) were removed and homogenized. Equivolute individual organ suspensions were mixed to form a mixed organ suspension. The suspension mixture was used in an ex vivo survival assay. A 5 μl overnight bacterial culture was subcultured (time 0) in 500 μl of the organ suspension. At 24 and 48 hours, viable bacteria were quantified by counting colony-forming units on LB agar supplemented with 50 μg / ml DAP.

[0203] In vivo bacterial survival assay Bacterial suspensions with or without 5 μg / ml DAP (approximately 1 × 10⁻⁶) 9 CFU was subcutaneously injected into the flank of female C57BL / 6J mice aged 6 to 8 weeks (average body weight approximately 20 g). Tissue was then removed from the bacterial injection site and vital organs (including liver, lungs, heart, kidneys, and spleen) to determine colony-forming units at different time points. Approximately 1 gram of each tissue was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were successively diluted and spread on LB agar supplemented with 50 μg / ml DAP, and each suspension was divided into 37 portions. o The tissues were incubated overnight in 1C. Colony-forming units (cfus) were counted in each diluted tissue suspension, and the number of bacteria in the tissue was calculated based on the dilution ratio.

[0204] A similar in vivo bacterial survival assay was repeated using a method similar to the one described above, where the bacterial suspension (approximately 5 × 10⁻⁶) was measured. 8 CFU was injected into the tail vein of female C57BL / 6J mice aged 6 to 8 weeks (average body weight approximately 20 g). Tissue was then removed from the bacterial injection site and vital organs (including liver, lungs, heart, kidneys, and spleen) to determine colony-forming units at different time points. Approximately 1 gram of each tissue was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were successively diluted and spread on LB agar supplemented with 50 μg / ml DAP, and each suspension was divided into 37 portions. o The tissues were incubated overnight in 1C. Colony-forming units (cfus) were counted in each diluted tissue suspension, and the number of bacteria in the tissue was calculated based on the dilution ratio.

[0205] Example 2 (2) Short-lived bacteria were used as vectors for medical effectors. We constructed short-lived bacteria that express cytotoxins through gene cloning. The exlA gene (SEQ ID NO:35) (Genbank:CP000744.1), which encodes exolicin A (ExlA) of Pseudomonas erginosa PA7 (Figure 4) and has a promoter and terminator, was synthesized and cloned into the pBAD-DEST49 plasmid (Invitrogen, Inc., catalog number 12283-016) using CloneEZ seamless cloning technology (GenScript) according to the manufacturer's instructions. Recombinant plasmid pExlA was validated by sequencing analysis. Subsequently, recombinant plasmid pExlA was introduced into asd-deleted mutant SH3 by electroporation and validated by colony PCR using primers oxb-F (forward: CTGTTGTGACCGCTTGCTCT) (SEQ ID NO:33) and exlA-R (reverse: GAGGTGGAAGACAGGATTGTC) (SEQ ID NO:34). After confirming plasmid transformation, a single colony was selected. The resulting mutant strain containing the recombinant plasmid was named mp107. Strain mp107 was deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC) on May 18, 2020, with deposit number 19835.

[0206] In vitro cytotoxicity assay Mouse Lewis lung cancer (LLC) cell line and human lung cancer cell line (A549) were used in in vitro cytotoxicity assays. Each cell line was placed in growth medium (DMEM + 10% FBS + 1% Gln + 1% P / S) at a rate of 1 × 10⁶ per well. 4Cells were inoculated into 96-well plates. After the cells grew to an 80% confluency, they were co-cultured with bacterium mp107 in antibiotic-free medium with 5 μg / ml DAP added, at 100 moi (i.e., 100 bacteria per cell). Escherichia coli standard strain MG1655 was used as a control bacterium. As a control, the control bacterium was also co-cultured in 1× phosphate-buffered saline (PBS) buffer. After 3 hours of incubation, the bacterial cells were washed three times with PBS and stained with 1% crystal violet for 5 minutes. Since dead cells were removed by washing, cells stained with crystal violet were considered viable. The stained cells were lightly washed with PBS and destained with 95% ethanol. The amount of crystal violet stain in the destaining solution (light density (OD) at 595 nm) was measured at 595 nm using a microtiter plate reader, which indicates the number of viable cancer cells. The percentage of cells killed by co-cultured bacteria (or the killing rate (%)) is expressed using the formula (comparative OD). 595 - Processing OD 595 ) / Contrasting OD 595 The calculation was performed using ) × 100%.

[0207] In vivo antitumor evaluation of short-lived bacteria at local administration. Six to eight weeks old female C57BL / 6J mice were used for tumor transplantation with the Lewis lung cancer cell line (LLC). In particular, 1 × 10⁶ of the cancer cell line were used. 6 The cells were subcutaneously injected into the flank of each mouse. Between 7 and 12 days after cell transplantation, the average tumor volume was approximately 100-200 mm². 3 When it reached this stage, control bacteria MG1655, short-lived bacteria SH3 and mp107 were introduced at a rate of 5 × 10⁶ per gram of tumor. 8 Each mouse was injected with a dose of cfu into each tumor. A negative control was created by injecting PBS, and 4 × 10⁶ of one gram of tumor was injected. 9High-dose MP107 groups were prepared by injecting cfu. After intratumoral (IT) bacterial injection, tumor size was measured approximately twice a week (from day 0 to day 20) using a digital caliper. Differences in tumor growth inhibition rates (TGI) between each treatment group and control group were evaluated.

