A method for classifying colorectal cancer patients into HMCC group or LMCC group.

The method addresses the limitation of existing methods by using methylation at specific CpG sites in chromosomes 2-19 regions to predict colorectal cancer drug sensitivity, enhancing drug response prediction accuracy.

JP7856963B2Active Publication Date: 2026-05-12TOHOKU UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
TOHOKU UNIV
Filing Date
2024-10-17
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for predicting the responsiveness of colorectal cancer patients to drug therapy are limited by the lack of utilization of previously unknown methylation sites as indicators.

Method used

A novel method using methylation at specific CpG sites in regions of chromosomes 2, 3, 4, 5, 6, 7, 10, 11, 14, 17, and 19 as indicators for testing the sensitivity of colorectal cancer to drug therapy, utilizing DNA collected from patients through methods like bisulfite treatment and real-time PCR.

Benefits of technology

Enables accurate prediction of drug therapy sensitivity by detecting methylation patterns in these regions, improving the effectiveness of drug response prediction for colorectal cancer patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007856963000007
    Figure 0007856963000007
  • Figure 0007856963000008
    Figure 0007856963000008
  • Figure 0007856963000009
    Figure 0007856963000009
Patent Text Reader

Abstract

To provide a new method for testing for sensitivity of chemotherapy against colorectal cancer using, as an indicator, a methylation site that has not been conventionally known to be an indicator of responsiveness to chemotherapy of colorectal cancer.SOLUTION: The present invention provides a method for testing for sensitivity of chemotherapy against colorectal cancer, the method using, as an indicator, methylation in at least one site selected from a group consisting of CpG sites comprised in regions (i) to (xvi) in DNA collected from a colorectal cancer patient (the regions (i) to (xvi) are as described herein).SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] [Cross - reference to Related Applications] This application claims priority based on Japanese Patent Application No. 2019 - 103299 filed on May 31, 2019 (the entire disclosure of which is incorporated herein by reference). The present invention relates to a method for examining the sensitivity of drug therapy for colorectal cancer.

Background Art

[0002] Colorectal cancer is a general term for cancerous tumors that occur in the large intestine (colon, rectum, anus). Colorectal cancer has a large number of cases and deaths among cancers, and research on its treatment methods has been continuously carried out. Also, as one of the attempts in cancer treatment research, "personalized medicine" is being considered in order to maximize the treatment effect and minimize side effects.

[0003] For example, in Patent Document 1, 24 genes represented by the following Target IDs, cg01791410, cg01802453, cg02484469, cg02916312, cg03839709, cg05218346, cg07005523, cg01068327, cg07258916, cg01360792, cg09767602, cg11092616, cg12646649, cg13261931, cg16041660, cg16958716, cg11188046, cg18412834, cg20012008, cg20265733, cg20339230, cg21787291, cg24792289, cg27628784 are used as marker genes, and based on whether the bases at specific positions of these marker genes are methylated or not, a method for predicting the responsiveness of colorectal cancer patients to anti - EGFR antibody - based cancer drug therapy is described (Cited Document 1, Example 8, etc.).

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

[0005] The present invention aims to provide a novel method for testing the sensitivity of colorectal cancer to drug therapy, using methylation sites, which were not previously known to be indicators of responsiveness to drug therapy for colorectal cancer, as an indicator. [Means for solving the problem]

[0006] Under these circumstances, the inventors conducted diligent research and found that sensitivity to drug therapy for colorectal cancer can be efficiently tested by using methylation at at least one site selected from the group consisting of CpG sites included in regions (i) to (xvi) described later as an indicator. The present invention is based on this novel finding.

[0007] Accordingly, the present invention provides the following: Item 1. A method for testing the sensitivity of drug therapy to colorectal cancer, using methylation at at least one site selected from a group consisting of CpG sites in the following regions (i) to (xvi) in DNA collected from colorectal cancer patients as an indicator. Region (i) Region 4 of chromosome 2, from 207307150 to 20730900 Region (ii) Regions 241758282 to 241760510 of chromosome 2 Region (iii) Regions 150802997 to 150805168 of chromosome 3 Region (iv) Regions 141347993 to 141348489 of chromosome 4 Region (v) Chromosome 4, regions 186048714-186050048 Region (vi) Regions 17216679-17219240 of chromosome 5 Region (vii): Regions 37663982 to 37664539 of chromosome 6. Region (viii) Regions 39281183 to 39282332 of chromosome 6 Region (ix) Region 42273390~42277951 of chromosome 7 Region (x) Chromosome 10, regions 13039715~13043422 Region (xi): Regions 81664401-81665076 of chromosome 10. Region (xii) Regions 88126287-88127189 of chromosome 10 Region (xiii) Regions 61595807 to 61596627 of chromosome 11 Region (xiv) Chromosome 14, regions 23820337 to 23822266 Region (xv) Chromosome 17, regions 44895317~44896749 Region (xvi) is the region of chromosome 19, from position 39520228 to 39523159.

[0008] Item 2. Chromosome 2, positions 207307150, 207307490, 207307544, 207307622, ​​207307732, 207308004, 207308087, 207308244, 207308375, 207308829, 207309003, 241758282, 241758399, 241758805, 241758901, 241759279, 241759414, 241760025, 241760164, 241760190, 241760509, Chromosome 3, positions 150802997, 150803295, 150803307, 150803666, 150803669, 150804058, 150804063, 150804313, 150804490, 150804696, 150804719, 150805167, Chromosome 4, positions 141347993, 141348043, 141348167, 141348307, 141348488, 186048714, 186048907, 186049687, 186049926, 186050047, Chromosome 5, positions 17216679, 17216922, 17217093, 17217877, 17218089, 17218278, 17218308, 17218547, 17218778, 17219020, 17219128, 17219226, 17219239, Chromosome 6, positions 37663982, 37664451, 37664538, 39281183, 39281421, 39281450, 39281541, 39281694, 39281885, 39282164, 39282316, 39282331, Chromosome 7, positions 42273390, 42275601, 42275813, 42275870, 42275872, 42276004, 42276814, 42276816, 42276819, 42276848, 42276881, 42276890, 42276941, 42276981, 42277044, 42277066, 42277071, 42277347, 42277375, 42277394, 42277410, 42277807, 42277950, Chromosome 10, numbers 13039715, 13041989, 13043313, 13043421, 81664401, 81664567, 81664583, 81664698, 81664955, 81665075, 88126287, 88126291, 88126299, 88126306, 88126853, 88127188, Chromosome 11, positions 61595807, 61595956, 61596068, 61596307, 61596333, 61596405, 61596626, Chromosome 14, positions 23820337, 23821149, 23821229, 23821435, 23821445, 23821570, 23821596, 23821902, 23822017, 23822265, Chromosome 17, positions 44895317, 44896017, 44896080, 44896147, 44896162, 44896166, 44896168, 44896212, 44896223, 44896424, 44896748, The method according to item 1, wherein methylation at at least one site selected from the group consisting of bases 39520228, 39521931, 39522418, 39522548, 39522747, 39522944, 39523083, and 39523158 of chromosome 19 is detected, and the detection result is used as an indicator of sensitivity to drug therapy for colorectal cancer.

