Use of substituted aminopropionic acid compounds in the treatment of SARS-CoV-2 infection

Abstract

To provide a compound that can be used for the treatment of a related disease caused by SARS-CoV-2 infection and a pharmaceutical composition comprising the compound.SOLUTION: The present application relates to a substituted aminopropionate compound represented by Formula I, a geometric isomer, a pharmaceutically acceptable salt, a solvate and / or a hydrate thereof, and a pharmaceutical composition comprising the compound.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] This application relates to the use of substituted aminopropionic acid compounds represented by the following formula I, their geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates, and pharmaceutical compositions comprising the said compounds for the treatment of SARS-CoV-2 infection.

[0002] [ka] [Background technology]

[0003] This application is based on Chinese Patent Application No. 202010071087.7, filed on 21 January 2020, and claims priority therefrom. The disclosure of that application is incorporated herein by reference in its entirety.

[0004] (2S)-2-[[[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazine-7-yl)-5-cyano-3,4-dihydroxyoxolan-2-yl]methoxy-phenoxyphosphoryl]amino]propionate 2-ethylbutyl, also known as remdesivir (GS-5734), is a viral RNA polymerase inhibitor, and its active form in vivo is the nucleoside triphosphate (NTP) form of the parent compound. Phase III clinical trials of this drug compound for the clinical treatment of Ebola virus infection have now been completed, and it has shown excellent therapeutic efficacy against Ebola virus infection.

[0005] Cell-based assays have demonstrated that remdesivir possesses antiviral activity against various variants of EBOV and other filoviruses. In a rhesus monkey model infected with the Ebola virus, intravenous administration of 10 mg / kg of GS-5734 per day for 12 consecutive days significantly inhibited EBOV replication, even when treatment was initiated 3 days after viral exposure (systemic viral RNA was detected in 2 out of 6 treated animals). 100% of EBOV-infected animals were protected from death, and clinical signs and pathophysiological markers were improved. In addition to the Ebola virus, GS-5734 also exhibits broad-spectrum antiviral activity against viruses such as Nipah virus, Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and Marburg virus.

[0006] The 2019 novel coronavirus (2019-nCoV) is a novel coronavirus strain that had never been found in humans before. On February 11, 2020, the International Committee on Taxonomy of Viruses (ICTV) announced that the 2019 novel coronavirus (2019-nCoV) was Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). On the same day, the World Health Organization (WHO) announced that the official name of the disease caused by this virus would be COVID. The symptoms of SARS-CoV-2 virus infection are mainly pneumonia, but are classified according to the severity of the disease into simple infection, mild pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, and septic shock. Patients with simple infection present with non-septic symptoms such as fever, cough, sore throat, nasal congestion, fatigue, headache, muscle pain or discomfort, and elderly and immunocompromised individuals may have atypical symptoms. Patients with mild pneumonia mainly present with cough, shortness of breath, and rapid breathing. Severe pneumonia can occur in adolescents, adults, or children, and its main symptoms include increased respiratory rate, severe respiratory failure or dyspnea, central cyanosis, drowsiness, unconsciousness or seizures, and shortness of breath. Lung imaging in acute respiratory distress syndrome shows bilateral ground-glass opacities that cannot be fully explained by exudation, lobular exudation, or atelectasis, or lung masses, and its main symptom is pulmonary edema. Patients with sepsis often have fatal organ failure, and most severely ill patients present with septic shock and have a high mortality rate.

[0007] Currently, SARS-CoV-2 virus infections are primarily treated with supportive care in hospitals, and antiviral drugs are not readily available. [Overview of the project]

[0008] Concept of the present invention The object of the present invention is to discover a drug having antiviral activity against SARS-CoV-2 that can be used to treat diseases associated with SARS-CoV-2 infection. Through creative research, the present invention has found that the compound represented by formula I has the function of inhibiting the replication of SARS-CoV-2 and has potentially superior therapeutic effects in treating diseases caused by SARS-CoV-2.