[0208] We evaluated the in vivo regulation of short-lived bacteria survival time by medical effectors using SH3 and mp107 supplemented with 5 μg / ml DAP.

[0209] In vivo antitumor evaluation of short-lived bacteria during systemic administration. Six to eight weeks old female C57BL / 6J mice were used for tumor transplantation with the Lewis lung cancer cell line (LLC). In particular, 1 × 10⁶ of the cancer cell line were used. 6 The cells were subcutaneously injected into the flank of each mouse. Between 7 and 12 days after cell transplantation, the average tumor volume was approximately 100-200 mm². 3 When it reaches 7.5 × 10 9 Short-lived bacteria MP107 were administered systemically by intravenous injection into the tail vein of each mouse at a dose equivalent to cfu / kg. Negative controls were prepared by injection with PBS. After intravenous (IV) bacterial injection, tumor size was measured approximately twice a week (from day 0 to day 20) using a digital caliper. Differences in tumor growth inhibition rates (TGI) between each treatment group and control were evaluated.

[0210] Distribution of short-lived bacteria in mice After in vivo antitumor evaluation, the mice were euthanized. Tissue was then removed from tumor tissue and vital organs (including liver, lungs, heart, kidneys, and spleen) to determine colony-forming units at different time points. Approximately 1 gram of each tissue was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were sequentially diluted and spread on LB agar supplemented with 50 μg / ml DAP, and each suspension was divided into 37 portions. o The tissues were incubated overnight in 1C. Colony-forming units (cfus) were counted in each diluted tissue suspension, and the number of bacteria in the tissue was calculated based on the dilution ratio.

[0211] Flow cytometry Tumor tissue was degraded with 37.5 μg / mL Liberase™ (Roche) and 8,000 U / mL DNase I, and bovine pancreas (Merck Millipore). The cell suspension was filtered through a 200 μM cell filter and washed with PBS. The cells were then stained against the following markers: BB700 rat anti-mouse CD4 clone RM4-5 (RUO) (BD), Ms CD3e FITC 145-2C11 (BD), Ms CD4 BV510 RM4-5 (BD), Ms CD8a APC-Cy7 53-6.7 (BD), and BV510 rat anti-mouse CD45RB (BD). The stained cells were analyzed using a Life Attune NxT flow cytometer (Life Technologies) according to the manufacturer's instructions.

[0212] result Example 3 Construction of short-lived bacteria A mutant strain containing a gene deletion in the chromosome was produced based on the method described in Example 1 and named SH3. There are four phylogenetic groups (A, B1, B2, and D) of the E. coli strain, and the phylogenetic type can be determined by PCR detection of the chuA and yjaA genes and the DNA fragment TSPE4.C2 in the E. coli chromosome. The primer pairs used were chuA-F(GACGAACCAACGGTCAGGAT)(SEQ ID NO:23) and chuA-R(TGCCGCCAGTACCAAAGACA)(SEQ ID NO:24), yjaA-F(TGAAGTGTCAGGAGACGCTG)(SEQ ID NO:25) and yjaA-R(ATGGAGAATGCGTTCCTCAAC)(SEQ ID NO:26), and TspE4C2-F(GAGTAATGTCGGGGCATTCA)(SEQ ID NO:27) and TspE4C2-R(CGCGCCAACAAAGTATTACG)(SEQ ID NO:28). The sizes of the obtained PCR products were 279-, 211-, and 152 bp, respectively. If an E. coli strain is positive for both chuA and yjaA, the strain is identified as belonging to phylogenetic group B2. Phylogenetic typing indicated that SH3 belongs to phylogenetic type B2 Escherichia coli. Further PCR detection for E. coli toxic genes showed that SH3 was positive for polyketide synthase genomic islands (pks islands) (these islands are pathogenic islands encoding large modularized non-ribosomal peptides and polyketide synthase) and other toxic genes or operons such as chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, and yfcV. The results suggest that SH3 is an E. coli strain that, due to its multiple toxic factors, offers higher baseline levels of immunogenicity and therapeutic efficacy compared to strains engineered from non-pathogenic or non-toxic strains.

[0213] Results of in vitro bacterial growth assays of short-lived bacteria Referring to Figures 1A and 1B, the in vitro growth assay shows that the asd-deleting mutant SH3 cannot survive in growth medium (LB) without DAP supplementation (Figure 1A), but it grows easily when DAP is supplemented in the growth medium (approximately 8 × 10 after 24 hours). 7 It is cfu and approximately 5 × 10 after 48 hours. 7 This demonstrated that the bacteria were cfu (Figure 1B). These results show that, in the absence of essential supplements, genetically modified, short-lived bacteria with essential gene deletions cannot survive in vitro.

[0214] Results of ex vivo bacterial survival assays of short-lived bacteria Referring to Figure 1C, the asd mutant SH3 was observed to be unsustainable in ex vivo studies (failure to grow after 24 or 48 hours). In the aforementioned study, the asd mutant SH3 was incubated in a homogenized mixed organ suspension, and viable bacteria were quantified by counting colony-forming units on LB agar supplemented with DAP (50 μg / ml) (Figure 1C). The results showed that, without essential supplementation, genetically modified, short-lived bacteria with essential gene deletions cannot survive ex vivo.

[0215] Results of in vivo bacterial survival assays of short-lived bacteria To determine whether the asd mutant SH3 can survive in vivo for a short period, the asd mutant SH3 (approximately 1 × 10⁻¹⁰) 9 CFU was subcutaneously injected into mice.