[0009] Item 3. The method according to Item 1 or 2, using methylation at at least one site selected from the group consisting of CpG sites in the following regions (i') to (iv'), regions (viii') to (x'), and regions (xii') to (xvi') as an indicator: Region (i'): Regions 207307490 to 207308376 of chromosome 2. Region (ii') Chromosome 2, region 241758805~241760510 Region (iii'): Region 150802997~150804720 of chromosome 3 Region (iv'): Regions 141348167 to 141348308 of chromosome 4. Region (viii'): Regions 39281541 to 39282165 of chromosome 6. Region (ix'): Regions 42275870 to 42276817 of chromosome 7. Region (x') Chromosome 10, regions 13041989~13043422 Region (xii'): Regions 88126287 to 88126307 of chromosome 10. Region (xiii'): Regions 61595807 to 61596334 of chromosome 11. Region (xiv'): Regions 23821596 to 23822266 of chromosome 14. Region (xv'): Regions 44895317 to 44896425 of chromosome 17. Region (xvi') is the region of chromosome 19, from position 39520228 to 39523084.

[0010] Item 4. Chromosome 2, positions 207308141, 207308149, 207308153, 207308172, 207308177, 207308181, 207308185, 207308244, 207308247, 207308267, and 2417588 85th, 241758889th, 241758896th, 241758901st, 241758919th, 241758922nd, 241758931st, 241758936th, 241758940th, 241759003rd, 241759005th, 241759009th, Chromosome 3, positions 150804417, 150804420, 150804474, 150804479, 150804486, 150804490, 150804496, 150804504, 150804507, Chromosome 4, positions 141348224, 141348232, 141348272, 141348282, 141348289, 141348307, 141348318, 141348324, 186049623, 186049636, 186049659, 186049670, 186049685, 186049687, 186049689, 186049705, Chromosome 5, positions 17216904, 17216916, 17216922, 17216940, 17216949, 17216952, 17217003, 17217011, 17217017, Positions 37664352, 37664366, 37664419, 37664424, 37664451, 37664460, 39281692, 39281694, 39281723, 39281729, 39281735, 39281738, 39281797, 39281806, 39281808, 39281813 on chromosome 6 Positions 42276764, 42276767, 42276769, 42276783, 42276810, 42276814, 42276816, 42276819, 42276825, 42276852, 42276862, 42276874 on chromosome 7 Positions 13043231, 13043247, 13043285, 13043288, 13043313, 13043321, 13043333, 81664567, 81664573, 81664583, 81664598, 81664600, 81664606, 81664614, 81664636, 81664656, 88126243, 88126250, 88126259, 88126285, 88126287, 88126291, 88126299, 88126306, 88126310 on chromosome 10 Positions 61595796, 61595807, 61595815, 61595818, 61595820, 61595829, 61595843, 61595852 on chromosome 11 Positions 23822015, 23822017, 23822043, 23822054, 23822073, 23822075, 23822079 on chromosome 14 Positions 44896314, 44896316, 44896324, 44896386, 44896390, 44896401, 44896424, 44896443, 44896450 on chromosome 17 The method according to item 1, wherein at least one methylation selected from the group consisting of the bases at positions 39522493, 39522510, 39522533, 39522537, 39522548, 39522550, 39522552, 39522582, 39522587, 39522591, and 39522608 of chromosome 19 is detected, and the detection result is used as an index for the sensitivity of drug therapy for colorectal cancer.

[0011] The method according to any one of items 1 to 4 of item 5, Region from position 207308134 to position 207308268 of chromosome 2 Region from position 241758885 to position 241759011 of chromosome 2 Region from position 150804402 to position 150804508 of chromosome 3 Region from position 141348215 to position 141348329 of chromosome 4 Region from position 186049616 to position 186049706 of chromosome 4 Region from position 17216901 to position 17217025 of chromosome 5 Region from position 37664344 to position 37664472 of chromosome 6 Region from position 39281671 to position 39281814 of chromosome 6 Region from position 42276764 to position 42276875 of chromosome 7 Region from position 13043227 to position 13043334 of chromosome 10 Region from position 81664566 to position 81664662 of chromosome 10 Region from position 88126243 to position 88126334 of chromosome 10 Region from position 61595787 to position 61595864 of chromosome 11 Region from position 23821996 to position 23822092 of chromosome 14 Region from position 44896309 to position 44896451 of chromosome 17 Region from position 39522493 to position 39�22609 of chromosome 19 A method that uses methylation at at least one site selected from the group consisting of CpG sites contained in as an indicator.

[0012] Item 6. The method according to any one of items 1 to 5, wherein the CpG site is located in a region in the DNA obtained by bisulfite treatment of DNA containing the methylated CpG site, in which at least one oligonucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 48 hybridizes.

[0013] Article 7. A method described in any one of Articles 1 to 6, (1) A step of detecting multiple CpG sites in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites. (2) For each region measured in step (1) above, if the frequency of methylation is equal to or greater than a predetermined value, the step of determining that region is a highly methylated region. (3) If, among the regions measured in step (1) above, a predetermined percentage or more of the region is determined to be a hypermethylated region in step (2), the region is determined to be insensitive to drug therapy for colorectal cancer. Methods that include...