[0009] The present invention relates to a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts and / or solvates or hydrates:

[0010] [ka]

[0011] In some embodiments, pharmaceutically acceptable salts of the compounds represented by formula I as described herein include inorganic or organic salts and inorganic or organic base salts. The present invention relates to all forms of the above salts, and examples include, but are not limited to, sodium salts, potassium salts, calcium salts, lithium salts, meglumine salts, hydrochlorides, hydrobroms, hydroiodides, nitrates, sulfates, hydrogen sulfides, phosphates, hydrogen phosphates, acetates, propions, butyrates, oxalates, pivalates, adipines, alginates, lactates, citrates, tartrates, succinates, maleates, fumarates, picrinates, aspartates, glucons, benzoates, methanesulfons, ethanesulfons, benzenesulfons, p-toluenesulfons, embonates, and the like.

[0012] The compound represented by formula I can inhibit SARS-CoV-2 virus replication in cells and reduce the nucleic acid load of SARS-CoV-2 virus in cell cultures.

[0013] Following creative invention research, the inventors of this application discovered a novel in-cellular characteristic of the compound represented by formula I: that the compound represented by formula I can reduce the viral nucleic acid load in cells infected with SARS-CoV-2 at the micromolar concentration level.

[0014] The present invention also relates to the use of a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates in the manufacture of a pharmaceutical for the treatment of diseases or infections caused by SARS-CoV-2 (e.g., respiratory diseases, e.g., simple infections (e.g., fever, cough and sore throat), pneumonia, acute respiratory infections, severe acute respiratory syndrome (SARI), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis and septic shock, etc.).

[0015] [ka]

[0016] The present invention also relates to the use of the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates in the manufacture of pharmaceuticals as SARS-CoV-2 inhibitors.

[0017] The present invention also relates to the use of the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates in the manufacture of a pharmaceutical for inhibiting the replication or reproduction of SARS-CoV-2 in cells (e.g., mammalian cells).

[0018] The present invention also relates to pharmaceutical compositions comprising a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates.

[0019] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. Specifically, the pharmaceutical composition is a solid dosage form, an injection, a topical preparation, a spray, a liquid preparation, or a compound preparation.

[0020] In some embodiments, the pharmaceutical composition comprises an effective amount of a compound represented by Formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates.

[0021] The present invention relates to the use of a compound represented by Formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, or a pharmaceutical composition comprising the same, in the manufacture of a medicament for treating respiratory diseases such as, but not limited to, simple infections (such as fever, cough and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARI), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis and septic shock.

[0022] The present invention also relates to the use of a compound represented by Formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, or a pharmaceutical composition comprising the same, in the manufacture of a medicament for treating diseases or infections caused by SARS-CoV-2, such as respiratory diseases [such as simple infections (such as fever, cough and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARI), hypoxic respiratory failure and acute respiratory distress syndrome, sepsis and septic shock].

[0023] The present invention also relates to the use of a compound of Formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, or a pharmaceutical composition comprising the same, in the manufacture of a medicament as a SARS-CoV-2 inhibitor.

[0024] The present invention also relates to the use of a compound of Formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, or a pharmaceutical composition comprising the same, in the manufacture of a medicament for inhibiting the replication or propagation of SARS-CoV-2 in cells.

[0025] The present invention also relates to the use of pharmaceutical compositions comprising a compound of formula I, a pharmaceutically acceptable salt thereof, a solvate, and / or a hydrate, in the manufacture of a pharmaceutical for inhibiting the replication or reproduction of SARS-CoV-2 in cells (e.g., mammalian cells).

[0026] The present invention also relates to a method for treating and / or preventing a disease in a mammal of need, or a method for inhibiting the replication or reproduction of SARS-CoV-2 in a mammal of need, the method comprising administering to the mammal of need a therapeutic and / or prophylactic effective amount of a pharmaceutical composition comprising a compound of formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, or of a compound of formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, wherein the disease includes diseases caused by SARS-CoV-2, for example, viral infectious diseases caused by SARS-CoV-2 [including, for example, respiratory diseases, such as simple infections (e.g., fever, cough and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARIs), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis and septic shock, etc.].