[0216] Referring to Figure 1D, if DAP is not supplemented, the number of living bacteria in SH3 on day 2 after injection is approximately 1 × 10⁶. 9 Approximately 2.7 × 10⁻¹⁴ from cfu 8The number of living bacteria decreased, and at this point, approximately 27% of SH3 bacteria were still surviving at the injection site. After 5 days, the number of living bacteria continued to decline significantly. After 11 days, no living bacteria could be detected, indicating that the genetically modified bacteria with essential gene deletions had a shorter lifespan and were incapable of in vivo copying or colonization.

[0217] Results of in vivo bacterial survival assays of short-lived bacteria In vivo bacterial survival assay results further showed that, on days 2, 5, and 11 after injection, regardless of whether DAP was supplemented in the bacterial suspension, SH3 was present only at the subcutaneous injection site and could survive for up to 5 days, but was not present in any of the other tested organs (including the liver, lungs, heart, kidneys, and spleen).

[0218] The results showed that short-lived bacteria are localized within the subcutaneous injection site, making them safe for local administration.

[0219] To further evaluate the safety of short-lived bacteria during systemic administration, we have investigated the short-lived bacteria SH3 (approximately 5 x 10⁻¹⁰). 8 SH3 was injected into the tail vein of female C57BL / 6J mice aged 6 to 8 weeks. After intravenous injection, mice treated with the short-lived bacteria did not die. In contrast, 100% of mice treated with the wild-type bacteria died within 48 hours. Furthermore, when examined 6 days after intravenous (iv) injection, SH3 was not detected in any organ of any of the mice treated with the short-lived bacteria.

[0220] It should be noted that in all of these in vivo evaluations, the mutation rate of the asd-deleted mutant SH3 was 0%. That is, 100% of the SH3 cells isolated from the injection site maintained their dependence on DAP for survival and proliferation, which indicates that even if the genetically modified bacteria retain their toxic factors, the bacteria can be safely used in both local and systemic administration.

[0221] In short, these data demonstrate that short-lived bacteria with toxic factors are surprisingly safe when used in vivo, whether locally or systemically. Without being constrained by any theory, short-lived bacteria, even if possessing multiple toxic factors, can survive transiently within a subject or host without causing systemic infection or disease. Therefore, these bacteria can be used as safe and highly effective vectors or media for manufacturing vaccines or therapeutic agents to treat or prevent various diseases or improve certain medical conditions. For example, short-lived mutant bacteria such as SH3 could be used as a platform for developing active therapeutic agents.

[0222] Regulation of the lifespan of short-lived bacteria Referring still to Figure 1D, an in vivo bacterial survival assay was performed using a bacterial suspension supplemented with DAP at a final concentration of 5 μg / ml. When DAP was supplemented, the number of living SH3 bacteria on day 2 after injection was approximately 1 × 10⁶. 9 Approximately 6.27 × 10⁻¹⁴ from cfu 8 The reduction occurred only in cfu. In other words, approximately 62.7% of asd mutant SH3 survived at the injection site for 2 days after injection (Figure 1D). This percentage was significantly higher than the percentage of SH3 in the absence of DAP. Therefore, the results indicate that the survival time of short-lived bacteria can be regulated by supplementing with a regulatory effector. Favorably, the survival time of mutant short-lived bacteria can be controlled by a regulatory effector. Although the survival time of injection-site SH3 increased with the addition of 5 μg / ml DAP, SH3 was not present in any vital organs of any mouse when examined at 2, 5, and 11 days post-injection.

[0223] Example 4 Results of constructing short-lived bacteria that express heterologous toxic factors In this exemplary example, the short-lived bacterium SH3 obtained from Example 2 was further transformed using a plasmid expressing the cytotoxin, Pseudomonas erginosa exolysin A (ExlA), under the control of the constitutive promoter oxb18. The sequence containing the oxb 18 promoter, the pelB reader sequence, the Pseudomonas erginosa PA7 exlA gene, and the terminator (rrnB transcriptional terminator region) is shown in SEQ ID NO:35 and was cloned into plasmid pBAD-DEST49 to form recombinant plasmid pExlA (Figure 4). The purified and validated recombinant strain was named mp107.

[0224] Results of in vitro cytotoxicity assays of short-lived bacteria expressing cytotoxins Referring to Figure 2A, the cytotoxicity of mp107 was evaluated in vitro. The cell line and bacteria were co-cultured for 3 hours in growth medium supplemented with DAP (5 μg / ml), and the killing rate was determined. Both results were P<0.001 (independent t-test). The data showed that the killing rate of the short-lived bacterium mp107 against LLC cells was surprisingly high (approximately 92%), while the killing rate of the control bacterium MG1655 was only about 13% (Figure 2A). The data also showed that the killing rate of mp107 against A549 cells was surprisingly high (approximately 90%), while the killing rate of the control bacterium MG1655 was only about 30% (Figure 2B). These results indicate that mp107 is toxic or lethal to mouse lung cancer cells and human lung cancer cells, suggesting that short-lived bacteria expressing heterologous toxic factors, such as cytotoxins, may have high efficacy in treating cancers such as lung cancer.

