Nick-Linked STLFR

A single-tube method for sequencing library preparation using nicking and ligation in a single reaction mixture addresses inefficiencies in current methods by creating overlapping nucleic acid fragments with branched adapters, enhancing efficiency and control over fragment size for large genome sequencing.

JP7846205B2Active Publication Date: 2026-04-14MGI TECH CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
MGI TECH CO LTD
Filing Date
2022-07-22
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Current methods for constructing sequencing libraries require multi-step processes that are labor-intensive and inefficient, often involving separate reactions or vessels for attaching adapters to nucleic acids, which complicates the attachment of barcodes for identification and sequencing.

Method used

A method involving a single reaction mixture where double-stranded nucleic acids are nicked to create overlapping fragments with single-strand breaks, then ligated with branched adapters containing barcodes, allowing simultaneous attachment of adapters to both ends of the nucleic acid fragments.

Benefits of technology

This approach simplifies the library preparation process, reduces material loss, avoids sequence bias, and enables controlled fragment size production, making it suitable for de novo assembly of large genome fragments with reduced labor and increased efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007846205000027
    Figure 0007846205000027
  • Figure 0007846205000028
    Figure 0007846205000028
  • Figure 0007846205000029
    Figure 0007846205000029
Patent Text Reader

Abstract

The present application relates to methods and compositions for preparing a library of polynucleotides for sequencing, comprising in a single reaction mixture. The method comprises contacting a double-stranded target nucleic acid with one or more nicking agents to generate overlapping nucleic acid fragments separated by overhanging single-stranded breaks, and contacting a partially double-stranded first adaptor with at least one of the nucleic acid fragments in the presence of a ligase, thereby ligating the 5' end of the double-stranded region of the first adaptor to the 3' end of at least one of the nucleic acid fragments using a DNA ligase via a 3' branched ligation. The first adaptor comprises (i) a double-stranded blunt end having a 5' end and a 3' end, and (ii) a single-stranded region comprising a barcode.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application claims priority and benefit of U.S. Provisional Application No. 63 / 224,731, filed on 22 July 2021. The entire contents of the said Provisional Application are incorporated herein by reference for all purposes. [Background technology]

[0002] To construct sequencing libraries for commonly used next-generation sequencing platforms, it is often necessary to attach adapters to both ends of the target nucleic acid. These adapters typically contain barcodes for the identification of the sample or molecule. In some cases, simultaneous barcoding is performed to attach the same barcode to sub-fragments of a single long genomic DNA molecule to facilitate whole-genome sequencing. Current processes for constructing sequencing libraries often require multi-step methods for attaching adapters. Each step is often performed in separate reactions or vessels, which are labor-intensive and inefficient. [Overview of the Initiative] [Means for solving the problem]

[0003] In one embodiment, the present disclosure provides a method for preparing a library of adapter-modified polynucleotides for sequencing, comprising: (a) contacting a double-stranded target nucleic acid with one or more nickeling agents to generate a plurality of overlapping nucleic acid fragments separated by overhanging single-strand breaks in a single reaction mixture; (b) providing a plurality of beads (b-BLAs), each containing a plurality of branched ligating adapters immobilized on a bead, to provide a population of L-adapters having a degenerate sequence at the 3' end; (c) contacting the b-BLAs with at least one of the nucleic acid fragments in the presence of a ligase to ligate the b-BLAs to the 3' end of the nucleic acid fragment; and (d) contacting the population of L-adapters in the presence of a ligase to ligate the L-adapters to the 5' end of the nucleic acid fragment to obtain a library of nucleic acid fragments having an L-adapter sequence at the 5' end and a b-BLA adapter sequence at the 3' end.

[0004] In another aspect, this specification discloses a method for preparing a library of polynucleotides for sequencing, in a single reaction mixture: (a) Contacting a double-stranded target nucleic acid with one or more nickeling agents to generate overlapping nucleic acid fragments separated by protruding single-strand breaks; and (b) Contacting the nucleic acid fragments with beads containing a plurality of partially double-stranded first adapters in the presence of a ligase, each first adapter comprising (i) a double-stranded blunt end including the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region immobilized on the bead, wherein the single-stranded region comprises a barcode, thereby the double-stranded blunt end of at least one first adapter. The method comprises (c) ligating the 5' end of a strand at the end to at least one 3' end of a nucleic acid fragment using a DNA ligase to generate a ligated first adapter, wherein the ligated first adapter contains a barcode and at least one nucleic acid fragment; (c) denaturing the ligated first adapter; and (d) performing controlled extension of a primer that hybridizes to a sequence that is 3' to the barcode in the ligated first adapter, thereby generating a partially extended strand complementary to the ligated first adapter.

[0005] In yet another embodiment, the Specified herein is disclosed a reaction mixture comprising (1) one or more nicking agents, (2) one or more ligases, (3) a plurality of overlapping nucleic acid fragments separated by protruding single-strand breaks, and (4) a partially double-stranded branching adapter comprising a barcode oligonucleotide and a hybridization oligonucleotide that hybridize with each other to form a partially double-stranded nucleic acid molecule, wherein the barcode oligonucleotide is attached to a bead and comprises a barcode, and the hybridization oligonucleotide is not attached to a bead, and the partially double-stranded nucleic acid molecule comprises (i) a double-stranded blunt end having a 5' end and a 3' end, and (ii) a single-stranded region comprising a barcode and having a single-stranded end, wherein the 5' end of the double-stranded blunt end is ligated to at least one 3' end of the nucleic acid fragment.

[0006] The drawings and their description illustrate exemplary embodiments of the present invention. The invention provided in this disclosure is not limited to the embodiments shown in these drawings. [Brief explanation of the drawing]

[0007] [Figure 1] Figure 1 shows an exemplary workflow for library preparation.

[0008] [Figure 2] Figure 2 shows how a nick is introduced into a double-stranded target nucleic acid (210) to generate a protruding single-strand break (220). Figure 2 also shows how the break is extended to a creator that extends the gap (230) between the fragments (240) separated by the break in order to prepare the adapter ligation.

[0009] [Figure 3A]Figures 3A and 3B illustrate exemplary methods for attaching a b-BLA adapter (320) to the 3' end of target DNA (310) via a branched ligature (320) and attaching an L-adapter (340) to the 5' end of target DNA in a single reaction mixture. Figure 3A shows a bead (300) containing b-BLA immobilized on it. Each b-BLA consists of two strands: 1) a barcode oligonucleotide containing a barcode sequence (330) and a dideoxyblocker nucleotide at its 3' end, and 2) a hybridization oligonucleotide that hybridizes to the barcode oligonucleotide. The 5' end of the barcode oligonucleotide is joined to the bead (300). For better illustration and explanation, although shown in a separate step, the attachment of b-BLA and L-adapters can occur in a single reaction. The barcode (330) derived from the b-BLA adapter (340) is copied by extending the strand (350) that is not attached to the bead, generating an extended nucleic acid fragment (360). The excess b-BLA adapter (370) (i.e., the b-BLA adapter not attached to the fragment) is also extended. The extended nucleic acid fragment (360) can be amplified using two primers annealed to the b-BLA adapter sequence and L-adapter sequences at both ends. Alternatively, the extended nucleic acid fragment (360) can be circularized by using split oligonucleotides that anneal to both adapter sequences, as further described below. See Section 10, titled "Amplification". The excess adapter (370) does not have an L-adapter and therefore cannot be amplified by PCR or circularized. [Figure 3B] Same as above.

[0010] [Figure 4]Figure 4 shows an exemplary method for attaching a b-BLA (410) to the 3' end of target DNA and an L-adapter (420) to the 5' end in a single reaction. The L-adapter contains a protective bond (e.g., a phosphorothioate bond) to prevent exonuclease digestion (indicated by *). The barcode oligonucleotide of each b-BLA is blocked at the 3' end (e.g., by having a dideoxyblocker nucleotide). A hybridization oligonucleotide of the same b-BLA can be ligated to the target nucleic acid fragment via a 3' branched ligature. The ligated product (450) formed by ligating the hybridization oligonucleotide and the target nucleic acid fragment is extended to incorporate the barcode (430) from the b-BLA and form an extended nucleic acid fragment (460). The extended nucleic acid fragment (460) can be released from the beads by denaturation, and the released fragment is then amplified or cyclized by PCR. If necessary, excess b-BLA(440) can be broken down by lambda exonuclease and exonuclease, thus avoiding amplification of uncoupled adapters.

[0011] [Figure 5]Figure 5 shows another exemplary method of attaching b-BLA(510) to the 3' end and an L-adapter(520) to the 5' end of the target DNA in a single reaction similar to that shown in Figure 4. The b-BLA is immobilized on a bead(500). Unlike Figure 4, where the barcode oligonucleotide is blocked from extension, in Figure 5, the hybridization oligonucleotide is blocked and the barcode oligonucleotide can be ligated to the target nucleic acid fragment to produce a barcoded nucleic acid fragment(550); there is no need to copy the barcode by extension. Next, both the excess b-BLA(560) and the ligated product are denatured, resulting in a single-stranded barcoded nucleic acid fragment(530) which remains ligated to the bead. In one approach, the b-BLA contains uracil near the 3' end of the barcode oligonucleotide; the barcoded nucleic acid fragment(530) produced as described above can be released from the bead by contact with USER. This released strand(540) can then be amplified or directly circulated. Excess b-BLA(570) can be removed as needed by RecJ or Exo7 treatment. "*" represents a phosphorothioate bond.

[0012] [Figure 6]Figure 6 shows an exemplary embodiment of the present invention in which b-BLA comes into contact with target DNA during nickase treatment. Similar to Figure 4, the barcode oligonucleotide of each b-BLA is blocked from elongation, however, in Figure 6, each barcode oligonucleotide may also contain one or more uracil (610) between the barcode sequence (620) and the dideoxyblocker nucleotide. The hybridization oligonucleotide (630) can be ligated to the target nucleic acid fragment via branched ligation. Next, USER is added to cleave the barcode oligonucleotide, releasing the dideoxyblocker nucleotide and resulting in a barcode oligonucleotide (650) with an elongated end. The ligated product (630) is elongated to incorporate the barcode and form a barcoded nucleic acid fragment (640). The barcode oligonucleotide (650) without the 3' blocker nucleotide is also elongated. Next, ExoIII, which has 3'→5' exonuclease activity, is added to completely degrade the excess b-BLA(660), and further partially degrade the barcoded nucleic acid fragment from the 3'→5' direction, resulting in a partially hybridized barcoded target nucleic acid fragment (670). Next, the partially hybridized barcoded target nucleic acid fragment (670) is extended to form a double-stranded barcoded nucleic acid fragment (680), which is then linked to a second adapter via blunt-end linking. In some cases, the second adapter does not contain a 5' phosphate group to minimize self-linking. The linked product is denatured to form a single-stranded nucleic acid fragment (690), which has adapter sequences at both ends. The single-stranded nucleic acid fragment (690) can then be amplified by PCR or cyclized.

[0013] [Figure 7A]Figures 7A and 7B show another embodiment of the present invention in which b-BLA is immobilized on beads (700). Each b-BLA comprises a barcode oligonucleotide (710) and a hybridization oligonucleotide (720) that hybridizes with each other. The hybridization oligonucleotide contains a dideoxyblocker nucleotide at its 3' end, and the barcode oligonucleotide contains uracil at a locus on the 5' side of the barcode sequence (790). Figures 7A and 7B illustrate the following process: 1) A barcode oligonucleotide is ligated to a nickase-treated target nucleic acid fragment to form a barcoded nucleic acid fragment (730) via branched ligation; 2) The hybridization oligonucleotide is removed by denaturation; 3) A nuclease such as RecJ or ExoVII is added to degrade the excess single-stranded b-BLA (740); 4) A primer (750) is annealed to the 5' barcode sequence on the barcoded nucleic acid fragment (730) and extended to form a double-stranded DNA molecule (760); the double-stranded DNA molecule is then ligated to a second double-stranded adapter (770) to form a double-stranded adapter molecule (780) having adapter sequences at both ends, with one adapter sequence derived from the branched adapter and the other from the second double-stranded adapter. Optionally, the second adapter does not contain a 5' phosphate group to avoid self-ligation. Next, the double-stranded molecule (780) having the duaL-adapter sequence is denatured and released from the beads by USER, producing a single-stranded molecule (781), which can then be amplified and / or cyclized. [Figure 7B] Same as above.

[0014] [Figure 8]FIG. 8 shows an exemplary embodiment of the present invention in which b-BLA is immobilized on beads (800). Each b-BLA includes a barcode oligonucleotide (820) and a hybridization oligonucleotide (810). The barcode oligonucleotide (820) includes a dideoxy blocker nucleotide at the 3'. The hybridization oligonucleotide in the b-BLA is ligated to the target nucleic acid fragment via a branched ligation during nickase treatment. Lambda exonuclease and exonuclease I are added to the reaction to remove excess b-BLA (830). The ligation product formed by ligating the hybridization oligonucleotide and the target nucleic acid fragment is extended to copy the barcode, resulting in a barcoded nucleic acid fragment (840), which is separated from the barcode oligonucleotide by denaturation. The primer is annealed to the single-stranded molecule with a sequence 3' to the barcode sequence and extended. The extension forms a double-stranded molecule (850), which is then ligated to a second adapter to form a double-stranded nucleic acid fragment (860) having adapter sequences at both ends. Next, the double-stranded nucleic acid fragment (860) can be amplified by PCR. Alternatively, the double-stranded nucleic acid fragment can be denatured to form a single-stranded nucleic acid fragment, which is then circularized. Optionally, the second adapter lacks a 5' phosphate that can minimize self-ligation of individual second adapters.

[0015] [Figure 9A]Figures 9A and 9B show another embodiment of the present invention in which b-BLA is immobilized on beads (900). Each b-BLA includes a barcode oligonucleotide (910) and a hybridization oligonucleotide (920) that hybridizes to each other. The hybridization oligonucleotide (920) includes a dideoxy blocker nucleotide at its 3'-end. First, the barcode oligonucleotide is ligated to the nicked target nucleic acid fragment to form a barcode nucleic acid fragment (930) via a branched ligation. Second, the hybridization oligonucleotide is removed by denaturation. Third, controlled polymerase extension is performed to leave a 5'-overhang (940) that can be used for 3'-branched ligation. The controlled extension proceeds only about 100-150 bases and is performed by a DNA polymerase having no 3'-5' exonuclease activity, resulting in an A-tail (950) at the end of the template. This results in complete extension of the excess adapter and an A-tail, but the adapter ligated to the genomic fragment is incomplete. Next, ligation is performed using a hairpin adapter having a T-tail complementary to the A-tail of the extended excess adapter, so that the excess adapter (960) is blocked from ligation or extension, while the remaining adapters ligated to the target nucleic acid fragment (970) are not blocked (i.e., these remaining adapters cannot ligate to the hairpin adapter). Terminators can be added at different concentrations or at different times during different cycles to generate extension products of different lengths, providing an overlapping range over most of the bases of each fragment during the sequencing process.

[0016] The remaining adapter (970) is further extended with a reversible terminator, followed by a reaction to remove the terminator blocking group, then 3'-branched ligation is performed to add a second adapter (980) to the terminal target nucleic acid fragment. Next, the reaction is denatured, and the single-stranded molecule containing two adapter sequences at both ends (990) can be amplified or circularized by PCR or circularized. [Figure 9B] The same as above.

