Expression vector and method

Abstract

The present disclosure relates to regulatable expression vectors for systematically controlling and silencing the expression of therapeutic molecules and their uses, for example, in treating ocular disorders such as choroidal neovascularization.

Description

Technical Field

[0001] The present disclosure relates to an inducible expression vector for systematically controlling and silencing the expression of therapeutic molecules, and its uses, such as for treating eye disorders such as choroidal neovascularization.

Background Art

[0002] Gene delivery using viral vectors can result in transgene expression that persists over a long period in the eye. However, technical improvements are required to transfer current systems to clinical practice. One problem is the ability to regulate transgene expression. To avoid abnormal production of therapeutic agents, control must be maintained not only temporally but also quantitatively. Moreover, certain diseases have a narrow therapeutic window, and thus treatment must be not only precise but also timely. Incorporating cell-specific regulatory elements may help in this process, but such elements have not been identified in all eye cell types, and those that have been identified are generally quite large and exceed the size constraints of viral vectors with limited cargo capacity.

[0003] Therefore, there is a need for new expression vectors and methods for regulated gene delivery.

Summary of the Invention

[0004] Regulation or silencing of the expression of therapeutic genes in the eye may be necessary when their effects cause unexpected or unwanted impacts. Accordingly, the inventors have developed an inducible expression vector for systematically controlling and silencing the expression of therapeutic molecules.

[0005] In the first example, the disclosure includes an expression vector comprising a deactivation switch and a moduloable element functionally linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the moduloable element is regulated by a moduloable compound, and activation of the deactivation switch silencing the expression of the nucleic acid encoding the therapeutic molecule from the vector.

[0006] In one example, the discontinuation switch includes a first site-specific recombinant sequence and a second site-specific recombinant sequence, and recombination between the first and second site-specific recombinant sequences silences the expression of the therapeutic molecule.

[0007] In one example, the first site-specific recombinant sequence is located upstream of the nucleic acid sequence encoding the therapeutic molecule, and the second site-specific recombinant sequence is located downstream of the nucleic acid sequence encoding the therapeutic molecule.

[0008] In one example, the first and second site-specific recombinant sequences are loxP sites.

[0009] In one example, the expression vector further comprises a constitutive promoter functionally ligated to a nucleic acid sequence encoding a regulatory compound-binding polypeptide that can bind to the regulatory compound, and the regulatory compound-binding polypeptide modulates the expression of a therapeutic molecule when bound to the regulatory compound.

[0010] For example, a regulatory compound-binding polypeptide promotes the expression of a therapeutic molecule when bound to a regulatory compound.

[0011] For example, a regulatory compound-binding polypeptide suppresses the expression of a therapeutic molecule when it binds to a regulatory compound.

[0012] For example, the regulatory compound-binding polypeptide includes one or more of the following: reverse tetracycline regulatory transactivators (rtTAs), tetracycline regulatory transactivators (tTAs), or cysteine ​​metabolic repressors (CymRs).

[0013] In one example, the regulatory compound-bound polypeptide contains the amino acid sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0014] Examples of regulatory compounds include tetracycline, cumate, progesterone, glucocorticoids, estrogen, or mifepristone.

[0015] For example, a moduloable element may include one or more of the following: a tetracycline response element (TRE), a chemate operator (CuO), an ecdysone response element (EcRE), an estrogen response element (ERE), a glucocorticoid response element (GRE), a progesterone response element (PRE), a heat shock sequence element (HSE), or a photoinducible promoter.

[0016] For example, the adjustable element includes the nucleic acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5.

[0017] In one example, the constitutive promoter is the compound human CMV-EF1-HTLV promoter.

[0018] In one example, the constitutive promoter contains the nucleic acid sequence shown in SEQ ID NO: 6.

[0019] In one example, therapeutic molecules inhibit angiogenesis.

[0020] In one example, therapeutic molecules inhibit inflammation.

[0021] In one example, the therapeutic molecule is a nucleic acid or polypeptide.

[0022] For example, therapeutic molecules are - Including endostatins, angiostatins, or fusions of endostatins and angiostatins; -It is a binding protein; - Comprising the antigen-binding site of an antibody; - Selected from the group consisting of ranibizumab, bevacizumab, and aflibercept; - Suppressing inflammation; or - Interleukin 10 (IL-10), interleukin 1 receptor antagonist (IL-1RA), or a fusion of IL-10 and IL-1RA.

[0023] In one example, the expression vector further comprises a transcriptional repressor between a constitutive promoter and a regulatable promoter.

[0024] In one example, the expression vector is - A first loxP site located upstream of the nucleic acid sequence encoding the therapeutic molecule, and a second loxP site located downstream of the nucleic acid sequence encoding the therapeutic molecule, - A regulatable promoter comprising a tetracycline response element operably linked to the nucleic acid sequence encoding the therapeutic molecule, and - A constitutive promoter operably linked to the nucleic acid sequence encoding the reverse tetracycline-controlled transactivator (rtTA). including.

[0025] In one example, the expression vector is a viral vector. In one example, the expression vector is an adeno-associated virus (AAV) vector.

[0026] The inventors also found that the vectors disclosed herein appear to be particularly effective in regulating inflammatory pathways and / or angiogenesis. These findings suggest that the expression vectors of the present disclosure may be useful in treating eye disorders. Thus, in another example, the present disclosure provides a method of treating an eye disorder in a subject, the method comprising administering an effective amount of an expression vector comprising a stop switch and a nucleic acid encoding a therapeutic molecule, wherein activation of the stop switch silences the expression of the therapeutic molecule.

[0027] In one example, the expression vector further includes a moduloable element functionally linked to a nucleic acid encoding a therapeutic molecule, the activity of which is regulated by administration of a modulating compound to the target.

[0028] In one example, the method described herein further comprises administering a second expression vector comprising a constitutive promoter functionally ligated to a nucleic acid sequence encoding a regulatory compound-binding polypeptide capable of binding to a regulatory compound, the regulatory compound-binding polypeptide modulating the expression of a therapeutic molecule from the first expression vector upon binding to the regulatory compound.

[0029] In one example, the expression vector further comprises a constitutive promoter functionally ligated to a nucleic acid sequence encoding a regulatory compound-binding polypeptide that binds to the regulatory compound, and the regulatory compound-binding polypeptide modulates the expression of a therapeutic molecule when bound to the regulatory compound.

[0030] For example, a regulatory compound-binding polypeptide promotes the expression of a therapeutic molecule when it binds to a regulatory compound.

[0031] For example, a regulatory compound-binding polypeptide suppresses the expression of a therapeutic molecule when it binds to the regulatory compound.

[0032] In one example, activating the stop switch is, - One or more promoters; and / or - Nucleic acids that encode therapeutic molecules Remove it.

[0033] In one example, the cancel switch is: - One or more promoters; and / or - Nucleic acids that encode therapeutic molecules It includes a site-specific recombinant sequence positioned alongside it.

[0034] In one example, the method further includes administering an expression vector as defined herein.

[0035] In one example, eye disorders include diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, squamous cell carcinoma, corneal transplant rejection, intraocular inflammation, or superficial corneal transplant rejection.

[0036] In one example, the eye disorder is cancer. In another example, the cancer is uveal melanoma.

[0037] In one example, the eye disorder may be macular degeneration, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, central retinal vein occlusion, retinal vein branch occlusion, or intraocular neovascularization.

[0038] For example, the methods described herein include intravitreous or subretinal administration of an expression vector.

[0039] Current treatments for various eye disorders disclosed herein require the sequential administration of therapeutic agents by invasive intravitreal injection. In addition to being generally unpleasant, intravitreal administration of therapeutic agents does not eliminate the risk of infection or other side effects. One advantage of the vectors disclosed herein is their ability to be modulated non-invasively. For example, the vectors disclosed herein may be initially administered by intravitreal or subretinal injection, but thereafter they may be modulated by topical or oral administration of modulating compound(s). For example, modulating compounds may be administered as eye drop formulations. Thus, in another example, the methods described herein further include topical administration of the modulating compound to the eye.

[0040] In one example, the regulatory compound is a small molecule.

[0041] In one example, the regulatory compound is tetracycline or chmate.

[0042] In one example, the regulatory compound is administered as eye drops.

[0043] For example, the method described herein further comprises activating a discontinuation switch by administering a site-specific recombinase or a nucleic acid encoding a site-specific recombinase, the site-specific recombinase catalyzing recombination between a first site-specific recombinant sequence and a second site-specific recombinant sequence, thereby silencing the expression of a therapeutic molecule.

[0044] In another example, the present disclosure includes a method for treating an eye disorder in a subject, comprising administering an effective amount of an expression vector, the expression vector comprising a deactivation switch, a nucleic acid encoding a therapeutic molecule, a moduloable promoter functionally ligated to the nucleic acid encoding the therapeutic molecule, and a constitutive promoter functionally ligated to a nucleic acid sequence encoding a regulatory compound-binding polypeptide, wherein the activity of the moduloable promoter is regulated by the regulatory compound-binding polypeptide after administration of the regulatory compound to the subject, and the activation of the deactivation switch silencing the expression of the therapeutic molecule.

[0045] In another example, this disclosure includes expression vectors as defined herein for use in the treatment of eye disorders in subjects. In yet another example, this disclosure includes the use of expression vectors as defined herein in the manufacture of pharmaceuticals for the treatment of eye disorders.

[0046] In another example, the disclosure includes a pharmaceutical composition comprising a first expression vector as defined herein and a second expression vector comprising a constitutive promoter functionally ligated to a nucleic acid sequence encoding a regulatory compound-binding polypeptide that can bind to a regulatory compound, wherein the regulatory compound-binding polypeptide modulates the expression of a therapeutic molecule from the first expression vector when bound to the regulatory compound.

[0047] In another example, the disclosure includes a kit comprising an eye drop formulation containing an expression vector (or more) as defined herein and a regulatory compound (or more) as defined herein. In one example, the kit comprises a therapeutic system.

[0048] In one example, the kit further includes a discontinuation switch activator as defined herein.

[0049] In one example, the kit further comprises an expression vector containing a nucleic acid sequence encoding a termination switch activator as defined herein.

[0050] For example, the kit is: - Expression vectors (multiple) as defined herein, - Eye drop formulations containing tetracycline, and -Cre recombinase, or an expression vector containing a nucleic acid sequence encoding Cre recombinase. Includes.

[0051] Unless otherwise stated, any example in this specification should be construed as applicable to any other example, with appropriate modifications.

[0052] The scope of this disclosure should not be limited by the specific examples provided herein, which are for illustrative purposes only. Functionally equivalent products, compositions, and methods are clearly included within the scope of this disclosure as described herein.

[0053] Throughout this specification, unless otherwise stated or specified in the context, any reference to a single step, composition, group of steps, or group of compositions should be interpreted as encompassing one or more (i.e., one or more) of these steps, compositions, group of steps, or group of compositions.

