Treatment for myotonic dystrophy type 1

PPR proteins targeting the CUG repeat sequence through specific amino acid combinations in nucleic acid compositions delivered via viral vectors address the underlying splicing abnormalities in DM1, providing therapeutic benefits.

JP7854207B2Active Publication Date: 2026-05-01EDITFORCE INC
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
EDITFORCE INC
Filing Date
2024-03-13
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Current treatments for myotonic dystrophy type 1 (DM1) are limited to symptomatic relief, with no cure available, and existing therapeutic approaches have not effectively addressed the underlying splicing abnormalities caused by the abnormal elongation of the CTG repeat sequence in the DMPK gene.

Method used

A pharmaceutical composition comprising nucleic acids encoding PPR proteins that specifically bind to the CUG repeat sequence, utilizing PPR motifs with specific amino acid combinations to target and correct splicing abnormalities, delivered via viral vectors like AAV to muscle tissue.

Benefits of technology

The PPR proteins effectively reduce RNA-foci formation, improve splicing abnormalities, and alleviate symptoms such as myotonia in DM1 model animals, demonstrating a therapeutic potential for DM1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007854207000022
    Figure 0007854207000022
  • Figure 0007854207000023
    Figure 0007854207000023
  • Figure 0007854207000024
    Figure 0007854207000024
Patent Text Reader

Abstract

To provide a pharmaceutical composition or a method that is effective for treating myotonic dystrophy type 1 (DM1).SOLUTION: Provided is a therapeutic drug or a method for DM1 that utilizes a modified PPR protein.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a pharmaceutical composition or method for the treatment of myotonic dystrophy type 1. [Background technology]

[0002] Myotonic dystrophy type I (DM1) is the most common muscle disease in adults. DM1 is an autosomal dominant multi-organ disorder affecting skeletal muscle, smooth muscle, as well as the eyes, heart, endocrine system, and central nervous system. Its symptoms are diverse and include muscle atrophy, muscle weakness, myotonia, cataracts, insulin resistance, hypogonadism, cardiac conduction disorders, anterior baldness, and intellectual disability. DM1 is caused by abnormal elongation of the CTG repeat sequence in the 3'UTR (3' untranslated region) of the myotonin protein kinase (DMPK) gene. Specific splicing regulators bind to the transcript (mRNA) containing the abnormally elongated CUG repeat sequence, resulting in a deficiency of the splicing regulators necessary for normal splicing and thus causing splicing abnormalities.

[0003] Currently, various approaches are being used to develop therapeutic drugs for DM1, including small molecule compounds and nucleic acid drugs (see, for example, Non-Patent Documents 1 and 2). However, at present, there is no cure, and treatment for DM1 is mainly limited to symptomatic treatment. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Nakamori et al. Ann Clin Transl Neurol. (2015) [Non-Patent Document 2] Overby et al. Drug Discov. Today (2018) [Overview of the project] [Problems that the invention aims to solve]

[0005] The object of this invention is to provide a pharmaceutical composition or method effective for the treatment of myotonic dystrophy type 1 (DM1). [Means for solving the problem]

[0006] Pentatricopeptide repeat (PPR) proteins are proteins containing repeating PPR motifs, each approximately 35 amino acids long, and it is known that each PPR motif specifically or selectively binds to a single base. In recent years, the amino acids that function when PPR motifs exhibit RNA-binding properties have been identified, and the relationship between the structure of the PPR motif and the target base has been clarified, leading to the development of RNA editing / modification technologies using PPR proteins (e.g., WO2013 / 058404).

[0007] The inventors of this invention searched for novel compounds and substances that could treat DM1 and found that DM1 can be treated by utilizing modified PPR proteins.

[0008] The present invention is based on the above findings and may have the following features.

[0009] [1]: A pharmaceutical composition for the treatment of myotonic dystrophy type 1, The pharmaceutical composition comprises a nucleic acid encoding a protein that specifically binds to a CUG repeat sequence. The protein that specifically binds to the aforementioned CUG repeat sequence contains at least six pentatricopeptide repeat (PPR) motifs, each consisting of a polypeptide with a length of 30-38 amino acids represented by formula 1. [ka] (In formula 1: Helix A is a 12-amino acid length region capable of forming an α-helix structure, represented by Equation 2. [ka] In formula 2, A1~A 12 Each of these independently represents an amino acid; X is either absent or a segment consisting of 1 to 9 amino acids in length; Helix B is a region consisting of 11-13 amino acids that can form an α-helix structure; L is the portion represented by formula 3, which is 2 to 7 amino acids long; [ka] In Equation 3, each amino acid is numbered from the C-terminus as "i" (-1), "ii" (-2), and so on. However, L iii ~L vii (It may not exist.) A1, A4, and L in each of the aforementioned PPR motifs ii A combination of these three amino acids, or A4, L ii The combination of two amino acids is selected so that each of the aforementioned PPR motifs binds to C, U, or G, thereby configuring the protein to specifically bind to the CUG repeat sequence. Pharmaceutical composition.

[0010] [2]:The pharmaceutical composition described in [1], wherein the protein that specifically binds to the CUG repeat sequence contains 9 to 30 PPR motifs, Pharmaceutical composition.

[0011] [3]:[2] The pharmaceutical composition, wherein the protein that specifically binds to the CUG repeat sequence contains 12 to 24 PPR motifs, Pharmaceutical composition.

[0012] [4]: A pharmaceutical composition according to any of [1] to [3], wherein A1, A4, and L in each of the PPR motifs. ii The combination of these three amino acids; If the target base of the PPR motif is A (adenine), then A1, A4, and L iiThe combination of three amino acids is, in the order of (A1, A4, L ii ), (valine, threonine, asparagine), (phenylalanine, serine, asparagine), (phenylalanine, threonine, asparagine), (isoleucine, asparagine, aspartic acid), or (threonine, threonine, asparagine); When the base targeted by the PPR motif is G (guanine), the combination of the three amino acids of A1, A4, and L ii is, in the order of (A1, A4, L ii ), (glutamic acid, glycine, aspartic acid), (valine, threonine, aspartic acid), (lysine, threonine, aspartic acid), or (leucine, threonine, aspartic acid); When the base targeted by the PPR motif is U (uracil), the combination of the three amino acids of A1, A4, and L ii is, in the order of (A1, A4, L ii ), (valine, asparagine, aspartic acid), (isoleucine, asparagine, asparagine), (isoleucine, asparagine, aspartic acid), (isoleucine, methionine, aspartic acid), (phenylalanine, proline, aspartic acid), or (tyrosine, proline, aspartic acid); or,[[ID=1--5]] When the base targeted by the PPR motif is C (cytosine), the combination of the three amino acids of A1, A4, and L ii is, in the order of (A1, A4, L ii ), (valine, asparagine, asparagine), (isoleucine, asparagine, asparagine), (valine, asparagine, serine), or (isoleucine, methionine, aspartic acid), Pharmaceutical composition.

[0013] [5]: The pharmaceutical composition according to any one of [1] to [3], wherein the combination of the two amino acids of A4 and L in each of the above PPR motifs is; ii When the base targeted by the PPR motif is A (adenine), A4 and L ​ii The combination of these two amino acids is (A4, L ii ) in that order, (threonine, asparagine), (Serine, asparagine) or (Glycine, asparagine); If the target base of the PPR motif is G (guanine), then A4 and L ii The combination of these two amino acids is (A4, L ii ) in that order, (threonine, aspartic acid) or (glycine, aspartic acid); If the target base of the PPR motif is U (uracil), then A4 and L ii The combination of these two amino acids is (A4, L ii The order is (asparagine, aspartic acid), (proline, aspartic acid), (methionine, aspartic acid), or (valine, threonine); When the target base of the PPR motif is C (cytosine), then A4 and L ii The combination of these two amino acids is (A4, L ii ) in that order, (asparagine, asparagine), (Asparagine, serine) or (Leucine, aspartic acid) Pharmaceutical composition.

[0014] [6]: A pharmaceutical composition described in any of [1] to [5], The expression vector is characterized by incorporating a nucleic acid encoding a protein that specifically binds to the aforementioned CUG repeat sequence. Pharmaceutical composition.

[0015] [7]: A pharmaceutical composition described in any of [1] to [5], The viral vector is characterized in that it contains nucleic acids encoding a protein that specifically binds to the aforementioned CUG repeat sequence. Pharmaceutical composition.

[0016] [8]:[7] The pharmaceutical composition described above, The viral vector is characterized by being a viral vector that has a directivity to muscle tissue. Pharmaceutical composition.

[0017] The pharmaceutical compositions described in [9]:[8], The viral vector is characterized by being an adeno-associated virus (AAV) vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, or a herpes simplex virus vector. Pharmaceutical composition.

[0018] The pharmaceutical compositions described in

[10] :[9], The viral vector is characterized in that it is an AAV vector. Pharmaceutical composition.

[0019]

[11] :

[10] The pharmaceutical composition described above, The AAV vector is characterized in that it is an AAV1 vector, an AAV2 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or an AAV12 vector. Pharmaceutical composition.

[0020]

[12] : An expression vector comprising a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in [1].

[0021]

[13] : Cells containing the expression vector described in

[12] .

[0022]

[14] : A protein produced from the cells described in

[13] that specifically binds to the CUG repeat sequence.

[0023]

[15] : A viral expression vector comprising nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in [1].

[0024]

[16] :Cells containing the viral expression vector described in

[15] .

[0025]

[17] :A viral vector produced from the cells described in

[16] .

[0026]

[18] : Use of nucleic acids encoding proteins that specifically bind to the CUG repeat sequence as defined in [1] in the manufacture of pharmaceuticals for the treatment of myotonic dystrophy type 1.

[0027]

[19] : A treatment method for myotonic dystrophy type 1, The step of applying a therapeutically effective amount of the pharmaceutical composition described in [1] to a subject, method.