[0017] [Figure 10A] Figures 10A and 10B illustrate another embodiment of the present invention, which involves controlled elongation, similar to Figures 9A and 9B. The b-BLA used in this embodiment is also a branched adapter comprising a barcode oligonucleotide and a hybridization oligonucleotide (1020) hybridized with each other. The hybridization oligonucleotide (1020) contains a dideoxyblocker nucleotide at its 3' end. Firstly, the barcode oligonucleotide is ligated to a nickase-treated target nucleic acid fragment to form a barcode nucleic acid fragment (1030) via branching ligation. Secondly, the hybridization oligonucleotide is removed by denaturation. Thirdly, controlled polymerase elongation is performed using a polymerase having 3-5' exonuclease activity under conditions that limit elongation to approximately 100-150 bases. This leaves a 5' overhang (1040) that can be used for 3' branching ligation. This results in incomplete elongation of the adapter linked to the target nucleic acid fragment (1040) and complete elongation of the excess adapter (1050), forming a blunt-ended dsDNA adapter with a 5' phosphate group. Next, lambda exonuclease is added to the reaction, and lambda degrades the blunt-ended dsDNA adapter with the 5' phosphate group (1050). Since lambda exonuclease prefers phosphorylated double-stranded DNA to single-stranded DNA, the adapterized short insertions (such as 1050) are degraded preferentially over the longer insertions (such as 1040). The remaining steps of this method are similar to those shown in Figures 9A and 9B, as shown in Figure 10B. [Figure 10B] Same as above.

[0018] [Figure 11A]Figure 11A shows controlled elongation as described in Figure 10A, where the excess adapter (1150) is fully elongated and the ligated product (1140) is partially elongated. Figure 11B shows that the partially elongated ligated product (1140) is then further elongated in the presence of a reversible terminator, followed by the removal of the terminator blocking group within the reversible terminator, and then ligated with a second adapter (1160). This results in blunt-end ligation of the excess adapter (1150) and 3' branched ligation of the barcoded target nucleic acid fragment (1170), forming a nucleic acid fragment with adapter sequences at both ends (1180). The unligated strand (1190) is elongated by a polymerase-substituted strand under elongation control conditions, resulting in the unligated strand being elongated by approximately 100–150 bases. This extension results in strand displacement of the adaptered nucleic acid fragment (1190), which remains immobilized on the bead, and release of the adaptered nucleic acid fragment (1190). The release of the adaptered nucleic acid fragment can be recovered in solution. The bead can be reused for the next cycle of controlled extension. As with the other embodiments described above with a reversible terminator, the terminator can be added at different concentrations or at different time points between different cycles to produce extension products of different lengths. This is advantageous as it provides a range that overlaps across most of the bases of each fragment during the sequencing process. [Figure 11B] Same as above.

[0019] [Figure 12A]Figures 12A and 12B show the electrophoresis results of nick-linked products formed using the methods disclosed herein. Segmentase (available from MGI, Shenzhen, PRChina) was used in progressively increasing amounts in the different reactions shown in Figure 12A, and Masterase (Qiagen) was used in progressively increasing amounts in the different reactions shown in Figure 12B. Figures 12C and 12D show the electrophoresis results of products formed from two rounds of the nick-linked reaction. Segmentase was used in the reaction shown in Figure 12C, and Masterase was used in the reaction shown in Figure 12D. [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 12D] Same as above. [Modes for carrying out the invention]

[0020] I. Overview This specification describes a “nick-linking” or “nick-linking” single-tube LFR method for preparing sequencing libraries. This method introduces single-strand breaks (e.g., nicks or gaps) into a double-stranded target nucleic acid at a controlled rate, frequency, or both. The method also ligates adapters(s) to the 3' (3-prime) side of the break, the 5' (5-prime) side of the break, or both sides of the nick or gap, as further described below. The addition of one or more adapters produces an “adapted fragment.” The enzymatic reactions involved in library preparation, e.g., nicking and ligation, can be carried out in a single mixture to produce a library of target nucleic acids with the desired adapters and barcodes.

[0021] Nick-linking has specific advantages, making it particularly suitable for de novo assembly of sequence readings for sequencing of large genome fragments.

[0022] Firstly, this process generates overlapping single-stranded nucleic acid fragments that remain related to each other throughout the entire library preparation process. Compared to methods that generate double-strand breaks at DNA break sites (e.g., methods based on transposon insertion), the method disclosed herein avoids material loss and increases the clonal range of the target nucleic acid.

[0023] Secondly, compared to transposon-mediated simultaneous barcoding methods (e.g., described in Zhang et al., Nature Biotechnology, June 2017, doi 10.1038 / nbt.3897), the nick-linking method avoids bias caused by transposase preference for specific DNA sequences.

[0024] Thirdly, unlike multi-step transposon-based simultaneous barcoding methods, the library preparation and simultaneous barcoding processes disclosed herein can be performed as a single-step, single-tube preparation.

[0025] Fourth, the size of the adapter-formed fragments produced by the methods disclosed herein can be controlled by controlling the components during the reaction, regardless of the target nucleic acid. The size of target nucleic acid fragments produced by other existing transposon-based methods is influenced by the amount of high molecular weight genomic DNA in the reaction and is therefore often difficult to control. In contrast, in the methods disclosed herein, the size can be controlled, for example, by balancing the amounts of the nicking agent and ligase.

[0026] An exemplary workflow is shown in Figure 1. In steps 1 and 2, the double-stranded nucleic acid is nicked, resulting in a protruding single-strand break (220). In step 3, the break is extended (equivalently, "spreads" or "opens the gap") by a "gapping enzyme" such as Krenow fragment (if no nucleotides are present). As shown in Figure 2, these nicking and gapping processes produce single-stranded gaps and overlapping nucleic acid fragments (240) ("fragments"). Parts of each of these fragments remain hybridized to parts of another fragment with a complementary sequence.

[0027] In step 3, the fragments are coupled to adapters. One of the adapters may be a branched coupling adapter coupled to a bead or a branched coupling adapter immobilized on a bead called a B-BLA. The other adapter may be an L-adapter provided in solution. If necessary, excess adapters (i.e., adapters not coupled to any fragment) may be removed by a nuclease (step 4).

[0028] In step 5, the adaptered fragment is expanded to potentially generate a double-stranded fragment containing a barcode sequence. Although disclosed herein as separate steps, nicking and ligation may occur in a single reaction, or may occur simultaneously. In some embodiments, the nicking and ligation reactions may last for at least 30 minutes, e.g., at least 60 minutes, at least 90 minutes, or at least 120+ minutes. In some embodiments, the double-stranded fragment is denatured to form a single-stranded molecule.

[0029] In step 6, the denatured nucleic acid fragment is amplified, for example, by PCR using primers annealed to the adapter sequences at both ends of the fragment. Alternatively, the denatured nucleic acid fragment can be circularized and amplified.

[0030] Variations of this workflow are also covered by this disclosure. Exemplary variations are shown in Figures 3–8.

[0031] II. Definition The term "components" or "reaction in a single reaction mixture" means that the reaction occurs in a single mixture without compartmentalization into separate tubes, containers, aliquots, wells, chambers, or droplets during the tagging process. Components can be added simultaneously or in any order to produce a single reaction mixture.

[0032] The term “overhanging single-strand break” refers to a break introduced into a single strand of a double-stranded or partially double-stranded DNA molecule (resulting from nicking or gapping), resulting in multiple overlapping single-stranded nucleic acid fragments that hybridize to other single-stranded nucleic acid fragments. For at least a portion of the nucleic acid fragments, a portion of the 5' sequence is complementary to at least a portion of the 5' sequence of another nucleic acid fragment, and at least a portion of the 3' sequence is complementary to at least a portion of the 3' sequence of yet another nucleic acid fragment, so that under hybridization conditions, multiple nucleic acid fragments hybridize to each other to form a nucleic acid complex. For illustrative purposes only, not limitation, Figure 2 shows a nucleic acid complex containing four nucleic acid fragments separated by overhanging single-strand breaks. It is understood that a nucleic acid complex (or “complex”) may, and typically may, contain more than four nucleic acid fragments.

[0033] The term "partially double-stranded" refers to two DNA strands that hybridize with each other, but where at least a portion of one strand does not hybridize with the other. The two DNA strands in partially double-stranded DNA can be of different lengths or of the same length.

[0034] As used herein, “Unique Molecular Identifiers” (UMIs) refer to sequences of nucleotides present in a DNA molecule that can be used to distinguish individual DNA molecules from one another. See, for example, Kivioja, Nature Methods 9, 72-74 (2012). UMIs are sequenced together with the DNA sequences to which they are associated, and can identify sequence readings that originate from the same source nucleic acid. As is evident from the context, the term “UMI” is used herein to refer to both the nucleotide sequences and physical nucleotides of a UMI. UMIs can be random, pseudo-random, partially random, or non-random nucleotide sequences that are inserted into an adapter or otherwise incorporated into a source nucleic acid (e.g., DNA) molecule to be sequenced. In some implementations, each UMI is expected to uniquely identify any given source DNA molecule present in the sample.

[0035] As used herein, the terms “single-tube LFR” or “stLFR” refer to the process described, for example, U.S. Patent Publication No. 2014 / 0323316 and Wang et al., Genome Research, 29: 798-808 (2019), the entirety of which is incorporated herein by reference, in which, among other things, multiple copies of the same unique barcode sequence (or “tag”) are associated with individual long nucleic acid fragments. In one embodiment of single-tube LFR, long nucleic acid fragments are labeled with “inserted oligonucleotides” at regular intervals. In one embodiment, the inserted oligonucleotides are introduced into the long nucleic acid molecule by one or more enzymes, e.g., transposes, niccasases, and ligases. The barcode sequences between different long nucleic acid fragments are different. Thus, the process for labeling individual long nucleic acid fragments can be conveniently carried out, for example, in a single container without compartmentalization. This process allows for the analysis of numerous individual DNA fragments without the need to separate the fragments into separate tubes, containers, aliquots, wells, or droplets during the tagging process.

[0036] As used herein, “unique” barcode means a nucleotide sequence associated with an individual bead that can be used to distinguish it. In a population of beads, each having a unique barcode, the barcode sequence associated with one bead is different from the barcode sequences of at least 90%, more frequently at least 99%, more frequently at least 99.5%, and most frequently at least 99.9% of the beads in the population.

[0037] The term "conjugate," as used in relation to polynucleotides and substrates (e.g., beads), refers to a polynucleotide (or one end of a polynucleotide) directly contacting or covalently linking with a substrate. For example, a surface may have reactive functional groups that react with functionalities on the polynucleotide molecule to form a covalent linkage. As an exemplary example, b-BLA is immobilized on beads by conjugating either a barcode oligonucleotide or a hybridization oligonucleotide to the beads.

[0038] When used in reference to an adapter (or any other polynucleotide or polynucleotide complex) used in a method or composition disclosed herein, the term “in solution” means that the adapter (or any other polynucleotide or polynucleotide complex) is not immobilized on a substrate and is freely movable in solution. When used to describe a reaction, as in “a reaction carried out in solution,” it means that the reaction occurred entirely between nucleic acids in solution.

[0039] The term "adapter" is used in different senses herein, as is evident from the context. In some embodiments, "adapter" refers to the "branched adapter (BLA)" discussed below. In some embodiments, "adapter" refers to the "L-adapter" discussed below. A BLA immobilized on a bead is called a bead-bound branched adapter ("b-BLA"). A BLA in solution is called a solution-branched adapter ("s-BLA").

[0040] The term "adapted nucleic acid fragment" refers to a polynucleotide containing one target nucleic acid fragment and one or more adapter sequences. For example, one or more adapter sequences may be sequences within the b-BLA, sequences within the L-adapter, or both.

[0041] The term "excessive adapter" (e.g., excessive b-BLA adapter) or "unlighted adapter" refers to an adapter that is immobilized on a bead but is not bound to the target nucleic acid fragment, even though other bead adapters are bound to the target nucleic acid fragment.

[0042] The term "extended nucleic acid fragment" or "barcoded extension product" refers to a fragment that has been extended to an adapter and contains a copy of a barcode.

[0043] The term “concatenated product” or “concatenated adapter” refers to a product that includes a target nucleic acid fragment and an adapter sequence derived from at least a b-BLA adapter. In some cases, the concatenated product may further include an adapter sequence derived from b-BLA at one end and an adapter sequence derived from another adapter (e.g., an L-adapter) at the other end.

[0044] The term "linked first adapter" refers to the product formed by linking the target nucleic acid fragment with the sequence of the first adapter.

[0045] The term "adapter sequence," as is clear from the context, refers to a sequence on either strand of an adapter. That is, an "adapter sequence" can refer to both the adapter sequence on one strand and the complementary sequence on the second strand. For example, a b-BLA adapter sequence could be a sequence on a barcode oligonucleotide or a sequence on a hybridization oligonucleotide.

[0046] The terms “branched ligation adapter,” “branched adapter,” or “BLA” refer to a partially double-stranded adapter. The partially double-stranded adapter comprises (i) a double-stranded blunt end containing the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region containing a barcode sequence. The 5' end of the double-stranded region of the branched adapter can be ligated to the 3' end of a nucleic acid fragment via branching ligation, as further described below.

[0047] The term “bead-immobilized branched coupling adapter” or “b-BLA” refers to a branched coupling adapter immobilized on a bead. The b-BLAs disclosed herein include barcode oligonucleotides and hybridization oligonucleotides that hybridize with each other.

[0048] The term "barcode oligonucleotide" refers to a chain of b-BLA containing a barcode sequence.

[0049] The term "hybridization oligonucleotide" refers to a chain of branched ligation adapters that are complementary to a barcode oligonucleotide.

[0050] The terms “reversible terminator nucleotide” or “reversible terminator” refer to a nucleotide having a 3' reversible blocking group. A “reversible blocking group” refers to a group that can be cleaved to provide a hydroxyl group at the 3' position of a nucleotide that can be linked to the 5' phosphate group of another nucleotide. Reversible blocking groups can be cleaved by enzymes, chemical reactions, heat, and / or light. Exemplary nucleotides having a 3' reversible blocking group are known in the art and disclosed in U.S. Patent No. 10,988,501, the relevant disclosures of which are incorporated herein by reference.

[0051] The term "copy" refers to the process of generating a complementary nucleotide chain of a template through primer extension.

[0052] III. Exemplary Embodiments of the Method The nick-linking method can be carried out according to various schemes. This section provides exemplary embodiments of the method. Those skilled in molecular biology and sequencing who are drawn by this disclosure will recognize numerous variations of the individual steps and can incorporate reagents into the following schemes.

[0053] method 1. Nicking In one approach, a target nucleic acid is combined with one or more nicking agents to create a protruding single-strand break in double-stranded DNA. In some embodiments, the nicking agent is an enzyme (commonly called a “nickase”), such as an endonuclease that cleaves phosphodiester bonds within a polynucleotide chain or removes one or more adjacent nucleotides from a polynucleotide chain. In some cases, the nickase is a non-sequence-specific endonuclease that nicks the DNA strand at random positions. Non-limiting examples of nicking agents include Vibrio brunificus nuclease (Vvn), shrimp dsDNA-specific endonuclease, DNAse I, segmentase (MGI), and masterase (Qiagen). In some embodiments, the nicking agent is a site-specific or sequence-specific nuclease, such as a restriction endonuclease, that nicks the DNA at its recognition sequence. Non-limiting examples of site-specific nickases include Nt.CviPII(CCD), Nt.BspQI, and Nt.BbvCI, described in Shuang-yong Xu, BioMol Concepts 2015; 6(4): 253-267, the full disclosure of which is incorporated herein by reference.