[0027] The present invention relates to a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used to treat diseases or infections caused by SARS-CoV-2 (including, for example, respiratory diseases (such as simple infections like fever, cough, and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARIs), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, and septic shock).

[0028] The present invention also relates to a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used as a SARS-CoV-2 inhibitor.

[0029] The present invention also relates to a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used to inhibit the replication or reproduction of SARS-CoV-2 in cells (e.g., mammalian cells).

[0030] The present invention also relates to pharmaceutical compositions comprising a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used to treat diseases or infections caused by SARS-CoV-2, such as respiratory diseases (including, for example, simple infections (e.g., fever, cough and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARIs), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis and septic shock, etc.).

[0031] The present invention also relates to pharmaceutical compositions comprising a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used as a SARS-CoV-2 inhibitor.

[0032] The present invention also relates to pharmaceutical compositions comprising a compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates, used to inhibit the replication or reproduction of SARS-CoV-2 in cells (e.g., mammalian cells).

[0033] In some embodiments, diseases caused by SARS-CoV-2 as described in this specification include, but are not limited to, respiratory diseases such as simple infections (e.g., fever, cough, and sore throat), pneumonia, acute respiratory infections, severe acute respiratory infections (SARIs), hypoxic respiratory failure and acute respiratory distress syndrome, sepsis, and septic shock.

[0034] The disease caused by SARS-CoV-2 as described herein is COVID-19.

[0035] In this application, the official name of the term "2019 novel coronavirus (2019-nCoV)" is Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

[0036] In this application, the official name of "the disease caused by the novel coronavirus (2019-nCoV)" is COVID-19.

[0037] In some embodiments, mammals include Bovidae, Equidae, Capritidae, Suidae, Canidae, Felidae, rodents, and primates, where preferred mammals are humans, cats, dogs, or pigs.

[0038] The pharmaceutical compositions described in this specification can be prepared in various dosage forms according to various routes of administration.

[0039] According to the present application, the pharmaceutical composition can be administered by any one of the following routes: oral administration, spray inhalation, rectal administration, nasal administration, oral administration, vaginal administration, topical administration, parenteral administration, such as subcutaneous, intravenous, intramuscular, intraperitoneal, subarachnoid, intraventricular, intrasternal and intracranial injection or infusion, or administration using an explant reservoir, wherein the preferred routes of administration are oral, intraperitoneal or intravenous.

[0040] For oral administration, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be prepared in the form of orally administrative formulations, such as, but not limited to, tablets, capsules, aqueous solutions, or aqueous suspensions. The carrier used for tablets generally contains lactose and corn starch, and lubricants such as magnesium stearate may also be added. The diluent used for capsules typically contains lactose and dried corn starch. Aqueous suspensions are usually prepared by mixing the active ingredient with a suitable emulsifier and a suitable suspending agent. Sweeteners, flavorings, or colorings may also be added to the oral formulations if necessary.

[0041] For rectal administration, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be formulated into suppositories prepared by mixing the drug with a suitable non-irritating excipient. The excipient is solid at room temperature but melts at rectal temperature to release the drug. Examples of such excipients include cocoa butter, beeswax, and polyethylene glycol.

[0042] When administered topically, particularly to easily accessible affected surfaces or organs, such as the eyes, skin, or neurological disorders of the lower intestines, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be prepared into various topical formulations according to different affected surfaces or organs. Specific instructions are as follows:

[0043] For topical administration to the eye, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be formulated into dosage forms such as finely powdered suspensions or solutions, the carrier used in which case is an isotonic sterile saline with a constant pH, and preservatives such as benzyl alkoxide chloride may or may not be added. In addition, for administration to the eye, the compound can also be compounded into the form of an ointment such as petrolatum ointment.