[0028] Furthermore, inventions that arbitrarily combine one or more of the above-mentioned features are also included within the scope of the present invention. [Effects of the Invention]

[0029] The present invention may treat or alleviate the symptoms of myotonic dystrophy type 1 (DM1). [Brief explanation of the drawing]

[0030] [Figure 1] Figure 1 shows that the PPR protein of the present invention specifically binds to the CUG repeat sequence. [Figure 2] Figure 2 shows that the PPR protein of the present invention suppressed RNA-foci formation in DM1 model cells. [Figure 3] Figure 3 shows that the PPR protein of the present invention improved splicing abnormalities in DM1 model cells. [Figure 4] Figure 4 shows that the PPR protein of the present invention improved muscle differentiation efficiency in a DM1 model animal. [Figure 5] Figure 5 shows that the PPR protein of the present invention suppressed RNA-foci formation in a DM1 model animal. [Figure 6]Figure 6 shows that the PPR protein of the present invention improved splicing abnormalities in a DM1 model animal. [Figure 7] Figure 7 shows that the PPR protein of the present invention improved myotonia in a DM1 model animal. [Figure 8] Figure 8 shows the relationship between the improvement effect of the present invention on abnormal splicing and the improvement effect on muscle rigidity. [Figure 9] Figure 9 shows that AAV9-CUG-PPR1 suppressed RNA-foci formation in a dose-dependent manner in DM1 model animals. In the figure, "Ctrl" represents the PBS-administered group, "LD" represents the low-dose AAV9-CUG-PPR1-administered group, "MD" represents the medium-dose AAV9-CUG-PPR1-administered group, and "HD" represents the high-dose AAV9-CUG-PPR1-administered group. The vertical axis shows the percentage of RNA-foci-positive cells. [Figure 10] Figure 10 shows that AAV9-CUG-PPR1 dose-dependently improved splicing abnormalities in DM1 model animals. The left figure shows the results in the abnormal splicing detection system for Clcn1, and the right figure shows the results for Atp2a1. In the figure, "Ctrl" represents the PBS administration group, "LD" represents the low-dose AAV9-CUG-PPR1 administration group, "MD" represents the medium-dose AAV9-CUG-PPR1 administration group, and "HD" represents the high-dose AAV9-CUG-PPR1 administration group. The vertical axis shows the percentage of normal splicing isoforms in each case. [Figure 11] Figure 11 shows that AAV9-CUG-PPR1 improved myotonia in a dose-dependent manner in DM1 model animals. The vertical axis shows the myotonia score, with the frequency of myotonic discharges decreasing in the order of score 3, 2, 1, and 0. The frequency and severity of myotonic discharges correlate. In the figure, "Ctrl" represents the PBS administration group, "LD" represents the low-dose AAV9-CUG-PPR1 administration group, "MD" represents the medium-dose AAV9-CUG-PPR1 administration group, and "HD" represents the high-dose AAV9-CUG-PPR1 administration group. [Figure 12]Figure 12 shows the relationship between the dose of AAV9-CUG-PPR1 and PPR mRNA expression levels. GAPDH is used as the internal standard. Each individual point represents the PPR mRNA expression level in the thigh muscle of each mouse. The vertical axis is displayed in logarithmic scale. In the figure, "Ctrl" represents the PBS administration group, "LD" represents the low-dose AAV9-CUG-PPR1 administration group, "MD" represents the medium-dose AAV9-CUG-PPR1 administration group, and "HD" represents the high-dose AAV9-CUG-PPR1 administration group. [Figure 13] Figure 13 shows that AAV9-CUG-PPR1 suppressed RNA-foci formation in a time-dependent manner in DM1 model animals. In the figure, "Ctrl" indicates the PBS-administered group. "2w," "4w," "8w," and "16w" indicate the duration of the study after AAV9-CUG-PPR1 administration, respectively. The vertical axis shows the percentage of RNA-foci-positive cells. [Figure 14] Figure 14 shows that AAV9-CUG-PPR1 improved splicing abnormalities in a time-dependent manner in DM1 model animals. The left figure shows the results in the abnormal splicing detection system for Clcn1, and the right figure shows the results for Atp2a1. In the figure, "Ctrl" indicates the PBS-administered group. "2w," "4w," "8w," and "16w" indicate the test period after AAV9-CUG-PPR1 administration, respectively. The vertical axis shows the content of normal splicing isoforms. [Figure 15] Figure 15 shows that AAV9-CUG-PPR1 improved myotonia in a time-dependent manner in DM1 model animals. The vertical axis shows the myotonia score, with the frequency of myotonic discharges decreasing in the order of score 3, 2, 1, and 0. The frequency and severity of myotonic discharges correlate. In the figure, "Ctrl" indicates the PBS-administered group. "2w," "4w," "8w," and "16w" indicate the study period after AAV9-CUG-PPR1 administration, respectively. [Figure 16]Figure 16 shows that splicing abnormalities are comprehensively normalized after administration of AAV9-CUG-PPR1. Figure 16a shows how splicing events with a PSI (Percent spliced ​​in) change of 0.2 or more (left) changed in PPR-administered HSA-LR mice (right) compared to WT and PBS-administered HSA-LR mice. Figure 16b shows the changes in DM1-related splicing events identified by Tanner et al. (2021). Black circles represent signals from normal mice, blue squares represent signals from PBS-administered drug-responsive mice, and red triangles represent signals from PPR-administered drug-responsive mice. Figure 16c shows the results of gene ontology analysis for each gene in Figure a. The P-value indicates the P-value for each gene ontology term. In PPR-administered HSA-LR mice, the number of genes in three stages of exon skipping improvement rate is indicated: greater than 50%, 20-50%, and less than 20%. [Figure 17] Figure 17 shows the PPR mRNA expression levels in various organs of mice administered AAV9-CUG-PPR1. The vertical axis shows the relative expression levels in logarithmic scale, with the expression level of a 1 × 10¹³ vg / kg administered mouse set to 1. GAPDH mRNA expression levels are used as the internal standard. The horizontal axis shows the AAV9-CUG-PPR1 dose (vg / kg mouse body weight). The values ​​for each individual mouse are plotted as dots, and the median is connected by a line. [Figure 18] Figure 18 shows the persistence of mRNA expression in various organs of mice treated with AAV9-CUG-PPR1. The vertical axis shows the relative expression level, with the expression level of one mouse at 2 weeks (Day 14) after AAV administration set to 1. GAPDH mRNA expression level is used as the internal standard. On the horizontal axis, "Ctrl" represents the PBS group, and "14," "28," "56," "112," and "183" represent the number of days after administration. The values ​​for each individual mouse are plotted as dots, and the mean values ​​are connected by lines. [Modes for carrying out the invention]

[0031] [PPR motifs and PPR proteins] In this disclosure, when the term "PPR motif" is used, unless otherwise specified, it refers to a polypeptide composed of 30 to 38 amino acids whose amino acid sequence, when analyzed using a web-based protein domain search program, has an E value of PF01535 in Pfam and PS51375 in Prosite that is less than or equal to a predetermined value (preferably E-03). The positional numbers of the amino acids constituting the PPR motif as defined in this disclosure are almost synonymous with PF01535, but correspond to the number obtained by subtracting 2 from the amino acid position in PS51375 (e.g., the 1st amino acid in this invention → the 3rd amino acid in PS51375). However, when the term "ii" (-2) amino acid is used, it refers to the second amino acid from the end (C-terminus) of the amino acid constituting the PPR motif, or the -2nd amino acid, two positions N-terminus relative to the 1st amino acid of the next PPR motif. If the next PPR motif is not clearly identified, the amino acid two positions prior to the 1st amino acid of the next helix structure is designated as "ii".

[0032] The conserved amino acid sequence of the PPR motif has low conservation at the amino acid level, but the two α-helices are well conserved in the secondary structure. A typical PPR motif consists of 35 amino acids, but its length is variable, ranging from 30 to 38 amino acids.

[0033] The basic structure of the PPR motif is known to be represented by Equation 1.

[0034] [ka] (In the formula: Helix A is a 12-amino acid length region capable of forming an α-helix structure, represented by Equation 2.

[0035] [ka] In formula 2, A1~A 12 Each of these independently represents an amino acid; X is either absent or a segment consisting of 1 to 9 amino acids in length; Helix B is a region consisting of 11-13 amino acids that can form an α-helix structure; L is the portion represented by formula 3, which is 2 to 7 amino acids long;

[0036] [ka] In Equation 3, each amino acid is numbered from the C-terminus as "i" (-1), "ii" (-2), and so on. However, L iii ~L vii It may not exist.

[0037] In this disclosure, "PPR protein" refers to a PPR protein having one or more, preferably two or more, of the above-described PPR motifs, unless otherwise specified. In this disclosure, "protein" refers to all substances consisting of polypeptides (chains of amino acids linked by peptide bonds), unless otherwise specified, and includes those consisting of relatively low-molecular-weight polypeptides. In this invention, "amino acid" may refer to an ordinary amino acid molecule, or it may refer to an amino acid residue that constitutes a peptide chain. Which is referred to will be clear to those skilled in the art from the context.

[0038] In this disclosure, when the binding of a PPR motif to RNA bases is referred to as "selective" or "specific," unless otherwise specified, it means that the binding activity to any one of the RNA bases is higher than the binding activity to the other bases. This selectivity or specificity can be confirmed by designing and conducting experiments based on methods known to those skilled in the art, or it can be determined by calculation.

[0039] In this disclosure, when "RNA base" refers to an RNA base, unless otherwise specified, it refers to adenine (A), guanine (G), cytosine (C), or uracil (U). Note that PPR proteins may exhibit selectivity for bases in RNA, but they do not bind to nucleic acid monomers.

[0040] PPR proteins are abundant in plants, with 500 proteins and approximately 5000 motifs found in Arabidopsis thaliana. Many land plants, such as rice, poplar, and Selaginella, also possess PPR motifs and PPR proteins with diverse amino acid sequences. In this invention, naturally occurring PPR motifs and PPR proteins may be used, or PPR motifs and PPR proteins designed based on methods disclosed, for example, in WO2013 / 058404 may be used. Specifically, desired PPR motifs and PPR proteins can be designed based on the following information disclosed in WO2013 / 058404.

[0041] (I) Information regarding the positions of amino acids important for selective binding. The combination of three amino acids in the PPR motif: A1, A4, L ii ), or 4, a combination of two amino acids in the "ii" (-2) position (A4, L ii These are important for selective binding to RNA bases, and their combinations allow us to determine which RNA base will bind.

[0042] This invention is disclosed in WO2013 / 058404, A1, A4, and L ii The combination of the three amino acids, and / or A4, and L ii We can utilize our knowledge regarding the combination of these two amino acids.