[0054] The present disclosure will now be described by the following non-limiting embodiments with reference to the attached drawings. [Brief explanation of the drawing]

[0055] [Figure 1]Map of the cistronic switch vector skeleton. It is a bicistronic vector encoding a repressor cloning site that functions with a compound human CMV-EF1-HTLV promoter, and cloning sites for the promoter and gene of interest. The promoter site is separated by a transcriptional blocker. Two AAV2 ITR sequences for packaging within the AAV, as well as a LoxP site enabling control of vector excision and termination, are positioned alongside the construct. [Figure 2] Schematic diagram of the vector construct. Tetracycline or kmet repressor genes (SEQ ID NOs. 2 and 3, respectively) were cloned at repressor cloning site 1 using the XbaI and EcoRI restriction sites. The corresponding promoters (SEQ ID NOs. 4 and 5, respectively) were cloned at promoter cloning site 2 using the BstBI and SalI restriction sites. Conditionally regulated genes of interest were cloned at GOI cloning site 3 using the SalI and NheI restriction sites (e.g., GFP, IL-10, endo / angiostatin fusion protein, IL1RN, or IL10 / IL1RN genes shown in SEQ ID NOs. 7-11) or using compatible XhoI and XbaI sites (Nano-Luciferase, SEQ ID NO. 12). [Figure 3] Schematic diagram of the mechanism of the termination switch. A vector was constructed in which all expression sequences are located within two LoxP sites (SEQ ID NO: 13). This arrangement allows expression to occur. To permanently stop or terminate expression, a vector encoding Cre is added to the cells. Cre removes all expression sequences through splicing at the two lox sites. As a result, the vector loses its expression mechanism and cannot induce transgene expression. [Figure 4]The experimental design used to test the deactivation switch of vector constructs. Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing a Tet or Cu regulatory sequence or CMV to stimulate expression of the marker gene luciferase. After 24 hours, the cells were incubated for a further 48 hours with or without treatment with Tet or Cu, and then luciferase expression was evaluated. The ability of the system to deactivate the expression of the transgene (luciferase) was investigated by transfecting the cells with a Cre vector that excises the expression sequence between LoxP sites. The cells were washed, and the drug was re-added to the medium daily until day 7, during which changes in luciferase expression levels were evaluated. [Figure 5] Experimental results obtained by testing the deactivation switch. A shows luciferase expression in cells treated with the Tet vector with or without Tet activation (pAAV-LTetL-luc turned on). Activated cells were then treated with Cre and luciferase was tested. B shows luciferase expression in cells treated with the Cu vector with or without Cu activation. Cells with an activated Cu promoter were treated with Cre and luciferase expression was tested. C and D show luciferase expression after transfecting with the CMV vector with or without Cre-mediated excision, respectively. Significantly lower luciferase expression was detected in all Cre-excised cells. [Figure 6A]Schematic diagram of controlled expression brought about by vector systems. A shows the Tet On system. The EF1-HTLV promoter constitutively expresses a Tet transactivator protein, which is unable to bind to the Tet response element (TRE) in the Tet promoter, resulting in its inactivation and the absence of transgene expression. In the presence of tetracycline, the transactivator protein binds to the Tet response element (TRE) in the promoter, activating it and inducing transgene expression. B shows the Cu On system. In this system, a Cu repressor protein binds to the Cu operator sequence in the absence of Cu, thereby inactivating the promoter and resulting in the absence of transgene transcription. With the addition of Cu, Cu binds to the repressor protein bound to the Cu promoter, thereby releasing the repressor and enabling transgene transcription. [Figure 6B] Schematic diagram of controlled expression brought about by vector systems. A shows the Tet On system. The EF1-HTLV promoter constitutively expresses a Tet transactivator protein, which is unable to bind to the Tet response element (TRE) in the Tet promoter, resulting in its inactivation and the absence of transgene expression. In the presence of tetracycline, the transactivator protein binds to the Tet response element (TRE) in the promoter, activating it and inducing transgene expression. B shows the Cu On system. In this system, a Cu repressor protein binds to the Cu operator sequence in the absence of Cu, thereby inactivating the promoter and resulting in the absence of transgene transcription. With the addition of Cu, Cu binds to the repressor protein bound to the Cu promoter, thereby releasing the repressor and enabling transgene transcription. [Figure 7]Schematic diagram of the experimental design used to test the ability of vector constructs to regulate transgene expression. Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing a Tet or Cu regulatory sequence to promote the expression of the marker gene luciferase. After 24 hours, the cells were incubated for a further 48 hours with or without Tet or Cu treatment, and then luciferase expression was evaluated. The ability of the system to stop transgene (luciferase) expression was examined by removing Tet or Cu from the cells by washing before re-examining luciferase expression. Cells without Tet or Cu were used as controls, and cells with Tet or Cu not removed were also used as controls. [Figure 8] Gene expression regulated using vector constructs. A shows the results from a luminescence assay performed on day 7 of an experiment using tetracycline as the agent to switch on transgene production. B shows the results from a luminescence assay performed on day 7 of an experiment using cumate as the agent to switch on transgene production. In both experiments, the substrate (Tet or Cu) was able to induce significant levels of luciferase, and expression could be regulated by substrate removal, resulting in significantly reduced luciferase detection. [Figure 9] Schematic diagram of the experimental design used to investigate the effect of a vector containing an endo / angiostatin fusion (EAS) sandwiched in the LoxP site on angiogenesis using a tube formation assay with or without Cre. Young passaged (p2-4) HUVECs were transfected with a chemate-regulated vector (pAAV-LCuL-EAS) that produces EAS. Cells were counted two days after transfection, seeded in geltrex-coated wells, incubated at 37°C and 5% CO2 for 14-18 hours, and then photographed the tubes formed in the geltrex and analyzed using the ImageJ angiogenesis analyzer. [Figure 10]Results obtained by testing the effect of EAS on tubule formation in HUVECs. A shows HUVEC tubule formation in cells transfected with non-EAS-expressing pAAV-LCuL-EAS without Cu activation. B shows inhibition of tubule formation when HUVECs are treated with activated pAAV-LCuL-EAS. C shows recovery of tubule formation ability when activated pAAV-LCuL-EAS is excised with Cre. D and E quantify the total mesh area and total branch length, respectively, using ImageJ angiogenesis analysis software. The pAAV-LCuL-EAS vector was able to reduce tubule formation, but this tubule formation was generally reversed when the vector was excised with Cre. [Figure 11] Schematic diagram of the experimental design used to evaluate a vector containing Cu-regulated IL-10 with a LoxP site positioned aside, in relation to the induction of pro-inflammatory signaling determined by IL-6 expression, with or without Cre. Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing a Cu-regulated sequence to induce anti-inflammatory IL-10 expression. The negative control consisted of an IL-10 vector lacking Cu activation and treated with Cre. The IL-10 group consisted of an IL-10 vector activated by Cu. The discontinuation group consisted of an activated IL-10 vector treated with Cre. Cell expression of IL-10 and the pro-inflammatory marker IL-6 was examined by ELISA. [Figure 12]Results obtained from simultaneous ELISA of IL-10 and IL-6 after transfecting cells with or without Cre-containing crumate-regulated vectors containing IL-10. In cells treated with negative control vectors (without Cu and with Cre), detected levels of IL-10 were low and correlated with high levels of pro-inflammatory IL-6. Conversely, cells treated with Cu-regulated IL10 vectors (activated IL10 vectors) in the presence of Cu expressed high levels of IL-10, which correlated with low levels of IL-6 expression. Vectors in which IL-10 was excised by Cre (discontinued IL10 vectors) showed levels of IL-10 and IL-6 similar to those of the negative control, indicating favorable discontinuation of vector expression. [Modes for carrying out the invention]

[0056] Sequence Listing Guide Sequence ID 1: Nucleic acid sequence, termination switch vector skeleton. Sequence ID 2: Nucleic acid sequence, reverse tetracycline regulatory transactivator (rtTA). Sequence ID 3: Nucleic acid sequence, chemite repressor (CymR). Sequence ID 4: Nucleic acid sequence, tetracycline promoter. Sequence ID 5: Nucleic acid sequence, chemate promoter. Sequence ID 6: Nucleic acid sequence, CMV-EF1-HTLV promoter. Sequence ID 7: Nucleic acid sequence, green fluorescent protein (GFP). Sequence ID 8: Nucleic acid sequence, therapeutic polypeptide, interleukin (IL) 10. Sequence ID 9: Nucleic acid sequence, therapeutic polypeptide, endo / angiostatin. Sequence ID No. 10: Nucleic acid sequence, therapeutic polypeptide, interleukin-1 receptor antagonist (IL-1RA). Sequence ID 11: Nucleic acid sequence, therapeutic polypeptide, IL-10-IL-1RA. Sequence ID 12: Nucleic acid sequence, Nanoluciferase Sequence ID 13: Nucleic acid sequence, LoxP site Sequence ID 14: Nucleic acid sequence, transcription blocker Sequence ID 15: Nucleic acid sequence, pAAV-LCuL-EAS Sequence ID 16: Nucleic acid sequence, pAAV-LCuL-IL10 Sequence ID 17: Amino acid sequence, reverse tetracycline regulatory transactivator (rtTA) Sequence ID 18: Amino acid sequence, chemotripsy (CymR) Sequence ID 19: Amino acid sequence, therapeutic polypeptide, interleukin (IL) 10 Sequence ID No. 20: Amino acid sequence, therapeutic polypeptide, endo / angiostatin Sequence ID No. 21: Amino acid sequence, therapeutic polypeptide, interleukin-1 receptor antagonist (IL-1RA) Sequence ID 22: Nucleic acid sequence, LoxP site-mutant Sequence ID 23: Nucleic acid sequence, LoxP site -lox511 Sequence ID 24: Nucleic acid sequence, LoxP site -lox5171 Sequence ID 25: Nucleic acid sequence, LoxP site -lox2272 SEQ ID NO: 26: Nucleic acid sequence, LoxP site-M2 Sequence ID 27: Nucleic acid sequence, LoxP site-M3 Sequence ID 28: Nucleic acid sequence, LoxP site-M7 Sequence ID 29: Nucleic acid sequence, LoxP site-M11 Sequence ID 30: Nucleic acid sequence, LoxP site -lox71 Sequence ID 31: Nucleic acid sequence, LoxP site -lox66 Sequence ID 32: Nucleic acid sequence, FRT site Sequence ID 33: Nucleic acid sequence, FRT site-mutant Sequence ID 34: Nucleic acid sequence, FRT site -FL-IL-10A Sequence ID 35: Nucleic acid sequence, FRT site - FRT / FL-IL-10A Sequence ID 36: Nucleic acid sequence, rox site - WT Sequence ID 37: Nucleic acid sequence, rox site - rox7 Sequence ID 38: Nucleic acid sequence, rox site - rox8 Sequence ID 39: Nucleic acid sequence, rox site -rox12 Sequence ID 40: Nucleic acid sequence, rox site - rox61 Sequence ID 41: Nucleic acid sequence, rox site - rox85 SEQ ID NO: 42: Nucleic acid sequence, att site-attP Sequence ID 43: Nucleic acid sequence, att site - attB SEQ ID NO: 44: Nucleic acid sequence, att site-proB Sequence ID 45: Nucleic acid sequence, att site - trpC SEQ ID NO: 46: Nucleic acid sequence, att site-galT SEQ ID NO: 47: Nucleic acid sequence, att site-thrA Sequence ID 48: Nucleic acid sequence, att site -rrnB

[0057] Unless otherwise specified, all scientific and technical terms used herein should be interpreted as having the same meaning as those commonly understood by those with ordinary skill in the art (e.g., molecular biology, gene therapy, genetic engineering, biochemistry, physiology, and clinical trials).