[0054] In some embodiments, the nicking agents disclosed herein may also be chemical nicking agents. Non-limiting examples of chemical nicking agents include dipeptide ceryl histidine (Ser-His), Fe2+ / H2O2, or Cu(II) complex / H2O2.

[0055] Therefore, nicking agents can be grouped into categories such as nonspecific nickase, site-specific nickase, or chemical nicking agents. In some embodiments, the method uses two or more nicking agents. In some embodiments, the method uses two or more nicking agents from the same category of nicking agents. In some embodiments, the method uses nicking agents from different categories.

[0056] Numerous parameters can influence the length of nucleic acid fragments separated by cleavage. Typically, higher concentrations of the nicking agent and longer processing times with the nicking agent result in shorter fragment lengths. By adjusting one or more of these parameters, the fragment length can be controlled within a desired range. In some embodiments, the average length of nucleic acid fragments resulting from nicking is between 200 and 10,000 nucleotides, e.g., 200 to 500 nucleotides, 400 to 1,000 nucleotides, or 1,000 to 10,000 nucleotides.

[0057] 2. Gapping In some embodiments, the nick created by nickase is extended (expanded) by exonuclease to form a gap. This process can be called "gapping," and the exonuclease used in the process can be called a "gapping enzyme." Examples of enzymes having 3' exonuclease activity include DNA polymerase I, Klenow fragments (in the absence of nucleotides), exonuclease III, and others known in the art. Examples of enzymes having 5' exonuclease activity include Bst DNA polymerase, T7 exonuclease, exonuclease VIII cleavage, lambda exonuclease, T5 exonuclease, and other exonucleases known in the art. Low-processivity exonucleases (i.e., exonucleases that remove nucleotides from the ends of polynucleotides at a relatively low rate) are more preferable because they open short gaps (e.g., 2-7 bases, 3-10 bases, or 3-20 bases) and allow dissociation from DNA to enable adapter ligation. When using exonucleases, protection of the DNA adapter from exonuclease digestion can be achieved, if necessary, by introducing phosphorothioate bonds between bases (or modified bases) at the 5' and 3' ends of the adapter.

[0058] Figure 2 illustrates the process of generating overlapping nucleic acid fragments (240) separated by overhanging single-strand breaks (230) using one or more nicking agents and one or more gapping enzymes.

[0059] 3. Adding (connecting) an adapter As discussed above and shown in Figure 2, nicking and gapping generate multiple fragments (240) having a 5' end and a 3' end, respectively. In some embodiments, the “fragments” are single-stranded, but as discussed above and elsewhere in this specification, the fragments can hybridize to a complementary strand to form, for example, a nucleic acid complex. A first adapter is ligated to one end of the fragment (which may be the 5' end or the 3' end), and a second adapter (different from the first adapter) is ligated to the other end. The result is multiple adaptered fragments having two different adapter sequences; all adaptered fragments produced during the reaction have the same defined sequence (e.g., a 5' first adapter sequence and a 3' second adapter sequence, or a 5' second adapter sequence and a 3' first adapter sequence).

[0060] In one embodiment of the present invention, a first adapter is coupled to the 3' end of the fragment, and a second adapter is coupled to the 5' end of the fragment. In some embodiments, the first adapter is a b-BLA and is coupled to the fragment in a "3' branch coupling" process. In some embodiments, the second adapter is an "L-adapter". In some embodiments, coupling of the first and second adapters occurs in the same reaction mixture as the nicking and gapping reactions.

[0061] First adapter connection In some embodiments, the first adapter is a BLA. BLAs are known in the art and are defined above. A BLA comprises (i) a double-stranded blunt end including the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region including a barcode sequence. The double-stranded blunt end provides a 5' phosphate that can be ligated to the 3' of a target nucleic acid fragment via a 3' branched ligation. The 3' branched ligation involves the covalent joining of a 5' phosphate from the blunt-end adapter (donor DNA) to the 3' hydroxyl end of a double-stranded DNA acceptor at a 3' concave strand, gap, or nick. In contrast to conventional DNA ligations, 3' branched ligations do not require complementary base pairing. The 3' branched ligation is described in Wang et al., BioRxiv, June 29, 2018, doi:https: / / doi.org / 10.1101 / 357863; PCT International Publication No. 2019 / 217452; U.S. Patent Application Publication No. 2018 / 0044668 and International Patent Application Publication No. 2016 / 037418, U.S. Patent Application Publication No. 2018 / 0044667, and Wang et al., June 29, 2018, http: / / dx.doi.org / 10.1101 / 357863, all of which are incorporated by reference for all purposes.

[0062] Using 3' branched ligatures, it is theoretically possible to amplify and sequence all sub-fragments of a captured genomic molecule. Therefore, 3' branched ligatures have a wide range of molecular applications, including, for example, the attachment of adapters to DNA or RNA during NGS library preparation.

[0063] Furthermore, this ligation process allows the sample barcode to be positioned adjacent to the genome sequence for sampling multiplexing. The advantage of using these adapters for sample barcoding is that by positioning the barcode adjacent to the genomic DNA, both the barcode and genomic DNA can be sequenced using the same primers, eliminating the need for additional sequencing primers to read the barcode. Sample barcoding allows preparations from multiple samples to be pooled before sequencing and distinguished by barcodes. 3' branched ligation adapters can be synthesized in 96, 384, or 1536 plate formats, with each well containing multiple copies of the adapter carrying the same barcode, and each barcode being different between wells. After supplementation on beads, these adapters can be used for ligation in 96, 384, or 1536 plate formats.

[0064] 3' branching ligation is a simple, low-cost, and bias-free method for simultaneous barcode library preparation, either for standard sequencing library preparation or in the presence of barcode beads (adhesion to the beads may be on the 3' or 5' end of the barcode adapter). This strategy, which relies on the properties of the T4 DNA ligase, allows for the ligation of a double-stranded DNA adapter to the 3' end of DNA in a nick or gap, is the so-called "3' branching ligation" described in Wang et al., DNA Research, 2019 Feb 1 16(1):45-53. This novel ligation does not require degenerate single-stranded bases on the adapter's end to hybridize in the gap, thus enabling more efficient adapter ligation on beads with limited adapter binding capacity. Unlike L-adapter ligation, which requires larger gaps (e.g., 4-7 bases), 3' branching ligation can be performed in a nick or very small gap (1-base gap). Furthermore, this differs from the ligation of 5'-degenerate L-adapters, which may require high concentrations of this 5'-degenerate L-adapter to compensate for the fact that the ligase cannot bind to the single-stranded 5'-phosphate terminus of the L-adapter before hybridization.

[0065] To enable the most efficient 3'-branching ligation on the beads, these adapters may have stretches of the same base or simple repeats to improve access to the target DNA (e.g., free loose loops) imperfectly wrapped around each bead. Single-strand binding proteins (SSBs) can be attached to the single-strand portion of each adapter before the beads are mixed with the genomic DNA.

[0066] In some embodiments, the first adapter is a b-BLA comprising two polynucleotide chains, referred herein as “barcode oligonucleotide” and “hybridization oligonucleotide.” The barcode oligonucleotide is longer than the hybridization oligonucleotide and contains at least one barcode. The barcode oligonucleotide hybridizes with the hybridization oligonucleotide to form a complex that is partially double-stranded and has blunt ends.

[0067] In some embodiments, the barcode oligonucleotide has a 5' phosphate group that can be linked to the 3' end of the 3' concave fragment in the branched linkage and a 3' end that is linked to the bead; on the other hand, the hybridization oligonucleotide is not linked to the bead and has a 3' blocker nucleotide (e.g., dideoxyblocker nucleotide) that prevents the formation of a phosphodiester bond and therefore prevents the self-linking of the branched adapter. The 3' branched linkage results in the barcode oligonucleotide linked to the fragment. Please refer to Figure 9A.

[0068] In some embodiments, the hybridization oligonucleotide may be linked to the 3' of the 3' concave fragment in the branched ligation and have a 5' phosphate group with a 3' end that is joined to the bead; on the other hand, the barcode oligonucleotide is not joined to the bead and has a 3' blocker nucleotide that prevents the formation of a phosphodiester bond. The 3' branched ligation (described later) results in a hybridization oligonucleotide linked to the fragment. See Figures 3 and 4.

[0069] In some embodiments, the first adapter is in a solution. In some embodiments, part of the first adapter is immobilized on a bead, and part of the first adapter is in a solution.

[0070] Second adapter connection Nicks are inserted, and the gaps formed between related DNA fragments are ligated to a second adapter. The second adapter can be an L-adapter, an s-BLA, or any double-stranded or partially double-stranded adapter.

[0071] In some embodiments, the second adapter is an L-adapter. In some embodiments, the L-adapter is in solution. The L-adapter is described in U.S. Patent No. 10,479,991, the full disclosure of which is incorporated herein by reference. The L-adapter used in this method is a single-stranded adapter comprising a hybridization region and a tail region. The hybridization region of the L-adapter contains degenerate bases at its 3' end, e.g., 1 to 10, e.g., 3 to 8, or 4 to 7 degenerate nucleotides (Ns). Thus, the L-adapter can hybridize to a variety of target sequences. When in contact with a nucleic acid fragment in DNA in which the aforementioned nicks have been introduced and gaps formed, the hybridization region of the L-adapter anneals to a complementary sequence in the target nucleic acid, while the tail region remains single-stranded. Under ligation-accepting conditions, the 3' end of the L-adapter is ligated to the 5' end of the nucleic acid fragment. See Figures 3-5.

[0072] In some embodiments, the L-adapter contains specific bases adjacent to the hybridization region to improve ligation efficiency and reduce artifacts. For example, if the nickase used in the reaction preferentially cleaves at a particular base or sequence, the same base (or complementary base) can be manipulated at the end of the L-adapter to increase ligation efficiency. In some embodiments, two or more L-adapters having different sequences, for example, different numbers of degenerate nucleotides, can be used in the same reaction.

[0073] In some embodiments, the second adapter is a partially stranded adapter (Figures 6, 7B, and 8). In some embodiments, the second adapter has a double-stranded blunt end. In some embodiments, a fragment in DNA with a nick and gap formed can be ligated to the first adapter, and after forming double-stranded DNA via primer extension, the second adapter can be ligated to the opposite end from the first adapter. See Figures 5, 6B, and 7. In some embodiments, the second adapter is joined to the fragment by blunt-end ligation. In some embodiments, the second adapter is joined to the fragment by a single-base overhang ligation, provided that polymerase is used during the extension process that leaves the A-tail intact.

[0074] The connection of two adapters to the 5' and 3' ends of a nick or gap in the same reaction. In some embodiments, a first adapter (e.g., b-BLA) can be attached to the 3' end of a fragment, and a second adapter (e.g., L-adapter) can be ligated to the 5' end of a DNA fragment where a nick has been inserted and a gap has been formed. The ligation occurs in the same mixture, while nicking and gapping also occur. In some embodiments, after one round of the nick-ligation reaction, the beads wrapped in genomic DNA can be incubated with nickase and / or gapping enzymes in the presence of additional first and / or second adapters to allow a second round of the nick-ligation reaction to occur. This nick-ligation process can be repeated for multiple rounds, e.g., two, three, or four rounds, to improve the yield of the product ligated with two adapters. Exemplary examples are shown in Examples 6 and 7.

[0075] The conditions can be optimized for simultaneous nicking of both adapters during nicking by adjusting the L-adapter concentration, temperature, cycling, pH, salt concentration, and other additives to enhance 3'-terminus DNA respiration using the branched adapter ligated to the genome fragment and to allow short single-stranded regions for L-adapter hybridization and ligation. See Section 5, “Conditions for Simultaneous Nicking and Ligation,” below. In some embodiments, additional branched ligating adapters can be added to the reaction in solution (s-BLA) in addition to b-BLA to achieve more complete ligation and therefore a less overlapping read range.

[0076] In some embodiments, an enzyme having 5' exonuclease activity is added to the reaction to remove excess first adapter. This can be done before or simultaneously with L-adapter linking. Because excess adapter must be removed, higher concentrations of L-adapter, e.g., 0.01–100 μM, 0.1–50 μM, 0.5–30 μM, 1–20 μM, can be used without generating substantial amounts of bead-adapter + L-adapter linking artifacts. Adapted fragments having both the first adapter sequence and the second adapter sequence (e.g., L-adapter) can be sequenced using Illumina-type and other systems that do not require cyclization. Embodiments of sequencing are further described below.

[0077] In some cases, the opening of the nick can be increased to provide more space for linking a second adapter (e.g., L-adapter) by adding an additional enzyme having 3' exonuclease activity (e.g., DNA polymerase I, nucleotide-free Klenow fragment, exonuclease III, etc.) or 5' exonuclease activity (e.g., full-length Bst DNA polymerase or nucleotide-free Taq polymerase, T7 exonuclease, exonuclease VIII cleavage, lambda exonuclease, T5 exonuclease, etc.). An enzyme or combination of enzymes having both 3' and 5' exonuclease activity has the advantage of creating a gap for L-adapter linking even if the branched adapter is linked within the nick. When using exonucleases, protection of the DNA adapter can be achieved, if necessary, via phosphorothioate bonds between bases and / or modified bases at the 5' and 3' ends of the adapter. As mentioned above, this reaction can be carried out in the presence of polyethylene glycol or betaine, which can increase the activity of the ligation and / or nickase enzyme.

[0078] At this point, if necessary, the excess adapters discussed above can be removed. Using low concentrations of L-adapters and other conditions, adapter-adapter ligation (e.g., ligation between L-adapters themselves, or ligation between b-BLA and L-adapters) can be reduced, and the removal of excess adapters by exonuclease can be skipped. Otherwise, PCR can be performed here as there are adapter sequences on both sides of the subfragment. After PCR has been performed, or if PCR was skipped for a non-PCR process, the next step is rolling circle amplification following cyclization, as described in the previous section.

[0079] In one exemplary embodiment, in a single reaction mixture, a nonspecific nickeling nuclease, a DNA ligase, and a first adapter and a second adapter are mixed with a double-stranded target nucleic acid to produce a fragment having adapter sequences at both ends. In a preferred embodiment, one of the first and second adapters is bound to a micron-sized bead, while the other adapter is in solution.

[0080] The process of adding two adapters to a single reaction mixture can be performed in solution as a simple, low-cost, bias-free method for standard sequencing library preparation. This process can also be used as a simultaneous barcode library preparation method when used with barcode beads to which the adapters are attached.

[0081] 4. Conditions for performing nicking and coupling simultaneously In some embodiments, target nucleic acids may be nickeled and gapped, and one or more adapters may be attached to the fragments produced by nickeling and gapping, in the presence of additives (e.g., polyethylene glycol or betaine) to increase ligase activity, nickeling agent activity, or both. In some embodiments, the attachment includes attaching at least a first adapter (e.g., b-BLA) bound to a bead to the nucleic acid fragment. In some embodiments, the attachment includes attaching both a first adapter bound to a bead in solution and a second adapter (e.g., L-adapter) to the nucleic acid fragment.