[0043] (II)A 1 、A 4 Information regarding the correspondence between the three amino acid combinations of Lii and RNA bases. (3-1) A1, A4, and L iiWhen the combination of these three amino acids is valine, asparagine, and aspartic acid, the PPR motif has selective RNA base binding ability, strongly binding to U, then to C, and then to A or G. (3-2) A1, A4, and L ii In the case of the three amino acid combinations, valine, threonine, and asparagine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to A, then to G, then to C, but not to U. (3-3) A1, A4, and L ii The combination of these three amino acids, in order, valine, asparagine, and asparagine, respectively, has a selective RNA base-binding ability in which its PPR motif strongly binds to C, then to A or U, but does not bind to G. (3-4) A1, A4, and L ii When the combination of these three amino acids is glutamic acid, glycine, and aspartic acid, the PPR motif has selective RNA base binding ability, strongly binding to G but not to A, U, and C. (3-5) A1, A4, and L ii The combination of these three amino acids, in order, isoleucine, asparagine, and in the case of asparagine, its PPR motif has selective RNA base binding ability, binding strongly to C, then to U, then to A, but not to G. (3-6) A1, A4, and L ii When the combination of these three amino acids is valine, threonine, and aspartic acid, the PPR motif has selective RNA base binding ability, strongly binding to G, then to U, but not to A and C. (3-7) A1, A4, and L ii When the combination of these three amino acids is lysine, threonine, and aspartic acid, the PPR motif has selective RNA base binding ability, strongly binding to G, then to A, but not to U and C. (3-8) A1, A4, and Lii When the combination of these three amino acids is phenylalanine, serine, and asparagine, the PPR motif has selective RNA base binding ability, binding strongly to A, then to C, and then to G and U. (3-9) A1, A4, and L ii When the combination of these three amino acids is valine, asparagine, and serine, the PPR motif has selective RNA base binding ability, strongly binding to C, then to U, but not to A and G. (3-10) A1, A4, and L ii When the combination of these three amino acids is phenylalanine, threonine, and asparagine, the PPR motif has selective RNA base binding ability, strongly binding to A but not to G, U, and C. (3-11) A1, A4, and L ii When the combination of these three amino acids is, in order, isoleucine, asparagine, and aspartic acid, its PPR motif exhibits selective RNA base binding ability, strongly binding to U, then to A, but not to G and C. (3-12) A1, A4, and L ii When the combination of these three amino acids is threonine, threonine, and asparagine, the PPR motif has selective RNA base binding ability, strongly binding to A but not to G, U, and C. (3-13) A1, A4, and L ii When the combination of these three amino acids is, in order, isoleucine, methionine, and aspartic acid, its PPR motif exhibits selective RNA base binding ability, strongly binding to U, then to C, but not to A and G. (3-14) A1, A4, and L ii The combination of these three amino acids, in the case of phenylalanine, proline, and aspartic acid, is called PPR, and its motif has selective RNA base binding ability, strongly binding to U, then to C, but not to A and G. (3-15) A1, A4, and L ii When the combination of these three amino acids is tyrosine, proline, and aspartic acid, the PPR motif has selective RNA base binding ability, strongly binding to U but not to A, G, and C. (3-16) A1, A4, and L ii When the combination of these three amino acids is leucine, threonine, and aspartic acid, the PPR motif exhibits selective RNA base binding ability, strongly binding to G but not to A, U, and C.

[0044] (II)A 4 , and L ii Information regarding the correspondence between the combination of two amino acids and RNA bases. (2-1) A4, L ii However, in the case of asparagine and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to U, then to C, and then to A and G. (2-2) A4, L ii However, in the case of asparagine, its PPR motif has selective RNA base binding ability, binding strongly to C, then to U, and then to A and G. (2-3) A4, L ii However, in the case of threonine and asparagine, their PPR motifs exhibit selective RNA base binding ability, strongly binding to A, and then weakly binding to G, U, and C. (2-4) A4, L ii However, in the case of threonine and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to G and then weakly binding to A, U, and C. (2-5) A4, L ii However, in the case of serine and asparagine, their PPR motifs exhibit selective RNA base binding ability, strongly binding to A, and then to G, U, and C. (2-6) A4, L iiHowever, in the case of glycine and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to G, then U, then A, but not to C. (2-7) A4, L ii However, in the case of asparagine and serine, their PPR motifs exhibit selective RNA base binding ability, binding strongly to C, then to U, and then to A and G. (2-8) A4, L ii However, in the case of proline and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to U, then to G, C, and C, but not to A. (2-9) A4, L ii However, in the case of glycine and asparagine, their PPR motifs exhibit selective RNA base binding ability, strongly binding to A, then to G, but not to C and U. (2-10) A4, L ii However, in the case of methionine and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to U and then weakly binding to A, G, and C. (2-11) A4, L ii However, in the case of leucine and aspartic acid, their PPR motifs exhibit selective RNA base binding ability, strongly binding to C and then to U, but not to A and G. (2-12) A4, L ii However, in the case of valine and threonine, their PPR motifs exhibit selective RNA base binding ability, strongly binding to U and then to A, but not to G and C.

[0045] The above rules apply to the PPR motif (A1, A4, L ii ) or (A4, L iiThe combination of amino acids in the above rules can statistically significantly increase the likelihood that the PPR motif will bind to the target base. However, the above rules do not mean that a PPR motif (or PPR protein) that binds to the target base (or base sequence) can be produced with 100% probability. Nevertheless, a person skilled in the art can obtain a PPR motif (or PPR protein) that binds to the target base (or base sequence) with a high probability by producing several to several dozen candidate PPR proteins based on the above rules. Furthermore, the selection of a desired PPR protein through the production and verification of candidate PPR proteins can be carried out by a person skilled in the art within the scope of normal trial and error and does not impose an excessive burden on such a person.

[0046] [Utilization of PPR motifs and PPR proteins] A single PPR motif can recognize a specific base of RNA. According to the present invention, by appropriately selecting amino acids at specific positions, PPR motifs selective for A, U, G, and C can be selected or designed. Furthermore, a protein containing an appropriate sequence of such PPR motifs can specifically or selectively recognize the corresponding base sequence. Moreover, based on the above findings, it is possible to design a PPR motif that can selectively bind to a desired RNA base, and a protein having multiple PPR motifs that can sequence-specifically bind to a desired RNA. During design, the portion of the PPR motif other than the amino acids at the important positions may be referenced from the sequence information of a native PPR motif. Alternatively, the entire native PPR motif may be used, and only the amino acids at the aforementioned important positions may be substituted. The number of repeats in the PPR motif can be appropriately set depending on the target sequence, but can be, for example, two or more, and can range from 2 to 30.

[0047] [PPR protein that specifically binds to CUG repeat sequences] This invention relates to a PPR protein that specifically binds to mRNA containing an abnormally elongated CUG repeat sequence that causes DM1. Based on the theory described above, the PPR protein according to this invention can be produced by linking together multiple sets of [PPR motifs that bind to C, PPR motifs that bind to U, and PPR motifs that bind to G]. The first PPR motif of the PPR protein according to this invention does not necessarily have to be a PPR motif that binds to C; as long as the PPR protein as a whole specifically binds to the CUG repeat sequence, the first PPR motif may be a PPR motif that binds to U or a PPR motif that binds to G. Naturally, as long as the PPR protein according to this invention as a whole is configured to specifically bind to the CUG repeat sequence, the number of PPR motifs contained in the PPR protein does not need to be a multiple of 3.

[0048] Non-limiting examples of C-binding PPR motifs that may be used in the present invention include PPR motifs having the following sequences.

[0049] JPEG0007854207000007.jpg29166

[0050] In the present invention, A1, A4, L of the above sequence ii amino acids at the position, or A4, L ii A PPR motif having sequence homology (or sequence identity) of 80% or more (preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) with the above sequence, provided that the amino acid at the nth position is conserved, and having binding affinity to C may be used.

[0051] In the present invention, A1, A4, L of the above sequence ii amino acids at position A4, L iiA PPR motif having a binding affinity to C and having substitutions, additions, and / or deletions of 7 bases or less (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) to the above sequence may be used, provided that the amino acid at the position is conserved. The amino acid substitution may be, for example, a conserved substitution of amino acids known in this art.

[0052] Non-limiting examples of U-binding PPR motifs that may be used in the present invention include PPR motifs having the following sequences.

[0053] JPEG0007854207000008.jpg15166

[0054] In the present invention, A1, A4, L of the above sequence ii amino acids at position A4, L ii A PPR motif having sequence homology (or sequence identity) of 80% or more (preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) to the above sequence, provided that the amino acid at the position is conserved, and having binding affinity to U, may also be used.

[0055] In the present invention, A1, A4, L of the above sequence ii amino acids at position A4, L ii A PPR motif having substitutions, additions, and / or deletions of 7 bases or less (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) to the above sequence, provided that the amino acid at position 1 is conserved, and which has binding affinity to U, may be used. The amino acid substitution may be, for example, a conserved amino acid substitution known in this art.

[0056] Non-limiting examples of G-binding PPR motifs that may be used in the present invention include PPR motifs having the following sequences.

[0057] JPEG0007854207000009.jpg27166

[0058] In the present invention, A1, A4, L of the above sequence ii amino acids at position A4, L ii A PPR motif that has sequence homology (or sequence identity) of 80% or more (preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) to the above sequence and has binding affinity to G may be used, provided that the amino acid at the 1-position is conserved.

[0059] In the present invention, A1, A4, L of the above sequence ii amino acids at position A4, L ii A PPR motif having a binding affinity to G and having substitutions, additions, and / or deletions of 7 bases or less (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) to the above sequence may be used, provided that the amino acid at position A is conserved. The amino acid substitution may be, for example, a conserved amino acid substitution known in this art.

[0060] In this invention, when "identity" is used with respect to a base sequence (sometimes called a nucleotide sequence) or amino acid sequence, unless otherwise specified, it refers to the percentage of matching bases or amino acids shared between two sequences when the two sequences are aligned in the most optimal manner. That is, identity can be calculated as (number of matching positions / total number of positions) × 100, and can be calculated using algorithms that are distributed for a fee or free of charge. Such algorithms are incorporated into the NBLAST and XBLAST programs described, for example, in Altschul et al., J.Mol.Biol. 215(1990) 403-410. More specifically, the search and analysis of identity between base sequences or amino acid sequences can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, the parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. The specific methods of these analysis methods are also well known to those skilled in the art.

[0061] Conservative substitution of amino acids may be, for example, a substitution with an amino acid with similar properties. Amino acids with similar properties refer to amino acids with similar physical characteristics such as hydroxyl, charge, pKa, and solubility, and include, for example, the following: • Hydrophobic amino acids: alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, tyrosine; • Non-hydrophobic amino acids: arginine, asparagine, aspartic acid, glutamic acid, glutamine, lysine, serine, threonine, cysteine, histidine; • Hydrophilic amino acids: arginine, asparagine, aspartic acid, glutamic acid, glutamine, lysine, serine, threonine; • Acidic amino acids: aspartic acid, glutamic acid; Basic amino acids: lysine, arginine, histidine; Neutral amino acids: alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine; • Sulfur-containing amino acids: methionine, cysteine; • Aromatic ring amino acids: tyrosine, tryptophan, phenylalanine.

[0062] [DM1 treatment according to this invention] The effects of the present invention are exerted when the PPR protein of the present invention binds to mRNA containing an abnormally elongated CUG repeat sequence within the target cell. The means of delivering the PPR protein into the target cell are not limited; the nucleic acid encoding the PPR protein of the present invention may be delivered into the target cell to express the PPR protein of the present invention within the target cell, or the PPR protein of the present invention itself may be delivered into the target cell. The means of delivering proteins or nucleic acids are not limited, and various means known in the art can be used. Non-limited examples of means of delivering nucleic acids or proteins into the target cell that can be used in the present invention include liposomes, lipid nanoparticles (LNPs), polymer micelles, emulsions, polymer microcapsules, antibody-nucleic acid complexes, antibody-drug complexes, viruses, etc.

[0063] Non-limiting examples of viral vectors that may be used in the present invention include adeno-associated virus (AAV) vectors, adenovirus vectors, retrovirus vectors, lentivirus vectors, or herpes simplex virus vectors, which can be appropriately selected by those skilled in the art depending on their directivity to cells or tissues, the necessity of nucleic acid integration into the host genome, etc.