[0044] When administered topically to the skin, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be prepared in suitable dosage forms such as ointments, lotions, or creams, in which case the active ingredient is suspended or dissolved in one or more carriers. Carriers for ointments, but not limited to, include: mineral oil, light oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax, and water. Carriers for lotions and creams, but not limited to, include: mineral oil, sorbitan monostearate, Tween® 60, cetyl ester wax, hexadecenylaryl alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0045] For local administration to the lower intestinal tract, the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be formulated into dosage forms such as the rectal suppositories or suitable enemas described above, and in addition, topical transdermal patches can also be used.

[0046] Compounds represented by formula I, their geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates can be administered in sterile injectable forms, such as aqueous solutions or oily suspensions for injection, or in sterile injectable dosage forms. Suitable carriers and solvents include water, Ringer's solution, and isotonic salines. Furthermore, sterile non-volatile oils such as monoglycerides or diglycerides can also be used as solvents or suspension media.

[0047] The various dosage forms of drugs mentioned above can be manufactured in accordance with conventional methods in the pharmaceutical manufacturing field.

[0048] In this application, the terms “therapeutic dose” or “preventive dose” refer to a dose sufficient to treat or prevent a patient’s disease, but low enough to avoid serious side effects in reasonable medical judgment (a reasonable benefit-risk ratio). The therapeutic dose of a compound will vary depending on various factors such as the specific compound selected (e.g., selected considering the compound’s efficacy, effectiveness and half-life), the route of administration selected, the disease being treated, the severity of the disease being treated, the patient’s age, size, weight and health status, medical history, duration of treatment, nature of the current therapy, and desired therapeutic effect, but this can be routinely determined by those skilled in the art.

[0049] Furthermore, the specific doses and methods of use of the compound represented by formula I, its geometric isomers, pharmaceutically acceptable salts, solvates, and / or hydrates depend on a number of factors for each different patient, such as the patient's age, weight, sex, natural health status, nutritional status, drug activity, administration time, metabolic rate, severity of the disease, and the physician's subjective judgment. Here, it is preferable to use a dose of 0.001 to 1000 mg / kg body weight / day. [Brief explanation of the drawing]

[0050] [Figure 1] Figure 1 shows that remdesivir can efficiently reduce the viral nucleic acid load in SARS-CoV-2 infected Vero E6 cells. In Figure 1, (a) shows that remdesivir can reduce the viral RNA load in cells 48 hours after infection with the SARS-CoV-2 virus. The vertical axis represents the copy number of viral RNA in the sample, and the horizontal axis represents the drug concentration. (b) shows that no cytotoxicity was observed when test cells were treated with the test concentration of remdesivir. The vertical axis represents the cell viability (%) compared to the vehicle control group (cells only, no drug), and the horizontal axis represents the drug concentration. [Modes for carrying out the invention]

[0051] The following embodiments are exemplary preferred embodiments of the Application and do not constitute any limitation of the Application. Example 1: Experiment with remdesivir in reducing viral nucleic acid loading in cells infected with SARS-CoV-2 virus. (1) Drug treatment of virus-infected cells Vero E6 cells (purchased from ATCC, catalog number 1586) were seeded on 24-well plates, incubated for 24 hours, and then infected with a virus. Specifically, SARS-CoV-2 (2019-nCoV) virus (nCoV-2019BetaCoV / Wuhan / WIV04 / 2019 strain provided by the Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to the corresponding concentration in a 2% cell maintenance solution (formulation: FBS (purchased from Gibco, catalog number 16000044) was added to MEM (purchased from Gibco, product number 10370021) in a 2% volume ratio to obtain a 2% cell maintenance solution), and then each well was filled with 100 TCID. 50 The cells were added to 24-well plates to contain the required viral load. Next, remdesivir (purchased from MedChemExpress, catalog number HY-104077) was diluted to the corresponding concentration in 2% cell maintenance solution and added to the corresponding wells to achieve final drug concentrations of 100 μM, 33 μM, 11 μM, 3.7 μM, 1.23 μM, 0.41 μM, and 0.14 μM, respectively. The plates were then placed in a 37°C, 5% CO2 incubator and cultured continuously for 48 hours. Cells in the excipient control group were then added only to 2% cell maintenance solution without any additional test drugs.