[0014] Article 8. A method described in any one of Articles 1 to 6, (1) A step of detecting multiple CpG sites in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites. (2) For each region measured in step (1) above, if the frequency of methylation is equal to or greater than a predetermined value, the step of determining that region is a highly methylated region. (3) If, among the regions measured in step (1) above, a region with a pre-set percentage or less is determined to be a hypermethylated region in step (2), then the region is determined to be sensitive to drug therapy for colorectal cancer. Methods that include...

[0015] Item 9. The method according to item 7 or 8, wherein the frequency of methylation in each region in step (1) is measured by real-time PCR, and the region is defined as a highly methylated region if the ΔCt value, which is the difference between the Ct value measured by real-time PCR and the Ct value of the control reaction, is less than a predetermined value.

[0016] Item 10. The method according to any one of items 7 to 9, wherein the frequency of methylation is measured for at least 8 regions from regions (i) to (xvi) in step (1).

[0017] Item 11. The method according to any one of items 1 to 10, wherein the DNA collected from the colorectal cancer patient is prepared from colorectal tissue, blood, serum, plasma, feces, bowel cleansing solution, or enema cleansing solution collected from the colorectal cancer patient.

[0018] Item 12. The method according to any one of items 1 to 11, wherein the drug therapy for colorectal cancer is performed using an anti-EGFR antibody.

[0019] Item 13. The method according to item 12, wherein the anti-EGFR antibody is at least one selected from the group consisting of cetuximab and panitumumab.

[0020] Item 14. A kit for obtaining information that may serve as an indicator of sensitivity to drug therapy for colorectal cancer, comprising a primer set for analyzing methylation at at least one site selected from a group consisting of CpG sites in the following regions (i) to (xvi) in DNA collected from colorectal cancer patients. Region (i) Region 4 of chromosome 2, from 207307150 to 20730900 Region (ii) Regions 241758282 to 241760510 of chromosome 2 Region (iii) Regions 150802997 to 150805168 of chromosome 3 Region (iv) Regions 141347993 to 141348489 of chromosome 4 Region (v) Chromosome 4, regions 186048714-186050048 Region (vi) Regions 17216679-17219240 of chromosome 5 Region (vii): Regions 37663982 to 37664539 of chromosome 6. Region (viii) Regions 39281183 to 39282332 of chromosome 6 Region (ix) Region 42273390~42277951 of chromosome 7 Region (x) Chromosome 10, regions 13039715~13043422 Region (xi): Regions 81664401-81665076 of chromosome 10. Region (xii) Regions 88126287-88127189 of chromosome 10 Region (xiii) Regions 61595807 to 61596627 of chromosome 11 Region (xiv) Chromosome 14, regions 23820337 to 23822266 Region (xv) Chromosome 17, regions 44895317~44896749 Region (xvi) is the region of chromosome 19, from position 39520228 to 39523159.

[0021] Item 15. The kit according to item 14, wherein the primer set is a primer set for analyzing methylation of CpG sites by at least one method selected from the group consisting of methylation-specific PCR, sequencing, and mass spectrometry.

[0022] Item 16. The kit according to item 14 or 15, wherein the primer set includes a primer set capable of amplifying at least one of the following regions after bisulfite treatment if the CpG sites contained in the region are methylated: The region containing chromosome 2, positions 207308134 to 207308267. The region containing chromosome 2, positions 241758885 to 241759011. The region containing chromosome 3, positions 150804402 to 150804508. The region containing chromosome 4, positions 141348215 to 141348329. The region containing chromosome 4, positions 186049616 to 186049705. The region containing chromosome 5, positions 17216901 to 17217025. The region containing chromosome 6, positions 37664344 to 37664472. The region containing chromosome 6, positions 39281671 to 39281814. The region containing chromosome 7, positions 42276765 to 42276874. The region containing chromosome 10, positions 13043227 to 13043334. The region containing chromosome 10, positions 81664566 to 81664662. The region containing chromosome 10, positions 88126244 to 88126334. The region containing chromosome 11, positions 61595787 to 61595864. The region containing chromosome 14, positions 23821996 to 23822092. The region containing chromosome 17, positions 44896309 to 44896450. The region containing chromosome 19, positions 39522494 to 39522608.

[0023] Item 17. Use of a primer set for analyzing methylation at at least one site selected from the group consisting of CpG sites in the following regions (i) to (xvi) in DNA collected from colorectal cancer patients, in order to manufacture a kit for obtaining information that may serve as an indicator of the sensitivity of drug therapy for colorectal cancer: Region (i) Region 4 of chromosome 2, from 207307150 to 20730900 Region (ii) Regions 241758282 to 241760510 of chromosome 2 Region (iii) Regions 150802997 to 150805168 of chromosome 3 Region (iv) Regions 141347993 to 141348489 of chromosome 4 Region (v) Chromosome 4, regions 186048714-186050048 Region (vi) Regions 17216679-17219240 of chromosome 5 Region (vii): Regions 37663982 to 37664539 of chromosome 6. Region (viii) Regions 39281183 to 39282332 of chromosome 6 Region (ix) Region 42273390~42277951 of chromosome 7 Region (x) Chromosome 10, regions 13039715~13043422 Region (xi): Regions 81664401-81665076 of chromosome 10. Region (xii) Regions 88126287-88127189 of chromosome 10 Region (xiii) Regions 61595807 to 61596627 of chromosome 11 Region (xiv) Chromosome 14, regions 23820337 to 23822266 Region (xv) Chromosome 17, regions 44895317~44896749 Region (xvi) is the region of chromosome 19, from position 39520228 to 39523159.

[0024] Item 18. Use as described in Item 17, wherein the primer set is a primer set for analyzing methylation of CpG sites by at least one method selected from the group consisting of methylation-specific PCR, sequencing, and mass spectrometry.