[0064] AAV vectors have the ability to infect both dividing and quiescent cells, and can deliver genetic material to a wide variety of cell types, making them particularly suitable for use in the present invention. To date, 12 serotypes of AAV (AAV1 to AAV12) have been reported, and all known serotypes can infect various types of tissue cells. The serotypes of AAV vectors that can be used in the present invention are not limited, but for example, AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12 vectors, which are known to have a directivity to muscle tissue (skeletal muscle, cardiac muscle, and / or smooth muscle), may be used.

[0065] Treatment of DM1 using the present invention may involve directly applying the present invention to the living body of a person suffering from DM1 (in vivo), or it may involve treating cells or tissues outside the body using the present invention and introducing them into the living body of the person (ex vivo).

[0066] The method for producing the expression vector containing the nucleic acid encoding the PPR protein of the present invention is not limited, and a person skilled in the art can produce it by conventional methods (for example, using a commercially available protein expression vector production kit, using a commercially available virus expression vector production kit, commissioning a manufacturer, etc.).

[0067] The method for producing the PPR protein of the present invention is not limited, but for example, a desired PPR protein can be obtained by selectively extracting and / or purifying the PPR protein by conventional methods from cells (e.g., animal cells, plant cells, Escherichia coli, yeast, etc.) containing an expression vector (e.g., plasmid, transposon, virus, etc.) encoding the PPR protein designed by the method described herein.

[0068] Unless otherwise specifically defined, terms used herein are used to describe specific embodiments and are not intended to limit the invention.

[0069] Furthermore, the term "includes" as used herein means that the described items (components, steps, elements, numbers, etc.) exist, unless the context clearly requires a different interpretation, and does not exclude the existence of other items (components, steps, elements, numbers, etc.).

[0070] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as they are commonly understood by those skilled in the art to which this invention pertains. Unless otherwise explicitly defined, terms used herein should be interpreted to have a meaning consistent with that of this specification and the related art, and should not be interpreted in an idealized or overly formal sense.

[0071] The present invention will be described in more detail below with reference to examples. However, the present invention can be embodied in various forms and should not be construed as being limited to the examples described herein. [Examples]

[0072] [Example 1: Production of PPR protein that binds to CUG repeat RNA sequences and analysis of its binding to RNA]

[0073] We prepared recombinant proteins to create a PPR protein that binds to CUG repeat RNA sequences (hereinafter abbreviated as CUG-PPR) and to analyze its binding, and then conducted RNA binding experiments.

[0074] <Experimental materials and methods> (1) Preparation of PPR expression plasmid vector A gene was cloned by fusing luciferase, PPR protein, and a 3x hexahistidine tag in that order to the multiple cloning site of the E. coli expression plasmid vector pET-22b. The expression of the fusion gene is regulated by the T7 promoter. The cloning of the correct-sized gene was confirmed by PCR, and the gene sequence was confirmed by sequencing (SEQ ID NOs: 11-14). These were named Luc-CUG-PPR1, Luc-CUG-PPR2, Luc-CUG-PPR3, and Luc-CUG-PPR4, and were used in subsequent experiments.

[0075] [Table 1] JPEG0007854207000011.jpg210166

[0076] The following shows the detailed sequences of the PPR motifs contained in the PPR proteins in Table 1 above. Each PPR protein contains 18 PPR motifs. [Table 2] [Table 3] [Table 4] [Table 5]

[0077] (2) Preparation of PPR protein The expression plasmid vector constructed above was introduced into *E. coli* Rosetta (DE3) strain. This *E. coli* was cultured in 2 mL of LB medium containing 100 μg / μL ampicillin at 37°C for 12 hours. OD 600 However, when the concentration reached 0.5 to 0.8, the culture medium was transferred to a 15°C incubator and allowed to stand for 30 minutes. Then, 100 μL (final concentration 0.1 mM IPTG) was added and the cells were incubated at 15°C for 16 hours. The E. coli pellet was collected by centrifugation at 5,000 × g, 4°C, for 10 minutes, and 1.5 mL of lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% NP-40, 1 mM MgCl2, 2 mg / ml lysozyme, 1 mM PMSF, 2 μl DNase) was added, and the cells were frozen at -80°C for 20 minutes. Cell freeze-stretching was performed at 25°C with shaking for 30 minutes. Subsequently, the supernatant (E. coli lysate) containing soluble PPR protein was collected by centrifugation at 3700 rpm, 4°C, for 15 minutes and used in the following experiments.

[0078] (3) Binding test of PPR protein to RNA The binding test between PPR protein and RNA was performed using the binding method between PPR protein and biotinylated RNA on a streptavidin plate. The target was a 30-base RNA (GACA) containing the CUG×7 sequence. CUGCUGCUGCUGCUGCUGCUGAUGCA (SEQ ID NO: 15) and a 30-base RNA containing non-target CAG×6 (GACAUGC CAGCAGCAGCAGCAGCAG RNA probes modified with biotin at the 5' end were synthesized for GACUG (SEQ ID NO: 16) (commissioned to Greiner). 2.5 pmol of biotinylated RNA probes were added to streptavidin-coated plates (Cat No. 15502, Thermo Fisher) and reacted at room temperature for 30 minutes. The probes were washed with probe washing buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 0.1% BSA). Wells containing lysis buffer without biotinylated RNA were also prepared for background measurement (labeled "-Probe"). Subsequently, blocking buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 1% BSA) was added, and the plate surface was blocked at room temperature for 30 minutes. 1.5 × 10 8 100 μL of E. coli lysate containing a luciferase-fused PPR protein with a luminescence value of LU / μL was added to each well, and the binding reaction was carried out at room temperature for 30 minutes. The plates were washed five times with 200 μL of washing buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT), and 40 μL of luciferase substrate (Promega, E151A), diluted 2500-fold with the washing buffer, was added to each well and reacted for 5 minutes. After that, the luminescence was measured using a plate reader (PerkinElmer, Cat No. 5103-35).

[0079] <Result> The results are shown in Figure 1. All four proteins—Luc-CUG-PPR1, Luc-CUG-PPR2, Luc-CUG-PPR3, and Luc-CUG-PPR4—showed binding affinity to the CUG probe but not to the CAG probe. In other words, all PPR proteins exhibited high binding specificity to the CUG repeat sequence.

[0080] [Example 2: Effect of PPR on RNA aggregate formation in DM1 model cells] DM1 model cells were treated with PPR protein, and the number of RNA aggregates was measured using FISH (fluorescent in situ hybridization).

[0081] <Experimental materials and methods> (1) DM1 model cells As a DM1 cell model, we used C2C12 cells into which a DMPK gene region containing an 800 CTG repeat was introduced (C2C12-DMPK800R, Nucleic Acids Research, 2014, 42(10), 6591-6602). C2C12-DMPK800 was prepared using the following procedure: A plasmid (pLC16) containing a sequence with an 800 CTG inserted into the 3' untranslated region of the DMPK gene, and a plasmid expressing PhiC31 integrase were both transfected into the mouse myoblast cell line C2C12 using Nucleofector (trade name, Lonza). Stable expression cells were then selected using selective medium supplemented with puromycin. Subsequently, the stable expression cells were transfected with a plasmid expressing Cre recombinase, and clones that induced transcription of mRNA with an 800 CUG repeat were selected using selective medium supplemented with hygromycin.

[0082] (2) Preparation of PPR protein expression plasmid vectors for cell transfection Fusion genes of the green fluorescent protein mCLover3 gene, PPR protein gene, 3× nuclear localization signal, and 3× FLAG epitope tag were cloned into mammalian expression plasmid vectors, in that order. Expression of the fusion genes is regulated by the CMV promoter and the SV40 poly-A signal. Cloning of the correct-sized genes was confirmed by PCR, and the gene sequences were confirmed by sequencing. In addition, fusion genes without the PPR protein gene, i.e., fusion genes of the green fluorescent protein mCLover3 gene, 3× nuclear localization signal, and 3× FLAG epitope tag, were prepared using the same method as controls. These were named mCLo-CUG-PPR1, mCLo-CUG-PPR2, mCLo-CUG-PPR3, mCLo-CUG-PPR4, and mCLo-empty, respectively, and were used in subsequent tests. The sequences of the PPR proteins (PPR1~PPR4) encoded in each expression plasmid vector are identical to the sequences of each PPR protein listed in Table 1.

[0083] [Table 6] JPEG0007854207000017.jpg220166JPEG0007854207000018.jpg83166

[0084] (3) Measurement of RNA aggregate formation DM1 model cells were cultured in 10% FBS, penicillin / streptomycin-containing DMEM medium at 37°C under 5% CO2 conditions. 200 ng of plasmid DNA prepared above, 0.6 μL of Fugene®-HD (Promega, E2311), and 200 μL of Opti-MEM were mixed and added to all wells. After 72 hours of incubation at 37°C under 5% CO2 conditions, the cells were fixed with 3% paraformaldehyde for 15 minutes at room temperature. After fixation, the cells were washed twice with PBS and then permeabilized with 0.5% TritonX-100-containing PBS for 5 minutes. Next, they were pre-hybridized with 2×SSC buffer containing 30% formamide for 10 minutes. Subsequently, the samples were hybridized at 37°C for 1 hour using 2×SSC buffer containing 30% formamide, 2 μg / mL BSA, 66 μg / mL yeast tRNA, 2 mM vanadyl complex, and 1 ng / μL Texas Red CAG probe. After post-hybridization at 42°C for 30 minutes using 2×SSC buffer containing 30% formamide, the samples were washed once with 1×SSC buffer and then twice with PBS. After fixation using Vectashield with DAPI (trade name, Vector Laboratories), the number of RNA aggregates in the nucleus was measured using a fluorescence microscope (Keyence PZ-9000).

[0085] <Result> The results are shown in Figure 2. As is clear from Figure 2, the percentage of RNA aggregate-positive cells exceeded 40% in the untreated DM1 model cells, but the percentage of RNA aggregate-positive cells was significantly reduced in the four experimental groups to which the PPR protein was applied.

[0086] [Example 3: Effect of PPR protein on splicing abnormalities in DM1 model cells] We applied PPR protein to DM1 model cells to investigate whether it improved splicing abnormalities in exon 22 of the Atp2a1 gene.

[0087] <Experimental materials and methods> (1) DM1 model cells The same DM1 model cells (C2C12-DMPK800R) as in Example 2 were used.

[0088] (2) PPR protein The same expression plasmid vector as in Example 2 was used.

[0089] (3) Determination of splicing products DM1 model cells were transfected with a PPR protein expression plasmid vector using the same method as in Example 2, and total RNA was extracted after 72 hours using the RNeasy Mini Plus Kit (product name, Qiagen). As a control, DM1 model cells that had not been transfected with the PPR protein expression plasmid vector were used, and total RNA was extracted in the same manner. Subsequently, cDNA was prepared using the SuperScript III First Strand Symthesis System (Invitrogen). After RNaseH treatment of the cDNA, RT-PCR was performed using the following Atp2a1 exon 22 RT primers. The RT-PCR products were electrophoresed on a 2% agarose gel, stained with GelRed, and then normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad). ATP2A1 exon 22 RT primer Fw: GCTCATGGTCCTCAAGATCTCAC (Sequence ID 22) Rv: GGGTCAGTGCCTCAGCTTTG (Sequence ID 23)

[0090] <Result> The results are shown in Figure 3. The lower panel shows the electrophoresis results of the RT-PCR products, and the upper panel is a graph showing the proportion of normal cells in the RT-PCR products. In the group not treated with PPR protein, the proportion of abnormal cells was higher than that of normal cells. It was shown that treatment with PPR protein significantly increased the proportion of normal cells in DM1 model cells, improving splicing abnormalities.