[0058] Unless otherwise indicated, the molecular and statistical techniques used in this disclosure are standard procedures known to those skilled in the art. Such techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), DMGlover and BDHames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and FMAusubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors), Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), JEColigan et al. This is described and explained throughout the literature, including sources such as al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0059] The expression vectors relating to this disclosure can be administered to a variety of subjects. For example, the subjects are mammals. Mammals may be companion animals such as dogs or cats, or domestic animals such as horses or cattle. Another example is that the subjects are humans. The terms “subject,” “patient,” or “individual” are terms that may be used interchangeably in the context of this disclosure.

[0060] As used herein, terms such as “to treat” or “to cure” refer to a clinical intervention intended to alter the natural processes of an individual or cell being treated during the course of a clinical condition. Desired effects of treatment include slowing disease progression, improving or alleviating the disease state, and achieving remission or improving prognosis. An individual is “treated” to a favorable outcome if, for example, one or more symptoms associated with the disease are alleviated or disappear. As an example, the term “treatment” refers to both therapeutic and prophylactic or protective measures for eye disorders aimed at reversing, preventing or slowing (reducing) the targeted disorder, such as exudative macular degeneration, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, central retinal vein occlusion, retinal vein branch occlusion, or intraocular neovascularization. Those who require treatment include individuals who already have an eye disorder, are prone to developing such a disorder, or need to prevent such a disorder. As an example, treatment includes stabilization and / or improvement of visual acuity.

[0061] The “effective dose” refers to the amount of medication that is effective in achieving at least the desired therapeutic or prophylactic outcome over the required period of time. The effective dose may be provided in one or more doses. In some examples of this disclosure, the term “effective dose” is used to refer to the amount required to bring about the treatment of the eye disorder or condition described above. The effective dose may vary depending on the disease or condition being treated, as well as weight, age, racial background, sex, health and / or physical condition, and other factors relating to the mammal being treated. Typically, the effective dose will fall within a relatively broad range (e.g., “dosage” range) which may be determined by conventional testing and experimentation by a physician. The effective dose may be administered as a single dose or in doses repeated once or several times over the course of treatment.

[0062] The "therapeutic effective dose" is the minimum concentration required to produce at least a measurable improvement in a particular eye disorder (e.g., exudative macular degeneration). In this specification, the therapeutic effective dose may also vary depending on factors such as the patient's disease state, age, sex, and weight, as well as the individual's ability to elicit the desired response from the therapeutic agent. The therapeutic effective dose is also the amount at which the therapeutically beneficial effect outweighs any toxic or adverse effects of the therapeutic agent. For the treatment of exudative macular degeneration, in vivo effectiveness may be measured by, for example, one or more of the following: assessment of the mean change in best-corrected visual acuity (BCVA) from baseline to a desired time; assessment of the percentage of subjects whose visual acuity decreases to less than 15 letters at the desired time compared to baseline; assessment of the percentage of subjects whose visual acuity increases to 15 letters or more at the desired time compared to baseline; assessment of the percentage of subjects with Snellen visual acuity equivalent to or worse than 20 / 2000 at the desired time; assessment of the NEI Visual Function Questionnaire; and assessment of the size of choroidal neovascularization (CNV) and / or CNV leakage at the desired time as assessed by fluorescein angiography.

[0063] As used herein, the term “promoter” should be interpreted in its broadest context and includes transcriptional regulatory sequences of genomic genes, including TATA boxes or initiation elements required for accurate transcription initiation, whether or not there are additional regulatory elements (e.g., upstream activating sequences, transcription factor binding sites, enhancers) that alter nucleic acid expression, for example, in response to development and / or external stimuli or in a tissue-specific manner. An exemplary promoter may contain copies of one or more additional specific regulatory elements to further enhance the expression of the nucleic acid and / or alter spatial and / or transient expression. In one example, the promoter is a regulated promoter as described herein. Another example of a promoter encompassed by this disclosure is a “constitutive promoter.” Such promoters are constitutively active (i.e., they constitutively produce, activate, or enhance nucleic acid expression).

[0064] The term "functionally linked" means that the expression element is positioned relative to the nucleic acid as defined herein so that the expression of the nucleic acid is controlled by the expression element.

[0065] As used herein and in the claims set forth herein, singular terms and singular "a," "an," and "the" optionally include plural meanings, unless otherwise evident from the context. Therefore, for example, a reference to "therapeutic molecule" optionally includes one or more therapeutic molecules.

[0066] As used herein, the term “about” means + / - 10%, more preferably + / - 5%, and more preferably + / - 1% of the specified value, unless otherwise indicated.

[0067] The terms "and / or," for example, "X and / or Y," should be understood to mean either "X and Y" or "X or Y," and should be interpreted as giving explicit support for both meanings or either one of them.

[0068] Throughout this specification, the term "comprise" or its variations, such as "comprises" or "contains," will be understood to implicitly mean that it encompasses the specified element, integer, or step, or group of elements, integers, or steps, but does not exclude any other element, integer, or step, or group of elements, integers, or steps.

[0069] Cancel switch The expression vectors contained herein include “termination switches.” The term “termination switch” refers to an element of a vector as defined herein that can silence the expression of a nucleic acid encoding a therapeutic molecule(s) from the vector. The term “silencing” is used in this context to mean complete and irreversible suppression of expression. For example, silencing completely eliminates the expression of a nucleic acid encoding a therapeutic molecule from an expression vector as defined herein.

[0070] In one example, a termination switch can facilitate the removal of a nucleic acid sequence or part thereof encoding a therapeutic molecule(s). In another example, a termination switch can facilitate the removal of some or all of the transcription mechanisms required for the expression of a therapeutic molecule(s). In yet another example, a termination switch can facilitate the removal of one or more promoters. In yet another example, a termination switch can facilitate the removal of a transactivator gene. In yet another example, a termination switch can facilitate the removal of an entire expression cassette from the vector (i.e., all foreign genes and regulatory elements are removed). In yet another example, a termination switch can facilitate the inversion of a sequence encoding one or more of the above elements. For example, a termination switch can facilitate the inversion of some or all of the sequences encoding a promoter(s), therapeutic molecule(s), or transactivator(s). An example of a termination switch vector skeleton is shown in Sequence ID No. 1.

[0071] In one example, the termination switch is a pair of site-specific recombination sequences. In this example, recombination between the site-specific recombination sequences silences the expression of the nucleic acid encoding the therapeutic molecule. In another example, the termination switch is a pair of site-specific recombination sequences that are cleaved after contact with a recombinase. In one example, the site-specific recombination sequences are "placed aside" of the nucleic acid encoding the therapeutic molecule. In other words, the first site-specific recombination sequence is located upstream of the therapeutic molecule, and the second site-specific recombination sequence is located downstream of the therapeutic molecule. In another example, the site-specific recombination sequences are placed aside some or all of the transcriptional mechanisms involved in the expression of the nucleic acid encoding the therapeutic molecule. For example, the site-specific recombination sequences may be placed aside of one or more promoters disclosed herein. In yet another example, the site-specific recombination sequences are placed aside of all genes and regulatory elements in the vector. Those skilled in the art will recognize that having site-specific recombination sequences placed aside of all genes and regulatory elements in the vector provides a safety mechanism that allows for the removal of all foreign genes and regulatory elements from the vector in the event of, for example, an abnormal immune response or malignant transformation in the host.

[0072] Those skilled in the art will recognize that the position and orientation of site-specific recombinant sequences can promote inversion or excision of a region from a vector. Thus, in one example, site-specific recombinant sequences are positioned to promote excision. For example, site-specific recombinant sequences may be positioned in the same orientation. In another example, site-specific recombinant sequences may be positioned to promote inversion. For example, site-specific recombinant sequences may be positioned in opposing orientations.

[0073] In one example, the termination switch may include a pair of LoxP sites that are cleaved after contact with Cre recombinase. Exemplary LoxP sites are described in Hoess et al. (1982) PNAS, 3398:402. For example, the vector defined herein may include the canonical loxP sequence ATAACTTCGTATA-[spacer]-TATACGAAGTTAT. In one example, the vector defined herein may include a pair of sites having the nucleotide sequence shown in SEQ ID NO: 13. Other examples or LoxP sites are shown in Table 1. [Table 1]

[0074] In another example, the discontinuation switch may include a pair of short flippase-recognition target (FRT) sites that are cleaved after contact with flippase (Flp). Exemplary FRT sites are described in Bolusani et al. 2006 Nucleic Acids Res. 34:5259-69. For example, the vector as defined herein may include the canonical FRT sequence GAAGTTCCTATTC-[spacer]-GtATAGGAACTTC (e.g., SEQ ID NO: 32). Other examples or FRT sites are shown in Table 2. [Table 2]

[0075] In another example, the termination switch may include a pair of rox sites that are cleaved after contact with Dre recombinase. Exemplary rox sites are described in Anastassiadis et al., 2009 Dis Model Mech 2:508-515. For example, the vector as defined herein may include the canonical rox sequence TAACTTTAAATAAT-[spacer]-ATTATTTAAAGTTA. Examples of other rox sites are described in Chuang et al. 2016 G3 (Bethesda) 6:559-571, including those shown in Table 3. [Table 3]

[0076] In another example, the termination switch may include a pair of att sites that are cleaved after contact with phiC31 integrase. Exemplary att sites are described in Thorpe and Smith, 1998 PNAS 95:5505-5510. For example, the vector as defined herein may include the canonical attP sequence TCAGCTTTTTTATACTAAGTTGG (SEQ ID NO: 42) and the canonical attB sequence CCTGCTTTTTTATACTAACTTGA (SEQ ID NO: 43). Examples of second important att sites are shown in Table 4. [Table 4]

[0077] The reactivation switches as defined herein can be activated by a variety of mechanisms. For example, a reactivation switch can be brought into contact with a “reactivation switch activator.” In the context of this disclosure, the term “reactivation switch activator” is used to refer to an element that can activate the reactivation switches disclosed herein and silence the expression of nucleic acids encoding therapeutic polypeptides. For example, a reactivation switch activator is an enzyme. For example, an enzyme can bind to one or more of the site-specific recombinant sequences described above. For example, an enzyme is a recombinase. For example, an enzyme is a tyrosine recombinase. For example, an enzyme is a Cre recombinase (see, e.g., Sauer and Henderson (1988) PNAS 85:5166-5170, US4959317, registration P06956). For example, an enzyme is a Dre recombinase (see, e.g., Anastassiadis et al., 2009 Dis Model Mech 2:508-515, registration AAV84949). In another example, the enzyme is a flippase. For example, the enzyme could be FLP recombinase (see, e.g., Sadowski and Zhu (1995) J Biol Chem. 270:23044:23054, registration P03870). In yet another example, the enzyme is a serine recombinase. In one example, the enzyme is phiC31 integrase (see, e.g., Thorpe and Smith, 1998 PNAS 95:5505-5510, registration NP_047974).