[0025] Item 19. Use according to item 17 or 18, wherein the primer set includes a primer set capable of amplifying at least one of the following regions after bisulfite treatment if the CpG sites contained in said region are methylated: The region containing chromosome 2, positions 207308134 to 207308267. The region containing chromosome 2, positions 241758885 to 241759011. The region containing chromosome 3, positions 150804402 to 150804508. The region containing chromosome 4, positions 141348215 to 141348329. The region containing chromosome 4, positions 186049616 to 186049705. The region containing chromosome 5, positions 17216901 to 17217025. The region containing chromosome 6, positions 37664344 to 37664472. The region containing chromosome 6, positions 39281671 to 39281814. The region containing chromosome 7, positions 42276765 to 42276874. The region containing chromosome 10, positions 13043227 to 13043334. The region containing chromosome 10, positions 81664566 to 81664662. The region containing chromosome 10, positions 88126244 to 88126334. The region containing chromosome 11, positions 61595787 to 61595864. The region containing chromosome 14, positions 23821996 to 23822092. The region containing chromosome 17, positions 44896309 to 44896450. The region containing chromosome 19, positions 39522494 to 39522608. [Effects of the Invention]

[0026] According to the present invention, it is possible to provide a novel method for testing the sensitivity of colorectal cancer to drug therapy, which uses methylation sites, which were not previously known to be indicators of responsiveness to drug therapy for colorectal cancer, as an indicator. [Brief explanation of the drawing]

[0027] [Figure 1] The graph below summarizes the progression-free survival (PFS) for each group in Example 2. [Figure 2] The graph below summarizes the progression-free survival (PFS) for each group in Example 3. [Figure 3] The graph shows the progression-free survival (PFS) for each group in 83 cases of advanced or recurrent colorectal cancer with wild-type KRAS genes in Example 4. [Figure 4] The graph shows the progression-free survival (PFS) for each group in 65 cases of wild-type RAS genes in Example 4. [Figure 5] The results of DNA methylation analysis around Target ID cg07319626 in the example are shown. [Figure 6] The results of DNA methylation analysis around Target ID cg02610058 in the example are shown. [Figure 7] The results of DNA methylation analysis around Target ID cg13803214 in the example are shown. [Figure 8] The results of DNA methylation analysis around Target ID cg14235416 in the example are shown. [Figure 9] The results of DNA methylation analysis around Target ID cg24642320 in the example are shown. [Figure 10] The results of DNA methylation analysis around Target ID cg25203704 in the example are shown. [Figure 11] The results of DNA methylation analysis around Target ID cg26129310 in the example are shown. [Figure 12] The results of DNA methylation analysis around Target ID cg18960642 in the example are shown. [Figure 13] The results of DNA methylation analysis around Target ID cg07413609 in the example are shown. [Figure 14] The results of DNA methylation analysis around Target ID cg22738219 in the example are shown. [Figure 15] The results of DNA methylation analysis around Target ID cg20629468 in the example are shown. [Figure 16] The results of DNA methylation analysis around Target ID cg20649951 in the example are shown. [Figure 17] The results of DNA methylation analysis around Target ID cg25303599 in the example are shown. [Figure 18] The results of DNA methylation analysis around Target ID cg01557297 in the example are shown. [Figure 19] The results of DNA methylation analysis around Target ID cg12379948 in the example are shown. [Figure 20] The results of DNA methylation analysis around Target ID cg14730085 in the example are shown. [Modes for carrying out the invention]

[0028] (1. Methods for testing the sensitivity of colorectal cancer to drug therapy) This invention provides a method for testing the sensitivity of drug therapy to colorectal cancer, using methylation at at least one site selected from the group consisting of CpG sites in the following regions (i) to (xvi) in DNA collected from colorectal cancer patients as an indicator: Region (i) Region of chromosome 2, positions 207307150 to 207309004 (preferably positions 207307490 to 207308376) Region (ii) Region of chromosome 2, positions 241758282 to 241760510 (preferably positions 241758805 to 241760510) Region (iii) Region of chromosome 3, positions 150802997 to 150805168 (preferably positions 150802997 to 150804720) Region (iv) Region of chromosome 4, positions 141347993 to 141348489 (preferably positions 141348167 to 141348308) Region (v) Chromosome 4, regions 186048714-186050048 Region (vi) Regions 17216679-17219240 of chromosome 5 Region (vii): Regions 37663982 to 37664539 of chromosome 6. Region (viii) Region of chromosome 6, positions 39281183 to 39282332 (preferably 39281541 to 39282165) Region (ix) Region of chromosome 7, positions 42273390 to 42277951 (preferably positions 42275870 to 42276817) Region (x) Region of chromosome 10, positions 13039715 to 13043422 (preferably 13041989 to 13043422) Region (xi): Regions 81664401-81665076 of chromosome 10. Region (xii) Region of chromosome 10, positions 88126287-88127189 (preferably 88126287-88126307) Region (xiii) Region of chromosome 11, positions 61595807 to 61596627 (preferably positions 61595807 to 61596334) Region (xiv) Region of chromosome 14, positions 23820337 to 23822266 (preferably 23821596 to 23822266) Region (xv) Region of chromosome 17, positions 44895317 to 44896749 (preferably 44895317 to 44896425) Region (xvi) is the region of chromosome 19, positions 39520228 to 39523159 (preferably 39520228 to 39523084).

[0029] Furthermore, the inspection method of the present invention is performed in vitro.

[0030] (1.1. Explanation of Terms) This invention targets DNA collected from colorectal cancer patients for measurement. In this invention, colorectal cancer refers to cancers that occur in the large intestine (colon (including the cecum) and rectum), and also includes cancers that occur in the anal canal. The subject of this invention is humans. In this invention, colorectal cancer patients include not only people who have colorectal cancer, but also people who are suspected of having colorectal cancer and need to have their response to cancer drug therapy investigated. Furthermore, in this invention, colorectal cancer patients also include people whose colorectal cancer has already been removed by surgical removal.

[0031] In the present invention, DNA is extracted from a sample taken from the colorectal cancer patient. The sample from which DNA is extracted is not particularly limited, but examples include colorectal tissue, blood, serum, plasma, feces, bowel cleansing solution, enema cleansing solution, etc., taken from the colorectal cancer patient. The method for extracting DNA from these samples is also not particularly limited and can be carried out using or based on known methods. For example, it can be carried out using commercially available kits such as EZ DNA Methylation-GOLD QIAampKit (ZYMO RESEARCH), QIAamp DNA Micro Kit (QIAGEN), and NucleoSpin® Tissue (TAKARA).