[0225] Results of in vivo antitumor evaluation against short-lived bacteria at local administration Referring to Figure 2B, we constructed a mouse cancer model in which mice carry subcutaneous tumors formed from Lewis lung cancer cells (LLCs) of the same gene. To improve the in vivo survival time of short-lived bacteria in tumors, in vivo antitumor evaluation was performed with bacterial suspensions supplemented with DAP at a dose of 5 μg / ml before administration to tumors in mice. For the control strain MG1655, short-lived bacteria SH3, and short-lived bacteria mp107 expressing exolA exolysin, these bacteria exhibited survival rates of 5 × 10⁶ per gram of tumor. 8 The injection was administered at the CFU dose, and for the MP107 (high dose) group, the injection dose was 4 × 10⁶ per gram of tumor. 9 This is cfu. As shown in Figure 2B, tumor growth in the SH3 group was significantly suppressed compared to the control MG 1655 group and PBS group (bacterial injection) over the treatment period (days 3 to 20). Compared to the reference strain MG1655 (p=0.0002), the short-lived bacterium SH3 showed a higher level of tumor suppression, indicating that SH3 bacteria with toxic factors have higher anticancer efficacy than control bacteria. The data further showed that tumor growth in the mp107 group was significantly suppressed compared to the SH3 group over the treatment period (days 3 to 20). The data itself indicates that the suppression of tumor growth by the short-lived bacterium mp107, which expresses a different cytotoxin, is more effective than that of the short-lived bacterium SH3 (p=0.03), indicating that the cytotoxin encoded by exlA confers additional anticancer capability to short-lived bacteria. The injection dose was 4 × 10⁶ per gram of tumor. 9 When the cfu (higher dose) was increased, the anticancer efficacy of mp107 also increased accordingly. After injecting the bacteria into tumors for 20 days, the competitive response rate of high-dose mp107 reached 75% (6 out of 8 mice), showing an additive or synergistic effect on the anticancer efficacy of short-lived bacteria SH3 (i.e., the mp107 treatment group) with heterologous toxic factors, such as the cytotoxin ExlA. Comparison of tumor growth inhibition rates (TGI) showed significant differences between the treatment group and the control group.

[0226] Results of in vivo antitumor evaluation against short-lived bacteria during systemic administration Referring to Figure 3A, the short-lived bacterium mp107 is injected intravenously into the tail vein of a mouse (7.5 × 10⁻¹⁴). 9 The mice were treated with cfu / kg. Over the treatment period (days 2 to 30), intravenously injected short-lived bacteria significantly suppressed tumor growth compared to the PBS control group. 44.4% of the mp107-treated mice (4 out of 9 mice) had their tumors cured by day 30, which is 7.5 × 10⁻⁶. 9 We demonstrated that these short-lived bacteria can effectively treat cancer when administered systemically at a single dose of cfu / kg in mice.

[0227] Results of the distribution of short-lived bacteria in mice At the end of the experiment, the intracellular distribution of bacteria in mice treated with the bacteria was analyzed. The absence of detection of the short-lived bacterium mp107 in tumors or any vital organs (including liver, lungs, heart, kidneys, and spleen) indicated that these short-lived bacteria do not colonize tumor tissue or subjects. Since the tumors do not contain bacteria, the data suggest that the tumor suppression observed after intravenous injection of these short-lived bacteria is due to indirect mechanisms, such as immune mechanisms.

[0228] Flow cytometry results Referring to Figures 3B and 3C, tumor lymphocytes were analyzed by flow cytometry. The data showed that CD4+ T cells and CD8+ T cells in tumors of mice treated with the short-lived bacterium mp107 increased 19-fold and 12-fold, respectively, compared to cells in mice treated with the control bacterium MG1655, indicating that these short-lived bacteria induce a T cell response in treated mice. These data demonstrate that the short-lived bacterium mp107, which expresses the heterologous protein ExlA, suppresses tumor growth by inducing anti-cancer immunity.

[0229] These data suggest that short-lived bacteria expressing certain antigens could be used as vaccines against disease progression, such as cancer.

[0230] Example 5 Materials and methods (3) Method for constructing short-lived bacteria Deletion or mutation of toxic genes To further improve the safety of use of short-lived bacteria, their toxicity can be further reduced by further genetic modification. In this exemplary example, a novel bacterial strain, SH4, was generated by deleting or mutating the hlyCABD operon encoding α-hemolysin in the bacterial (Escherichia coli) strain SH3.

[0231] In this exemplary example, the hlyCABD operon was deleted from the bacterial chromosome of E. coli strain SH3 using the lambda(λ)-Red recombinant system. Two primers were used to produce the deletion. M-hly-F (forward): TIFF0007836794000004.tif18162M-hly-R (reverse direction): TIFF0007836794000005.tif21161

[0232] Chloramphenicol-resistant cassettes were amplified by PCR using M-hly-F and M-hly-R primers. Using the chloramphenicol resistance gene (cat) as a template, a DNA fragment containing the loxP-cat-loxP chloramphenicol-resistant cassette was amplified by PCR, and the chloramphenicol-resistant cassette has homology (45nt) to the region directly adjacent to the hlyCABD operon. Primers M-hly-F and M-hly-R were used in this PCR. Bacterial strain SH3 was transformed using plasmid pSim6, and expression of the λ recombinant protein was induced on the plasmid at 42°C. The PCR fragment was introduced into SH3 carrying pSim6 by electroporation. After inducing λ-red, recombinants were selected for chloramphenicol resistance, and the recombinants were verified by colony PCR. Then, the chloramphenicol-resistant cassette was removed using the 705Cre method according to the manufacturer's instructions (Gene Bridges, Germany). Specifically, Cre recombinase expression from plasmids in transformants was induced at 37°C, and the bacteria were spread on LB agar without any antibiotics. After culturing overnight at 37°C, single colonies were delineated on both LB agar and LB agar supplemented with chloramphenicol. A single colony that grew on LB agar but not on LB agar with chloramphenicol was selected. This mutant strain, possessing both the hlyCABD operon deletion and the asd gene deletion, but with the loxp-cat-loxp cassette, was named SH4. Bacterial strain SH4 was deposited with the China Common Microbial Species Preservation and Management Center (CGMCC) on May 18, 2021, with deposit number 22557.