[0082] 4.1 Temperature The reaction can be maintained at temperatures ranging from 5 to 65°C, for example, 5 to 42°C, 10 to 37°C, or 5 to 15°C. In some embodiments, the reaction is maintained at room temperature or 37°C. In some embodiments, when using thermostat ligase and nicking enzyme, the reaction can be maintained at temperatures higher than 37°C. In some embodiments, the reaction is subjected to conditional cycling between lower temperatures (5°C to 25°C, for example, 10°C to 15°C) and higher temperatures (for example, 37°C or above) for multiple cycles (e.g., 5 to 100 cycles, or 20 to 60 cycles, 30 to 55 cycles, etc.). Exemplary examples are shown in Examples 1 to 7.

[0083] 4.2 pH In some embodiments, the pH of the reaction mixture is maintained within the range of 5.0 to 9.0, for example, 7.0 to 9.0, to accommodate all the enzymatic functions required for library preparation. The duration of the nicking and ligation reactions may vary depending on the desired size of the nucleic acid fragments and other conditions, such as the concentration of the enzyme (including polymerase, exonuclease, or both), time, temperature, and input DNA volume.

[0084] 4.3 hours Typically, the duration of the nicking and ligation reaction can range from 5 minutes to 5 hours, for example, 15 to 90 minutes, or 30 to 120 minutes. The reaction can be terminated using methods well known in the art. In some embodiments, nicking and ligation are performed in solution, and the reaction can be terminated via a DNA purification method (such as Ampure XP beads from Beckman Coulter). In some embodiments, nicking and ligation are performed on beads, and the reaction can be terminated by washing the beads with a buffer (e.g., Tris NaCl buffer) to remove the enzymes and components required for the nicking and ligation reaction.

[0085] 4.4 Enzymes The methods and compositions described herein enable nicking and ligation in a single reaction mixture. In some embodiments, conditions and enzymes are selected so that ligation occurs at a higher rate than nicking / gapping. This ensures that some of the nicks that initially form gaps are ligated to most of them by adapters before subsequent gapping, thus minimizing DNA loss. The methods and compositions disclosed herein enable high nick resealing rates, e.g., 70–100%, 70–90%, 80–90%, 80–95%, and 90–99%. The nick resealing rate disclosed herein refers to the percentage of open gaps that are resealed by the ligase. High nick resealing rates can be achieved by many methods. In some embodiments, nicking is performed using a low-activity nickase. In some embodiments, nicking is performed using a low concentration of nickase, e.g., 0.00–10 U / µl. In some embodiments, ligation is performed using a ligase with a high ligation rate. In some embodiments, ligation is performed using a high-concentration ligase, for example, 1 to 100 U / μl.

[0086] 4.5 Order of adding ingredients The order in which components are added to a single reaction mixture can be altered. In some embodiments, ligase is added before or simultaneously with the addition of nickase. The order in which ligase is added and the target nucleic acid is loaded onto the beads can also be altered. In some embodiments, ligase is added to the beads immobilized with the adapter before the target nucleic acid (e.g., genomic DNA) is added. In some embodiments, the target nucleic acid is loaded onto the beads before the ligase is added.

[0087] In some embodiments, it is desirable to load the target nucleic acid onto the beads before adding either nickase or ligase so that the target nucleic acid binds to the beads before nicking and ligation. Genomic DNA can typically wrap around micron-sized paramagnetic beads very quickly, typically in about 1 to 10 minutes. In some embodiments, additional steps can be employed to increase the binding efficiency of the target nucleic acid to the beads, which may be particularly useful for binding longer DNA (e.g., longer than 200 kb) to larger beads (e.g., beads with a diameter of 3 microns or more). In some embodiments, the target nucleic acid is bound to the beads in a buffer containing PEG, having a relatively high concentration, e.g., 3 to 12%, e.g., 5 to 10%, with higher PEG concentrations generally resulting in higher binding. In some embodiments, the target nucleic acid is bound to the beads in a buffer having a relatively high pH to enhance the absorption of the target nucleic acid to the beads. In some embodiments, the pH is greater than 7.5, e.g., 7.5 to 9, 8.0 to 9.0, or 8.0 to 8.5. High pH increases DNA adsorption, particularly in buffers with lower PEG concentrations, e.g., 5%. In some embodiments, the buffer contains a low salt concentration, e.g., 10 mM MgCl2. The methods and compositions disclosed herein allow long DNA to rapidly wrap around beads under these conditions (e.g., 5–15 minutes, with the majority of DNA binding in 1–5 minutes or 2–10 minutes), minimizing the disruption of long DNA (e.g., >200kb, or >300kb, or >500kb) before binding to the beads. In one example, gDNA having a length greater than 1Mb can bind to beads having a diameter of about 3µm.

[0088] The target nucleic acid bound to the beads can remain accessible for enzymatic reactions such as nicking, gapping, or adapter ligation. This allows for the simultaneous barcoding of long DNA fragments (e.g., 20–500 kb) bound to the beads at 10–1000 contact points. This enables a common protocol for multiple sequential enzymatic reactions on the DNA adsorbed to the beads, particularly the conditions necessary to maintain DNA binding to the beads as described above.

[0089] DNA can be released from beads during preparation for sequencing. Methods for releasing DNA are not limited to but include using a low-salt buffer (<200 mM) with a pH in the range of 7–8, e.g., approximately 7.5 for 10 minutes–1 hour, e.g., approximately 15 minutes–45 minutes, approximately 15 minutes–45 minutes, or approximately 30 minutes.

[0090] 5. Any steps to remove adapters bonded to excess beads After nicking and ligation, various enzymes may be used to remove excess adapters, i.e., adapters not ligated to the target nucleic acid fragment. In some embodiments, the adapters bound to the beads are partially double-stranded, each containing a relatively short double-stranded region (e.g., 6-20 bases) that can be denatured relatively easily. That is, the adapters can be denatured to single-stranded DNA under conditions that do not result in the destruction of the double-stranded genomic DNA immobilized on the beads. This can be most easily achieved by raising the temperature to the melting point of the short double-stranded region.

[0091] Table 1 shows various enzymes that can be used for this purpose. Table 1. Exemplary enzymes that may be used to remove adapters bound to excess beads. [Table 1]

[0092] Next, adapters bound to the denatured single-stranded beads can be removed using an exonuclease. In some embodiments, adapters bound to excess beads with a 3' end attached to the beads are removed using an exonuclease (e.g., RecJ or ExoVII) that can remove nucleotides from single-stranded DNA in the 5' to 3' direction. In some embodiments, adapters bound to excess beads with a 5' end attached to the beads are removed using an exonuclease (e.g., Exo1, ExoT) that can remove nucleotides from single-stranded DNA in the 3' to 5' direction.

[0093] Alternatively, adapters bound to excess, partially double-stranded beads, which do not require denaturation, can be digested in the absence of dNTPs by a mixture of single-stranded specific exonucleases and enzymes having 3'-5' exonuclease activity on dSDNA, such as ExoIII, T4 DNA polymerase, or Phi29 DNA polymerase. In this embodiment, genomic dsDNA is protected from degradation by these enzymes by adapters ligated to the 3' end of a DNA nick or gap. The ligation results in nucleic acid fragments with single-stranded ends that are not substrates for these dsDNA-specific exonucleases.

[0094] Alternatively, the short double-stranded region of the adapter bound to the bead can be designed with specific bases (e.g., uracil or inosine), which can then be removed by processing with the corresponding DNA glycosylase (e.g., UDG or hAAG) (to create a debase site), followed by EndoIV, EndoVIII, APE1, or any other enzyme capable of removing the debase site. Using this strategy, the melting temperature of the short double-stranded region can be further reduced as the length of the contiguous double-stranded region decreases further after the removal of these bases.

[0095] Another approach is to carry out the reaction in solution, where excess adapters can be removed by a DNA purification method (e.g., Ampure XP beads). Yet another approach is to carry out the reaction on beads, where excess adapters and products bound to the adapters can be released from the beads via enzymatic release. In some embodiments, the adapter bound to the beads contains uracil, inosine, or both at a proximal position on the beads, and an enzyme can be added to release these bases, thus releasing the adapter from the beads. In some embodiments, the adapter is bound to the beads via a bond that is sensitive to chemical treatment, and a chemical can be added to release the adapter. In one example, the adapter is bound to the beads via a biotin-streptavidin interaction, and the interaction can be broken by heating or by treating the adapter bound to the beads with formamide. In another example, the adapter is bound to the beads via a photocleavable linker, and light can be used to cleave the linker and release the adapter from the beads.

[0096] In some embodiments, the method does not include the step of removing adapters bound to excess beads; the primer extension step is performed after the nicking and coupling steps as described above. In some embodiments, the primer extension step is performed after the removal of adapters bound to excess beads.

[0097] 6. Expanding the barcode for copying. In some embodiments, nucleic acid fragments linked by a branching adapter are then extended by DNA polymerase to copy a barcode. One exemplary embodiment is shown in Figure 6.

[0098] In some embodiments, the primer extension step can be performed on beads or in solution to copy the barcode. In some embodiments, a denaturation step (e.g., by heat) is performed to generate a single-stranded fragment linked to the adapter, and the chain linked to the nucleic acid fragment is extended to copy the barcode using a polymerase that does not have chain-displacement activity (e.g., pfu, pfuCx, Taq polymerase, DNA pol1). Figures 3 and 4. In some embodiments, no denaturation step is performed, and the primer is extended using a chain-displacement polymerase (e.g., phi29 polymerase or Bst). In an exemplary example, the reaction is denatured at 95°C for 3 minutes, followed by annealing the primer at 55°C for 3 minutes, and then extending the primer with pfuCx at 72°C for 10 minutes.

[0099] In some embodiments, if barcoded extension products are present in solution, another purification round can be performed at this step. If they are still bound to the beads, the beads can be washed in Tris NaCl buffer.

[0100] In scenarios where the extended nucleic acid fragment already contains two adapters, one at each end of the fragment, as shown in Figures 3 and 4, the extended fragment can be released from the beads for further processing, as described below. In some embodiments, only one adapter may be present in the extension product, as shown in Figures 6 and 7A, and the second adapter may be ligated from the first adapter to the opposite end of the nucleic acid fragment. In some embodiments, the second adapter is ligated to the nucleic acid fragment by blunt-end ligation. In some embodiments, if polymerase is used during the extension process leaving the A-tail intact, the second adapter may be ligated to the nucleic acid fragment by a single base overhang ligation. Importantly, for the purpose of doing this in a PCR-free manner, the 3'OH of the adapter is ligated to the 5'PO4 of the product. This is the original DNA strand (not a copy made during the extension process). For PCR-based library preparation strategies, a separate round of DNA purification is typically performed at this point, followed by PCR amplification.

[0101] 7. Controlled extension to separate connected and unconnected adapters. 7.1 Controlled Elongation In another embodiment, after branching and ligating a first adapter (e.g., b-BLA) to nucleic acid fragments separated by the single-strand breaks described above, the method includes extending a primer hybridized to the first adapter sequence under conditions that allow control of the degree of extension reaction. These extension control conditions include, but are not limited to, selecting a polymerase(s) having an appropriate polymerization rate or other properties, and using various reaction parameters including, but are not limited to, reaction temperature, reaction duration, primer composition, DNA polymerase, primer and nucleotide concentrations, additives, and buffer compositions. In some cases, extension can be controlled by a mixture of a reversible terminator and normal nucleotides for extension. The ratio of the amount of reversible terminator nucleotide to the amount of normal nucleotide can be adjusted to achieve the degree of extension; generally, a higher ratio of the amount of reversible terminator nucleotide to the amount of normal nucleotide results in incomplete extension. In some embodiments, extension is controlled to add only about 100–150 bases.

[0102] In some embodiments, the primer is 3' relative to the barcode sequence in the first adapter and hybridizes to the sequence to be extended under controlled extension conditions. Under such conditions, the extension of the primer to copy the ligation product produced by ligating the first adapter to the target fragment is incomplete, resulting in a partially double-stranded molecule; on the other hand, the extension of the primer completes the copying of the unligated b-BLA, resulting in a double-stranded molecule. Exemplary examples of preparing adapter-modified nucleic acid fragments using controlled extension are shown in Figures 10A-10B and 11A-11B.

[0103] Incomplete extension of the primer for copying the ligated first adapter leaves a 5' overhang that can be used for 3' branched ligation. With a reversible terminator, the blocking group of the reversible terminator is removed at the end of the extension reaction, and the 3'OH group is restored. At this point, a 3' branched ligation can be performed to ligate the second adapter to the 3' end of the fragment, thus producing an adaptered fragment having the first adapter sequence at one end and the second adapter sequence at the other end. In some embodiments, the reversible terminator can be added at different concentrations, different time points, or different cycles to provide a range that overlaps across most of the nucleotides in the nucleic acid fragment.

[0104] By fully extending the primer and copying the unlinked first adapter, a double-stranded molecule is generated, which can be degraded and removed by an enzyme with double-stranded DNA exonuclease activity. See Table 1.

[0105] 7.2 Removal of excessive adapters The following exemplary approach can be used to remove excess unbound adapters (i.e., adapters not bound to any nucleic acid fragments) to minimize the negative interference of these unbound adapters in library preparation.

[0106] 7.2.1 Removal of unconnected adapters by bead purification In some embodiments, excess adapters in the solution can be removed by Ampure XP bead purification (Beckman Coulter, Brea, CA).

[0107] 7.2.2 Block of unconnected adapters with hairpin adapters In some embodiments, excess adapters may be degraded or blocked using methods including, but not limited to, the following approaches. The first method, described in Figures 9A and 9B, uses primer elongation controlled to add only about 100–150 bases. The polymerase used for this elongation (e.g., Tag polymerase) lacks 3'-5' exonuclease activity, produces blunt ends, and can add an A tail to the 3' end. This results in complete elongation, producing an A tail of the excess adapter (i.e., adding A to the 3' end of the adapter) (950), but incomplete elongation (940) for copying the adaptered fragment. Next, ligation is performed using a hairpin adapter having a T tail complementary to the A tail of the fully elongated excess adapter (950), thereby preventing elongation of these excess adapters. However, the hairpin adapter cannot ligate to the incompletely elongated adaptered nucleic acid fragment (970). Therefore, these fragments (970) can be further extended together. In some embodiments, extension is carried out in the presence of a mixture of normal nucleotides and a reversible terminator, followed by a reaction to remove the terminator blocking group, and then a 3' branching ligation with BLA(980). This product (990) can be denatured, separated from the beads, and stored for sequencing. The beads can be reused for another round of primer extension with reversible terminator, removal of blocking group, 3' branching ligation, and denaturation. This process can be repeated multiple times with varying concentrations of terminator, allowing for a nearly complete overlapping DNA range of the genomic fragment.

[0108] 7.2.3 Disassembly of excessive adapters In another embodiment, as disclosed in Figures 10A and 10B, controlled elongation is performed using a polymerase having 3'-5' exonuclease activity (e.g., Pfu, Q5, Phusion, T7, Vent, Klenow, T4). Elongation is limited to approximately 100-150 bases. Again, the result is that incomplete elongation occurs in the adapters ligated to the genomic fragment, while complete elongation occurs in these excess adapters (i.e., unligated adapters). Due to the 3-5' exonuclease activity of the polymerase, the result is a blunt-ended dsDNA adapter with a 5' phosphate group. This is a perfect substrate for lambda exonuclease, but the incomplete elongation products of their adapterized fragments are not good substrates for lambda exonuclease. Consequently, all of the unligated excess adapters can be degraded using treatment with lambda exonuclease. The remaining steps, which are essentially identical to those described in Figures 9A and 9B, are used to ligate the second adapter to the genomic fragment.