[0032] In the present invention, drug therapy for colorectal cancer is not particularly limited and includes chemotherapy, treatment using molecularly targeted drugs, and combinations thereof. The drugs used in chemotherapy are not particularly limited and include, for example, oxaliplatin, irinotecan, fluorouracil, trifluridine / tipiracil hydrochloride, etc. The molecularly targeted drugs are also not particularly limited and include, for example, anti-EGFR antibodies, anti-VEGF antibodies, oral multikinase inhibitors, etc.

[0033] In the present invention, "anti-EGFR antibody" refers to an antibody specific to EGFR (epidermal growth factor receptor) or an immunologically active fragment thereof. While not particularly limited, anti-EGFR antibodies include, for example, cetuximab and panitumumab.

[0034] In this invention, susceptibility to drug therapy for colorectal cancer refers to the patient's sensitivity to cancer drug therapy as described above, and susceptibility is expressed when cancer drug therapy is effective, and resistance is expressed when it is not effective.

[0035] DNA methylation typically occurs at the 5th carbon atom of the pyrimidine ring of cytosine or the 6th nitrogen atom of the purine ring of adenine, which constitute DNA. In somatic cell tissues of adult mammals, DNA methylation is typically more likely to occur at CpG sites (dinucleotide sites where cytosine and guanine are adjacent). In this invention, when each region on DNA is referred to as "regions Y to Z of chromosome X", the reference sequence is "hg19". If the base sequence of DNA in the sample of a cancer patient being tested involves additions, substitutions, and / or deletions of base sequences compared to the base sequence recorded in the reference sequence, the TargetID and base position refer to the position in the human genome sequence recorded in "hg19" above, taking into account such additions, substitutions, and / or deletions. Furthermore, in the present invention, "detection of methylation of the Y-th base of chromosome X" includes not only the case where the Y-th base of chromosome X is cytosine and methylation of said cytosine is detected, but also the case where the Y-th base of chromosome X is guanine and methylation of the corresponding cytosine in the complementary strand is detected. In the present invention, "detection of methylation" means confirming the presence or absence of methylation of cytosine at a certain position, unless otherwise indicated.

[0036] (1.2. Methods for detecting methylation and measuring the frequency of methylation) The method for detecting methylation at CpG sites is not limited, but examples include calculating the β value using a bead array as described later, and determining the ΔCt value using real-time PCR. In addition, in the present invention, the frequency of methylation can be used as an indicator of methylation. In the present invention, the method for measuring the frequency of methylation at CpG sites contained in a predetermined region is not limited, but examples include calculating the β value using a bead array as described later to detect methylation at a predetermined position within the region and calculating the frequency of methylation from the detection result, and measuring the frequency by real-time PCR using the ΔCt value as an indicator of methylation frequency, and the method using real-time PCR is preferred.

[0037] When detecting CpG site methylation by calculating the β value using a bead array, for example, methylation can be detected using a bead array from Illumina (Infinium® HumanMethylation450 BeadChip or Infinium methylationEPIC BeadChip). In this method, methylated cytosine is distinguished from unmethylated cytosine by converting unmethylated cytosine in the DNA to uracil through bisulfite treatment. Then, probes immobilized on two beads, a methylation probe (M type) and an unmethylation probe (U type), which are specific to each site, are hybridized, and a single-nucleotide extension reaction is performed using labeled ddNTPs. The ratio of methylation to unmethylation is calculated from the fluorescence intensity signal. This allows for easy and comprehensive DNA methylation analysis. When using this method, the frequency of methylation can be measured, for example, using the β value. Specifically, the β value is an indicator of the methylation ratio (methylation / methylation + unmethylation) and is calculated by the following formula. β value = (maximum fluorescence value of methyl detection probe) / (maximum fluorescence value of non-methyl detection probe + maximum fluorescence value of methyl detection probe + 100). In the present invention, the reference value for the β value can be set as appropriate, but for example, it is preferable to define high methylation as a value greater than 0.4, and more preferably as a value greater than 0.3.

[0038] In another preferred embodiment of the present invention, real-time PCR can be used. Specifically, real-time PCR (methylation-specific PCR) is performed using forward primers, reverse primers and / or probes specific to methylated DNA sequences. Due to bisulfite treatment, cytosine in unmethylated DNA is converted to uracil, and its sequence differs from that of the forward and reverse primers specific to methylated DNA sequences, so PCR amplification does not occur, and only methylated DNA is amplified by PCR.

[0039] A probe is used to detect the PCR amplification product. In a typical embodiment, a probe labeled with a fluorescent substance and a quenching substance at both ends can be used. Before the reaction, fluorescence generation is suppressed by the quenching substance, but when the probe is degraded by the activity of DNA polymerase during the PCR reaction, the fluorescent substance is released and fluorescence is emitted. The fluorescent signal produced by the degradation of the probe is detected, and the cycle threshold (Ct) value, which is the number of cycles at which the fluorescence intensity reaches a certain level, is calculated. In methylation-specific PCR, the probe hybridizes with methylated DNA sequences, is then degraded, and emits light. The Ct value can be obtained by detecting this fluorescent signal. On the other hand, since the probe does not hybridize with unmethylated DNA sequences, the fluorescent signal due to probe degradation is not detected, and the Ct value becomes very large or cannot be obtained. Usually, the Ct value is also affected by the quantity and quality of the sample DNA, so real-time PCR of the control region is performed simultaneously in the same reaction to correct for this effect. In that case, preferably, the control primers and probes are designed to amplify and detect a region different from the region of DNA methylation to be detected. More preferably, the control primer is designed so that it does not contain a CpG site within the region to be amplified. Therefore, the control region can be amplified regardless of the presence or absence of methylation. The difference between the Ct value of the control reaction and the Ct value of the methylation detection reaction is calculated as the ΔCt value, and the result can be determined according to the ΔCt value. The ΔCt value is large for unmethylated DNA and small for methylated DNA.