[0233] Example 6 (4) Using short-lived bacteria as vectors for medical effectors We will construct short-lived bacteria that express cytotoxins and fragments of hemolysin III through gene cloning. DNA fragments of the exlA gene (SEQ ID NO: 41), which encodes exolysin A, and the hly III gene (SEQ ID NO: 42), which encodes hemolysin III, were synthesized and cloned into the pBAD-DEST49 plasmid (Invitrogen, USA, catalog number 12283-016) to form recombinant plasmid pExlA2 using CloneEZ seamless cloning technology (GenScript) according to the manufacturer's instructions (Figure 5). Recombinant plasmid pExlA2 was validated by sequencing analysis. Subsequently, recombinant plasmid pExlA2 was introduced into bacterial strains SH4 and SH3, respectively, by electroporation and validated by colony PCR. After confirming transformation, a single colony was selected for each bacterial strain. The mutant strains SH4 and SH3 obtained by recombinant plasmid pExlA2 transformation were named mp105 and mp106, respectively. Strain mp105 was deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC) on May 18, 2021, with deposit number 22555. Strain mp106 was deposited with the China Center for Common Microbial Species Preservation and Management (CGMCC) on May 18, 2021, with deposit number 22556.

[0234] Example 7 Hemolysis assay Recombinant plasmid pExlA2 was introduced into the control bacterial strain MG1655 by electroporation and validated by colony PCR. After confirming transformation, a single colony was selected. MG1655 obtained by plasmid pExlA2 transformation was named MG1655 / pExlA2.

[0235] Overnight cultures of bacterial strains SH3, SH4, and control bacterial strains MG1655 and MG1655 / pExlA2 were respectively dropped onto LB agar supplemented with diaminopimeric acid (DAP, 50 μg / ml) and 10% (v / v) rabbit blood, and then 37 oThe samples were incubated in C for 8 to 10 hours. At the endpoint, the hemolytic ability of the corresponding bacterial strain was observed. Clarification of the agar indicated hemolysis due to rupture of red blood cells.

[0236] Example 8 In vivo evaluation of the safety and anticancer efficacy of injections of short-lived bacteria. Six to eight weeks old female C57BL / 6J mice were used for tumor transplantation with the Lewis lung cancer cell line (LLC). Specifically, 1 × 10⁶ LLC cell lines were used. 6 The cells were subcutaneously injected into the flank of each mouse. Between 7 and 12 days after cell transplantation, the average tumor volume was approximately 50-200 mm². 3 When the stage was reached, bacterial strains (mp105, mp106, and / or mp107) were administered intravenously (iv) into the tail vein of each mouse, or a combination of intravenous and intratumoral injection (iv+it) was performed on each mouse. PBS buffer was injected in a similar manner as a negative control. Body weight was measured on days 4, 6, 8, and 11 after bacterial injection. Tumor size was measured 2-3 times per week using a digital caliper after bacterial injection.

[0237] Example 9 Genus and species identification The target bacteria were isolated from tissue and purified by subculturing. Then, following the manufacturer's instructions, genomic DNA was isolated from each bacterial strain using the Tiangen Genome DNA Kit (Tiangen Biotech, Beijing), and species identification was confirmed by 16S ribosomal DNA (rDNA) sequencing analysis. Specifically, PCR amplification was performed using genomic DNA as a template with primers 27F and 1492R. The PCR products were then sequenced, and BLAST alignment was performed in GenBank. 27F (forward): TIFF0007836794000006.tif111621492R (reverse direction): TIFF0007836794000007.tif11161

[0238] Example 10 Evaluation of Short-Lived Bacteria as Therapeutic and Preventive Vaccines In this example, female C57BL / 6J mice with bacterial infection were used to demonstrate and evaluate the ability of mp105 in reducing bacterial infection. Bacteria isolated from mouse organs (including liver and lung) were analyzed based on the method described in Example 9 to perform species identification. 16S rDNA sequencing showed that the mice were naturally infected with Salmonella typhimurium. To examine whether mp105 could treat conventional Salmonella typhimurium infection and / or prevent subsequent bacterial infection, mice were subcutaneously injected with mp105 (1×10 8 cfu / mouse) or PBS twice at 14-day intervals. On the 14th day after injection, mice were challenged with pathogenic Escherichia coli strain CFT073 at a dose of 2×10 7 cfu / mouse to establish additional infection. On the 5th day after challenge, the mice were euthanized, and the bacterial infection status of vital organs such as liver, lung, heart, kidney, and spleen was analyzed by plate count for colony-forming units (CFU) and PCR verification for colonies. Salmonella typhimurium is negative for the hlyCABD operon, while CFT073 carries the operon, so the two types of bacteria may be distinguished using PCR. The primers used for PCR are hly-F and hly-R. hly-F (forward): TIFF0007836794000008.tif12162hly-R (reverse): TIFF0007836794000009.tif11161

[0239] Results Example 11 Construction Results of Attenuated Short-Lived Bacteria Based on the method described in Example 5, a mutant strain having a gene deletion of the SH3 of the hlyCABD operon in the chromosome was produced and named SH4. Deletion of the hlyCABD operon encoding α-hemolysin may improve the safety of the use of SH4 as an example of short-lived bacteria for multiple applications such as, for example, cancer therapy and vaccines for microbial infections.