[0091] [Example 4: Effect of PPR protein on abnormal muscle differentiation in DM1 model cells] We investigated whether applying PPR protein to DM1 model cells improved the muscle differentiation efficiency of DM1 model cells.

[0092] <Experimental materials and methods> (1) DM1 model cells The same DM1 model cells (C2C12-DMPK800R) as in Example 2 were used.

[0093] (2) PPR protein The same PPR protein expression plasmid vector as in Example 2 was used.

[0094] (3) Quantification of muscle differentiation efficiency DM1 model cells were transfected with a PPR protein expression plasmid vector using the same method as in Example 2. The following day, the cells were changed to differentiation medium, and 72 hours after transfection, nuclear staining with DAPI and antibody staining with anti-MyHC antibody were performed. First, cells that were antibody-stained and had two or more nuclei were defined as myotubes, and the total number of nuclei in myotubes observed in the field of view was measured (hereinafter referred to as value A). Next, the total number of nuclei in the entire field of view, including not only the myotubes mentioned above but also undifferentiated cells, was measured (hereinafter referred to as value B). The fusion index is expressed as a percentage obtained by dividing value A by value B, and represents the muscle differentiation efficiency.

[0095] <Result> The results are shown in Figure 4. In the empty vector administration group (indicated as "no" in the figure), the Fusion index was approximately 3. On the other hand, in all PPR administration groups, the Fusion index was approximately 5 to 15, indicating a significant improvement in muscle differentiation efficiency.

[0096] [Example 5: Effects of PPR in DM1 model mice] A single dose of AAV6 containing the CUG-PPR gene was administered to the tibialis anterior muscle of DM1 model mice, and its effects on myotonic symptoms in the tibialis anterior muscle, its effects on splicing abnormalities of the Atp2a1 gene and the skeletal muscle chloride channel (Clcn1) gene, and the number of RNA aggregates formed were examined.

[0097] <Experimental materials and methods> (1) Animals used HSA as a DM1 model mouse LR Mice (donated by Dr. Charles Thornton (University of Rochester) and bred at the Osaka University Laboratory Animal Facility) were used. HSA LR The mice were transgenic animals in which a 220-repetition CTG repeat sequence was incorporated into the genome of the hACTA gene (a human gene constitutively expressed in muscle cells) in the 3' untranslated region. The expression of mRNA with the extended CUG sequence in muscle cells resulted in the appearance of DM1 symptoms (Science, 2000, 289(5485), 1769-73). Wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used as a control. Male and female mice at 14 weeks of age were used in the experiment.

[0098] (2) PPR protein (Manufacturing of AAV vectors) A gene was inserted into the multi-cloning site of an AAV vector (AAVpro® Helper Free System (AAV6), Takara, 6651 component) by sequentially fusing the green fluorescent protein mCLover3, PPR protein, 3× nuclear localization signal, and 3× FLAG epitope tag. The expression size of the constructed gene was confirmed by PCR, and the inserted sequence was confirmed by sequencing. The expression of the fusion gene is regulated by the CMV promoter and the Human growth hormone polyA signaling pathway.

[0099] (Preparation of AAV vectors) The AAV vector constructed in the previous section was used to create the pRC6 vector, and 20 μg each of the phelper vector (both components of AAVpro® Helper Free System (AAV6), Takara, 6651) were mixed using Polyethylenimine, Linear, MW25000 (Polysciences, Inc., 23966-1) in a 2.5 × 10⁻¹⁶ solution. 8 The AAVpro® HEK293T cell line (Takara, 632273) was transfected with a specific number of cells. AAV-producing cells were obtained 3 days after transfection. AAV purification was performed using the AAVpro® Purification Kit Maxi (all serotype) (Takara, 6666). Titer analysis was performed using the AAVpro titration kit for real time PCR ver.2 (Takara, 6233), resulting in a titer of 5 × 10⁶. 11 The solutions were diluted with D-PBS to vg / mL to prepare the administration solution. These were designated AAV6-mCLo-CUG-PPR1, AAV6-mCLo-CUG-PPR2, and AAV6-mCLo-empty, respectively, and used in subsequent tests. The sequences of the PPR proteins (PPR1, PPR2) encoded in each AAV vector are identical to the sequences of the PPR proteins listed in Table 1.

[0100] (3) Grouping and administration schedule Four groups were established: a DM1 group administered AAV6-mCLo-CUG-PPR1, a DM1 group administered AAV6-mCLo-CUG-PPR2, a DM1 group administered AAV6-mCLo-empty, and a DM1 group administered PBS (n=5 in each group (using the left and right limbs of 3 males and 2 females)). The AAV dosage was 1 × 10⁻¹⁶. 10 The regimen was vg / leg, and a single dose was administered. The PBS-treated DM1 group received a single dose of the same volume of PBS.

[0101] (4) Measurement of RNA aggregate formation Fifty-six days after the final dose, the tibialis anterior muscle was harvested from mice and sections were prepared. After washing twice with PBS, the sections were permeabilized for 5 minutes in PBS containing 0.5% TritonX-100. Next, pre-hybridization was performed for 10 minutes in 2×SSC buffer containing 30% formamide. Subsequently, hybridization was performed at 37°C for 1 hour in 2×SSC buffer containing 30% formamide, 2 μg / mL BSA, 66 μg / mL yeast tRNA, 2 mM vanadyl complex, and 1 ng / μL Texas Red CAG probe. Post-hybridization was performed at 42°C for 30 minutes in 2×SSC buffer containing 30% formamide, followed by one wash with 1×SSC buffer and then two washes with PBS. After fixation using Vectashield with DAPI (product name, Vector Laboratories), the number of RNA aggregates in the nucleus was measured using a fluorescence microscope (Keyence PZ-9000).

[0102] (5) Determination of splicing products The tibialis anterior muscle was collected from mice 56 days after the final administration. Total RNA was extracted using TRI Reagent (trade name, MRC), and cDNA was prepared using the SuperScript III First Strand Symthesis System (Invitrogen). After RNaseH treatment of the cDNA, RT-PCR was performed using the same Atp2a1 exon 22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel, stained with GelRed, and then normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad), and the proportion of normal products in the RT-PCR product was calculated. Statistical analysis was performed using t-tests. Clcn1 exon 7a RT primer Fw:TGAAGGAATACCTCACACTCAAGG (Sequence ID 24) Rv:CACGGAACACAAAGGCACTG (Sequence ID 25)

[0103] (6) Measurement of myotonia Fifty-six days after the final dose, electromyotonicity of the tibialis anterior muscle in mice was analyzed using needle electromyography under anesthesia. Specifically, the frequency of electromyotonicity occurring after 20 needle electrode insertions into the tibialis anterior muscle of mice was evaluated in the following four stages. Severity level 0: No electrical myotonia is observed. Severity level 1: Electrical myotonia is observed in less than 50% of cases. Severity level 2: Electromyotonic phenomenon is observed in 50% or more but less than 90% of the total. Severity level 3: Electrical myotonia is observed in over 90% of cases.

[0104] <Result> The results of RNA-foci analysis are shown in Figure 5. The PBS-administered group and the AAV6-mCLo-empty-administered group showed an RNA-foci-positive cell rate of approximately 30%. On the other hand, a significant decrease in RNA-foci positivity was observed in the AAV6-mCLo-CUG-PPR1 and AAV6-mCLo-CUG-PPR2-administered groups.

[0105] The results of the splicing abnormality evaluation are shown in Figure 6. For Atp2a1, the proportion of normal products was approximately 60% in the PBS-administered DM1 group and the AAV6-mCLo-Empty-administered MyoD group. In the AAV6-mCLo-CUG-PPR1-administered DM1 group and the AAV6-mCLo-CUG-PPR2-administered DM1 group, the proportion of normal RT-PCR products increased significantly, indicating that PPR protein administration improves splicing abnormalities of the Atp2a1 gene. Similarly, for Clcn1, it was observed that PPR administration improved splicing abnormalities of the Clcn1 gene.

[0106] The results of the myotonia analysis are shown in Figure 7. In both the PBS administration group and the AAV6-mCLo-empty administration group, all 5 animals showed myotonia of severity level 2. In both the AAV6-mCLo-CUG-PPR1 and AAV6-mCLo-CUG-PPR2-administered DM1 groups, 2 out of 5 animals showed severity level 1, and the remaining 3 showed severity level 2. Furthermore, the two cases that showed improvement were in the experimental group where the Clcn1 splicing abnormality improvement effect was high (Figure 8).

[0107] The results above demonstrate that the present invention improves splicing abnormalities caused by abnormal elongation of CTG repeat sequences, and as a result, improves myotonic symptoms in DM1.

[0108] [Example 6: Dose-dependent study of drug efficacy using DM1 model mice] To evaluate the dose-dependent efficacy of drugs using DM1 model mice, 3 × 10⁶ AAV9 mice carrying the CUG-PPR gene were introduced into DM1 model mice. 13 ,1×10 14 ,3×10 14 The vg / kg doses were administered as a single intravenous injection, and their effects on myotonic symptoms in the thigh muscle, on splicing abnormalities of the Atp2a1 gene and skeletal muscle chloride channel (Clcn1) gene, and on the number of RNA aggregates formed were examined.

[0109] <Experimental materials and methods> (1) Animals used HSA as a DM1 model mouse LR Mice (donated by Dr. Charles Thornton (University of Rochester) and bred at the Osaka University Laboratory Animal Facility) were used. HSA LRThe mice were transgenic animals in which a 220-repetition CTG repeat sequence was incorporated into the genome of the hACTA gene (a human gene constitutively expressed in muscle cells) in the 3' untranslated region. The expression of mRNA with the extended CUG sequence in muscle cells resulted in the appearance of DM1 symptoms (Science, 2000, 289(5485), 1769-73). Wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used as a control. Male and female mice at 14 weeks of age were used in the experiment.

[0110] (2) PPR protein (Manufacturing of AAV vectors) A gene fused sequentially with a PPR protein and a 3× nuclear localization signal was inserted into the multi-cloning site of the pAAV-CMV vector (AAVpro® Helper Free System, Takara, 6651 component). The expression size of the constructed gene was confirmed by PCR, and the inserted sequence was confirmed by sequencing. The expression of the fusion gene is regulated by the CMV promoter and the Human growth hormone polyA signaling pathway.