[0040] In this embodiment, the frequency of methylation in each region (i) to (xvi) can be measured by, for example, the following method. First, if all CpG sites to be detected are methylated, a primer and probe set is designed so that the range containing the CpG sites is amplified by PCR after bisulfite treatment and can be detected. Furthermore, a control region is also set and real-time PCR is performed to calculate the ΔCt value. If ΔCt is small, the frequency of methylation is high, and if ΔCt is large, the frequency of methylation is low. Therefore, if ΔCt is less than a predetermined value Tb, the region can be designated as a highly methylated region. Alternatively, the ΔCt value can be calculated by the above method, and if ΔCt is greater than or equal to a predetermined value Tb, the region can be designated as a low-methylated region. In the present invention, the reference value Tb for the ΔCt value can be set as appropriate, but for example, it can be set as appropriate within the range of 3≦Tb≦7, preferably 3.5≦Tb≦5, more preferably 3.5≦Tb≦4.5, and particularly preferably Tb=4. More specifically, for example, it is preferable to define hypermethylation as a ΔCt value of 6 or less, and more preferably as a value of less than 4. When using real-time PCR, the base length of the region amplified by the primer set can be set as appropriate, but for example, it can be set in the range of 75 to 200 bases, preferably 90 to 160 bases, and more preferably 100 to 150 bases. The number of CpG sites included in the amplified region can be one or more (for example, one or more, preferably three or more, more preferably five or more, more preferably eight or more, more preferably ten or more, more preferably thirteen or more, and even more preferably fifteen or more).The method for setting the amplified region is not particularly limited, but for example, as described later, (i-1)~(i-11), (ii-1)~(ii-10), (iii-1)~(iii-12), (iv-1)~(iv-5), (v-1)~(v-5), (vi-1)~(vi-13), (vii-1)~(vii-3), (viii-1)~(viii-9), (ix-1)~(ix-23), (x-1)~(x-4), (xi-1)~(xi-6), (xii-1)~( The settings can include one or more locations selected from the group consisting of xii-6), (xiii-1) to (xiii-7), (xiv-1) to (xiv-10), (xv-1) to (xv-11), and (xvi-1) to (xvi-8) (for example, one or more locations, preferably three or more, more preferably five or more, more preferably eight or more, more preferably ten or more, more preferably thirteen or more, and even more preferably fifteen or more).

[0041] In another typical embodiment, the method of the present invention uses the frequency of methylation at at least one site selected from the group consisting of CPG sites included in regions (i) to (xvi) as an indicator. In this embodiment, the method of the present invention includes the step of measuring the frequency of methylation at at least one site selected from the group consisting of CPG sites included in regions (i) to (xvi). The method for measuring the frequency of methylation in each of the regions (i) to (xvi) is not particularly limited, but for example, one method is to select a CPG site at a predetermined position in each region as a representative CPG site for that region and detect its methylation. Here, "frequency of methylation" is an indicator that shows the proportion of methylated (or unmethylated) cytosine. For example, it can be expressed as a percentage. In the present invention, the frequency of methylation at a CPG site can be rephrased as the frequency of methylation at the bases constituting the CPG site. In one embodiment, the methylation frequency is calculated by dividing the number of cytosines contained in the target CPG site within the region (including the complementary cytosines corresponding to glycine in the reference sequence's CPG site) by the number of methylated cytosines (or the number of unmethylated cytosines). Even if the number of target CPG sites within the region is 1, the methylation frequency can still be calculated. In this case, the methylation frequency is expressed as 0%, 50%, or 100%.

[0042] In this embodiment, if the ratio of the number of regions determined to be hypermethylated to the number of regions measured in regions (i) to (xvi) is equal to or greater than the reference value Tc, it can be determined that there is no sensitivity to drug therapy for colorectal cancer. For example, the reference value Tc can be appropriately set within the range of 0.2 ≤ Tc, preferably 0.2 ≤ Tc ≤ 0.8, more preferably 0.3 ≤ Tc ≤ 0.7, and even more preferably 0.4 ≤ Tc ≤ 0.6. More specifically, for example, Tc can be set to 0.5.

[0043] Furthermore, in another embodiment of the present invention, for example, when measuring the frequency of methylation in region (i), the measurement of the frequency of methylation in region (i) can be performed by detecting the methylation of a representative CpG site, rather than detecting the methylation of all CpG sites contained in the region. For example, the frequency of methylation in region (i) can be measured by detecting the methylation of at least one base (preferably two or more, more preferably six or more, more preferably eight or more, and even more preferably eleven) selected from the group consisting of (i-1) to (i-11) below: (i-1) Base number 207307150 of chromosome 2 (i-2) Base number 207307490 of chromosome 2 (i-3) Base number 207307544 of chromosome 2 (i-4) Base number 207307622 of chromosome 2 (i-5) Base number 207307732 of chromosome 2 (i-6) Base number 207308004 of chromosome 2 (i-7) Base number 207308087 of chromosome 2 (i-8) Base number 207308244 of chromosome 2 (i-9) Base number 207308375 of chromosome 2 (i-10) Base number 207308829 of chromosome 2 (i-11) Base position 207309003 on chromosome 2. In particular, it is preferable to detect methylation at at least (i-8) of the above base positions. The method for detecting methylation is not limited, but examples include calculating the β value using a bead array as described later, and calculating the ΔCt value using real-time PCR, with the method of calculating the β value using a bead array being preferred. In this embodiment, when detecting methylation at one of (i-1) to (i-11), the position where the detection is performed is considered a representative position in region (i), and when the base at that position is methylated (for example, when the β value is above a predetermined value, or when the ΔCt value is below a predetermined value, etc.), region (i) can be designated as a highly methylated region, and otherwise, region (i) can be designated as a low-methylated region. Furthermore, in this embodiment, when detecting methylation at two or more locations among (i-1) to (i-11), these locations are considered representative locations within region (i). When a predetermined percentage or more of the bases at these locations (for example, more than half, more than 60%, more than 70%, etc.) are methylated (for example, when the β value is above a predetermined value, or when the ΔCt value is below a predetermined value, etc.), region (i) can be designated as a highly methylated region. Otherwise, region (i) can be designated as a low-methylated region.