[0240] Example 12 Construction results of attenuated short-lived bacteria expressing cytotoxins Based on the method described in Example 6, the short-lived bacterium SH4 obtained from Example 5 and the SH3 obtained from Example 2 were further transformed respectively using a plasmid expressing a DNA fragment (SEQ ID NO: 42) of a part of the hly III gene encoding a cytotoxin, Pseudomonas aeruginosa exotoxin A (SEQ ID NO: 41) and hemolysin III. The sequence containing the oxb 18 promoter, the pelB leader sequence, the exlA gene of Pseudomonas aeruginosa PA7, a DNA fragment of a part of the hemolysin III coding gene, and a terminator (rrnB transcription terminator region) is as shown in SEQ ID NO: 40, and was cloned into the plasmid pBAD-DEST49 to form the recombinant plasmid pExlA2. The mutant strains SH4 and SH3 obtained from the transformation with the recombinant plasmid pExlA2 were named mp105 and mp106, respectively.

[0241] Example 13 Results of hemolysis assay Referring here to Figure 6A, as a result, it was shown that after the hlyCABD operon encoding α-hemolysin was deleted from the SH3 genome, SH4 lost the ability to cause hemolysis, which indicated that SH4 lost the ability to produce α-hemolysin. In contrast, SH3 still maintained the ability to cause hemolysis.

[0242] Referring to Figure 6B, the hemolysis assay results showed that neither MG1655 nor MG1655 / pExlA2 caused hemolysis. The results revealed that although a portion of the hemolysin III coding gene DNA was present, hemolysin III was not produced from the plasmid. Surprisingly, in vivo evaluations of the tumor therapy (details shown in Example 15 below) showed that expression of the fragment enhanced the anticancer efficacy.

[0243] As described above, since mp105 was obtained from SH4 transformed with pExlA2, and the exemplary short-lived bacterium mp105 also lacks hemolysin production ability, it is presumed that this short-lived bacterium is safer when used in subjects for multiple applications, such as cancer therapy.

[0244] Example 14 Results of in vivo evaluation of safety and anticancer efficacy after injection of short-lived bacteria Referring to Figure 7, a mouse cancer model of the same gene was established in which mice carry subcutaneous tumors formed from Lewis lung cancer cells (LLC). Based on the method described in Example 8, the change in the rate of weight loss of each mouse treated with bacteria mp105, mp106, and mp107 is shown. Each bacterial strain was 2 × 10⁻⁶ 8 The mice were administered intravenously at a dose of cfu / mouse. Generally, all mice treated with bacteria experienced some degree of weight loss after intravenous injection; however, mice treated with mp105 showed significantly less weight loss than mice treated with mp106 or mp107. In particular, the difference in weight loss between mice treated with mp105 and those treated with mp106 reached statistical significance (independent t-test, P<0.05). These results further demonstrate that, due to the deletion of at least the hlyCABD operon, the exemplary short-lived bacterium mp105 has better anticancer efficacy and is safer when used in vivo in subjects compared to mp106 or mp107.

[0245] Example 15 Results of in vivo evaluation of tumor therapy mediated by short-lived bacteria Referring to Figure 8, the anticancer efficacy of mp105, mp106, and mp107 was compared based on the method described in Example 8. In vivo data showed that the increase in tumor volume with mp106 was significantly slower than that with mp107, particularly on day 21 post-treatment, indicating that mp106 showed a moderate improvement in anticancer efficacy compared to mp107. These results showed that pExlA2 conferred superior anticancer ability to bacteria compared to pExlA. Surprisingly, mp105 was significantly superior to both mp106 (p=0.04) and mp107 (p=0.031) in suppressing tumor growth. At the end of the experiment, 37.5% of tumors in mice treated with mp105 were cured. The cure rates for the groups treated with mp106 and mp107 were 12.5% ​​and 11.1%, respectively, which were lower than the cure rate for mice treated with mp-105. These results summarize that the exemplary short-lived bacterium mp105 is not only safer but also more effective against cancer compared to mp106 and mp107.

[0246] Example 16 Results of in vivo evaluation of anticancer efficacy mediated by short-lived bacteria administered via different routes. Referring to Figure 9, different routes of administration of mp105 were compared based on the method described in Example 8. The combination of intratumoral injection and intravenous injection of mp105 in cancer therapy was compared with intravenous injection alone. The doses for intratumoral injection and intravenous injection were 7.5 × 10⁻⁶, respectively. 7 cfu / mouse and 3x10 7This is a cfu / mouse study. Figure 9 shows that compared to mice that received only intravenous injection (iv) of mp105, mice that received a combination of intravenous and intratumoral injection (iv+it) of mp105, carrying subcutaneous LLC tumors, showed a remarkable reduction in tumor volume on day 12 after treatment. The results indicate that the combination of two administration routes (i.e., intravenous injection and intratumoral injection) significantly improved the anticancer efficacy of the exemplary short-lived bacterium mp105 compared to intravenous injection alone. This demonstrates that for clinical use, it is possible to directly inject the exemplary short-lived bacterium mp105 into primary cancer lesions and simultaneously control metastatic lesions by intravenous injection.