[0111] (Preparation of AAV vectors) The AAV vector constructed in the previous section was manufactured by SignaGen Laboratories (hereinafter referred to as SG) under contract. Packaging was performed by cotransfection of the Rep / Cap plasmid and Helper plasmid owned by SG, along with the AAV vector sent by our company, into a packaging cell line. The cell lysates containing the packaged AAV were purified by density gradient centrifugation, and the titer was measured. The obtained AAV titer was 1.16 × 10⁶ 14 The concentration was vg / ml and the volume was 5 ml. This was used as AAV9-CUG-PPR1 in subsequent experiments. The sequence of the PPR protein (PPR1) encoded in each AAV vector is identical to the sequence of the PPR protein listed in Table 1.

[0112] (3) Grouping and administration schedule Four groups were established: a low-dose AAV9-CUG-PPR1 group (hereinafter abbreviated as Low dose: LD), a medium-dose AAV9-CUG-PPR1 group (hereinafter abbreviated as Middle dose: MD), a high-dose AAV9-CUG-PPR1 group (hereinafter abbreviated as High dose: HD), and a PBS group (hereinafter abbreviated as PBS). Each group consisted of n=5 (3 males and 2 females). The AAV dosage for the LD group was 3 × 10⁻¹⁴. 13 vg / kg, MD is 1 × 10 14 vg / kg, HD 3x10 14 The dose was adjusted to vg / kg and administered as a single intravenous dose. The PBS group received a single dose of the same volume of PBS.

[0113] (4) Measurement of RNA aggregate formation Twenty-eight days after the final dose, thigh muscles were harvested from mice and sections were prepared. After washing twice with PBS, the sections were permeabilized for 5 minutes with PBS containing 0.5% TritonX-100. Next, pre-hybridization was performed for 10 minutes with 2×SSC buffer containing 30% formamide. Subsequently, hybridization was performed at 37°C for 1 hour with 2×SSC buffer containing 30% formamide, 2 μg / mL BSA, 66 μg / mL yeast tRNA, 2 mM vanadyl complex, and 1 ng / μL Texas Red CAG probe. Post-hybridization was performed at 42°C for 30 minutes with 2×SSC buffer containing 30% formamide, followed by one wash with 1×SSC buffer and then two washes with PBS. After fixation using Vectashield with DAPI (product name, Vector Laboratories), the number of RNA aggregates in the nucleus was measured using a fluorescence microscope (Keyence PZ-9000).

[0114] (5) Determination of splicing products Twenty-eight days after the final administration, thigh muscle tissue was collected from mice. Total RNA was extracted using TRI Reagent® (MRC), and cDNA was prepared using the SuperScript III First Strand Symthesis System (Invitrogen). After RNaseH treatment of the cDNA, RT-PCR was performed using the same Atp2a1 exon 22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel, stained with GelRed, and then normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad). The proportion of normal products in the RT-PCR product was calculated. Statistical analysis was performed using t-tests.

[0115] Clcn1 exon 7a RT primer Fw:TGAAGGAATACCTCACACTCAAGG (Sequence ID 24) Rv:CACGGAACACAAAGGCACTG (Sequence ID 25)

[0116] (6) Measurement of myotonia Twenty-eight days after the final dose, electromyotonicity of the mouse thigh muscle was analyzed using needle electromyography under anesthesia. Specifically, the frequency of electromyotonicity occurring after 20 needle electrode insertions into the mouse thigh muscle was evaluated in the following four stages. Severity level 0: No electrical myotonia is observed. Severity level 1: Electrical myotonia is observed in less than 50% of cases. Severity level 2: Electromyotonic phenomenon is observed in 50% or more but less than 90% of the total. Severity level 3: Electrical myotonia is observed in over 90% of cases.

[0117] (7) Measurement of PPR mRNA expression levels in AAV-administered mouse tissues The excised thigh muscle tissue fragments were moistened with 800 μL of TRIzol Reagent. Two disruption beads (TOMY, SUB-30) were added, and the organs were disrupted using a bead-type cell disruptor, Micro Smash (TOMY SEIKO, MS-100R). 600 μL of the supernatant obtained after centrifugation at 15,000 g at 4°C for 5 minutes was collected, and 160 μL of chloroform solution was added. The mixture was inverted and mixed at room temperature for 5 minutes. Subsequently, the mixture was centrifuged at 15,000 g at 4°C for 5 minutes to separate the aqueous and organic phases. 300 μL of the aqueous phase was collected and subjected to a Maxwell RSC Instrument nucleic acid purification system to obtain purified total RNA. The concentration and purity of the RNA were determined by absorbance measurement using a NanoDrop 8000. To confirm the degree of degradation of the obtained RNA, electrophoresis was performed using LabChip GX Touch HT (PerkinElmer, CLS137031J) with 20-250 ng / μL of total RNA, and it was confirmed that degradation had not progressed based on the band intensity ratio of 28S and 18S rRNA. For cDNA synthesis, a reverse transcription reaction was performed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085) according to the product instructions for 20-100 ng / μL of obtained RNA. The amounts of PPR mRNA and GAPDH mRNA were quantified by mixing the prepared cDNA, Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882), and the primers listed below according to the manual, and then amplifying the mixture using a real-time PCR system Aria MX (Agilent).

[0118] Primers for PPR quantitative PCR Fw:GATGAGGCTTTGGAACTGTTTG (Sequence ID 26) Rv:TCTCTGGCTCTGCCGGCCTTGC (Sequence ID 27)

[0119] Primers for GAPDH quantitative PCR Fw:ATCATCCCTGCCTCTACTGG (Sequence ID 28) Rv:CTGCTTCACCACCTTCTTGA (Sequence ID 29)

[0120] <Result> The results of RNA-foci analysis are shown in Figure 9. RNA-FISH was performed on the acquired thigh muscle organ sections to verify the inhibitory effect of AAV9-CUG-PPR1 on RNA-foci formation. The results showed a dose-dependent inhibitory effect on RNA-foci formation in the AAV9-CUG-PPR1 administration group. The RNA-foci-positive cell rate was 39% in the PBS administration group, 18% in the low-dose AAV9-CUG-PPR1 group, 23% in the medium-dose AAV9-CUG-PPR1 group, and 17% in the high-dose AAV9-CUG-PPR1 group.

[0121] Figure 10 shows the results of the evaluation of splicing abnormalities. Total RNA was recovered from the collected organs, and reverse transcription PCR was performed to evaluate abnormal splicing of the Clcn1 and Atp2a1 genes. The abnormal splicing phenomenon of Clcn1 is a Cl channel known to be the direct cause of myotonic discharge. Atp2a1 is a Ca transporter also involved in myotonic discharge and is known as a sensitive marker gene. As a result of the splicing analysis, in the Clcn1 detection system, the PBS administration group showed normal splicing in 58% of cases, while the AAV9-CUG-PPR1 low-dose group showed 72%, the AAV9-CUG-PPR1 medium-dose group showed 78%, and the AAV9-CUG-PPR1 high-dose group showed 82%, confirming dose-dependent improvement in splicing. In the Atp2a1 detection system, the PBS-administered group showed 25% normal splicing, while the low-dose AAV9-CUG-PPR1 group showed 56%, the medium-dose AAV9-CUG-PPR1 group showed 60%, and the high-dose AAV9-CUG-PPR1 group showed 64%, indicating dose-dependent improvement in splicing.

[0122] The reduction and improvement effect of PPR on myotonic discharges was expressed using a four-level score based on the number of myotonic discharges. Specifically, a score of 0 meant 0 myotonic discharges out of 20, a score of 1 meant 1 to 9 out of 20, a score of 2 meant 10 to 19 out of 20, and a score of 3 meant 20 myotonic discharges out of 20. Analysis of myotonic discharges using the thigh muscle showed that the PBS administration group had a score of 3, the AAV9-CUG-PPR1 low-dose group had 1 / 5 patients with a score of 3 and 4 / 5 patients with a score of 2, the medium-dose group had 4 / 5 patients with a score of 2 and 1 / 5 patients with a score of 1, and the low-dose group showed improvement to a score of 2 and 2 / 5 patients with a score of 1 (Figure 11).

[0123] To investigate pharmacokinetics, total RNA was extracted from the thigh muscle, the target organ, and quantitative PCR of PPR mRNA was performed. RT-qPCR results confirmed dose-dependent PPR mRNA expression (Figure 12). The PPR mRNA expression levels in each group were calculated using GAPDH as the internal standard, with the lowest signal value in the AAV9-CUG-PPR1 low-dose group set to 1. The median values ​​for each group were 0.2 for the PBS group, 0.7 for the low-dose group, 1.8 for the medium-dose group, and 2.6 for the high-dose group, confirming dose-dependent PPR expression (Figure 12).

[0124] Based on these results, it was confirmed that AAV9-CUG-PPR1 has dose-dependent effects in suppressing myotonic discharge, inhibiting RNA-foci formation, and improving abnormal splicing.

[0125] [Example 7: Time-dependent changes in drug efficacy in DM1 model mice] To evaluate the time-axis changes in drug efficacy using DM1 model mice, AAV9 carrying the CUG-PPR gene was administered as a single dose via the tail vein to DM1 model mice. At each time point, the effects on myotonic symptoms in the thigh muscle, the effects on splicing abnormalities of the Atp2a1 gene and skeletal muscle chloride channel (Clcn1) gene, and the number of RNA aggregates formed were examined.

[0126] <Experimental materials and methods> (1) Use of animals As the DM1 model mouse, HSA LR mice (transferred from Dr. Charles Thornton (University of Rochester) and bred in the experimental animal facility of Osaka University) were used. HSA LR The mice were transgenic animals in which a CTG repeat sequence was extended 220 times in the 3'-untranslated region of the hACTA gene (a human gene that is constantly expressed in muscle cells) and integrated into the genome. By expressing mRNA with an extended CUG sequence in muscle cells, the symptoms of DM1 appeared (Science, 2000, 289(5485), 1769-73). As a control, wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used. Male and female mice at 12 weeks of age were used in the experiment.

[0127] [[ID=!0]](2) PPR protein (Production of AAV vector) A gene in which a PPR protein and a 3× nuclear localization signal were successively fused was inserted into the multiple cloning site of the pAAV-CMV vector (AAVpro (trademark) Helper Free System, Takara, product No. 6651). The expression size of the constructed gene by PCR and the inserted sequence were confirmed by sequencing. The expression of the fusion gene is controlled by the CMV promoter and the Human growth hormone polyA signal.

[0128] (Preparation of AAV vector) The AAV vector constructed in the previous section was commissioned to SignaGen Laboratories (hereinafter abbreviated as SG). Packaging was carried out by co-transfecting the Rep / Cap plasmid and Helper plasmid owned by SG, and the AAV vector sent from our company into the packaging cell line. The cell lysate containing the packaged AAV was purified by density gradient centrifugation and the titer was measured. The obtained AAV was 1.16×10 14The concentration was vg / ml and the volume was 5 ml. This was used as AAV9-CUG-PPR1 in subsequent experiments. The sequence of the PPR protein (PPR1) encoded in each AAV vector is identical to the sequence of the PPR protein listed in Table 1.