[0109] In yet another embodiment, after controlled elongation resulting in complete elongation of the unbound adapter and incomplete elongation of the bound product (Figure 11A), controlled elongation is continued with a reversible terminator added to the reaction. After a certain period of time, the terminator blocking group is removed from the elongation product, and a second adapter is added to the reactant under ligation-accepting conditions (e.g., in the presence of ligase and ligation buffer). Figure 11B. This results in blunt-end ligation of the excess adapter and 3' branching ligation of the adaptered fragment. At this point, controlled primer elongation is performed by elongating one strand (1190) of the newly ligated branched adapter using a strand-substituted polymerase. As previously mentioned, this elongation is controlled by time, temperature, and / or nucleotide concentration, and elongates by approximately 100–150 bases. This extension results in strand displacement of the first adapter (e.g., b-BLA) and release of copies of the dsDNA adapter (1180+1190), which can be separated from the beads and recovered. As in the previous example, the beads can be stored, and this process can be repeated to generate duplicate fragments from each adapter ligated to a genomic DNA fragment.

[0110] In some embodiments, after the connected first adapter has been extended as described above (for example, under extension control conditions), the second adapter (Figure 8, 890) may be connected to the end of the extended product, for example, via a blunt or branched connection.

[0111] 8. Release An extended fragment having two adapters, one at each end, is released from the beads. Release from the beads can be achieved by degrading the beads or by cleaving the chemical linkage between the adapter oligonucleotide and the beads. In some cases, release is achieved by removing an inosine residue from the captured oligonucleotide using the EndoV enzyme, or by removing uracil nucleotides with uracil deglycosylase and EndoIV / EndoVIII or other enzymes with similar function. In some cases, the captured oligonucleotide is crosslinked to the beads via one or more disulfide bonds. In such cases, release can be achieved by exposing the beads to a reducing agent (e.g., dithiothreitol (DTT) or tris(2-carboxyethyl)phosphine (TCEP)).

[0112] 9. Amplification In some embodiments, the extended fragments generated by the method steps described above are amplified. Such amplification methods include, but are not limited to, multi-substitution amplification (MDA), polymerase chain reaction (PCR), linkage chain reaction (also known as oligonucleotide ligase amplification (OLA)), cycling probe techniques (CPT), strand substitution assays (SDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), rolling circle amplification (RCR) (in the case of cyclic fragments), and invasive cleavage techniques. Amplification can be performed after fragmentation or before or after any of the steps outlined herein.

[0113] In an example shown in Figure 3, the ligated product formed by ligating the target nucleic acid fragment with the bead adapter and L-adapter is amplified by annealing the primers to the L-adapter and branched adapter.

[0114] In some embodiments, the extended fragment can first be denatured into a single-stranded nucleic acid molecule. For each of several single-stranded nucleic acid molecules, a sprint oligo is then added and hybridized to adapter sequences attached to both ends of the target nucleic acid fragment, and the single-stranded nucleic acid is then cyclized in the presence of a ligase (e.g., T4 or Taq ligase). The DNA polymerase used in RCR may be any DNA polymerase having strand displacement activity, e.g., Phi29, Bst DNA polymerase, Klenow fragment of DNA polymerase I, and Deep-Vent® NDA polymerase (NEB#MO258). These DNA polymerases are known to have different strengths of strand displacement activity. Selecting one or more suitable DNA polymerases to be used in the present invention is within the capabilities of those skilled in the art.

[0115] 10. Sequence determination The amplified and extended fragments can be sequenced using sequencing methods well known in the art, including, but not limited to, synthetic polymerase-based sequencing (e.g., HiSeq 2500 system, Illumina, San Diego, CA), ligation-based sequencing (e.g., SOLiD 5500, Life Technologies Corporation, Carlsbad, CA), ion semiconductor sequencing (e.g., Ion PGM or Ion Proton Sequencer, Life Technologies Corporation, Carlsbad, CA), zero-mode waveguide sequencing (e.g., PacBio RS sequencer, Pacific Biosciences, Menlo Park, CA), nanopore sequencing (e.g., Oxford Nanopore Technologies Ltd., Oxford, United Kingdom), pyrosequencing (e.g., 454 Life Sciences, Branford, CT), or other sequencing techniques. Some of these sequencing techniques are short-read techniques, while others produce long reads, such as GS FLX+ (454 Life Sciences; up to 1000 bp), PacBio RS (Pacific Biosciences; approximately 1000 bp), and nanopore sequencing (Oxford Nanopore Technologies Ltd.; 100 kb). Longer reads are advantageous for haplotyping and require fewer calculations, but prior to haplotyping, it may be necessary to identify and correct the higher error rates and errors in longer reads according to the methods described herein.

[0116] In one embodiment, sequencing is performed using a combinatorial probe-anchor linkage (cPAL), as described, for example, in U.S. Patent No. 20140051588 and U.S. Patent No. 20130124100, both of which are incorporated herein by reference in whole for all purposes.

[0117] In some embodiments, a single-stranded molecule can be generated by denaturing a fragment ligated to an adapter, or its amplified product. For example, 8-40 nucleotide sprint oligonucleotides are annealed to both ends of a single-stranded molecule. These annealed oligonucleotides allow for an overlap of 1-10 nucleotides between the two ends of the product, similar to the overhangs created after restriction enzyme digestion of plasmid DNA. The ligase can then be used to create a single-stranded ring with a small region of double-stranded DNA at the ligation site. These circles can then be used to produce DNA nanoballs (DNBs) for DNBseq sequencers.

[0118] In some embodiments, the fragment contains both a b-BLA adapter sequence at the 3' end and an L-adapter sequence at the 5' end, as described above. These adaptered fragments can be sequenced using Illumina-type and other systems that do not require circularization.

[0119] composition 1. Sample Samples containing target nucleic acids can be obtained from any suitable source. For example, a sample may be obtained from or provided by any organism of interest. Such organisms include, for example, plants; animals (e.g., mammals, including humans and non-human primates); or pathogens, such as bacteria and viruses. In some cases, a sample may be or be obtained from cells, tissues, or polynucleotides of a population of such organism of interest. As another example, a sample may be a microbiome or microbiota. Where appropriate, a sample may be an environmental sample, such as a sample of water, air, or soil.

[0120] Samples derived from the organism of interest or a population of such organisms include, but are not limited to, samples of bodily fluids (including, but not limited to, blood, urine, serum, lymph, saliva, anal and vaginal secretions, sweat, and semen); cells; tissues; biopsies, research samples (e.g., products of nucleic acid amplification reactions such as PCR amplification); purified samples, e.g., purified genomic DNA; RNA preparations; and biological samples (e.g., bacteria, viruses, genomic DNA). Methods for obtaining target polynucleotides (e.g., genomic DNA) from organisms are well known in the art.

[0121] 2.Target nucleic acid As used herein, the terms “target nucleic acid” (or “polynucleotide”) or “target nucleic acid” refer to any nucleic acid (or polynucleotide) suitable for processing and sequencing by the methods described herein. Nucleic acids may be single-stranded or double-stranded and may include DNA, RNA, or other known nucleic acids. Target nucleic acids may be from any organism, but are not limited to viruses, bacteria, yeast, plants, fish, reptiles, amphibians, birds, and mammals (including, but not limited to, mice, rats, dogs, cats, goats, sheep, cattle, horses, pigs, rabbits, monkeys, and other non-human primates, and humans). Target nucleic acids may be obtained from an individual or from multiple individuals (i.e., a population). Samples from which nucleic acids are obtained may contain nucleic acids derived from cells or even mixtures of organisms, such as human salivary samples containing human and bacterial cells; or mouse xenografts containing mouse cells and cells derived from transplanted human tumors. Target nucleic acids may be unamplified or amplified by any suitable nucleic acid amplification method known in the art. The target nucleic acids may be purified according to methods known in the art to remove cellular and intracellular contaminants (such as lipids, proteins, carbohydrates, and nucleic acids other than those to be sequenced), or they may not be purified, i.e., they may include at least several cellular and intracellular contaminants, including intact cells that are destroyed to release their nucleic acids for processing and sequencing. The target nucleic acids may be obtained from any suitable sample using methods known in the art. Such samples may include, but are not limited to, biological samples, e.g., tissues, isolated cells or cell cultures, body fluids (including, but not limited to, blood, urine, serum, lymph, saliva, anal and vaginal secretions, sweat and semen); and environmental samples, e.g., air, agricultural, water and soil samples.

[0122] The target nucleic acid may be genomic DNA (e.g., from a single individual), cDNA, and / or a complex nucleic acid containing nucleic acids from multiple individuals or genomic nucleic acids. Examples of complex nucleic acids include the microbiome in the bloodstream of a pregnant mother, circulating fetal cells (see, e.g., Kavanagh et al., J. Chromatol. B 878: 1905-1911, 2010), and circulating tumor cells (CTCs) from the bloodstream of a cancer patient. In one embodiment, such a complex nucleic acid has a complete sequence containing at least 1 gigabase (Gb) (the diploid human genome contains approximately 6 Gb of sequence).

[0123] In some cases, the target nucleic acid or the first complex is a genomic fragment. In some embodiments, the genomic fragment is longer than 10 kb, for example, 10–100 kb, 10–500 kb, 20–300 kb, 50–200 kb, 100–400 kb, or longer than 500 kb. In some cases, the target nucleic acid or the first complex is 5,000–100,000 kb in length. The amount of DNA (e.g., human genomic DNA) used in a single mixture may be <10 ng, <3 ng, <1 ng, <0.3 ng, or <0.1 ng of DNA. In some embodiments, the amount of DNA used in a single mixture may be less than 3,000 ×, for example, less than 900 ×, less than 300 ×, less than 100 ×, or less than 30 × haploid DNA amounts. In some embodiments, the amount of DNA used in a single mixture may be at least 1× haploid DNA, for example, at least 2× or at least 10× haploid DNA.

[0124] The target nucleic acid can be isolated using conventional techniques, such as those disclosed in Sambrook and Russell, Molecular Cloning: A Laboratory Manual. In some cases, particularly when small amounts of nucleic acid are used in a particular step, it is advantageous to provide a carrier DNA, such as an unrelated cyclically synthesized double-stranded DNA, to be mixed with the sample nucleic acid whenever only small amounts of sample nucleic acid are available and there is a risk of loss through nonspecific binding, such as the container wall.

[0125] According to some embodiments of the present invention, genomic DNA or other complex nucleic acids can be obtained from individual cells or a small number of cells, with or without purification, by any known method.

[0126] Long fragments are desirable for the method of the present invention. Long fragments of genomic DNA can be isolated from cells by any known method. A protocol for isolating long genomic DNA fragments from human cells is described, for example, in Peters et al., Nature 487:190-195 (2012). In one embodiment, cells are lysed and intact nuclei are pelleted by a gentle centrifugation step. Genomic DNA is then released after digestion with proteinase K and RNase over several hours. The material can be treated to reduce the concentration of remaining cellular waste, for example, by dialysis and / or dilution for a period of time (i.e., 2 to 16 hours). Since such a method does not require the use of many destructive processes (ethanol precipitation, centrifugation, and vortexing, etc.), the genomic nucleic acids remain largely intact, producing the majority of fragments having a length of more than 150 kilobases. In some embodiments, fragments are about 5 to about 750 kilobases in length. In further embodiments, the fragments are approximately 150–600, 200–500, 250–400, and 300–350 kilobases in length. The smallest fragment usable for haplotyping is approximately 2–5 kb; there is no maximum theoretical size, but the fragment length can be limited by shear resulting from the handling of the starting nucleic acid preparation.

[0127] In other embodiments, long DNA fragments are isolated and manipulated in a manner that minimizes shearing or absorption of the DNA into a container, for example, by isolating cells in agarose gel plugs or agarose in oil, or by using specially coated tubes and plates.

[0128] According to another embodiment, in the case of a sample containing a small number of cells (e.g., 1, 2, 3, 4, 5, 10, 10, 15, 20, 30, 40, 50, or 100 cells derived from a microbial biopsy or circulating tumor cells or embryonic cells), all long fragments obtained from the cells are barcoded using the method disclosed herein in order to obtain a uniform genomic range.

[0129] 3. Barcode According to one embodiment, a barcode-containing sequence having two, three, or more segments is used, of which, for example, one is a barcode sequence. For example, the introduced sequence may include one or more regions of a known sequence and one or more regions of a degenerate sequence that acts as a barcode(s) or tag(s). The known sequence (B) may include, for example, a PCR primer binding site, a transposon end, a restriction endonuclease recognition sequence (e.g., a site for a rare cutter, e.g., Not I, Sac II, Mlu I, BssH II, etc.), or other sequences. The degenerate sequence acting as a tag(s) (N) is long enough to provide a population of different sequence tags equal to, or preferably larger than, the number of fragments of the target nucleic acid to be analyzed.

[0130] According to one embodiment, the barcode-containing sequence includes one region of a known sequence of any selected length. According to another embodiment, the barcode-containing sequence includes two regions of a known sequence of a selected length adjacent to a region of a degenerate sequence of a selected length, i.e., B n N n B n The configuration includes, where N can be long enough to tag a long fragment of the target nucleic acid, for example, but not limited to, N = 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, and B can be of any length to accommodate the desired sequence, such as a transposon end, primer binding site, etc. For example, such an embodiment includes B 20 N 15 B 20 It is possible.

[0131] In one embodiment, a two-segment or three-segment design is utilized for barcodes used to tag long fragments. This design allows for a wider range of possible barcodes by enabling the generation of combined barcode segments by concatenating different barcode segments together to form complete barcode segments, or by using segments as reagents in oligonucleotide synthesis. This combined design provides a larger repertoire of possible barcodes, while reducing the number of full-size barcodes that need to be generated. In a further embodiment, unique identification of each long fragment is achieved with an 8-12 base pair (or longer) barcode.

[0132] In one embodiment, two different barcode segments are used. Segments A and B are easily modified to each contain a different half-barcode sequence, generating thousands of combinations. In a further embodiment, the barcode sequences are incorporated onto the same adapter. This can be achieved by splitting adapter B into two parts, each having a half-barcode sequence separated by a common overlapping sequence used for concatenation. The two tag components each have 4 to 6 bases. An 8-base (2×4 base) tag set can uniquely tag 65,000 sequences. Both 2×5 base and 2×6 base tags may include the use of degenerate bases (i.e., "wildcards") to achieve optimal decoding efficiency.

[0133] In further embodiments, unique identification of each sequence is achieved using an 8-12 base pair error-corrected barcode. The barcode may have a length of 5-20 information bases, typically 8-16 information bases, which is illustrative but not limited to the barcode.

[0134] 4. UMI In various embodiments, unique molecular identifiers (UMIs) are used to distinguish individual DNA molecules from one another. For example, UMIs are used to distinguish between capture oligonucleotides immobilized on a first bead. An assembly of adapters is generated, each having a UMI, and these adapters are attached to the fragments to be sequenced or other source DNA molecules, and each individual sequenced molecule has a UMI that helps distinguish it from all the other fragments. In such an implementation, a very large number of different UMIs (e.g., thousands to millions) can be used to uniquely identify DNA fragments in a sample.