[0052] (2) RNA extraction I purchased an RNA extraction kit from Qiagen (catalog number 74106). All consumables (spin column, RNase-free 2 mL collection tubes, etc.) and reagents (RLT, RW1, RPE, RNase-free water, etc.) required for the RNA extraction process described below were included in the kit. The following extraction steps were all performed as recommended in the kit's instructions.

[0053] 1) 100 μL of supernatant was taken from the test plate and added to a nuclease-free EP tube. Then 350 μL of buffer RLT was added, and the mixture was completely dissolved by pipetting (mixing by moving the liquid up and down with a pipette). The supernatant was then collected after centrifugation. 2) Add an equal volume of 70% ethanol to the supernatant obtained in step 1) and mix thoroughly. 3) The mixed solution obtained in step 2) was transferred to an RNase-free spin column, centrifuged at 12000 rpm for 15 seconds, and the waste liquid was discarded. 4) 700 μL of buffer RW1 was added to the spin column, and then the spin column was washed by centrifugation at 12000 rpm for 15 seconds, and the waste liquid was discarded. 5) 500 μL of buffer RPE was added to the spin column, then the spin column was washed by centrifugation at 12000 rpm for 15 seconds, and the waste liquid was discarded. 6) 500 μL of buffer RPE was added to the spin column, and then the spin column was washed by centrifugation at 12000 rpm for 2 minutes, and the waste liquid was discarded. 7) Place the spin column into a new RNase-free 2 mL collection tube, and dry the spin column by centrifugation at 12000 rpm for 1 minute, then transfer the entire spin column to the 1.5 mL collection tube from step 8). 8) The spin column dried in step 7) was placed in a new 1.5 mL collection tube, 30 μL of RNase-free water was added, and the column was centrifuged at 12000 rpm for 2 minutes. The resulting eluate containing the corresponding RNA was then mixed with an RNase inhibitor (purchased from NEB, catalog number M0314L), and the concentration of each RNA was determined by measuring with a Nano Drop (Nano Drop®; purchased from Thermo Scientific, Nano Drop One).

[0054] (3) RNA reverse transcription In this experiment, we used a reverse transcription kit (PrimeScript, which includes a gDNA Eraser manufactured by TaKaRa Company).TM The RT reagent kit, catalog number RR047Q), was used for RNA reverse transcription. It was carried out according to the following steps.

[0055] (i) Removal of gRNA: RNA samples were collected from each experimental group, 1 μg of which was taken and subjected to reverse transcription. First, 2 μL of 5×gDNA Eraser buffer was added to the RNA samples of each experimental group, and RNase-free water was supplemented in the reaction system to make it 10 μL, mixed well, incubated in a water bath at 42 °C for 2 minutes, and the gRNA that might be present in the sample was removed. (ii) Reverse transcription: An appropriate amount of enzyme, primer mix, and reaction buffer were added to the sample obtained in (i), supplemented with RNase-free water to make a volume of 20 μL, reacted in a water bath at 37 °C for 15 minutes, and then placed in a water bath at 85 °C for 5 seconds to obtain cDNA by transcription.

[0056] (4) Real-time PCR Fluorescent quantitative PCR was used to determine the copy number per 1 mL of the original virus solution.

[0057] The reaction system was mixed using TB Green (registered trademark) Premix (manufactured by TaKaRa, catalog number RR820A), and the amplification reaction and reading were carried out using a StepOne Plus real-time PCR instrument (ABI brand). The copy number contained per 1 mL of the original virus solution was calculated. The steps were as follows: (i) Standard: Plasmid pMT-RBD (this plasmid was provided by the Wuhan Institute of Virology, Chinese Academy of Sciences) was at 5×10 8 copies / μL, 5×10 7 copies / μL, 5×10 6 copies / μL, 5×10 5 copies / μL, 5×10 4 copies / μL, 5×10 3 copies / μL, 5×10 2The sample was diluted to copy number / μL. 2 μL of the standard substance or cDNA template was collected for the qPCR reaction.