[0129] (3) Grouping and administration schedule Four groups were established at 14 days (2 weeks), 28 days (4 weeks), 56 days (8 weeks), and 112 days (16 weeks) after administration of AAV9-CUG-PPR1. Each group consisted of n=5 mice (2 males, 3 females). The AAV dose was 3 × 10⁻⁶. 14 The dose was adjusted to vg / kg and administered as a single intravenous injection.

[0130] (4) Measurement of RNA aggregate formation Thigh muscle tissue was harvested from mice 14, 28, 56, or 112 days after the final dose and sections were prepared. After washing twice with PBS, the sections were permeabilized for 5 minutes with PBS containing 0.5% TritonX-100. Next, pre-hybridization was performed for 10 minutes with 2×SSC buffer containing 30% formamide. Subsequently, hybridization was performed at 37°C for 1 hour with 2×SSC buffer containing 30% formamide, 2 μg / mL BSA, 66 μg / mL yeast tRNA, 2 mM vanadyl complex, and 1 ng / μL Texas Red CAG probe. After post-hybridization at 42°C for 30 minutes with 2×SSC buffer containing 30% formamide, the sections were washed once with 1×SSC buffer and then twice with PBS. After fixation using Vectashield with DAPI (product name, Vector Laboratories), the number of RNA aggregates in the nucleus was measured using a fluorescence microscope (Keyence PZ-9000).

[0131] (5) Determination of splicing products Thigh muscle was collected from mice 14, 28, 56, or 112 days after the final administration. Total RNA was extracted using TRI Reagent® (MRC), and cDNA was prepared using the SuperScript III First Strand Symthesis System (Invitrogen). After RNaseH treatment of the cDNA, RT-PCR was performed using the same Atp2a1 exon 22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel, stained with GelRed, and then normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad), and the proportion of normal products in the RT-PCR product was calculated. Statistical analysis was performed using t-tests.

[0132] Clcn1 exon 7a RT primer Fw:TGAAGGAATACCTCACACTCAAGG (Sequence ID 24) Rv:CACGGAACACAAAGGCACTG (Sequence ID 25)

[0133] (6) Measurement of myotonia Immediately before necropsy, the electromyotonic phenomenon of mouse thigh muscles was analyzed using needle electromyography under anesthesia. Specifically, the frequency of electromyotonic phenomenon occurring after 20 needle electrodes were inserted into the mouse thigh muscles was evaluated in the following four stages. Severity level 0: No electrical myotonia is observed. Severity level 1: Electrical myotonia is observed in less than 50% of cases. Severity level 2: Electromyotonic phenomenon is observed in 50% or more but less than 90% of the total. Severity level 3: Electrical myotonia is observed in over 90% of cases.

[0134] <Result> The results of RNA-foci analysis are shown in Figure 13. RNA-FISH was performed on the acquired thigh muscle organ sections to verify the inhibitory effect of AAV9-CUG-PPR1 on RNA-foci formation. The results showed a dose-dependent inhibitory effect on RNA-foci formation in the AAV9-CUG-PPR1 administration group. The values ​​from the PBS administration group used in the dose-dependent study of Example 6 were used as the control. The percentage of RNA-foci-positive cells in the control group was 39%, in the group 14 days after AAV9-CUG-PPR1 administration it was 36%, in the group 28 days after administration it was 23%, in the group 56 days after administration it was 19%, and in the group 112 days after administration it was 18% (Figure 13).

[0135] Figure 14 shows the results of the evaluation of splicing abnormalities. Total RNA was recovered from the collected organs, and reverse transcription PCR was performed to evaluate abnormal splicing of the Clcn1 and Atp2a1 genes. The abnormal splicing phenomenon of Clcn1 is a Cl channel known to be the direct cause of myotonic discharge. Atp2a1 is a Ca transporter also involved in myotonic discharge and is known as a sensitive marker gene. As a result of the splicing analysis, in the Clcn1 detection system, the PBS administration group shown in Example 6 showed 58% normal splicing, while the experimental group 14 days after AAV9-CUG-PPR1 administration showed 62%, 28 days after AAV9-CUG-PPR1 administration showed 76%, 56 days after AAV9-CUG-PPR1 administration showed 79%, and 112 days after AAV9-CUG-PPR1 administration showed an 80% improvement in splicing. In the Atp2a1 detection system, the PBS-administered group shown in Example 6 showed 25% normal splicing, while the experimental group 14 days after AAV9-CUG-PPR1 administration showed 30%, 63% at 28 days after AAV9-CUG-PPR1 administration, 76% at 56 days after AAV9-CUG-PPR1 administration, and a 75% improvement in splicing was confirmed at 112 days after AAV9-CUG-PPR1 administration (Figure 14).

[0136] The reduction and improvement effect of PPR on myotonic discharges was expressed using a four-level score based on the number of myotonic discharges. Specifically, a score of 0 means 0 myotonic discharges out of 20, a score of 1 means 1 to 9 out of 20, a score of 2 means 10 to 19 out of 20, and a score of 3 means 20 myotonic discharges out of 20. As a result of myotonic discharge analysis using the thigh muscle, the PBS administration group shown in Example 6 showed a score of 3, in the experimental group 14 days after AAV9-CUG-PPR1 administration 4 / 5 cases showed a score of 3 and 1 / 5 cases showed a score of 2, in the experimental group 28 days after AAV9-CUG-PPR1 administration 56 days after AAV9-CUG-PPR1 administration 3 / 5 cases showed a score of 2 and 2 / 5 cases showed a score of 1, and in the experimental group 112 days after administration 3 / 5 cases showed a score of 2 and 2 / 5 cases showed a score of 1 (Figure 15).

[0137] To investigate pharmacokinetics, total RNA was extracted from the thigh muscle, the target organ, and quantitative PCR of PPR mRNA was performed. RT-qPCR results confirmed sustained PPR expression even 112 days after administration (data not shown).

[0138] Based on these results, it was confirmed that the efficacy of AAV9-CUG-PPR1-treated mice improved up to 14, 28, and 56 days after administration, and that the efficacy persisted even on day 112 after administration.

[0139] [Example 8: Comprehensive improvement of DM1-related splicing abnormalities by administration of AAV9-CUG-PPR1] <Experimental materials and methods> (1) Analyzed organs HSALR mice (14 weeks old) were given AAV9-CUG-PPR1 in 3 × 10⁶ doses. 14 A single intravein dose of vg / kg of PBS was administered, and thigh muscle tissue samples excised 8 weeks after administration (Day 56) were designated as the PPR treatment group. Thigh muscle samples excised after a single dose of the same volume of PBS were designated as the untreated group. Thigh muscle tissue samples from wild-type FVB / NJcl mice with matched genetic backgrounds were used as the wild-type group.

[0140] (2) Analysis of abnormal splicing events Total RNA was extracted from the thigh muscle of the PPR-treated group, the PPR-untreated group, and the wild-type group according to the total RNA extraction method described in Example 6. The required amount was sent to GENEZWIZ for RNA sequencing (Illumina Hiseq 2×150bp sequencing). Ribosomal RNA was removed from the submitted RNA using the Poly A selection method. The RNA was reverse transcribed to synthesize cDNA and prepare a library with adapters. Sequencing was performed, and adapter trimming was performed on the obtained read information using Trimmomatic (v0.33)59. Alignment of the trimmed read sequences was performed using STAR (v2.7.9a) with GRCm39 (obtained from Ensemble) as the reference genome. Splicing events were identified using rMATS (v3.2.5) based on the STAR-aligned file (.bam). To identify fluctuating splicing events, a comparison was made between the wild-type group and the PPR-untreated group (HSALR mice administered with PBS). The presence or absence of fluctuation was determined using "p-adjusted-value" and "InclLevelDifference" as indicators, and only candidates defined as fluctuating were extracted. For fluctuating splicing events, a cutoff threshold of FDR (False Discovery Rate)-adjusted P value < 0.05 was used for intergroup comparisons. Percent spliced-in index (PSI) was defined as the ratio of spliced-in transcripts to the total number of reads of the target gene. Gene ontology analysis was performed using Metascape (https: / / metascape.org / gp / index.html# / main / step1).

[0141] <Result> Total RNA was extracted from thigh muscles excised from wild-type mice (14 weeks old) as described in the previous section (hereinafter referred to as the wild-type group), thigh muscles excised 8 weeks after administration of PBS to HSALR mice (hereinafter referred to as the untreated PPR group), and thigh muscles excised 8 weeks after administration of AAV9-CUG-PPR1 (Day 56) (hereinafter referred to as the PPR-treated group). Comprehensive analysis of expressed RNA was performed using next-generation sequencing technology.

[0142] After mapping the obtained read sequences, the number of reads for adjacent exon sequences was compared, and the PSI (percent spliced ​​in index) was calculated to determine the inclusion level of each exon of each gene. Splicing events with a difference of 0.2 or more between the wild-type and PBS-treated groups were identified as abnormal splicing events in HSALR mice (n=455, Figure 16a left). A comparison of the PSI of the same splicing events 8 weeks after AAV9-CUG-PPR1 administration with the PSI in the wild-type (WT) group (Figure 16a right) revealed that the PSI had recovered overall.

[0143] Improvements were also observed in splicing events in HSA-LR other than Atp2a1 and Clcn1, as reported in the following literature (Figure 16b). Reference: Matthew K Tanner et al. Nucleic Acids Research, Volume 49, Issue 4(2021)

[0144] Gene ontology analysis of the gene groups exhibiting abnormal splicing revealed that they were terms related to muscle function and muscle differentiation. Analysis of the number of genes showing improvement in each gene ontology showed that approximately 40% of genes showed strong improvement (greater than 50%), and including those showing improvement (greater than 20%), the total was found to be 90% (Figure 16c).

[0145] From these findings, it was found that various splicing abnormalities were improved by administration of AAV9-CUG-PPR1.

[0146] [Example 9: Analysis of the expression level of PPR mRNA in each organ of normal mice to which AAV9-CUG-PPR1 was applied]

[0147] [Experimental materials and methods] (1) Organs for analysis Four organ pieces (heart, quadriceps muscle, gastrocnemius muscle, tibialis anterior muscle) excised from normal mice administered with AAV9-CUG-PPR1 (dose: 1×10 13 vg / kg, 3×10 13 vg / kg, or 3×10 14 vg / kg) by intravenous injection were used.