[0135] The UMI is long enough to ensure the uniqueness of each and all source DNA molecules. In some embodiments, the unique molecular identifier is about 3–12 nucleotides long, or 3–5 nucleotides long. In some cases, each unique molecular identifier is about 3–12 nucleotides long, or 3–5 nucleotides long. Thus, the unique molecular identifier can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more nucleotides long.

[0136] 5. Barcode Beads The beads are barcoded by barcode oligonucleotides in b-BLA immobilized thereon. Each bead contains multiple b-BLAs, and therefore multiple barcode oligonucleotides. Each barcode oligonucleotide contains at least one barcode. Barcode oligonucleotides on the same bead share the same barcode sequence, while barcode oligonucleotides on different beads have different barcode sequences. Each bead itself carries multiple copies of its own barcode sequence, which can be transferred to a target nucleic acid fragment using the method described above.

[0137] The beads used may have diameters ranging from 1 to 20 μm, alternatively 2 to 8 μm, 3 to 6 μm, or 1 to 3 μm, for example, in the range of about 2.8 μm. For example, the spacing between barcoded oligonucleotides on the beads may be at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, or at least 7 nm. In some (come) embodiments, the spacing is less than 10 nm (e.g., 5 to 10 nm), less than 15 nm, less than 20 nm, less than 30 nm, less than 40 nm, or less than 50 nm. In some embodiments, the number of different barcodes used per mixture may be >1M, >10M, >30M, >100M, >300M, or >1B. As will be discussed below, a very large number of barcodes can be generated for use in the present invention, for example, using the methods described herein. In some embodiments, the number of different barcodes used per mixture may be >1M, >10M, >30M, >100M, >300M, or >1B, and they are sampled from a pool of at least 10 times greater diversity (e.g., different barcodes on beads of >10M, >0.1B, >0.3B, >0.5B, >1B, >3B, >10B). In some embodiments, the number of barcodes per bead is 100k to 10M, e.g., 200k to 1M, 300k to 800k, or about 400k.

[0138] In some embodiments, the barcode region is approximately 3–15 nucleotides long, for example, 5–12, 8–12, or 10 nucleotides long. In some cases, each barcode in the barcode region is approximately 3–12 nucleotides long, or 3–5 nucleotides long. Thus, the barcode is either a sample barcode, a cell barcode, or any other barcode, and can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more nucleotides long. In one particular example, each barcode region contains three barcodes, each barcode consisting of 10 bases, and the three barcodes are separated by a common sequence of 6 bases.

[0139] The barcode beads are moved to the target nucleic acid sequence. In some embodiments, the movement was made to occur at regular intervals via the ligation of the 3' end of an adapter oligonucleotide to the nucleic acid fragment created by the disclosed nicking and gapping.

[0140] In some embodiments, barcode beads are constructed using three sets of double-stranded barcode DNA molecules via a split-and-pool ligation strategy. In some embodiments, each set of double-stranded barcode DNA molecules consists of 10 base pairs, and the three sets have different nucleic acid sequences. An exemplary method of split-and-pool ligation for generating barcode beads is described in PCT Publication 2019 / 217452, the disclosure of which is incorporated herein by reference in whole. Figures 12 and 13 of International Publication 2019 / 217452 also illustrate the split-and-pool methodology. In one approach, a common adapter sequence containing a PCR primer annealing site was attached to Dynabeads™ M-280 streptavidin (ThermoFisher, Waltham, MA) magnetic beads having a 5' double biotin linker. Integrated DNA Technologies (Coralville, IA) constructed 1,536 barcode oligos in three sets containing regions of overlapping sequences. The ligation was performed in a 384-well plate using a 15 μL reaction containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM ATP, 2.5% PEG-8000, 571 units of T4 ligase, 580 pmol of barcode oligo, and 65 million M-280 beads. The ligation reaction was incubated on a rotor for 1 hour at room temperature. During ligation, the beads were pooled into a single container by centrifugation, collected to the side of the container using a magnet, and washed once with a high-salt wash buffer (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 0.1 mM EDTA, and 0.05% Tween20) and twice with a low-salt wash buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 0.05% Tween20). The beads were resuspended in 1× ligation buffer, dispersed in a 384-well plate, and the ligation process was repeated.

[0141] In one embodiment, the present invention provides a composition comprising beads having an adapter oligonucleotide containing an attached cloned barcode, the composition comprising more than 3 billion different barcodes, the barcodes being tripartite barcodes having the structure 5'-CS1-BC1-CS2-BC2-CS3-BC3-CS4. In some embodiments, CS1 and CS4 are longer than CS2 and CS3. In some embodiments, CS2 and CS3 are 4 to 20 bases, CS1 and CS4 are 5 or 10 to 40 bases, e.g., 20 to 30, and the BC sequence is 4 to 20 bases (e.g., 10 bases) in length. In some embodiments, CS4 is complementary to the sprint oligonucleotide. In some embodiments, the composition comprises a crosslinked oligonucleotide. In some embodiments, the composition comprises a crosslinked oligonucleotide, beads containing the aforementioned tripartite barcode, and genomic DNA comprising a hybridization sequence having a region complementary to the crosslinked oligonucleotide.

[0142] Another source of cloned barcodes, such as beads or other supports associated with numerous copies of the tag, can be prepared by emulsion PCR, CPG (controlled pore glass), or chemical synthesis, and other particles can be prepared together with the prepared copies of the compatible barcode. Populations of tag-containing DNA sequences can be PCR-amplified on beads in water-in-oil (w / o) emulsion by known methods. See, for example, Tawfik and Griffiths, Nature Biotechnology 16: 652-656 (1998); Dressman et al., Proc. Natl. Acad. Sci. USA 100:8817-8820, 2003; and Shendure et al., Science 309:1728-1732 (2005). This results in numerous copies of each single tag-containing sequence on each bead.

[0143] Another way to create a source of clone barcodes is a "mix and split" combinatorial process by oligonucleotide synthesis on microbeads or CPG. Using this process, a set of beads can be created, each having a population of copies of a barcode. For example, on average, for each of 100 beads, all Bs, each of which is represented by about 1 billion copies of about 1000 or more copies 20 N 15 B 20 To create, start with about 100 billion beads and synthesize the B 20 common sequence (adapter) on all of them, then split them into 1024 synthesis columns to create different 5-mers in each, then mix them, then split them again into 1024 columns to create additional 5-mers, then repeat it once more to complete N15, then mix them, and in one large column, synthesize the final B 20 as a second adapter. Thus, in 3050 syntheses, in one large emulsion PCR reaction, a "clone-like" barcode set can be created that is the same as about 100 billion beads (1 12 beads), which is to prevent only 1 in 10 beads from having the starting template (the other 9 do not) and having 2 templates with different barcodes per bead.

[0144] An exemplary process for barcode array assembly is described in PCT Application Publication No. 2019 / 217452, the disclosure of which is incorporated herein by reference.

[0145] 6. Immobilization Polynucleotides can be immobilized on a substrate (e.g., beads) by various techniques, including covalent and non-covalent attachment. In some embodiments, the polynucleotide is bonded to the substrate (e.g., beads), i.e., one end of the polynucleotide is in direct contact with the substrate or linked to it. For example, the surface may have reactive functional groups that react with complementary functional groups on the polynucleotide molecule to form a covalent bond. Long DNA molecules, e.g., several nucleotides or more, can also be efficiently attached to hydrophobic surfaces, e.g., clean glass surfaces with low concentrations of various reactive functional groups such as -OH groups. In other embodiments, the polynucleotide molecule can be adsorbed to the surface via nonspecific interactions with the surface or via non-covalent interactions such as hydrogen bonding or van der Waals forces.

[0146] In some embodiments, polynucleotides are immobilized on a surface by hybridizing to a captured oligonucleotide on the surface and forming a complex with the components of the captured oligonucleotide, for example, a double helix or a partially double helix.

[0147] 7. Reaction mixture This specification provides a reaction mixture comprising one or more nickeling agents, one or more ligases, a plurality of beads, and a plurality of overlapping nucleic acid fragments separated by protruding single-strand breaks. Each bead comprises at least one branched ligation adapter immobilized thereon. Each branched ligation adapter comprises a hybridization oligonucleotide and a barcode oligonucleotide. The barcode oligonucleotide comprises a barcode and is attached to the bead, while the hybridization oligonucleotide is not attached to the bead. Each of the plurality of beads comprises a unique barcode sequence, i.e., branched ligation adapters on the same bead share the same barcode sequence, and branched ligation adapters on different beads have different barcode sequences.

[0148] The barcode oligonucleotide is hybridized to a hybridization oligonucleotide to form a partially double-stranded nucleic acid molecule containing a single-stranded region and a double-stranded region. The double-stranded region includes a double-stranded blunt end with a 5' end and a 3' end, the 5' end of the double-stranded blunt end being ligated to the 3' end of the nucleic acid fragment.

[0149] Exemplary Embodiments The following are non-limiting exemplary embodiments of the methods and compositions disclosed herein.

[0150] Embodiment 1. A method for preparing an adapter-modified polynucleotide library for sequencing, comprising: (a) contacting a double-stranded target nucleic acid with one or more nickeling agents to generate a plurality of overlapping nucleic acid fragments separated by overhanging single-strand breaks in a single reaction mixture; (b) providing a plurality of beads each containing a plurality of branched ligating adapters (b-BLAs) immobilized on a bead, providing a population of L-adapters having a degenerate sequence at the 3' end; and (c) contacting a b-BLAs with at least one of the nucleic acid fragments in the presence of a ligase, thereby (d) a method comprising (a) ligating a b-BLA to the 3' end of a nucleic acid fragment, and (b) contacting a group of L-adapters in the presence of a ligase to ligate an L-adapter to the 5' end of the nucleic acid fragment, thereby obtaining a library of nucleic acid fragments having an L-adapter sequence at the 5' end and a b-BLA adapter sequence at the 3' end, wherein each b-BLA comprises a barcode oligonucleotide containing the b-BLA adapter sequence and a hybridization oligonucleotide that hybridizes to the barcode oligonucleotide, and each L-adapter contains the L-adapter sequence. Optionally, the 3' end of the hybridization oligonucleotide is a blocker nucleotide.

[0151] Embodiment 2. The method according to Embodiment 1, wherein the 3' end of the L-adapter is ligated to at least one 5' end of a nucleic acid fragment.

[0152] Embodiment 3. The method according to Embodiment 1, wherein each BLA comprises (i) a double-stranded blunt end including the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region including a barcode sequence, wherein the 5' end of the strand in the double-stranded blunt end is linked to at least one 3' end of the nucleic acid fragment via a branched linkage.

[0153] Embodiment 4. The method according to Embodiment 1, further comprising adding an enzyme to the reaction, wherein the enzyme degrades excess b-BLA before the L-adapter is linked.

[0154] Embodiment 5. The method according to Embodiment 1, wherein the L-adapter contains 1 to 10 degenerate bases at its 3' end.

[0155] Embodiment 6. The method according to Embodiment 1, wherein the L-adapter is in a solution, the barcode oligonucleotide is attached to the bead, and the hybridization oligonucleotide is not attached to the bead.

[0156] Embodiment 7. The method according to Embodiment 5, wherein the b-BLA contains uracil, and the uracil can be removed to release the b-BLA from the beads.

[0157] Embodiment 8. The method according to Embodiment 5, wherein each bead is fixed thereon with a plurality of b-BLAs, and each of the plurality of b-BLAs has the same barcode sequence.

[0158] Embodiment 9. The method according to Embodiment 1, further comprising extending at least one of a nucleic acid fragment to generate an extended nucleic acid fragment by linking it with both a b-BLA and an L-adapter, wherein the extended nucleic acid fragment includes a copy of a barcode.

[0159] Embodiment 10. The method according to Embodiment 8, further comprising cyclizing the extended nucleic acid fragment.

[0160] Embodiment 11. The method according to Embodiment 5, comprising a plurality of beads, each bead containing a unique barcode sequence.

[0161] Embodiment 12. The method according to Embodiment 1, wherein the 3' end of the double-stranded region, or the 3' end of the hybridization oligonucleotide, is a dideoxyblocker nucleotide.

[0162] Embodiment 13. The method according to Embodiment 1, wherein the average length of the nucleic acid fragments is 200 to 10,000 nucleotides.

[0163] Embodiment 14. A method of an embodiment in which more than 50% of the protruding single-strand breaks created in step (a) are closed by linking in step (b).

[0164] Embodiment 15. The method according to Embodiment 1, wherein one or more nicking agents are selected from the group consisting of nonspecific nicking nucleases, site-specific nicking nucleases, and chemical nicking agents.

[0165] Embodiment 16. The method according to Embodiment 1, wherein the nonspecific nickase is selected from the group consisting of Vvn, shrimp dsDNA-specific endonuclease, and DNAse I.

[0166] Embodiment 17. The method according to Embodiment 1, wherein the ligase is T4 DNA ligase.

[0167] Embodiment 18. A method for preparing a library of polynucleotides for sequencing, in a single reaction mixture, (a) Contacting a double-stranded target nucleic acid with one or more nicking agents to generate duplicate nucleic acid fragments separated by overhanging single-strand breaks, (b) Contacting a nucleic acid fragment with beads containing a plurality of partially double-stranded first adapters in the presence of a ligase, wherein each first adapter contains (i) a double-stranded blunt end containing the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region immobilized on the bead, the single-stranded region containing a barcode, thereby ligating the 5' end of the strand at the double-stranded blunt end of at least one first adapter to at least one 3' end of the nucleic acid fragment using a DNA ligase, thereby producing a ligated first adapter, the ligated first adapter containing a barcode and at least one nucleic acid fragment, (c) Modifying the connected first adapter, (d) Controlled extension of a primer hybridized to a 3' sequence relative to the barcode in the linked first adapter, thereby generating a partially extended chain complementary to the linked first adapter. Includes.

[0168] Embodiment 19. The method according to Embodiment 18, wherein at least one of the partially double-stranded first adapters remains uncoupled, and controlled elongation is performed by hybridizing a primer which hybridizes to a sequence that is 3' relative to the barcode in both the coupled and uncoupled first adapters, thereby producing a partially elongated chain complementary to the coupled first adapter and a fully elongated chain complementary to the uncoupled first adapter, thereby producing a mixture comprising a partially double-stranded molecule containing the coupled first adapter and a double-stranded molecule containing the uncoupled adapter, which includes shorter and longer chains.

[0169] Embodiment 20. The method according to Embodiment 19, further comprising adding an exonuclease having double-stranded DNA exonuclease activity, thereby causing the exonuclease to degrade the double-stranded molecule.

[0170] Embodiment 21. The method according to Embodiment 19, further comprising adding a hairpin adapter to the mixture under coupling-allowable conditions in step (d), thereby coupling a double-stranded molecule to one hairpin adapter, while partially double-stranded molecules remain uncoated to the hairpin adapter.

[0171] Embodiment 22. The method according to Embodiment 21 or Embodiment 20, further comprising (e) extending a shorter chain in a partially double-stranded molecular chain to copy the sequence of nucleic acid fragments in a longer chain, thereby generating a further extended chain, and (f) ligating a second adapter to the 3' end of the further extended chain.

[0172] Embodiment 23. The method according to Embodiment 22, wherein the extension of the shorter chain in step (e) is carried out in the presence of a mixture of extendable nucleotides and nucleotides having a 3' reversible blocking group, and the linking of the second adapter in step (f) is carried out after the removal of the 3' blocking group.