[0044] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (ii), the frequency of methylation in region (ii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably six or more, more preferably seven or more, and even more preferably ten) selected from the group consisting of (ii-1) to (ii-10) below: (ii-1) Base number 241758282 of chromosome 2 (ii-2) Base number 241758399 of chromosome 2 (ii-3) Base number 241758805 of chromosome 2 (ii-4) Base number 241758901 of chromosome 2 (ii-5) Base number 241759279 of chromosome 2 (ii-6) Base number 241759414 of chromosome 2 (ii-7) Base number 241760025 of chromosome 2 (ii-8) Base number 241760164 of chromosome 2 (ii-9) Base number 241760190 of chromosome 2 (ii-10) Base position 241760509 on chromosome 2. In particular, it is preferable to detect methylation at at least (ii-4) of the above base positions. In this embodiment, the method for detecting methylation, and when region (ii) is considered a highly methylated region and when it is considered a low-methylated region, are the same as described above for region (i).

[0045] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (iii), the frequency of methylation in region (iii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably six or more, more preferably eight or more, and even more preferably twelve) selected from the group consisting of (iii-1) to (iii-12) below: (iii-1) Base number 150802997 of chromosome 3 (iii-2) Base number 150803295 of chromosome 3 (iii-3) Base number 150803307 of chromosome 3 (iii-4) Base number 150803666 of chromosome 3 (iii-5) Base number 150803669 of chromosome 3 (iii-6) Base number 150804058 of chromosome 3 (iii-7) Base number 150804063 of chromosome 3 (iii-8) Base number 150804313 of chromosome 3 (iii-9) Base position 150804490 of chromosome 3 (iii-10) Base number 150804696 of chromosome 3 (iii-11) Base number 150804719 of chromosome 3 (iii-12) Base position 150805167 of chromosome 3. In particular, it is preferable to detect methylation at at least (iii-9) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (iii) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0046] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (iv), the frequency of methylation in region (iv) can be measured by detecting methylation of at least one base (preferably two or more, more preferably three or more, more preferably four or more, and even more preferably five) selected from the group consisting of (iv-1) to (iv-5) below: (iv-1) Base number 141347993 of chromosome 4 (iv-2) Base number 141348043 of chromosome 4 (iv-3) Base number 141348167 of chromosome 4 (iv-4) Base number 141348307 of chromosome 4 (iv-5) Base position 141348488 on chromosome 4. In particular, it is preferable to detect methylation at at least (iv-4) of the above base positions. In this embodiment, the method for detecting methylation, and when region (iv) is considered a highly methylated region and when it is considered a low-methylated region, are the same as described above for region (i).

[0047] Furthermore, in one embodiment of the present invention, for example, the frequency of methylation in region (v) can be measured by detecting methylation of at least one base (preferably two or more, more preferably three or more, more preferably four or more, and even more preferably five) selected from the group consisting of (v-1) to (v-5) below: (v-1) Base number 186048714 of chromosome 4 (v-2) Base number 186048907 of chromosome 4 (v-3) Base number 186049687 of chromosome 4 (v-4) Base number 186049926 of chromosome 4 (v-5) Base position 186050047 on chromosome 4. In particular, it is preferable to detect methylation at at least (v-3) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (v) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0048] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (vi), the frequency of methylation in region (vi) can be measured by detecting methylation of at least one base (preferably two or more, more preferably seven or more, more preferably ten or more, and even more preferably thirteen) selected from the group consisting of (vi-1) to (vi-13) below: (vi-1) Base number 17216679 of chromosome 5 (vi-2) Base number 17216922 of chromosome 5 (vi-3) Base number 17217093 of chromosome 5 (vi-4) Base number 17217877 of chromosome 5 (vi-5) Base number 17218089 of chromosome 5 (vi-6) Base number 17218278 of chromosome 5 (vi-7) Base number 17218308 of chromosome 5 (vi-8) Base number 17218547 of chromosome 5 (vi-9) Base number 17218778 of chromosome 5 (vi-10) Base number 17219020 of chromosome 5 (vi-11) Base number 17219128 of chromosome 5 (vi-12) Base number 17219226 of chromosome 5 (vi-13) Base position 17219239 on chromosome 5. In particular, it is preferable to detect methylation at at least (vi-2) of the above base positions. In this embodiment, the method for detecting methylation, and when region (vi) is considered a highly methylated region and when it is considered a low-methylated region, are the same as described above for region (i).