[0247] Example 17 Results of evaluation of short-lived bacteria as therapeutic and preventive vaccines Referring to Figures 10A and 10B, we evaluated the ability of the exemplary short-lived bacterium mp105 as a vaccine against microbial infections. mp105 is a short-lived bacterium genetically modified from type B2 Escherichia coli, possessing multiple toxic factors and antigens, and has shown high immunogenicity in previous studies. This, along with heterologous expression of exlA and further attenuation through hlyCABD deletion, made it possible to use mp105 as a safe live vaccine in subjects. The results in Figures 10A and 10B show that two subcutaneous injections of mp105 significantly reduced Salmonella typhimurium in the tested organs (including the liver and lungs). Compared to PBS, mp105 reduced the number of Salmonella typhimurium in the liver by 73.6% (Figure 10A) and in the lungs by 64.6% (Figure 10B). This demonstrates that the exemplary short-lived bacterium mp105 is effective as a therapeutic vaccine against conventional bacterial infections. Furthermore, CFT073 was detected in the liver (100 CFU / 10 mg liver tissue) of mice treated with PBS, the heart (3 CFU / 10 mg heart tissue) of mice treated with PBS, and the lung (15 CFU / 10 mg liver tissue) of mice treated with PBS. In other words, 50% of the mice treated with PBS were infected with CFT073. Conversely, CFT073 was not detected in any of the mice treated with mp105 (chi-square test, P=0.046). This indicates that the exemplary short-lived bacterium mp105 may be effective as a preventive vaccine against potential bacterial infections.

[0248] Exemplary embodiments of the contents of this disclosure have been fully illustrated hereby. Although the description refers to specific embodiments, it will be apparent to those skilled in the art that the present invention can be carried out by variations of these specific details. Therefore, the contents of this disclosure should not be construed as being limited to the embodiments described herein.

[0249] For example, a medical effector that can obviously be used to treat a subject's disease or condition may be an endogenous effector of a selected bacterial strain. These medical effectors may be overexpressed or suppressed depending on the specific design of the genetic modification. Heterologous expression of medical effectors derived from other strains or sources may also be used.

[0250] For example, while the deletion of the essential gene aspartate-semialdehyde dehydrogenase (asd) on the chromosome is described above, deletions or mutations of other essential genes or nutrient requirement genes can also produce short-lived bacteria. These essential genes may be, but are not limited to, asd, csrA, thyA, dapA, dapB, ribF, ispH, folA, ftsL, murE, mraY, lpxC, secA, can, heml, map, rpsB, and tsf. Appropriate primer sequences can be designed depending on the relevant genes.

[0251] For example, the gene deletion in the chromosome described above was achieved by the lambda (λ)-Red recombination system, but other gene modification techniques known in this field, such as restriction endonuclease cloning, may also be used.

[0252] For example, while the bacterial strains used above are Escherichia coli strains, other bacterial strains, including Gram-positive and Gram-negative bacteria, can also be used. Examples include, but are not limited to, the genera Bacillus, Escherichia, Salmonella, Sigella, and Listeria. Other bacteria, such as those belonging to the genera Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, and Lactococcus, may also be used.

[0253] For example, the gene modification described above is a gene deletion, but other gene modifications such as gene mutations may also be used. Short-lived bacteria can be produced by introducing two or more gene modifications.

[0254] For example, the regulatory effector is DAP. However, depending on the relevant genetic modifications used, other regulatory effectors may be used. In some embodiments, the regulatory effector is non-toxic and can be safely used in a subject.

[0255] For example, exemplary embodiments of the expression of the cytotoxin ExlA are described above, but other constructs of short-lived bacteria that heterologously express other proteins or cytotoxins having a therapeutic effect may be used. The other proteins may be combinations that can be used in anti-cancer effectors or cancer therapies. Exemplary anti-cancer effectors may be the expression of one or more genes selected from the group consisting of exolysin A (ExlA) of Pseudomonas aeruginosa, non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuolating toxin of Helicobacter pylori, but are not limited thereto.

[0256] For example, exemplary embodiments of the heterologous expression of ExlA from Pseudomonas aeruginosa in Escherichia coli are described above, but the expression of one or more homologous or heterologous genes of other medical effectors may be used.

[0257] For example, the constitutive promoter oxb18 is described above, but the expression of the medical effector may be driven by other constitutive promoters or inducible promoters. Exemplary inducible promoters can be induced in response to tumor-specific microenvironments such as hypoxic or low-glucose conditions.

[0258] For example, other suitable leader sequences and terminator regions or other sequences or motifs can be introduced into the medical effector gene sequence to improve the expression of the protein in bacteria.

[0259] For example, the gene exlA mentioned above is expressed in plasmid pBAD, but other suitable plasmids may be used, and the gene may be expressed by being incorporated into a chromosome rather than in a plasmid. While medical effector genes can be expressed in plasmids, if the gene is inserted into a bacterial chromosome, the medical effector gene can also be expressed on the chromosome.

[0260] For example, short-lived bacteria such as SH3, SH4, mp107, mp105, and mp106 in the exemplary examples above may be used to treat a subject's disease or condition. However, short-lived bacteria may also be used as vaccines to prevent cancer or infection, or for diagnostic purposes.