[0173] Embodiment 24.3' The method according to Embodiment 23, wherein a nucleotide having a reversible blocking group is added between different cycles.

[0174] Embodiment 25. The method according to Embodiment 23, wherein the second adapter is a branching adapter (BLA).

[0175] Embodiment 26. The method according to Embodiment 23, further comprising extending the linked second branched coupling adapter with a chain substitution polymerase.

[0176] Embodiment 27. The method according to any one of Embodiments 1 to 26, wherein the target nucleic acid is bound to the beads before steps (a) and (b).

[0177] Embodiment 28. The method of Embodiment 27, comprising incubating the target nucleic acid with beads for 0 to 30 minutes prior to nicking in step (a).

[0178] Embodiment 29. The method according to Embodiment 28, wherein the target nucleic acid is incubated with beads in a buffer containing 3-12% PEG.

[0179] Embodiment 30. The method according to any one of Embodiments 1 to 26, wherein the pH of the single reaction mixture is 7 to 9.

[0180] Embodiment 31. The method according to any one of Embodiments 1 to 26, wherein step (a) occurs in the presence of ligase.

[0181] Embodiment 32. The method according to any one of Embodiments 1 to 26, wherein one or more nicking agents and ligases are selected such that the binding rate is higher than the nicking rate.

[0182] Embodiment 33. The method according to Embodiment 1, further comprising removing the DNA strand of the first adapter that is not linked to the nucleic acid fragment by denaturing the reaction mixture after step (b).

[0183] Embodiment 34. The method according to any one of Embodiments 1 to 26, further comprising step (a) adding an exonuclease to a single reactant to increase the gap of the protruding single-strand break.

[0184] Embodiment 35. The method according to Embodiment 34, wherein the increased gap has a length of 1 to 30 bases in the protruding single-strand break.

[0185] Embodiment 36. A reaction mixture comprising (1) one or more nickeling agents, (2) one or more ligases, and (3) a plurality of overlapping nucleic acid fragments separated by protruding single-strand breaks, and (4) a partially double-stranded branching adapter comprising barcode oligonucleotides and hybridization oligonucleotides that hybridize with each other to form a partially double-stranded nucleic acid molecule, wherein the barcode oligonucleotides are attached to beads and include barcodes, and the hybridization oligonucleotides are not attached to beads, and the partially double-stranded nucleic acid molecule comprises (i) a double-stranded blunt end having a 5' end and a 3' end, and (ii) a single-stranded region having a barcode and a single-stranded end, the 5' end of the double-stranded blunt end being linked to at least one 3' end of the nucleic acid fragment.

[0186] Embodiment 37. The reaction mixture according to Embodiment 36, wherein at least one 5' end of a nucleic acid fragment is ligated to an L-adapter.

[0187] Embodiment 38. The reaction mixture according to Embodiment 37, wherein the L-adapter contains 1 to 10 degenerate bases at its 3' end.

[0188] Embodiment 39. A method for preparing a library of polynucleotides for sequencing, in a single reaction mixture, (a) Contacting a double-stranded target nucleic acid with one or more nickeling agents to generate multiple duplicate nucleic acid fragments separated by overhanging single-strand breaks, (b) Contacting a partially double-stranded first adapter with at least one of the nucleic acid fragments in the presence of a ligase, The first adapter includes (i) a double-stranded region having a 5' end and a 3' end, and (ii) a single-stranded region containing a barcode. This involves joining the 5' end of the double-stranded region of the first adapter to at least one 3' end of the nucleic acid fragment using DNA ligase via a 3' branched ligament, (c) The second adapter is brought into contact with at least one opposite end of the nucleic acid fragment, and the linkage of the first and second adapters occurs in a single reaction. Includes.

[0189] Embodiment 40. The second adapter is an L-adapter, and the L-adapter includes a 3' terminal nucleic acid sequence that hybridizes to a single-stranded region of the target nucleic acid. The method according to embodiment 39, wherein the 3' end of the L adapter is ligated to the 5' end of at least one nucleic acid fragment.

[0190] Embodiment 41. The method according to Embodiment 39, further comprising adding an enzyme to the reaction, wherein the enzyme decomposes excess first adapter before linking the second adapter.

[0191] Embodiment 42. The method according to Embodiment 39, wherein the second adapter contains 1 to 10 degenerate bases at its 3' end.

[0192] Embodiment 43. The method according to Embodiment 39 further comprises extending at least one of a nucleic acid fragment to be joined with one or both of a first adapter and a second adapter to produce an extended nucleic acid fragment, the extended nucleic acid fragment including a copy of a barcode.

[0193] Embodiment 44. The method according to Embodiment 39, wherein the first adapter is fixed onto a bead via a single-strand region containing a barcode, and the bead is fixed with multiple copies of the first adapter, each containing the same barcode sequence.

[0194] Embodiment 45. The method according to Embodiment 39, wherein the 3' end of the double-stranded region is a dideoxyblocker nucleotide.

[0195] Embodiment 46. A method for preparing a library of polynucleotides for sequencing, comprising: (a) contacting a double-stranded target nucleic acid with one or more nickeling agents in a single reaction mixture to generate overlapping nucleic acid fragments separated by protruding single-strand breaks; and (b) contacting the nucleic acid fragments with beads containing a plurality of partially double-stranded first adapters in the presence of a ligase. Each first adapter includes (i) a double-stranded region having 5' and 3' ends, and (ii) a single-stranded region fixed on a bead, the single-stranded region including a barcode. This process involves ligating the 5' end of at least one double-stranded region of the first adapter to the 3' end of at least one nucleic acid fragment using DNA ligase via a 3' branched ligation, thereby generating a ligated first adapter. The linked first adapter includes a barcode and at least one nucleic acid fragment, At least one of the first adapters remains as an unconnected first adapter, (c) Denaturing the reaction mixture such that the linked first adapter and the unlinked first adapter are in a single-stranded form, (d) Controlled extension of a primer which hybridizes to a sequence that is 3' to the barcode in (i) a linked first adapter and (ii) an unlinked first adapter, thereby generating a partially extended chain complementary to the linked first adapter and a fully extended chain complementary to the unlinked first adapter, thereby generating a first mixture comprising a partially double-stranded molecule containing the linked first adapter and a double-stranded molecule containing the unlinked adapter. Includes.

[0196] Embodiment 47. The method of Embodiment 46, wherein controlled extension is performed using a tag polymerase, and the method further comprises adding a hairpin adapter to a first mixture in step (d) under conditions permissible for linking the hairpin adapter to double-stranded molecules, thereby producing a second mixture comprising double-stranded molecules linked to the hairpin adapter and partially double-stranded molecules not linked to the hairpin adapter.

[0197] Embodiment 48. The method according to Embodiment 46, further comprising adding an exonuclease having double-stranded DNA exonuclease activity, thereby causing the exonuclease to degrade the double-stranded molecule.

[0198] Embodiment 49. The method according to claim 47 of Embodiment 48, further comprising (e) extending a partially extended chain to incorporate a sequence of nucleic acid fragments to produce a further extended product, and (f) ligating a second branching adapter to the end of the further extended product.

[0199] Embodiment 50.(1) The method according to any of the above embodiments, wherein a nick is introduced into the target nucleic acid and both the b-BLA and L-adapter are attached to the nucleic acid fragment for at least 30 minutes, or a nick is introduced into the double-stranded target nucleic acid and the first adapter is attached to the nucleic acid fragment for at least 30 minutes. ***

[0200] Although the present invention has been disclosed with reference to specific aspects and embodiments, it will be apparent that other embodiments and variations of the present invention can be devised by those skilled in the art without departing from the true spirit and scope of the invention.

[0201] Each and all publications and patent documents cited herein are incorporated herein by reference as if each such publication or document were specific and individually indicated so as to be incorporated herein by reference. No citation of publications and patent documents is intended as an indication that any such document is relevant prior art, nor does it constitute an acknowledgment of its content or date. [Examples]

[0202] The following embodiments are provided to illustrate, but are not limited to, the embodiments disclosed in this application.

[0203] [Example 1] Nick linking protocol using segmentase 1. Pre-binding of genomic DNA to beads. A barcoded bead stock solution containing 1 million beads per microliter. The beads were immobilized with branched adapters containing barcode sequences using the method described in Cheng, et al. 2018, A simple bead-based method for generating cost-effective co-barcoded sequence reads. Protocol Exchange; Wang, et al. Genome Res. 2019 May;29(5):798-808. doi: 10.1101 / gr.245126.118. Epub Aprl 2., 2019, available at https: / / doi.org / 10.1038 / protex.2018.116, first twice in LSWB buffer (low-salt wash buffer: 0.05M Tris-HCl pH7.5, 0.15M NaCl, and 0.05% Tween 20), then in 1×HB buffer (3×HB buffer: 30% PEG8000, 150mM Tris-HCl pH7.8, 30mM The samples were washed once with MgCl2, 3 mM ATP, and 0.15 mg / mL BSA (pH 8.3).

[0204] The branched adapter contains barcode oligonucleotides and hybridization oligonucleotides that are annealed to each other. The barcode oligonucleotide has a phosphate group at terminus 5, and the hybridization oligonucleotide has a dideoxynucleotide at terminus 3. The barcoded oligonucleotide has the following sequence: / 5Phos / GTGCACT*GA*CG*AC*ATGATCACCAAGGATCGCCATAGTCCATGCTA[Barcode]GGAAGG[Barcode]CGCAGA[Barcode]CCAGAGCAACTCCTTGGCTCACAUAAAAAAAAAAAAAAA / 3BioTEG / (Each * (This represents a phosphothiolate bond that is resistant to nucleases.)

[0205] The hybridization oligonucleotide has the sequence G*TC*GT*CIGTGC*A* / 3ddC / , where 3ddC represents dideoxycytosine in the 3-prime.

[0206] Each sample containing approximately 1 ng of genomic DNA was to be mixed with 20 μL of 3×HB buffer and water to obtain a total volume of 45 μL of mixture. 30 million beads prepared as described above were added to each sample and incubated at room temperature for 15 minutes.

[0207] 2. Incubation with single-chain binding proteins (SSBs) The SSB mixture was prepared by mixing 4.75 μL (7.5 ug total) of SSB stock solution (Novus Biologicals #NBP2-35314-1 mg) in 10.25 μL of 1 × HB buffer. 15 μL of the SSB mixture was added to the genomic DNA and bead mixture from the previous step and incubated at 37°C for 15 minutes.

[0208] 3. Nick-Link L-oligosaccharides, ligase (NEB #M0202T), segmentase working solution (nickase included in MGI-ESEasy FS PCR-Free DNA Library Prep Set-MGI-Leading Life Science Innovation, MGI, item number 1000013454 or 1000013455), and Exo III (NEB #M0206S) were prepared by dilution in 1 × HB ("dilution concentration") according to Table 2 below. L-oligosaccharides were prepared using GAGACGTTCTCGACTCAGCAGANNNN. * N * N * N(N represents one of A, T, C, or G, and each * It has a sequence of phosphothiolate bonds that are resistant to nucleases. Table 2. [Table 2]

[0209] The prepared L-oligonucleotides, ligase, segmentase, and ExoIII working solution were added to 60 μL of a bead-gDNA mixture. Each bead was immobilized on ice with a branching adapter containing a mixed barcode. The total volume of the reaction mixture was 75 μL. See Table 3. Table 3 [Table 3]

[0210] The reaction mixture was subjected to a total of 54 cycles, cycling at 15°C for 30 seconds to 37°C for 30 seconds. The reaction mixture was briefly spun down and placed on a magnet for 2 minutes. Next, the beads in the mixture were washed with 40 μL of 0.1 M sodium hydroxide. Then, the beads were washed twice with 100 μL of LSWB. The beads were resuspended in 50 μL of LSWB, and the bead suspension was maintained at 4°C before PCR amplification, as further described below.

[0211] 4. PCR The LSWB buffer was removed from the bead suspension, and the beads were then resuspended in a PCR mixture containing primers PCR1 and PCR2 (sequences below) and 2×KAPA HiFi (Roche #7958935001) to amplify the product formed in the nick-coupling reaction, as shown in Table 4. Table 4 [Table 4]

[0212] The PCR cycle was performed according to the conditions shown in Table 5 below. Table 5. [Table 5]

[0213] Next, the PCR product was purified using 0.8× Ampure XP beads (160 μL) (Beckman Coulter #A63881). The beads were washed once in 200 μl of 0.8× Ampure wash buffer (800 μl of fresh Ampure beads and 1 ml of TE were mixed, the beads were placed on a magnet, and the supernatant was collected; this is the wash buffer). The remaining steps were carried out according to the manufacturer's protocol. The purified product was eluted from the Ampure XP beads in 60 μL of TE buffer. The second round of PCR was performed using the mixing and cycling conditions in Tables 6 and 7. Table 6. [Table 6] Table 7. [Table 7]

[0214] The PCR product was purified again using 0.8×Ampure XP beads (320 µl) with the same procedure as above, and eluted in 50 µl of TE. The purified product was analyzed by electrophoresis.

[0215] [Example 2] Effect of segmentase concentration on product size Nick ligation reactions were carried out as described in Example 1, in the presence of different concentrations of segmentase and T4 DNA ligase, as shown in Table 8. Table 8 [Table 8]

[0216] Figure 12A shows the electrophoresis results of the nicks-linked products (after amplification). The results indicate that as the amount of segmentase increases, the average size of the inserts gradually decreases, while as the amount of T4 DNA ligase increases, the average size of the inserts gradually increases. The products formed in these individual reactions #1 to #10 had lengths ranging from 300 bp to 2 kb and were suitable for sequencing.

[0217] [Example 3] Nick linking protocol using masterase 1. Pre-binding of genomic DNA to beads. Pre-binding of genomic DNA to beads immobilized with a branching adapter was performed as described in Example 1.

[0218] 2. Incubation with single-chain binding proteins (SSBs) The incubation of the SSB with genomic DNA and beads was carried out as described in Example 1.

[0219] 3. Nick-Link L-oligo (same sequence as described in Example 1), ligase (NEB #M0202T), masterase (Qiagen #EN31-005), and Exo III (NEB #M0206S) were separately diluted in 1 × HB ("dilution concentration") according to Table 9 below. Table 9 [Table 9]

[0220] L-oligonucleotides (the same as those described in Example 1), ligase, segmentase, and ExoIII were added to a 55 μL bead-gDNA mixture formed on ice and mixed. The total volume of the reaction was 75 μL. See Table 3 above. Table 3 [Table 10]

[0221] The reaction mixture was subjected to a total of 54 cycles, cycling at 10°C for 30 seconds to 37°C for 30 seconds. The reaction mixture was briefly spun down and placed on a magnet for 2 minutes. Next, the beads in the mixture were washed with 40 μL of 0.1 M sodium hydroxide. Then, the beads were washed twice with 100 μL of LSWB. The beads were resuspended in 50 μL of LSWB, and the bead suspension was maintained at 4°C before PCR amplification, as further described below.

[0222] 4. PCR The LSWB buffer was removed from the bead suspension, and the beads were then resuspended in a PCR mixture containing primer PCR1 (SEQ ID NO: 1) and 2×KAPA HiFi (Roche #7958935001). The results are shown in Table 10 below. Table 10 [Table 11] Primer elongation was performed according to the conditions in Table 5 above.