[0078] Expression vector In the context of this disclosure, the term “expression vector” is used to refer to a gene construct that facilitates the expression of nucleic acids in host cells. Expression vectors may exist as isolated polynucleotides, e.g., “naked DNA,” or they may contain one or more agents that enhance delivery to host cells, e.g., viral capsids and / or envelopes, lipids, or polymers. Thus, examples of expression vectors encompassed by this disclosure include, but are not limited to, naked DNA, phages, viruses, nanoparticles, e.g., lipid-based nanoparticles, plasmids, linear DNA, cosmids, episomes, circular DNA (as described in US2004 / 0214329), and bacteria. In another example, expression vectors are transposons, e.g., PiggyBac and PiggyBat (see Wu et al., PNAS, 103:15008-13, 2006; and WO2010 / 085699).

[0079] The expression vectors encompassed by this disclosure include DNA or RNA vectors. In one example, the expression vector is single-stranded. In another example, the expression vector is double-stranded.

[0080] Exemplary vector components include, but are not limited to, one or more of the following: sequences encoding therapeutic molecules and / or regulatory compound-binding polypeptides, promoters, such as regulatory promoters as defined herein, and transcription termination sequences.

[0081] In one example, an expression vector can transform host cells and result in the expression of nucleic acids encoding therapeutic molecules. In another example, the expression vector can be replicated within the host cell. In yet another example, the expression vector cannot be replicated within the host cell. In some examples, the expression vector can be integrated into the genome of the host cell.

[0082] The choice of expression vector will depend on various factors, such as the host, the immunogenicity of the vector, and the desired duration of therapeutic molecule production. For example, the expression vector may be a viral vector. In another example, it may be an adeno-associated virus (AAV) vector. In yet another example, it may be a retroviral vector. In yet another example, it may be a lentiviral vector. In yet another example, it may be an adenovirus vector.

[0083] AAV vectors typically contain 145 nt terminal inverted repeats (ITRs) at both ends, each containing sequences required for DNA replication and packaging into nucleic acid delivery virions. In one example, an ITR from AAV serotype 2 is used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those skilled in the art (see WO2006 / 110689). Various recombinant AAV vector systems have been developed for nucleic acid delivery because they are non-pathogenic and exhibit broad tissue specificity. AAV vectors can be readily constructed using techniques known in the art. For example, U.S. Patents 5,173,414 and 5,139,941, International Publications WO1992 / 01070 and WO1993 / 03769, Lebkowski et al. Molec. Cell. Biol. 5:3988-3996, 1988, Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press), Carter Current Opinion in Biotechnology 5:533-539, 1992, Muzyczka Current Topics in Microbiol, and Immunol. 158:97-129, 1992, Kotin Human Gene Therapy 5:793-801, 1994, Shelling and Smith Gene Therapy 7:165-169, 1994, and Zhou et al. J See Exp.Med.179:1867-1875,1994.

[0084] In another example, AAV is self-complementary AAV (sc-AAV) (see, for example, US2012 / 0141422). Self-complementary AAV vectors package a reverse-direction repetitive sequence genome that folds into dsDNA without requiring DNA synthesis or base pairing between multiple vector genomes.

[0085] Retroviral vectors generally contain cis-acting long-terminal repeat sequences (LTRs) capable of packaging foreign sequences of 6–10 kb or less. A minimal cis-acting LTR is sufficient for vector replication and packaging, which is then used to integrate the expression construct into target cells for long-term expression. Widely used retroviral vectors include those based on mouse leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SrV), human immunodeficiency virus (HIV), and combinations thereof (e.g., Buchscher et al., J Virol. 56:2731-2739 (1992), Johann et al., J. Virol. 65:1635-1640 (1992), Sommerfelt et al., Virol. 76:58-59 (1990), Wilson et al., J. Virol. 63:274-2318 (1989), Miller et al., J. Virol. 65:2220-2224 (1991), PCT / US94 / 05700, Miller and Rosman BioTechniques). See 7:980-990, 1989; Miller, ADHuman Gene Therapy 7:5-14, 1990; Scarpa et al. Virology 75:849-852, 1991; Burns et al. Proc.Natl.Acad.Sci USA 90:8033-8037, 1993.

[0086] Other viral vectors include, for example, viruses from the pox family, such as vaccinia virus and avian poxvirus, or those derived from alphaviruses, or composite viral vectors (e.g., those described in Fisher-Hoch et al., PNAS 56:317-321, 1989).

[0087] In another example, the expression vector is a plasmid. In one example, the expression vector may be a high copy number plasmid. In one example, a high copy number plasmid can produce approximately 100 to 1,000 copies per cell. In another example, a high copy number plasmid can produce approximately 200 to 500 copies per cell. In yet another example, the expression vector is a low copy number plasmid. In one example, a low copy number plasmid can produce approximately 20 to 100 copies per cell. In yet another example, a low copy number plasmid can produce approximately 20 to 50 copies per cell.

[0088] Other suitable examples of expression vectors include those that function (i.e., promote expression) in mammalian, preferably human, cells.

[0089] In some cases, expression vectors promote the expression of therapeutic polypeptides in specific cell types. Therefore, in some cases, expression vectors include cell type-specific promoters. For example, an expression vector may include a retinal cell-specific promoter, such as a mouse phosphoglycerate kinase 1 (PGK) promoter, an elongation factor-1 (EFS) promoter, a vitiligo macular dystrophy (VMD2) promoter, a red / green opsin promoter, a thymocyte antigen promoter, or a rhodopsin (Rho) promoter. In other cases, expression vectors promote expression in tumor cells. Such vectors may include, for example, a tumor-specific promoter(s), and / or molecules that bind to tumor-specific cell surface molecules to facilitate entry into tumor cells.

[0090] Expression vectors encompassed by this disclosure may be modified to increase the expression of nucleic acids encoding therapeutic molecules. Useful recombination techniques for increasing expression include, but are not limited to, functionally ligating the nucleic acid sequence encoding the therapeutic molecule into a high-copy-number plasmid, incorporating the molecule into one or more host cell chromosomes, adding vector stability sequences, substituting or modifying transcriptional regulatory signals (e.g., promoters, operators, enhancers), substituting or modifying translational regulatory signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modifying the nucleic acid sequence encoding the therapeutic molecule to correspond to codon use by the host cell, and deleting sequences that destabilize the transcript.

[0091] In some examples, expression vectors may contain regulatory sequences, such as transcriptional regulatory sequences, translational regulatory sequences, origins of replication, and other regulatory sequences that control the expression of nucleic acid sequences that are suitable for the target and encode therapeutic molecules. Transcriptional regulatory sequences are sequences that control the initiation, elongation, and / or termination of transcription. Particularly important transcriptional regulatory sequences are those that control transcription initiation, such as promoters, enhancers, operators, and repressor sequences. A variety of suitable transcriptional regulatory sequences are known to those skilled in the art. Examples include tac, lac, trp, trc, oxy-pro, omp / lpp, rrnB, bacteriophage lambda, bacteriophage T7, T7lac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01, metallothionein, alpha-conjugation factors, pichia alcohol oxidase, alphavirus subgenome promoters (e.g., Sindbisvirus subgenome promoter), antibiotic resistance genes, baculoviruses, Heliothis zea insect viruses, vaccinia viruses, herpesviruses, raccoon poxviruses, other poxviruses, adenoviruses, cytomegaloviruses (e.g., intermediate early promoters), monkey virus 40, retroviruses, actin, retrovirus long-chain terminal repeat sequences, Roussarcoma virus, heat shock, and phosphate and nitrate transcriptional regulatory sequences.

[0092] In one example, the expression vector further includes a transcription blocker between the constitutive promoter and the regulated promoter. The transcription blocker can be used to prevent transcriptional interference between multiple nearby promoters. Such transcription blockers are beneficial for tightly regulated expression systems, such as those used in gene therapy. The transcription blocker may include one or more polyadenylated signaling sequences and a transcription pause site to reduce background expression. Suitable transcription blockers are described, for example, in Eggermont and Proudfoot, EMBO J, 12:2539-2548, 1993. In one example, the transcription blocker includes the sequence shown in SEQ ID NO: 14.

[0093] In another example, the expression vector contains the nucleic acid sequence shown in SEQ ID NO: 15. In yet another example, the expression vector contains the nucleic acid sequence shown in SEQ ID NO: 16.

[0094] Adjustable elements, adjusting compounds, and molecules that bind adjusting compounds For example, a vector as defined herein includes a tunable element functionally ligated to a nucleic acid sequence encoding a therapeutic molecule. For instance, the tunable element may be functionally ligated to a nucleic acid sequence encoding a therapeutic molecule as described below.

[0095] As used in the context of this disclosure, the term “modulable element” refers to a recombinant synthetic or fusion nucleic acid (plural) that results in, activates, enhances, or inhibits the expression of a nucleic acid functionally linked to it. For example, a modulable element functionally linked to a therapeutic molecule as defined herein results in, activates, enhances, or inhibits the expression of a therapeutic molecule as defined herein.

[0096] In one example, the moduloable element may include a nucleic acid sequence that responds to the presence of a regulatory compound. In another example, the moduloable element may respond to the presence of a regulatory compound by promoting the expression of a functionally linked nucleic acid. In yet another example, the moduloable element may respond to the presence of a regulatory compound by suppressing the expression of a functionally linked nucleic acid.

[0097] The modulotable elements are not particularly limited insofar as they can selectively modulate the expression of therapeutic molecules from the vector as defined herein. For example, the modulotable elements include one or more of the following: tetracycline response elements (TRE), chemate operators (CuO), ecdysone response elements (EcRE), hormone response elements (HRE), estrogen response elements (ERE), glucocorticoid response elements (GRE), progesterone response elements (PRE), and heat shock sequence elements (HSE).

[0098] For example, a regulating element is a regulating promoter. Examples of regulating promoters include, but are not limited to, the tetracycline regulating promoter (e.g., SEQ ID NO: 4), the kmet regulating promoter (e.g., SEQ ID NO: 5), the rapamycin-inducible promoter, the steroid hormone-inducible promoter, the metal-response promoter, the heat shock response promoter, the photoresponse promoter, the interferon-response promoter, and the mifepristone regulating promoter. Examples of regulating promoters are described in Goverdhana et al., Mol Ther, 12:189-211, 2005; Agha-Mohammadi and Lotze, J Clin Invest, 105:1177-1183; and Mullick et al., BMC Biotech, 6:43, 2006). Other examples of regulating promoters include the hypoxia-inducible promoter, the IL-8 promoter, or the metallothionein-inducible promoter, which are activated when intraocular neovascularization or age-related macular degeneration is associated with hypoxia.

[0099] In one example, the adjustable promoter is a tetracycline-adjustable promoter. In another example, the adjustable promoter is a chmate-adjustable promoter.