[0058] (ii) The primer sequences used in this experiment were as follows (all in the 5′→3′ direction):

[0059] RBD-qF: CAATGGTTTAACAGGCACAGG RBD-qR: CTCAAGTGTCTGTGGATCACG

[0060] (iii) The reaction procedure was as follows: Preliminary denaturation: 5 minutes at 95°C; Cycle parameters: 15 seconds at 95°C, 15 seconds at 54°C, and 30 seconds at 72°C, for a total of 40 cycles.

[0061] (5) Cytotoxicity test of the test drug The cytotoxicity of the drugs was detected using the CCK-8 kit (Beoytime). The specific steps were as follows: (i) 1 × 10 4 Individual Vero E6 (ATCC) cells were seeded in a 96-well plate and incubated at 37°C for 8 hours. (ii) The drug was diluted with DMSO to a mother liquor of appropriate concentration, and then diluted to the same concentration as in the drug treatment using MEM medium (purchased from Gibco, catalog number 10370021) containing 2% FBS (purchased from Gibco, catalog number 16000044). The original medium in the 96-well plate was discarded, 100 μL of drug-containing MEM medium was added to the cells, and three replication wells were prepared for each concentration. Vehicle controls (DMSO and medium added to the cell wells without the drug) and blank controls (DMSO and medium added to the wells without cells) were prepared. After drug addition, the cells were cultured at 37°C for 48 hours. (iii) Add 20 μL of CCK-8 solution (Beoytime) to the well to be tested, mix gently to avoid creating bubbles, and incubate continuously at 37°C for 2 hours. OD 450The data was read using a microplate reader (Molecular Devices, model: SupectraMax® M5), and the cell viability was calculated:

[0062]

number

[0063] Here, A is the reading from the microplate reader. (6) Experimental results

[0064] Results from viral replication inhibition experiments showed that test compounds at concentrations of 100 μM, 33 μM, 11.1 μM, and 3.7 μM effectively inhibited the replication of the SARS-CoV-2 viral genome in infected cell supernatant (Table 1 and Figure 1).

[0065] [Table 1]

[0066] The cytotoxicity test results showed that treatment with the test compound (remdesivir) did not alter cell viability at any test concentration; in other words, the test compound had no toxic effect on cells at any concentration (Table 2 and Figure 1).

[0067] [Table 2]

Claims

1. A pharmaceutical composition for treating a disease or infection caused by SARS-CoV-2, comprising remdesivir, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates.

2. The pharmaceutical composition according to claim 1, wherein the disease caused by SARS-CoV-2 is a respiratory disease.

3. The pharmaceutical composition according to claim 1, wherein the disease caused by SARS-CoV-2 is simple infection, pneumonia, acute respiratory infection, severe acute respiratory infection (SARI), hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, or septic shock.

4. The pharmaceutical composition according to claim 3, wherein the simple infection is fever, cough and / or sore throat.

5. A pharmaceutical composition for inhibiting SARS-CoV-2, comprising remdesivir, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates.

6. A pharmaceutical composition for inhibiting the replication or proliferation of SARS-CoV-2 in cells, comprising remdesivir, its geometric isomers, pharmaceutically acceptable salts, solvates and / or hydrates.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

8. The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition is a solid preparation, an injection, a topical preparation, a spray, a liquid preparation, or a compound preparation.

9. The pharmaceutical composition according to claim 1, wherein the disease caused by SARS-CoV-2 is COVID-19.

10. The pharmaceutical composition according to claim 6, wherein the cells are mammalian cells.

11. The pharmaceutical composition according to claim 10, wherein the mammal is a member of the Bovidae subfamily, Equidae family, Capridae family, Suidae family, Canidae family, Felidae family, rodents, or primates.

12. The pharmaceutical composition according to claim 11, wherein the mammal is a human, a cat, a dog, or a pig.

Images