[0148] (2) Administration schedule and autopsy timing Eight-week-old female normal mice were used. The dose was set at 1×10 13 vg / kg, 3×10 13 vg / kg, or 3×10 14 vg / kg and administered by intravenous injection into the tail vein, and the volume was set at 10 μL / g. The observation period was 28 days after administration. The heart, quadriceps muscle, gastrocnemius muscle, and tibialis anterior muscle were excised from each individual mouse for analysis of PPR mRNA. ​​​​Total RNA was extracted from excised organ fragments, cDNA was synthesized, and quantitative PCR was performed. First, 50 mg (±5 mg) of the organ fragment obtained in the previous step was moistened with 800 μL of TRIzol Reagent. Two disruption beads (TOMY, SUB-30) were added, and the organ was disrupted using a bead-type cell disruptor, Micro Smash (TOMY SEIKO, MS-100R), and centrifuged at 4°C and 15,000 g for 5 minutes. 600 μL of the supernatant was collected, 160 μL of chloroform solution was added, and the mixture was inverted and mixed at room temperature for 5 minutes. Then, it was centrifuged at 4°C and 15,000 g for 5 minutes to separate the aqueous phase and the organic phase. 300 μL of the aqueous phase was collected and subjected to a nucleic acid purification device, Maxwell RSC Instrument, to obtain purified total RNA. The concentration and purity of RNA were measured by absorbance using NanoDrop 8000. To confirm the degree of degradation of the obtained RNA, electrophoresis was performed using a LabChip GX Touch HT (PerkinElmer, CLS137031J) with total RNA at concentrations of 20-250 ng / μL, and it was confirmed that degradation had not progressed based on the band intensity ratio of 28S and 18S rRNA.

[0150] cDNA synthesis was performed by reverse transcription of 20-100 ng / μL of obtained RNA according to the product instructions for SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085).

[0151] Quantitative PCR was performed using the Aria MX real-time PCR system (Agilent) in accordance with the general manual for Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882).

[0152] Primers for PPR quantitative PCR Fw:GATGAGGCTTTGGAACTGTTTG (Sequence ID 26) Rv:TCTCTGGCTCTGCCGGCCTTGC (Sequence ID 27)

[0153] Primers for GAPDH quantitative PCR Fw:ATCATCCCTGCCTCTACTGG (Sequence ID 28) Rv:CTGCTTCACCACCTTCTTGA (Sequence ID 29)

[0154] <Result> The results of quantitative PCR are shown in Figure 17. Quantitative PCR revealed a dose-dependent increase in PPR expression in each tissue, with a maximum dose of 3 × 10⁶. 14 The highest expression level was observed in the vg / kg dose group.

[0155] The above results demonstrate that AAV9-CUG-PPR1 can be delivered and expressed throughout the body, suggesting its effectiveness against DM1, a multi-organ disease affecting skeletal muscle, smooth muscle, and the heart.

[0156] [Example 10: Analysis of PPR mRNA expression persistence in various organs of normal mice treated with AAV9-CUG-PPR1]

[0157] <Experimental materials and methods> (1) Analyzed organs AAV9-CUG-PPR1 (Dosage: 1 x 10) 14 Four organ samples (heart, thigh muscle, calf muscle, and tibialis anterior muscle) were extracted from normal mice administered intravenously with IV-Vg / kg.

[0158] (2) Administration schedule and timing of autopsy Normal male mice aged 8 weeks were used. The dose was 1 × 10⁻⁶. 14 The drug was administered intravenously at a dose of vg / kg, with a set volume of 10 μL / g. Observation periods were observed on days 14, 28, 56, 112, and 182 after administration. The heart, thigh muscles, gastrocnemius muscle, and tibialis anterior muscle were excised from each mouse and analyzed for PPR mRNA.

[0159] (3) Measurement of PPR mRNA expression levels in AAV-administered mouse tissues Total-RNA was extracted from the excised organ pieces, cDNA was synthesized, and quantitative PCR was performed. First, 50 mg (±5 mg) of the organ pieces obtained in the previous section were moistened with 800 μL of TRIzol Reagent, 2 pieces of disruption beads (TOMY, SUB-30) were added, and the organ was disrupted using a bead-type cell disruption device, Micro Smash (Tomy Seiko, MS-100R). The supernatant obtained by centrifugation at 15,000 g for 5 minutes at 4°C was collected in 600 μL, 160 μL of chloroform solution was added, and the mixture was inverted and mixed at room temperature for 5 minutes. Then, it was centrifuged at 15,000 g for 5 minutes at 4°C to separate the aqueous phase and the organic phase. 300 μL of the aqueous phase was collected and subjected to a nucleic acid purification device, Maxwell RSC Instrument, to obtain a purified product of Total-RNA. The concentration and purity of the RNA were measured by absorbance using a NanoDrop 8000. To confirm the degradation degree of the obtained RNA, electrophoresis was performed using a LabChip GX Touch HT (PerkinElmer, CLS137031J) with 20 - 250 ng / μL of total-RNA, and it was confirmed that degradation had not progressed from the band intensity ratio of the 28S and 18S rRNAs. cDNA synthesis was performed by reverse transcription reaction according to the product procedure manual of SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085) using 20 - 100 ng / μL of the obtained RNA. Quantitative PCR was performed using a real-time PCR system, Aria MX (Agilent), according to the general manual of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882).

[0160] Primers for PPR quantitative PCR Fw: GATGAGGCTTTGGAACTGTTTG (SEQ ID NO: 26) Rv: TCTCTGGCTCTGCCGGCCTTGC (SEQ ID NO: 27)

[0161] Primers for GAPDH quantitative PCR Fw: ATCATCCCTGCCTCTACTGG (SEQ ID NO: 28) Rv: CTGCTTCACCACCTTCTTGA (SEQ ID NO: 29)

[0162] <Result> The results of quantitative PCR are shown in Fig. 18. As a result of quantitative PCR, sustained expression was confirmed even on the 183rd day after administration, and a time-dependent increase in expression was also confirmed. In previous papers, it has been shown that when AAV9 is administered via the tail vein, expression can be sustained over a long period (more than 6 months), and the results of this experiment are also consistent with this finding.

[0163] From the above, it was suggested that the present invention can achieve a desired effect over a long period with a small number of administrations to a subject.

Claims

1. A pharmaceutical composition for the treatment of a disease caused by abnormal elongation of a CTG repeat sequence in the 3' untranslated region (3'UTR) of the myotonin protein kinase (DMPK) gene, The pharmaceutical composition comprises a nucleic acid encoding a protein that specifically binds to a CUG repeat sequence. The protein that specifically binds to the CUG repeat sequence contains at least six pentatricopeptide repeat (PPR) motifs, each consisting of a polypeptide with a length of 30 to 38 amino acids represented by formula 1. 【Chemistry 1】 (In formula 1: Helix A is a 12-amino acid length portion capable of forming an α-helix structure, represented by formula 2. 【Chemistry 2】 In formula 2, A 1 ~A 12 Each of these independently represents an amino acid; X is either absent or a portion consisting of 1 to 9 amino acids in length; Helix B is a portion consisting of 11 to 13 amino acids that can form an α-helix structure; L is the portion represented by formula 3, which is 2 to 7 amino acids long; 【Transformation 3】 In Equation 3, each amino acid is numbered from the C-terminus as "i" (-1), "ii" (-2), and so on. However, L iii ~L vii (It may not exist.) A in each of the above PPR motifs 1 A 4 and L ii a combination of three amino acids, or A 4 L ii a combination of two amino acids is selected such that each of the above PPR motifs binds to C, U or G, whereby the protein is configured to specifically bind to the CUG repeat sequence The combination of the three amino acids A1, A4, and Lii in each of the aforementioned PPR motifs is: When the target base of the PPR motif is G (guanine), the combination of the three amino acids A1, A4, and Lii is (glutamic acid, glycine, aspartic acid), (valine, threonine, aspartic acid), (lysine, threonine, aspartic acid), or (leucine, threonine, aspartic acid), in the order of (A1, A4, Lii); When the target base of the PPR motif is U (uracil), the combination of the three amino acids A1, A4, and Lii is (valine, asparagine, aspartic acid), (isoleucine, asparagine, asparagine), (isoleucine, asparagine, aspartic acid), (isoleucine, methionine, aspartic acid), (phenylalanine, proline, aspartic acid), or (tyrosine, proline, aspartic acid); or, When the target base of the PPR motif is C (cytosine), the combination of the three amino acids A1, A4, and Lii is (valine, asparagine, asparagine), (isoleucine, asparagine, asparagine), (valine, asparagine, serine), or (isoleucine, methionine, aspartic acid), in the order of (A1, A4, Lii). and / or, The combination of the two amino acids A4 and Lii in each of the aforementioned PPR motifs is: When the target base of the PPR motif is G (guanine), the combination of the two amino acids A4 and Liiii is (threonine, aspartic acid) or (glycine, aspartic acid), in the order (A4, Liiii); When the target base of the PPR motif is U (uracil), the combination of the two amino acids A4 and Lii is (asparagine, aspartic acid), (proline, aspartic acid), (methionine, aspartic acid), or (valine, threonine), in the order (A4, Lii); When the target base of the PPR motif is C (cytosine), the combination of the two amino acids A4 and Lii is (asparagine, asparagine), (asparagine, serine), or (leucine, aspartic acid), in that order. Pharmaceutical composition.

2. The pharmaceutical composition according to Claim 1, Used to inhibit the formation of nuclear RNA aggregates caused by abnormal elongation of the CTG repeat sequence in the 3' UTR of the DMPK gene, It is used to improve splicing abnormalities caused by abnormal elongation of the CTG repeat sequence in the 3'UTR of the DMPK gene, or Used to improve myotonia symptoms caused by abnormal elongation of the CTG repeat sequence in the 3'UTR of the DMPK gene, Pharmaceutical composition.

3. The pharmaceutical composition according to claim 1, wherein the protein that specifically binds to the CUG repeat sequence contains 9 to 30 of the PPR motifs. Pharmaceutical composition.

4. The pharmaceutical composition according to claim 3, wherein the protein that specifically binds to the CUG repeat sequence comprises 12 to 24 PPR motifs. Pharmaceutical composition.

5. A pharmaceutical composition according to claim 1, The expression vector is characterized in that it incorporates a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence. Pharmaceutical composition.

6. A pharmaceutical composition according to claim 1, The viral vector is characterized in that it contains nucleic acids encoding a protein that specifically binds to the CUG repeat sequence. Pharmaceutical composition.

7. A pharmaceutical composition according to claim 6, The viral vector is characterized by being a viral vector that has a directivity to muscle tissue. Pharmaceutical composition.

8. A pharmaceutical composition according to claim 7, The viral vector is characterized by being an adeno-associated virus (AAV) vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, or a herpes simplex virus vector. Pharmaceutical composition.

9. A pharmaceutical composition according to claim 8, The viral vector is characterized in that it is an AAV vector. Pharmaceutical composition.

10. A pharmaceutical composition according to claim 9, The AAV vector is characterized in that it is an AAV1 vector, an AAV2 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or an AAV12 vector. Pharmaceutical composition.

11. Use of a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence as defined in Claim 1, in the manufacture of a pharmaceutical for the treatment of a disease caused by abnormal elongation of a CTG repeat sequence in the 3' untranslated region (3'UTR) of the myotonin protein kinase (DMPK) gene.

Citation Information

Patent Citations

  • Peptide-linked morpholino antisense oligonucleotides for treatment of myotonic dystrophy

    JP2020196751A

  • Design method for RNA-binding protein using PPR motif, and use thereof

    WO2013058404A1

  • DNA-binding protein using PPR motif and use of said DNA-binding protein

    WO2018030488A1

  • Method for editing target RNA

    WO2021201198A1

  • CUG repeat sequence binding agent

    WO2021235293A1