[0100] In one example, the adjustable promoter includes the sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5. In another example, the nucleic acid sequence of the adjustable promoter consists of the sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5.

[0101] The activity of “modulable elements” such as modulable promoters, as encompassed by this disclosure (i.e., their ability to produce, activate, enhance, or repress nucleic acid expression) is regulated by modulo compounds, either alone or conjugated to modulo compound-binding proteins.

[0102] In one example, a regulatory compound can directly bind to a regulating promoter to modulate its activity. For instance, the binding of a regulatory compound to a regulating promoter can promote the expression of nucleic acids encoding a therapeutic polypeptide. In another example, the binding of a regulatory compound to a regulating promoter can suppress the expression of nucleic acids encoding a therapeutic molecule.

[0103] In another example, the regulatory compound must bind to a regulatory compound-binding molecule expressed from an expression vector as defined herein in order to bind to a regulating promoter and modulate its activity. In one example, the regulatory compound-binding molecule is functionally linked to a constitutive promoter in the expression vector as defined herein. In this example, the regulatory compound-binding molecule is continuously expressed from the expression vector as defined herein and, upon binding to the regulatory compound, can bind to a regulating promoter functionally linked to a therapeutic polypeptide to modulate its activity.

[0104] Various constitutive promoters that can be functionally ligated to nucleic acids encoding regulatory compound-binding molecules are known in the art. Examples include the cytomegalovirus immediate early promoter (CMV-IE), the human elongation factor 1-α promoter (EF1), nuclear small RNA promoters (U1a and U1b), the α-myosin heavy chain promoter, the monkey virus 40 promoter (SV40), the Roussarcoma virus promoter (RSV), the adenovirus major late promoter, the β-actin promoter, hybrid regulatory elements including the CMV enhancer / β-actin promoter, or immunoglobulin promoters or their active fragments. For example, a constitutive promoter could be a compound human CMV-EF1-HTLV promoter.

[0105] In one example, the constitutive promoter contains the sequence shown in SEQ ID NO: 6. In another example, the nucleic acid sequence of the constitutive promoter consists of the sequence shown in SEQ ID NO: 6.

[0106] In one example, the regulatory compound-binding molecule and the therapeutic molecule are expressed from the same vector. In another example, the regulatory compound-binding molecule and the therapeutic molecule are expressed from separate vectors.

[0107] Those skilled in the art will understand that the appropriate regulatory compound is directed by the regulated promoter and / or the regulatory compound binding molecule. For example, for a tetracycline regulated promoter, the appropriate regulatory compound would be tetracycline or a structural analogue, such as doxycycline. In another example, for a kmeate regulated promoter, the appropriate regulatory compound would be kmeate or a structural analogue. In yet another example, for a rapamycin-inducible promoter, the appropriate regulatory compound would be rapamycin or a structural analogue. In yet another example, for a steroid hormone-inducible promoter, the appropriate regulatory compound would be a steroid hormone such as progesterone, or a structural analogue thereof, such as mifepristone.

[0108] In one example, the regulatory compound is a small molecule. In another example, the regulatory compound is tetracycline. In yet another example, the regulatory compound is kmate. In yet another example, the regulatory compound is rapamycin.

[0109] In some cases, the regulatory compound is a steroid hormone or its analogue. In one case, the regulatory compound is progesterone. In another case, the regulatory compound is ecdysone. In another case, the regulatory compound is a glucocorticoid. In another case, the regulatory compound is estrogen. In yet another case, the regulatory compound is mifepristone.

[0110] In one example, the moduloable element includes a tetracycline response element (TRE), and the modulating compound is tetracycline or a structural analog thereof. In another example, the moduloable element includes a chemate operator (CuO), and the modulating compound is chemate or a structural analog thereof. In yet another example, the moduloable element includes an ecdysone response element (EcRE), and the modulating compound is ecdysone or a structural analog thereof. In yet another example, the moduloable element includes an estrogen response element (ERE), and the modulating compound is estrogen or a structural analog thereof. In yet another example, the moduloable element includes a glucocorticoid response element (GRE), and the modulating compound is glucocorticoid or a structural analog thereof. In yet another example, the moduloable element includes a progesterone response element (PRE), and the modulating compound is progesterone or a structural analog thereof.

[0111] Furthermore, those skilled in the art will recognize appropriate combinations of regulatory compounds and regulatory compound-binding molecules. In one example, the regulatory compound-binding molecule is a polypeptide. In another example, the regulatory compound-binding molecule includes a tetracycline regulatory transactivator (tTA), a tetracycline repressor (TetR), or a reverse tetracycline regulatory transactivator (rtTA) (e.g., SEQ ID NO: 2, SEQ ID NO: 17). In yet another example, the regulatory compound-binding molecule includes a cysteine ​​metabolic repressor (CymR) (e.g., SEQ ID NO: 3, SEQ ID NO: 18). In yet another example, the regulatory compound-binding molecule includes a steroid hormone receptor, e.g., a progesterone receptor, an estrogen receptor (ER), or an ecdysone receptor (EcR). In some examples, the regulatory compound-binding molecule includes a rapamycin-binding protein. In some examples, the regulatory compound-binding molecule includes a Gal4 DNA-binding domain. In some examples, the regulatory compound-binding molecule includes a VP16 activation domain. In yet another example, the regulatory compound-binding molecule is a fusion of one or more of the molecules described herein. For example, regulatory compound-binding molecules may include a fusion of CymR and the VP16 activation domain.

[0112] In one example, the regulatory compound-binding molecule contains the amino acid sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0113] therapeutic molecules The therapeutic molecules included in this disclosure are not particularly limited in that they can be expressed from an expression vector disclosed herein or translated from a nucleic acid sequence expressed from such expression vector.

[0114] In one example, the expressed nucleic acid sequence encodes a therapeutic polypeptide. For instance, the nucleic acid sequence can be expressed from an expression vector as defined herein and translated by a cellular mechanism to generate a therapeutic polypeptide.

[0115] Exemplary therapeutic polypeptides include binding proteins such as immunoglobulins, antibodies, and antigen-binding fragments. For example, therapeutic polypeptides include single-stranded Fv fragments (scFv), dimeric scFv (di-scFv), and (scFv) n This includes scFv or di-scFv linked to the constant region of the antibody, Fc or heavy chain constant domain (CH)2 and / or CH3, diabodies, triabodies, tetrabodies, Fab, F(ab')2, and the antibody. In one example, the therapeutic polypeptide is an antibody or a TRAP molecule. Examples of such therapeutic molecules include ranibizumab, bevacizumab, and aflibercept.

[0116] In another example, a therapeutic polypeptide contains an antigen-binding site for an antibody.

[0117] In another example, a therapeutic molecule may be an inhibitory oligonucleotide. Exemplary inhibitory oligonucleotides include isolated or synthetic antisense RNA or DNA, siRNA or siRNA, miRNA, miRNA mimetic, shRNA or DNA, and chimeric antisense DNA or RNA. As used herein, the term “antisense” means a sequence of nucleotides complementary to, and therefore capable of binding to, a coding sequence, which may be either a strand of the DNA double helix receiving transcription or a messenger RNA molecule. The term “short hairpin RNA” or “shRNA” refers to an RNA structure having a double-stranded region and a loop region. The term “small interfering RNA (siRNA),” sometimes also known as short interfering RNA or silencing RNA, is a category of double-stranded RNA molecules with a length of 20–25 base pairs. siRNA that inhibits or interferes with the translation of a particular protein is represented by concatenating the term siRNA to the protein name. Therefore, siRNA that interferes with the translation of VEGF is represented as “VEGF siRNA.” The term "microRNA" (abbreviated as miRNA) refers to small, non-coding RNA molecules (containing approximately 22 nucleotides) found in plants, animals, and some viruses that function in RNA silencing and post-transcriptional regulation of gene expression. The prefix "miR" is followed by a dash and a number, the latter often indicating the order of naming. Various miRNAs that have nearly identical sequences except for one or two nucleotides are noted with an additional lowercase letter. Many miRNAs are known in the art (miRBase V.21 nomenclature, Kozomara et al. 2013, Griffiths-Jones, S. 2004). In another example, inhibitory oligonucleotides encompassed by this disclosure inhibit the activity of one or more miRNAs. Various species are suitable for this purpose. Examples include antagonists, interfering RNAs, ribozymes, miRNA sponges, and miR masks.The term “antagomyr” is used in the context of this disclosure to refer to a chemically modified antisense oligonucleotide that binds to a target miRNA and inhibits miRNA function by preventing the miRNA from binding to its homologous genetic targets.

[0118] For example, a therapeutic molecule is an “anti-angiogenic molecule.” The term “anti-angiogenic molecule” is used in the context of this disclosure to refer to a molecule expressed from an expression vector as defined herein that inhibits vascular development, e.g., angiogenesis, endothelial cell growth, vascular stability, and / or vasculogenesis. Anti-angiogenic molecules encompassed by this disclosure include polynucleotides, polypeptides, antibodies, or complexes or fusion proteins thereof. Exemplary anti-angiogenic molecules include inhibitors of VEGF and members of the VEGF family, P1GF, the PDGF family, the fibroblast growth factor family (FGF), TIE ligands (angiopoietin), ephrin, ANGPTL3, and ANGPTL4. In other examples, anti-angiogenic molecules inhibit growth hormones, e.g., insulin-like growth factor-I (IGF-I), VIGF, epidermal growth factor (EGF), CTGF and members of the CTGF family, TGF-α, and TGF-β. Other examples of anti-angiogenic molecules include antibodies against VEGF, antibodies against VEGF receptors, and angiogenesis inhibitors, such as angiostatins, endostatins, and their conjugates. Therefore, in one example, the therapeutic molecule comprises endostatin and / or angiostatin (e.g., SEQ ID NO: 9, SEQ ID NO: 20). In another example, the therapeutic molecule is a conjugate of one or more of the molecules described herein. For example, the therapeutic molecule may include a conjugate of endostatin and angiostatin.

[0119] In one example, the therapeutic molecule is an anti-inflammatory molecule. In one example, the anti-inflammatory molecule is an interleukin, e.g., IL-10, IL-4, IL-6, IL-11, or IL-13. For example, the anti-inflammatory molecule may be IL-10 (e.g., SEQ ID NO: 8, SEQ ID NO: 19). In another example, the anti-inflammatory molecule is an interleukin IL-1 receptor antagonist (IL-1RA) (e.g., SEQ ID NO: 10, SEQ ID NO: 21), or a fusion of IL-10 and IL-1RA (e.g., SEQ ID NO: 11). In yet another example, the anti-inflammatory molecule inhibits pro-inflammatory cytokines, e.g., IL-1, tumor necrosis factor alpha (TNF-α), or IL-18. In yet another example, the anti-inflammatory molecule increases the production or number of CD14+CD16+ cells in the subject, decreases IL-6 levels, decreases TNF-α levels, and / or increases IL-10 levels.