[0223] The primer extension reaction was left on a magnetic rack for 2 minutes. The supernatant was collected and a mixture containing the components listed in Table 11 was added. Table 11 [Table 12]

[0224] One cycle of elongation was performed under the following cycle conditions shown in Table 5.

[0225] ExoVII was added to remove any single-stranded artifact products using a mixture containing the following components (Table 12), and then the reaction was incubated for 30 minutes. Table 12 [Table 13]

[0226] Next, the elongation product was purified using 0.8× Ampure XP beads (85 μL) (Beckman Coulter #A63881) as described above. The purified product was eluted in 60 μL of TE buffer. The final round of PCR was performed using the mixture under the cycle conditions shown in Table 5, except that 9 cycles of PCR were performed. [Table 14]

[0227] The PCR product was purified again using 0.8× Ampure XP beads (320 μL) using the same procedure as above and eluted in 40 μL of TE. The purified product was analyzed by electrophoresis. [Example 4]

[0228] Effect of masterase concentration on product size The nick ligation reaction was performed according to the protocol described in Example 3 in the presence of various concentrations of masterase and T4 DNA ligase. See Table 13 below. Table 13 [Table 15]

[0229] Figure 12B shows the electrophoresis results of the nick-linked products (after amplification). The results indicate that as the amount of masterase increases, the length of the inserts gradually decreases. The products formed in reactions #1 to #6 had lengths ranging from 300 bp to 3 kb and were suitable for sequencing.

[0230] [Example 5] Two rounds of nick linking using segmentase. 1. Pre-binding of genomic DNA to beads. Pre-binding of genomic DNA to beads immobilized with a branching adapter was performed as described in Example 1.

[0231] 2. Incubation with single-chain binding proteins (SSBs) The incubation of the SSB with genomic DNA and beads was carried out as described in Example 1.

[0232] 3. Nick-Link L-oligo (same as described in Example 1), ligase (NEB #M0202T), segmentase (MGI), and Exo III (NEB #M0206S) were separately diluted in 1 × HB ("dilution concentration") according to Table 14 below. Table 14. [Table 16]

[0233] L-oligonucleotides (the same as those described in Example 1), ligase, segmentase, and ExoIII were added to a 60 μL bead-gDNA mixture formed on ice and mixed. The total volume of the reaction was 75 μL, as described in Example 1.

[0234] The reaction mixture was subjected to a total of 36 cycles, ranging from 30 seconds at 15°C to 30 seconds at 37°C. The reaction mixture was briefly spun down and placed on a magnet for 2 minutes. Next, the beads were washed once with 100 μL of LSWB. The beads were resuspended in 60 μL of 1×HB.

[0235] 4. Second L-Oligo Ligation L-Oligo (the same as that described in Example 1), ligase (NEB #M0202T), and T7 exo (NEB #M0263S) were separately diluted in 1×HB ("Dilution Concentration") according to Table 15 below. Table 15.

Table 17

[0236] L-Oligo (described in Example 1), ligase, and T7 exo were added to 60 μL of beads from the previous step. The total volume of the reaction was 75 μL. See Table 3 above.

[0237] The reaction mixture was subjected to cycling conditions of 30 seconds at 10°C to 30 seconds at 37°C for a total of 36 cycles. The reaction mixture was briefly spin-down and placed on a magnet for 2 minutes. Next, the beads were washed twice with 100 μL of LSWB. The beads were resuspended in 60 μL of LSWB.

[0238] 5. PCR LSWB buffer was removed from the bead suspension, and then the beads were resuspended in a PCR mixture containing primer PCR1 and PCR2 (sequences below) and 2×KAPA HiFi (Roche #7958935001). As described in Table 16 below. Table 16.

Table 18

[0239] The PCR cycle was performed for 5 cycles according to the conditions in Table 5. Next, the PCR product was purified using 0.8×Ampure XP beads (160 μL) as described above. The purified product was eluted in 60 μL of TE buffer. Using a mixture containing the components shown in Table 17 and the cycle conditions shown in Table 5, a second round of PCR was performed for 5 cycles. Table 17. [Table 19]

[0240] The PCR product was purified again using 0.8×Ampure XP beads (320 µl) with the same procedure as above, and eluted in 60 µl of TE. The purified product was analyzed by electrophoresis.

[0241] [Example 6] Effect of segmentase concentration on product size using a two-step protocol Nick ligation was carried out in the presence of different concentrations of segmentase and T4 DNA ligase, according to the protocol described in Example 5. See Table 18 below. Table 18 [Table 20]

[0242] Figure 12C shows the electrophoresis results of the nick-linked product (after amplification).

[0243] The results indicate that as the amount of segmentase increases, the length of the inserts gradually shortens, suggesting that the fragments are formed in these reactions and are suitable for sequencing.

[0244] [Example 7] Two rounds of Nick linking using Master Arze 1. Pre-binding of genomic DNA to beads. Barcoded bead stock solutions containing 1 million beads per microliter [see Cheng, et al. 2018; Wang, et al. 2019 for descriptions and protocols for bead preparation] were first washed twice with LSWB buffer (low-salt washing buffer: 0.05M Tris-HCl pH 7.5, 0.15M NaCl, and 0.05% Tween 20), and then once with 1×HB buffer (3×HB: 30% PEG8000, 150mM Tris-HCl pH 7.8, 30mM MgCl2, 3mM ATP, and 0.15mg / mL BSA, pH 8.3).

[0245] Each sample containing approximately 1 ng of genomic DNA was to be mixed with 20 μL of 3×HB buffer and water to obtain a total volume of 45 μL of mixture. 30 million beads prepared as described above were added to each sample and incubated at room temperature for 15 minutes.

[0246] 2. Incubation with single-chain binding proteins (SSBs) The SSB reaction was prepared by mixing 2.37 μL (3.75 ug total) of SSB stock solution in 7.63 μL of 1×HB buffer to produce 10 μL of SSB mixture. The 10 μL of SSB mixture was added to the genomic DNA and bead mixture from the previous step and incubated at 37°C for 15 minutes.

[0247] 3. Nick-Link L-oligosaccharides, ligase (NEB #M0202T), masterase (Qiagen #EN31-005), and Exo III (NEB #M0206S) were diluted separately in 1 × HB ("dilution concentration") according to Table 19. Table 19. [Table 21]

[0248] L-oligonucleotides (as described in Example 1), ligase, segmentase, and Exo III were added to a 55 μL bead-gDNA mixture formed on ice and mixed. The total volume of the reaction was 75 μL. See Table 3.

[0249] The reaction mixture was subjected to a total of 36 cycles, ranging from 30 seconds at 10°C to 30 seconds at 37°C. The reaction mixture was briefly spun down and placed on a magnet for 2 minutes. Next, the beads were washed once with 100 μL of LSWB. The beads were resuspended in 60 μL of 1×HB.

[0250] 4. Second L-oligo linkage L-oligo (as described in Example 1), ligase (NEB #M0202T), and T7 exo (NEB #M0263S) were separately diluted in 1 × HB ("dilution concentration") according to Table 20 below. Table 20 [Table 22]

[0251] L-oligosaccharide (as described in Example 1), ligase, and T7 exo were added to 60 μL of beads from the previous step. The total volume of the reaction was 75 μL, as shown in Table 3.

[0252] The reaction mixture was subjected to a total of 36 cycles, ranging from 30 seconds at 10°C to 30 seconds at 37°C. The reaction mixture was briefly spun down and placed on a magnet for 2 minutes. Next, the beads were washed twice with 100 μL of LSWB. The beads were resuspended in 60 μL of LSWB.

[0253] 5. PCR The LSWB buffer was removed from the bead suspension, and the beads were then resuspended in a PCR mixture containing primers PCR1 and PCR2 (sequences below) and 2×KAPA HiFi (Roche #7958935001), as shown in Table 21 below. Table 21 [Table 23]

[0254] The PCR cycle was performed according to the conditions shown in Table 5 below.

[0255] Next, the PCR product was purified using 0.8× Ampure XP beads (160 μL) (Beckman Coulter #A63881). The beads were washed once in 200 μL of 0.8× Ampure washing buffer (800 μL of fresh Ampure beads and 1 ml of TE were mixed, the beads were placed on a magnet, and the supernatant was collected; this is the washing buffer). The remaining steps were carried out according to the manufacturer's protocol. The product was eluted in 60 μL of TE buffer. A second round of PCR was performed with the mixture containing the components in Table 22 and under the cycling conditions shown in Table 5, except that PCR was performed for 7 cycles. Table 22. [Table 24]

[0256] The PCR product was purified again using 0.8×Ampure XP beads (320 µl) with the same procedure as above, and eluted in 60 µl of TE. The purified product was analyzed by electrophoresis.

[0257] [Example 8] Effect of masterase concentration on product size using a two-step protocol. Nick ligation was carried out in the presence of different concentrations of masterase and T4 DNA ligase, according to the protocol described in Example 7. See Tables 23 and 24 below. Table 23 [Table 25] Table 24. [Table 26]

[0258] Electrophoresis of the nick-linking product (after amplification) shows that the length of the insert gradually decreases as the amount of masterase increases, and the length of the insert gradually increases as the amount of T4 ligase increases. The fragments formed in these reactions were suitable for sequencing. See Figure 12D.

Claims

1. A method for preparing an adapter-type polynucleotide library for sequencing, comprising contacting a double-stranded target nucleic acid with one or more nickeling agents in a single reaction mixture to generate multiple duplicate nucleic acid fragments separated by overhanging single-strand breaks, (a) To provide a plurality of beads, each containing a plurality of branched connecting adapters (b-BLAs) fixed on a bead, and to provide a group of L-adapters having a degenerate arrangement at the 3' end, Each b-BLA comprises a barcode oligonucleotide containing a b-BLA adapter sequence, and a hybridization oligonucleotide that hybridizes to the barcode oligonucleotide. Each L-adapter includes an L-adapter array, (b) Contacting b-BLA with at least one of the nucleic acid fragments in the presence of a ligase, thereby ligating b-BLA to the 3' end of the nucleic acid fragment, (c) In the presence of ligase, a group of L-adapters is brought into contact with a nucleic acid fragment to which b-BLA is linked at the 3' end, thereby linking the L-adapters to the 5' end of the nucleic acid fragment. This will allow us to obtain a library of nucleic acid fragments having an L-adapter sequence at the 5' end and a b-BLA adapter sequence at the 3' end. A method that includes this.

2. The method according to claim 1, wherein the 3' end of the L-adapter is ligated to the 5' end of at least one nucleic acid fragment.

3. Each BLA includes (i) a double-stranded blunt end comprising the 5' end of one strand and the 3' end of the complementary strand, and (ii) a single-stranded region comprising a barcode sequence. The method according to claim 1, wherein the 5' end of the strand in the double-stranded blunt end is ligated to at least one 3' end of a nucleic acid fragment via a branched ligation.

4. The method according to claim 1, further comprising adding an enzyme to the reaction mixture, wherein the enzyme degrades excess b-BLA before linking the L-adapter.

5. The method according to claim 1, wherein the L-adapter contains 1 to 10 degenerate bases at its 3' end.

6. The L-adapter is in the solution. Barcode oligonucleotides are attached to beads. The method according to claim 1, wherein the hybridization oligonucleotide is not bonded to the bead.

7. The method according to claim 5, wherein the b-BLA contains uracil, and the uracil can be removed to release the b-BLA from the beads.

8. The method according to claim 5, wherein each bead is fixed thereon by a plurality of b-BLAs, and each of the plurality of b-BLAs has the same barcode sequence.

9. The method according to claim 1, further comprising extending at least one of a nucleic acid fragment to generate an extended nucleic acid fragment by aligning it with both a b-BLA and an L-adapter, wherein the extended nucleic acid fragment includes a copy of a barcode.

10. The method according to claim 8, further comprising circulating the extended nucleic acid fragment.

11. The method according to claim 5, comprising a plurality of beads, each bead comprising a unique barcode sequence.

12. The method according to claim 1, wherein the 3' end of the double-stranded region is a dideoxyblocker nucleotide.

13. The method according to claim 1, wherein the average length of the nucleic acid fragments is 200 nucleotides to 10,000 nucleotides.

14. The method according to claim 1, wherein more than 50% of the protruding single-strand breaks created in step (a) are closed by linking in step (b).

15. The method according to claim 1, wherein one or more nicking agents are selected from the group consisting of nonspecific nicking nucleases, site-specific nicking nucleases, and chemical nicking agents.

16. The method according to claim 1, wherein the nonspecific nickase is selected from the group consisting of Vvn, shrimp dsDNA-specific endonuclease, and DNAse I.

17. The method according to claim 1, wherein the ligase is T4 DNA ligase.

18. The method according to any one of claims 1 to 17, wherein the target nucleic acid is bound to the beads before steps (a) and (b).

19. The method according to claim 18, comprising incubating the target nucleic acid with beads for 0 to 30 minutes prior to nicking in step (a).

20. The method according to claim 19, wherein the target nucleic acid is incubated with beads in a buffer containing 3-12% PEG.

21. The method according to any one of claims 1 to 17, wherein the pH of the single reaction mixture is 7 to 9.

22. The method according to any one of claims 1 to 17, wherein step (a) occurs in the presence of ligase.

23. The method according to any one of claims 1 to 17, wherein one or more nicking agents and ligases are selected such that the binding rate is higher than the nicking rate.

24. The method according to claim 1, further comprising removing the DNA strand of the first adapter that is not linked to the nucleic acid fragment by denaturing the reaction mixture after step (b).

25. The method according to any one of claims 1 to 17, further comprising step (a) adding an exonuclease to a single reaction mixture to increase the gap of the protruding single-strand break.

26. The method according to claim 25, wherein the increased gap has a length of 1 to 30 bases.

27. The method according to claim 1, wherein the nicking of the target nucleic acid and the ligation of the b-BLA and L-adapter to the nucleic acid fragment are maintained for at least 30 minutes.

28. (1) One or more nicking agents, (2) One or more types of ligase, (3) Multiple overlapping nucleic acid fragments separated by overhanging single-strand breaks, (4) A reaction mixture comprising a partially double-stranded branched adapter containing a barcode oligonucleotide and a hybridization oligonucleotide that hybridize with each other to form a partially double-stranded nucleic acid molecule, Barcode oligonucleotides are attached to beads containing barcodes. The hybridization oligonucleotide was not bonded to the bead. Partially double-stranded nucleic acid molecules, (i) double-stranded blunt ends having a 5' end and a 3' end, and (ii) A single-stranded region containing a barcode and having a single-stranded end. It includes a double-stranded blunt end whose 5' end is ligated to at least one 3' end of the overlapping nucleic acid fragments. A reaction mixture in which at least one 5' end of a nucleic acid fragment is ligated to an L-adapter.

29. The reaction mixture according to claim 28, wherein the L-adapter contains 1 to 10 degenerate bases at its 3' end.

Citation Information

Patent Citations

  • High-throughput genome sequencing on DNA arrays

    JP2010500002A

  • Methods for targeted nucleic acid sequence enrichment with application to error-corrected nucleic acid sequencing

    JP2020511966A

  • Method and reagent for constructing nucleic acid double-linker single-strand cyclical library

    US20170355981A1

  • Transposase-based genomic analysis

    WO2019089959A1

  • Methods of producing nucleic acid libraries and compositions and kits for practicing same

    WO2019236726A1