[0261] For example, the gene expression of short-lived bacteria for treating cancer may be other medical effectors or anti-cancer factors such as CpG, cyclic dinucleotides, antigens, or other cytotoxins such as non-hemolytic enterotoxin (Nhe) and hemolysin from Bacillus cereus, and vacuolated toxin from Helicobacter pylori, or a combination of these anti-cancer factors.

Claims

1. It is a genetically modified, living bacterium. At least one effector gene that codes for at least one medical effector, At least one genetic modification, Including at least one toxic gene modification, Here, the bacterium in question is a toxic strain of E. coli. At least one effector gene contains the gene encoding exolysin A (ExlA) of Pseudomonas aeruginosa and a partial DNA fragment of the hemolysin III coding gene. The genetic modification involves deleting aspartate-semialdehyde dehydrogenase (ASD) from the bacterial chromosome, thereby shortening the lifespan of the bacteria, so that the living bacteria survive for a sufficient time after administration to a subject to enable the medical effector to produce at least one medical effect, and die after a time that minimizes the mechanism of disease development in the subject. The toxic gene modification involves the deletion of the hlyCABD operon from the bacterial chromosome, thereby weakening the bacterial toxicity. Genetically modified, living bacteria.

2. The bacterium according to claim 1, wherein the heterologous gene further comprises a leader sequence and / or a terminator region that improves heterologous expression in the bacterium.

3. The bacterium according to claim 1 or 2, wherein the target disease or condition is cancer or tumor, and the medical effector causes cancer or tumor suppression in the subject.

4. The bacterium according to claim 3, wherein the cancer is lung cancer.

5. The bacteria described above is the bacteria according to any one of claims 1 to 4, formulated for intravenous administration.

6. The bacterium according to any one of claims 1 to 5, wherein, when administered intravenously, the time sufficient to minimize the pathogenesis is less than 2 days, less than 5 days, or less than 11 days.

7. The bacteria described above is the bacteria according to any one of claims 1 to 6, formulated for topical administration.

8. The bacteria according to any one of claims 1 to 7, wherein when administered locally at the injection site, the bacteria survive at the injection site for up to 5 days, but die within 48 hours outside the injection site.

9. The aforementioned bacteria measured 7.5 × 10 9 The bacteria according to claim 5, administered in an equivalent dose of cfu / kg mice.

10. The bacterium according to any one of claims 1 to 9, wherein the disease is cancer or a tumor, and the bacterium is administered intratumorally.

11. The aforementioned bacteria present at least 5 × 10⁶ bacteria per gram of tumor. 8 Approximately 100-200 mm with an equivalent dose of CFU 3 The bacteria according to claim 10, which are administered.

12. The bacterium according to any one of claims 1 to 11, wherein the bacterium expresses a sequence having at least 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:

40.

13. The bacterium according to any one of claims 1 to 12, wherein the bacterium expresses a first sequence having at least 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO: 41, and / or expresses a second sequence having at least 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:

42.

14. The bacterium according to claim 12 or 13, wherein the bacterium is strain mp105, deposit number 22555, deposited with the China Common Microbial Species Preservation and Management Center (CGMCC).

15. The aforementioned bacteria are 2 × 10 8 The bacterium according to any one of claims 12 to 14, administered in a cfu / mouse equivalent dose.

16. The bacteria according to any one of claims 12 to 14, wherein the bacteria are formulated to be administered in combination by intravenous injection and intratumor injection.

17. The aforementioned intratumor injection was 7.5 × 10 7 The equivalent dose of cfu / mouse is present, and the intravenous injection is 3 × 10 7 The bacterium according to claim 16, having a cfu / mouse equivalent dose.

18. An immunogenic composition comprising the bacteria described in any one of claims 1 to 17.

19. A living bacterial vaccine comprising the bacteria described in any one of claims 1 to 17 and optionally an adjuvant.

20. A pharmaceutical composition for use in treating a disease or symptom, comprising an effective amount of the bacteria described in any one of claims 1 to 17.

21. The composition according to claim 20, wherein the disease is a tumor or cancer.

22. A method for constructing genetically modified, living bacteria, By including the step of genetically modifying bacteria, the bacteria are At least one effector gene encoding at least one medical effector, At least one gene modification, and It includes at least one toxic gene modification, Here, the bacterium in question is a toxic strain of E. coli. At least one effector gene contains the gene encoding exolysin A (ExlA) of Pseudomonas aeruginosa and a partial DNA fragment of the hemolysin III coding gene. The genetic modification involves deleting aspartate-semialdehyde dehydrogenase (ASD) from the bacterial chromosome, thereby shortening the lifespan of the bacteria, so that the living bacteria survive for a sufficient time after administration to a subject to enable the medical effector to produce at least one medical effect, and die after a time that minimizes the mechanism of disease development in the subject. A method for toxic gene modification, which involves the deletion of the hlyCABD operon from the bacterial chromosome, thereby weakening the toxicity of the bacteria.

Citation Information

Patent Citations

  • Bacteria engineered for disease treatments that benefit from reduced gastrointestinal inflammation and / or enhanced gastrointestinal mucosal barrier

    JP2018512841A

  • Recombinant bacterium to decrease tumor growth

    US20130209405A1

  • Microorganisms programmed to produce immune modulators and Anti-cancer therapeutics in tumor cells

    WO2019014391A1

  • Engineered immunostimulatory bacterial strains and uses thereof

    WO2019014398A1

  • Bacteria for targeting tumors and treating cancer

    WO2019047679A1