[0120] In another example, therapeutic molecules are neurotrophic factors. Neurotrophic factors are thought to be responsible for the development of developing neurons and the maintenance of adult neurons. In this regard, neurotrophic factors can be used to suppress or reverse the degeneration and death of nerve cells. Examples of neurotrophic factors include, for example, brain-derived neurotrophic factor, nerve growth factor, transforming growth factor, glial cell line-derived neurotrophic factor, neurotrophin 3, neurotrophin 4 / 5, and interleukin 1-B.

[0121] In another example, the therapeutic molecule is cytotoxic to cancer cells. In yet another example, the therapeutic molecule inhibits one or more of the following: nuclear factor kappa B (NFκB), C-kit (CD117, stem cell factor receptor), heat shock protein 90 (Hsp90), the Ras-Raf mitogen-activated protein kinase (MEK) pathway, Bcl-2, and IL-2.

[0122] In one example, the therapeutic molecule contains the amino acid sequence shown in SEQ ID NOs: 19-21. In another example, the regulatory compound-binding molecule consists of the amino acid sequence shown in SEQ ID NOs: 19-21.

[0123] Treatment and Prevention The methods described herein relate to the treatment and / or prevention of ocular disorders. The term “ocular disorder” is used in the context of this disclosure to mean disorders and abnormalities affecting the human eye and visual system. Examples of ocular disorders include, but are not limited to, congenital, developmental, inflammatory, infectious, vascular, occlusive, angiogenic, degenerative, neoplastic, preneoplastic, iatrogenic, traumatic, glaucomatous, post-transplant complications, cataracts, and idiopathic, diseases of the eye, retina, choroid, or macula, or systemic predispositions, associations, or complications of these diseases (e.g., metastatic uveal melanoma or multi-organ effects in hereditary dystrophy).

[0124] Other exemplary eye disorders include diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, squamous cell inflammation, corneal transplant rejection, intraocular inflammation, and superficial corneal transplant rejection. Other examples of eye disorders encompassed by this disclosure include macular degeneration, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, central retinal vein occlusion, retinal vein branch occlusion, or intraocular neovascularization. For example, an eye disorder may be “intraocular neovascularization.” The term “intraocular neovascularization” is used in the context of this disclosure to refer to a disorder characterized by intraocular neovascularization. Examples of intraocular neovascular diseases include, but are not limited to, proliferative retinopathy, choroidal neovascularization (CNV), dry age-related macular degeneration (AMD), wet age-related macular degeneration (AMD), diabetic retinopathy and other ischemic retinopathy, diabetic macular edema, pathological myopia, von Hippel-Lindau disease, ocular histoplasmosis, central retinal vein occlusion (CRVO), corneal neovascularization, and retinal neovascularization. For example, the method of this disclosure encompasses the treatment of wet AMD. In another example, the method of this disclosure encompasses the treatment of CNV.

[0125] For example, the methods of the present disclosure include inhibition of endothelial cell growth in the retina. For instance, the methods of the present disclosure include inhibition of endothelial cell growth in the subretinal pigment epithelium and / or subretinal space.

[0126] In another example, eye problems can be caused by infections.

[0127] In another example, the eye disorder is cancer. In one example, the cancer is uveal melanoma, ciliary body melanoma, iris melanoma, choroidal melanoma, intraocular lymphoma, retinoblastoma, or medullary epithelioma, choroidal hemangioma, choroidal metastasis, conjunctival Kaposi's sarcoma, malignant conjunctival tumor, orbital or lacrimal gland lymphoma, conjunctival lymphoma, conjunctival melanoma, or primary acquired melanosis with atypical features, orbital malignant tumor, lacrimal gland malignant tumor, pigmented conjunctival tumor, conjunctival squamous cell carcinoma, conjunctival intraepithelial neoplasm, or ocular surface squamous cell neoplasm. In one example, the cancer is uveal melanoma.

[0128] Other examples of ocular disorders include choroidal nevi, choroidal osteoma, nevus of Ota, conjunctival nevi, anterior segment dermoid, benign tumors of the lacrimal gland, benign tumors of the orbit, manifestation of thyroid eye disease, pinguecula, or pterygium.

[0129] In another example, the eye disorder is Leber congenital amaurosis due to RPE65, or an eye disorder caused by an RPE65 mutation. In yet another example, the eye disorder is retinitis pigmentosa caused by a mutation in MERTK, RPGR, PDE6B, RLBP1, or another gene, or another disease caused by a mutation in MERTK, RPGR, PDE6B, or RLBP1. In yet another example, the eye disorder is colloideremia, or an eye disorder caused by a CHM mutation. In yet another example, the eye disorder is color blindness, or an eye disorder caused by mutations in the CNGA3, CNGB3, GNAT2, PDE6C, PDE6H, and ATF6 genes. In yet another example, it is X-linked retinoschisis, or an eye disorder caused by an RS1 mutation. In yet another example, the eye disorder is Leber's hereditary neuropathy. In yet another example, the eye disorder is a complication of transplantation.

[0130] In one example, the method described above includes administering an expression vector as described herein. For example, the method may include administering an expression vector comprising a deactivation switch and a nucleic acid encoding a therapeutic molecule, wherein activation of the deactivation switch silences the expression of the nucleic acid encoding the therapeutic molecule. In one example, the vector further comprises a regulatory element functionally linked to the nucleic acid encoding the therapeutic molecule, and the activity of the regulatory promoter is regulated by administering a regulatory compound to the target. In one example, the expression vector further comprises a constitutive promoter functionally linked to a regulatory compound-binding molecule that binds to the regulatory compound, and the regulatory compound-binding polypeptide regulates the expression of the therapeutic molecule when bound to the regulatory compound.

[0131] In another example, regulatory compound-binding molecules and therapeutic molecules are expressed from separate expression vectors.

[0132] formulation Expression vectors, regulatory compounds, and other molecules described herein may be formulated as pharmaceutical compositions suitable for administration to a target. Exemplary pharmaceutical compositions may include pharmaceutically acceptable carriers, diluents, or excipients. Depending on the specific route of administration, various acceptable carriers known in the art, such as those described in Remington's Pharmaceutical Sciences (Mack Publishing Co., NJUSA, 1991), may be used.

[0133] Exemplary pharmaceutical compositions may include pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injection solutions or dispersions immediately before use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils, and organic esters for injection, such as ethyl oleate. The compositions may also contain adjuvants, such as preservatives, humectants, emulsifiers, and dispersants, or antimicrobial and antifungal agents.

[0134] In another example, expression vectors may be incorporated into sustained-release or targeted delivery systems. Exemplary sustained-release systems include polymer matrices, liposomes, and microspheres. Liposomes may be biodegradable and amphiphilic drug delivery systems, which may be formulated using phospholipids and cholesterol. Microspheres may be formulated using biodegradable and biocompatible polymers.

[0135] In one example, the modifying compound is provided contained in a topical formulation. For example, the modifying compound can be provided as an eye drop formulation. Examples of suitable eye drop formulations include liquids, suspensions, ointments, gels, or foams. In one example, the eye drop formulation comprises the modifying compound as defined herein and a suitable carrier. Exemplary carriers include saline solution, aqueous polyethers, e.g., polyethylene glycol, polyvinyl, e.g., polyvinyl alcohol and povidone, cellulose derivatives, e.g., methylcellulose and hydroxypropyl methylcellulose, petroleum derivatives, e.g., mineral oil and white petrolatum, animal fats, e.g., lanolin, polymers of acrylic acid, e.g., carboxypolymethylene gel, vegetable fats, e.g., peanut oil, and polysaccharides, e.g., dextran, and glycosaminoglycans, e.g., sodium hyaluronate, and salts, e.g., sodium chloride and potassium chloride.

[0136] In one example, the expression vector resides in or on a device that enables controlled or sustained release of the expression vector, such as an ophthalmic sponge, mesh material, mechanical reservoir, or mechanical graft. Grafts (see, e.g., US5,443,505, 4,853,224, and 4,997,652), devices (see, e.g., US5,554,187, 4,863,457, 5,098,443, and 5,725,493), such as implantable devices, e.g., mechanical reservoirs, intraocular devices, or extraocular devices with intraocular conduits, or grafts or devices containing polymer compositions are particularly useful for intraocular administration of the expression vector.

[0137] For example, expression vectors are formulated to improve transduction efficiency, that is, to enhance the transduction of the vector into host cells. Preferred compositions are further described in U.S. Patents 6,225,289 and 6,514,943.

[0138] Administration and medication In one example, an expression vector as defined herein is administered to a target. Subsequently, the expression of the therapeutic molecule from the expression vector is regulated by administering a modulating compound to the target. Then, the expression of the therapeutic molecule is silenced by administering a silencing switch activator to the target, or by administering a vector containing a nucleic acid sequence encoding the silencing switch activator. Each of the vector, modulating compound, and silencing switch activator may be administered to the target as a pharmaceutical composition. The choice of administration route will depend on various factors, such as the host, the immunogenicity of the vector, and the desired duration of therapeutic molecule production.

[0139] Pharmaceutical compositions can be administered topically, for example. For example, a composition can be administered by eye drops. In this example, the composition or a portion thereof may diffuse into the intraocular environment via the hydrophobic cornea. In another example, the composition is administered by intravitreal injection. In yet another example, the composition is administered by subretinal injection. In one example, a vitrectomy is performed before the subretinal injection. In yet another example, the composition is administered by subcutaneous injection. In yet another example, the composition is administered by intramuscular injection. In yet another example, the composition is administered by intravenous injection. In yet another example, the composition is administered as a food or beverage composition. In other examples involving the use of heat or light as a modulating compound, such compound is applied to the target eye as needed.

[0140] In one example, a pharmaceutical composition containing a vector is administered by an ophthalmic device for delivery to a specific area of ​​the eye. The use of specialized ophthalmic devices ensures the precise delivery of the expression vector while minimizing damage to adjacent ocular tissue. Delivery of the expression vector to a specific area of ​​the eye also limits exposure of unaffected cells to the therapeutic molecule, thereby reducing the risk of side effects. An example of such an ophthalmic device is a combination of forceps and a subretinal needle or a sharply curved cannula.

[0141] In one example, a pharmaceutical composition containing an expression vector is administered intravitreously or subretinally, followed by topical administration of a pharmaceutical composition containing one or more regulatory compounds as eye drops, and then a discontinuation switch activator is administered topically and / or intravitreously or subretinally.

[0142] In another example, a pharmaceutical composition containing an expression vector is administered intravitreously or subretinally, followed by the administration of a food or beverage composition containing the regulatory compound(s), and then the discontinuation switch activator is administered topically and / or intravitreously or subretinally.

[0143] In one example, a termination switch activator can be expressed from a vector described herein. In one example, two vectors can be administered to a target, one containing a termination switch and the other containing a nucleic acid sequence encoding a termination switch activator. Thus, the first vector can be administered to express a therapeutic molecule, and then, when the expression of the therapeutic molecule is no longer needed or desired, the second vector can be administered to express a termination switch activator, thereby silencing the expression of the therapeutic molecule. In some examples, the nucleic acid sequence encoding the termination switch activator is functionally ligated to a controllable promoter.

[0144] In another example, a vector containing a deactivation switch disclosed herein may further contain a deactivation switch activator functionally linked to a regulatory promoter. Thus, in some examples, nucleic acid sequences encoding both a therapeutic molecule and a deactivation switch activator may be present within the same vector. In this example, a regulatory compound is administered to the target to activate the regulatory promoter, thereby promoting the expression of the deactivation switch activator, and thereby activating the deactivation switch to silence the expression of the therapeutic molecule(s) from the vector. Similarly, in another example, a regulatory compound-binding molecule may be expressed from another vector. For example, two vectors may be administered to the target: one containing a regulatory element, and the other containing a constitutive promoter functionally linked to a nucleic acid encoding the regulatory compound-binding molecule. In this example, the regulatory compound is administered to the target, binds to the regulatory compound-binding molecule, and modulates the expression of the regulatory promoter.

[0145] Those skilled in the art will recognize that the dosage and route of administration can be selected to minimize the loss of the expression vector due to the host's immune system. For example, to bring the expression vector into contact with ophthalmic cells in vivo, it may be beneficial to administer a deletion expression vector (i.e., an expression vector that does not contain the nucleic acid sequence encoding the therapeutic molecule) to the host before carrying out the method described herein. Pre-administration of a deletion expression vector can play a role in generating immunity (e.g., tolerance) to the expression vector in the host, thereby reducing the amount of vector removed by the host's immune system.

[0146] The compositions disclosed herein may also be administered systemically, for example, by intravenous or intraperitoneal administration. In another example, the compositions may be administered orally. In yet another example, the compositions may be administered intranasally.

[0147] In one example, a subject is administered a first dose, followed by one or more subsequent doses. In one example, the first dose includes the vector disclosed herein. In another example, one or more subsequent doses containing the vector are administered. Modulating compounds may be administered simultaneously or as one or more subsequent doses to modulate the expression of the therapeutic molecule from the vector. For example, a first dose containing the vector disclosed herein may be administered to a subject, and a series of subsequent doses containing the modulating compounds may be administered to a subject. In this example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 50, 100 or more subsequent doses may be administered to the subject. In this example, the modulating compounds of the subsequent doses may be provided simultaneously with or after the expression vector of the subsequent doses disclosed herein. In one example, the dosing is once daily, every other day, every week, or every month. In one example, the daily dose includes a single application or multiple applications per administration. For example, at least 2, 3, 4 or more applications may be provided per day of administration.

[0148] kit The compositions relating to this disclosure may be provided as kits or packs. For example, the compositions disclosed herein may be packaged in a suitable container on which instructions for treating eye disorders are written. In one example, the compositions may be provided in single-dose containers such as eye drops or pre-filled syringes.

[0149] The kits of this disclosure may include a therapeutic system. Such a therapeutic system can deliver compositions without pre-programmed supervision at a fixed rate and for a fixed period of time established to meet a particular therapeutic need. The system may be designed, for example, to minimize patient intervention and to optimize adherence to a prescribed medication plan.

[0150] For example, the kit includes an eye drop formulation comprising an expression vector(s) as defined herein and a modulating compound(s) as defined herein, for use in a method of treating an eye disorder.

[0151] In one example, the kit further includes a discontinuation switch activator as defined herein.

[0152] In one example, the kit further comprises an expression vector containing a nucleic acid sequence encoding a termination switch activator as defined herein.

[0153] For example, the kit is: - Expression vectors (multiple) as defined herein, - Eye drop formulations containing tetracycline, and -Cre recombinase, or an expression vector containing a nucleic acid sequence encoding Cre recombinase. Includes. [Examples]

[0154] Example 1 - Method Vector construction The pAAV.LL termination switch vector skeleton (Figure 1) was constructed synthetically and ligated into pAAV-mcs containing AAV ITR. Synthetic vector inserts with restriction sites to enable cloning into the pAAV.LL skeleton were also synthesized. Tetracycline or khmate repressor genes with axiolytic and EcoRI sites were cloned into the XbaI-EcoRI site on the skeleton. Tetracycline or khmate response promoters and CMV promoters with axiolytic and SalI sites were cloned into the BstBI-SalI site in the specific skeleton. Finally, genes of interest (GFP, IL-10, endo / angiostatin, IL-1RA, and IL-10-IL-1RA) with axiolytic and NheI sites were cloned into the SalI-NheI site. Nano-luciferase was cloned into the SalI-Nhe site on a termination switch vector with compatible XhoI and XbaI sites (Figure 2).

[0155] Evaluation of the action of the termination switch in a vector construct containing the marker gene luciferase. ARPE-19 cells were cultured in T-75 tissue culture flasks with DMEM / F12 medium supplemented with 10% fetal bovine serum (FCS) and 100 IU / ml penicillin / streptomycin (P / S) until the cell density reached approximately 80%. The cells were trypsinized with 0.05% trypsin-EDTA and seeded into 96-well tissue culture plates at a concentration of 20,000 cells / well. After 12–24 hours, the cells were transfected with pAAV-LTetL-luc, pAAV-LCuL-luc, and pAAV-LCMVL-luc, all of which contain the marker gene nano-luciferase, using lipofectamine 3000 (Life Technologies, MA, USA).

[0156] Twenty-four hours after transfection, the cells were gently washed, and the culture medium was replaced with a subset of cells activated with doxycycline (tetracycline structural analog) and chemate, as well as the corresponding subset of unactivated cells (Figure 4). On day 4, luminescence was measured using a Nano-Glo luciferase assay (Promega, WI, USA) to confirm activation, and then a Cre-containing vector was transfected into the subset of activated cells. The cells were washed daily, and luminescence was measured on day 7. Briefly, the Nano-Glo luciferase assay was performed by adding 10 μl of medium from each treatment well to a 384-well plate with a black clear bottom. Then, 10 μl of Promega substrate was added to these wells, mixed, and left at room temperature for 3 minutes. Luminescence was read using a luminescence plate reader. A schematic diagram of this experiment is shown in Figure 4, and the results of vector discontinuation are shown in Figure 5.

[0157] Evaluation of activation and inactivation of vector constructs containing the marker gene luciferase. ARPE-19 cells were seeded as described above. After 12–24 hours, the cells were transfected with pAAV-LTetL-luc and pAAV-LCuL-luc. The following day, the culture medium was changed, and doxycycline or chmate was added to a subset of the cells (Figure 7). On day 4, after changing the culture medium on day 3, the culture medium from the cells was examined for the expression of the marker gene luciferase using the Nano-Glo luciferase assay. The Nano-Glo luciferase assay was performed as described above.

[0158] Following the luciferase assay, the culture medium was changed in all wells. A subset of cells activated with doxycycline and chemate were washed to inactivate the vector. After washing for 3 days, the Nano-Glow luciferase assay was performed again, and the results are shown in Figure 8.

[0159] Evaluation of the effects of endo / angiostatin-containing vector constructs on angiogenesis. The effect of the vector on angiogenesis was evaluated using a standard endothelial cell tube formation assay according to the manufacturer's protocol (Life Technologies, Angiogenesis Starter Kit: A14609-01). Briefly, primary human umbilical vein endothelial cells (HUVECs) were transfected with a Cre-modulated vector (pAAV-LCuL-EAS) containing endo / angiostatin, with or without Cre (as described above). Cells were washed within 24 hours of transfection and seeded on geltrex (basement membrane matrix) 48 hours after transfection. Tubes were photographed 14–18 hours later and analyzed using ImageJ angiogenesis analysis software (NIH, MD, USA). A schematic diagram of the experiment is shown in Figure 9, and the results are shown in Figure 10.

[0160] Evaluation of the modulation of inflammatory markers in IL-10-containing vector constructs. ARPE-19 cells were seeded and transfected with pAAV-LCuL-IL-10, a vector containing Cu-regulated IL-10 (as described above). Induction of pro-inflammatory signaling using this vector containing the anti-inflammatory cytokine IL-10 was tested by measuring IL-6 expression. Cre was used to activate an internal termination switch and to silence activated and inactivated vectors. After transfection of ARPE-19, cells were washed for 2 days, and the culture medium collected on day 4 was used in an enzyme-linked immunosorbent assay (ELISA) to determine the concentrations of IL-6 and IL-10 according to the manufacturer's instructions (elisakit.com-0012, elisakit.com-0031). A schematic diagram of the experiment is shown in Figure 11, and the results are shown in Figure 12.

[0161] statistical analysis All statistical analyses were performed using Sigma Plot 13.0 (Systat software, CA, USA). Differences in gene regulation among vectors were all evaluated by t-tests, with p-values ​​< 0.05 considered statistically significant.

[0162] Example 2 - Expression Vector Tetracycline or kmet repressor genes (SEQ ID NOs. 2 and 3, respectively) were cloned into repressor cloning site 1 of the vector backbone (Figure 1) using the XbaI and EcoRI restriction sites. The corresponding promoters were cloned into promoter cloning site 2 using the BstBI and SalI restriction sites (SEQ ID NOs. 4 and 5, respectively). Conditionally regulated polypeptides were cloned into GOI cloning site 3 using the SalI and NheI restriction sites (GFP, IL-10, endo / angiostatin fusion protein, IL-1RA, or IL-10 / IL-1RA genes; SEQ ID NOs. 7-11) or using compatible XhoI and XbaI sites (Nano-Luciferase, SEQ ID NO. 12). Figure 2 shows a schematic diagram of how the expression vector was constructed.

[0163] Example 3 - Activation of the discontinuation switch An expression vector was constructed with all expression sequences positioned within two LoxP sites (Figures 1 and 2). To permanently silence expression, a vector expressing Cre was transfected into cells. Cre removes all expression sequences by site-directed recombination at the two LoxP sites (SEQ ID NO: 13). The resulting vector lacks an expression mechanism and cannot induce transgene expression.

[0164] Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing tetracycline or kmeate regulatory elements or the CMV promoter to promote the expression of the marker gene luciferase. After 24 hours, cells were treated with tetracycline (Tet) or kmeate (Cu) or left untreated, and incubated for a further 48 hours before evaluating luciferase expression. The ability of the system to discontinue transgene (luciferase) expression was investigated by transfecting cells with a Cre vector and cleaving the expression sequence between LoxP sites. Cells were washed, and regulatory compounds (Tet and Cu) were added daily until day 7, when the culture medium was examined for changes in luciferase expression levels.

[0165] Figure 5a shows luciferase expression in cells treated with the Tet vector with or without Tet activation (pAAV-LTetL-luc turned on). Figure 5b shows luciferase expression in cells treated with the Cu vector with or without Cu activation. Figure 5c shows luciferase expression after transfecting with the CMV vector with or without Cre-mediated excision. Luciferase expression was effectively silenced in all Cre-excised cells.

[0166] Example 4 - Modification of therapeutic agent The Tet On system used is summarized in Figure 6a. The EF1-HTLV promoter constitutively expresses a Tet transactivator protein, which cannot bind to the Tet response element (TRE) in the Tet promoter, resulting in its inactivation and the absence of transgene expression. In the presence of Tet, the transactivator protein binds to the Tet response element (TRE) in the promoter, activating it and inducing transgene expression. The Cu On system used is summarized in Figure 6b. In this system, the Cu repressor protein binds to the Cu operator sequence in the absence of Cu, thereby inactivating the promoter and resulting in the absence of transgene transcription. When Cu is added, Cu binds to the repressor protein bound to the Cu promoter, thereby releasing the repressor and enabling transgene transcription.

[0167] Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing a tet or cu regulatory sequence to promote the expression of the marker gene luciferase. After 24 hours, cells were incubated for a further 48 hours with or without tet or cu treatment, and then luciferase expression was evaluated. The ability of the system to halt the expression of the transgene (luciferase) was examined by removing tet or cu from the cells by washing before re-examining luciferase expression. Cells without tet or cu were used as controls, and cells with tet or cu removed were also used as controls.

[0168] Figure 8a shows the results of a luminescence assay performed on day 7 of an experiment using tetracycline as the agent to switch on transgene production. Figure 8b shows the results of a luminescence assay performed on day 7 of an experiment using cumate as the agent to switch on transgene production. In both experiments, the substrate (Tet or Cu) was able to induce significant levels of luciferase expression, which was regulated by substrate removal, resulting in a significant decrease in detectable luciferase.

[0169] Example 5 - Tube Formation Assay The effect of vectors containing endo / angiostatin (EAS) with a LoxP site positioned axillarily on angiogenesis was evaluated using a tube formation assay in primary human umbilical vein endothelial cells (HUVECs) with and without Cre (Figure 9). Young passaged (p2-4) HUVECs were transfected with a chemate-regulated vector (pAAV-LCuL-EAS) that produces EAS. Cells were counted two days after transfection, seeded in geltrex-coated wells, incubated at 37°C and 5% CO2 for 14-18 hours, and then photographed the tubes formed in the geltrex and analyzed using the ImageJ angiogenesis analyzer.

[0170] Figure 10A shows HUVEC tube formation in cells transfected with non-EAS-expressing pAAV-LCuL-EAS without Cu activation. Figure 10B shows inhibition of tube formation when HUVEC is treated with activated pAAV-LCuL-EAS. Figure 10C shows recovery of tube formation ability when activated pAAV-LCuL-EAS is excised with Cre. Figures 10D and E show quantification of total mesh area and total branch length, respectively, using ImageJ angiogenesis analysis software. The pAAV-LCuL-EAS vector was able to reduce tube formation, but this tube formation was generally reversed when the vector was excised with Cre.

[0171] Example 6 - Pro-inflammatory signaling The effect of a vector containing Cu-regulated IL-10 with a LoxP site on the induction of pro-inflammatory signaling was determined by measuring IL-6 expression with and without Cre (Figure 11). Human retinal pigment epithelial cell line (aRPE-19) was transfected with a vector construct containing a Cu regulatory sequence to promote the expression of anti-inflammatory IL-10. The negative control consisted of an IL-10 vector lacking Cu activation and treated with Cre. The IL-10 group consisted of an IL-10 vector activated by Cu. The discontinuation group consisted of an activated IL-10 vector treated with Cre. Cell expression of IL-10 and the pro-inflammatory marker IL-6 was examined by ELISA.

[0172] Figure 12 shows the results obtained from simultaneous ELISA of IL-10 and IL-6 after transfecting cells with and without Cre-containing chromate-regulated vectors. In cells treated with negative control vectors (without Cu and with Cre), the detected levels of IL-10 were low and correlated with high levels of pro-inflammatory IL-6. Conversely, cells treated with Cu-regulated IL-10 vectors (IL-10 vectors that were turned on) in the presence of Cu expressed high levels of IL-10, which correlated with low levels of IL-6 expression. Vectors in which IL-10 was excised by Cre (discontinued IL-10 vectors) showed levels of IL-10 and IL-6 similar to those of the negative control, indicating that IL-10 expression was effectively silenced.

[0173] Those skilled in the art will recognize that many changes and / or modifications can be made to this disclosure without departing from the broadly described spirit or scope of this disclosure, as shown in the specific embodiments. Accordingly, embodiments of the present invention should be construed in all respects as illustrative and non-limiting.

[0174] All publications discussed and / or referenced herein are incorporated herein by reference.

[0175] Any considerations of documents, laws, materials, apparatus, articles, etc., included herein are solely for the purpose of providing context to the present invention. They should not be considered, simply because they existed prior to the priority date of any claim in this application, to constitute any or all of the prior art foundation or to be common knowledge in the relevant art of the present invention.

[0176] This application claims priority under AU2018900206, filed on 23 January 2018, the entire contents of which are incorporated herein by reference.

Claims

1. An expression vector, a) A discontinuation switch comprising a first site-specific recombinant sequence and a second site-specific recombinant sequence, b) A moduloable element functionally linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the moduloable element is regulated by a modulating compound, c) A constitutive promoter functionally linked to a nucleic acid sequence encoding a regulatory compound-binding polypeptide that can bind to a regulatory compound, wherein the regulatory compound-binding polypeptide, when bound to the regulatory compound, modulates the expression of the therapeutic molecule; An expression vector wherein activation of the termination switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the vector.

2. The first site-specific recombinant sequence is located upstream of the nucleic acid sequence encoding the therapeutic molecule, and the second site-specific recombinant sequence is located downstream of the nucleic acid sequence encoding the therapeutic molecule, and / or The expression vector according to claim 1, wherein the first site-specific recombinant sequence and the second site-specific recombinant sequence are loxP sites.

3. When the regulatory compound-bound polypeptide binds to the regulatory compound... a) Promotes the expression of the therapeutic molecule, or b) The expression vector according to claim 1 or 2, which suppresses the expression of the therapeutic molecule.

4. An expression vector according to any one of claims 1 to 3, applying one, more, or all of the following: a) The regulatory compound-bound polypeptide comprises one or more of the following: reverse tetracycline regulatory transactivators (rtTA), tetracycline regulatory transactivators, or cysteine ​​metabolic repressors (CymR). b) The regulatory compound is tetracycline, cumate, progesterone, glucocorticoid, estrogen, or mifepristone. c) The adjustable element comprises one or more of the following: a tetracycline response element (TRE), a chemate operator (CuO), an ecdysone response element (EcRE), an estrogen response element (ERE), a glucocorticoid response element (GRE), a progesterone response element (PRE), a heat shock sequence element (HSE), or a photoinducible promoter. d) The constitutive promoter is a compound human CMV-EF1-HTLV promoter. e) The therapeutic molecule inhibits angiogenesis. f) The therapeutic molecule - Including endostatins, angiostatins, or fusions of endostatins and angiostatins; - It is a binding protein; - Includes the antigen-binding site of the antibody; - Selected from the group consisting of ranibizumab, bevacizumab, and aflibercept; - To suppress inflammation; or - Interleukin 10 (IL-10), interleukin 1 receptor antagonist (IL-1RA), or a fusion of IL-10 and IL-1RA, g) The vector further includes a transcription blocker between the constitutive promoter and the adjustable promoter, h) It is a viral vector.

5. The expression vector according to any one of claims 1 to 4, wherein the vector is an adeno-associated virus (AAV) vector.

6. An effective amount of the expression vector according to any one of claims 1 to 5 for use in treating an eye disorder in a subject.

7. An effective amount of expression vector for use in treating ocular inflammatory disorders in a subject, The expression vector a) A discontinuation switch comprising a first site-specific recombinant sequence and a second site-specific recombinant sequence, b) A moduloable element functionally linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the moduloable element is regulated by a modulating compound, c) A constitutive promoter functionally linked to a nucleic acid sequence encoding a regulatory compound-binding polypeptide capable of binding to a regulatory compound, wherein the regulatory compound-binding polypeptide, when bound to the regulatory compound, modulates the expression of the therapeutic molecule, comprising: Activation of the termination switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the vector. An effective amount of expression vector.

8. The expression vector according to claim 7, wherein the adjustable element is regulated by administration of a regulatory compound to the target.

9. The expression vector according to claim 8, wherein the regulatory compound-bound polypeptide, when bound to the regulatory compound, promotes the expression of the therapeutic molecule or suppresses the expression of the therapeutic molecule.

10. a) The activation of the aforementioned stop switch - One or more promoters; and / or, - The nucleic acid encoding the therapeutic molecule To excise, and / or, b) The cancellation switch is - One or more promoters; and / or, - The nucleic acid encoding the therapeutic molecule An expression vector according to any one of claims 7 to 9, comprising a site-specific recombinant sequence positioned alongside the expression vector.

11. The expression vector according to any one of claims 6 to 10, wherein the eye disorder is diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, squamous cell inflammation, corneal transplant rejection, intraocular inflammation, superficial corneal transplant rejection, uveal melanoma, or retinoblastoma.

12. The expression vector according to any one of claims 6 to 10, wherein the eye disorder is macular degeneration, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, central retinal vein occlusion, retinal vein branch occlusion, or intraocular neovascularization.

13. The expression vector according to claim 7, wherein the ocular inflammatory disorder is uveitis, endophthalmitis, iritis, giant cell arteritis, vasculitis, squamous cell inflammation, pigmentary retinitis, corneal transplant rejection, or superficial corneal transplant rejection.

14. This includes intravitreous or subretinal administration of the expression vector, and / or The use further comprises activating the discontinuation switch by administering a site-specific recombinase or a nucleic acid encoding a site-specific recombinase, The site-specific recombinase catalyzes recombination between the first site-specific recombinant sequence and the second site-specific recombinant sequence, thereby silencing the expression of the therapeutic molecule. An expression vector according to any one of claims 6 to 13.

15. The expression vector according to any one of claims 6 to 14, applying one, more, or all of the following: a) The use includes topical administration of the modulated compound to the eye, b) The regulatory compound is a small molecule, c) The regulatory compound is tetracycline or chmate, d) The regulatory compound is administered as eye drops.

16. An effective amount of expression vector for use in treating ocular disorders in a subject, wherein the expression vector is A discontinuation switch comprising a first site-specific recombinant sequence and a second site-specific recombinant sequence, a nucleic acid encoding a therapeutic molecule, a regulatory promoter functionally linked to the nucleic acid encoding the therapeutic molecule, and a constitutive promoter functionally linked to a nucleic acid sequence encoding a regulatory compound-binding polypeptide. An effective expression vector comprising the above, wherein the activity of the adjustable promoter is regulated by the adjustable compound-binding polypeptide after administration of the adjustable compound to the target, and the activation of the discontinuation switch by recombination between the first site-specific recombinant sequence and the second site-specific recombinant sequence silences the expression of the therapeutic molecule.

17. The expression vector according to any one of claims 1 to 16, wherein the therapeutic molecule is a nucleic acid or a polypeptide.

18. A pharmaceutical composition comprising an expression vector according to any one of claims 1 to 5 or 17.

19. A kit comprising an expression vector according to claim 5 or 17, and an eye drop formulation containing a regulatory compound.

20. Recombinase, or An expression vector containing a nucleic acid sequence encoding a recombinase, and / or - Eye drop formulations containing tetracycline, and - An expression vector containing Cre recombinase, or a nucleic acid sequence encoding Cre recombinase. The kit according to claim 19, further comprising:

Images