[0049] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (vii), the frequency of methylation in region (vii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably three) selected from the group consisting of (vii-1) to (vii-3) below: (vii-1) Base 37663982 of chromosome 6 (vii-2) Base number 37664451 of chromosome 6 (vii-3) Base position 37664538 on chromosome 6. In particular, it is preferable to detect methylation at at least (vii-2) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (vii) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0050] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (viii), the frequency of methylation in region (viii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably five or more, more preferably seven or more, and even more preferably nine) selected from the group consisting of (viii-1) to (viii-9) below: (viii-1) Base number 39281183 of chromosome 6 (viii-2) Base number 39281421 of chromosome 6 (viii-3) Base number 39281450 of chromosome 6 (viii-4) Base number 39281541 of chromosome 6 (viii-5) Base number 39281694 of chromosome 6 (viii-6) Base number 39281885 of chromosome 6 (viii-7) Base number 39282164 of chromosome 6 (viii-8) Base number 39282316 of chromosome 6 (viii-9) Base position 39282331 of chromosome 6. In particular, it is preferable to detect methylation at at least (viii-5) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (viii) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0051] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (ix), the frequency of methylation in region (ix) can be measured by detecting methylation of at least one base (preferably two or more, more preferably 12 or more, more preferably 18 or more, and even more preferably 23) selected from the group consisting of (ix-1) to (ix-23) below: (ix-1) Base number 42273390 of chromosome 7 (ix-2) Base number 42275601 of chromosome 7 (ix-3) Base number 42275813 of chromosome 7 (ix-4) Base number 42275870 of chromosome 7 (ix-5) Base number 42275872 of chromosome 7 (ix-6) Base number 42276004 of chromosome 7 (ix-7) Base number 42276814 of chromosome 7 (ix-8) Base number 42276816 of chromosome 7 (ix-9) Base number 42276819 of chromosome 7 (ix-10) Base number 42276848 of chromosome 7 (ix-11) Base number 42276881 of chromosome 7 (ix-12) Base number 42276890 of chromosome 7 (ix-13) Base number 42276941 of chromosome 7 (ix-14) Base number 42276981 of chromosome 7 (ix-15) Base number 42277044 of chromosome 7 (ix-16) Base number 42277066 of chromosome 7 (ix-17) Base number 42277071 of chromosome 7 (ix-18) Base number 42277347 of chromosome 7 (ix-19) Base number 42277375 of chromosome 7 (ix-20) Base number 42277394 of chromosome 7 (ix-21) Base number 42277410 of chromosome 7 (ix-22) Base number 42277807 of chromosome 7 (ix-23) Base position 42,277,950 on chromosome 7. In particular, it is preferable to detect methylation at at least (ix-8) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (ix) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0052] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in region (x), the frequency of methylation in region (x) can be measured by detecting methylation of at least one base (preferably two or more, more preferably three or more, and even more preferably four) selected from the group consisting of (x-1) to (x-4) below: (x-1) Base number 13039715 of chromosome 10 (x-2) Base number 13041989 of chromosome 10 (x-3) Base number 13043313 of chromosome 10 (x-4) Base position 13043421 on chromosome 10. In particular, it is preferable to detect methylation at at least (x-3) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (x) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0053] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xi), the frequency of methylation in the region (xi) can be measured by detecting methylation of at least one base (preferably two or more, more preferably four or more, more preferably five or more, and even more preferably six) selected from the group consisting of (xi-1) to (xi-6) below: (xi-1) Base number 81664401 of chromosome 10 (xi-2) Base number 81664567 of chromosome 10 (xi-3) Base number 81664583 on chromosome 10 (xi-4) Base number 81664698 of chromosome 10 (xi-5) Base number 81664955 of chromosome 10 (xi-6) Base position 81665075 on chromosome 10. In particular, it is preferable to detect methylation at at least (xi-3) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xi) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0054] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xii), the frequency of methylation in the region (xii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably three or more, more preferably four or more, and even more preferably six) selected from the group consisting of (xii-1) to (xii-6) below: (xii-1) Base number 88126287 of chromosome 10 (xii-2) Base number 88126291 of chromosome 10 (xii-3) Base number 88126299 of chromosome 10 (xii-4) Base number 88126306 of chromosome 10 (xii-5) Base number 88126853 of chromosome 10 (xii-6) Base position 88127188 on chromosome 10. In particular, it is preferable to detect methylation at at least (xii-4) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xii) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0055] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xiii), the frequency of methylation in the region (xiii) can be measured by detecting methylation of at least one base (preferably two or more, more preferably five or more, more preferably seven) selected from the group consisting of (xiii-1) to (xiii-7) below: (xiii-1) Base number 61595807 of chromosome 11 (xiii-2) Base number 61595956 of chromosome 11 (xiii-3) Base number 61596068 of chromosome 11 (xiii-4) Base number 61596307 of chromosome 11 (xiii-5) Base number 61596333 of chromosome 11 (xiii-6) Base number 61596405 of chromosome 11 (xiii-7) Base position 61596626 on chromosome 11. In particular, it is preferable to detect methylation at at least (xiii-1) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xiii) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0056] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xiv), the frequency of methylation in the region (xiv) can be measured by detecting methylation of at least one base (preferably two or more, more preferably five or more, more preferably eight or more, and even more preferably ten) selected from the group consisting of (xiv-1) to (xiv-10) below: (xiv-1) Base number 23820337 of chromosome 14 (xiv-2) Base number 23821149 of chromosome 14 (xiv-3) Base number 23821229 of chromosome 14 (xiv-4) Base number 23821435 of chromosome 14 (xiv-5) Base number 23821445 of chromosome 14 (xiv-6) Base number 23821570 of chromosome 14 (xiv-7) Base number 23821596 of chromosome 14 (xiv-8) Base number 23821902 of chromosome 14 (xiv-9) Base number 23822017 of chromosome 14 (xiv-10) Base position 23822265 on chromosome 14. In particular, it is preferable to detect methylation at at least (xiv-9) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xiv) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0057] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xv), the frequency of methylation in the region (xv) can be measured by detecting methylation of at least one base (preferably two or more, more preferably six or more, more preferably eight or more, and even more preferably 11) selected from the group consisting of (xv-1) to (xv-11) below: (xv-1) Base number 44895317 of chromosome 17 (xv-2) Base number 44896017 of chromosome 17 (xv-3) Base number 44896080 of chromosome 17 (xv-4) Base number 44896147 of chromosome 17 (xv-5) Base number 44896162 of chromosome 17 (xv-6) Base number 44896166 of chromosome 17 (xv-7) Base number 44896168 of chromosome 17 (xv-8) Base number 44896212 of chromosome 17 (xv-9) Base number 44896223 of chromosome 17 (xv-10) Base number 44896424 of chromosome 17 (xv-11) Base position 44896748 on chromosome 17. In particular, it is preferable to detect methylation at at least (xv-10) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xv) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0058] Furthermore, in one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xvi), the frequency of methylation in the region (xvi) can be measured by detecting methylation of at least one base (preferably two or more, more preferably four or more, more preferably six or more, and even more preferably eight) selected from the group consisting of (xvi-1) to (xvi-8) below: (xvi-1) Base number 39520228 of chromosome 19 (xvi-2) Base number 39521931 of chromosome 19 (xvi-3) Base number 39522418 of chromosome 19 (xvi-4) Base number 39522548 of chromosome 19 (xvi-5) Base number 39522747 of chromosome 19 (xvi-6) Base number 39522944 of chromosome 19 (xvi-7) Base number 39523083 of chromosome 19 (xvi-8) Base position 39523158 on chromosome 19. In particular, it is preferable to detect methylation at at least (xvi-4) of the above base positions. In this embodiment, the method for detecting methylation, and the conditions under which region (xvi) is considered a highly methylated region and the conditions under which it is considered a low-methylated region, are the same as those described above for region (i).

[0059] By detecting methylation at multiple CpG sites within each region using the method described above, sensitivity to drug therapy for colorectal cancer can be accurately assessed even if only the methylation frequency of one region (i) to (xvi) is measured. In this case, if the measured region is a highly methylated region according to the above criteria, the patient can be determined to be a highly methylated patient and not sensitive to drug therapy for colorectal cancer. Conversely, if the measured region is a low-methylated region, the patient can be determined to be a low-methylated patient and sensitive to drug therapy for colorectal cancer. Furthermore, in this embodiment, even when measuring the frequency by detecting methylation at relatively few base positions among the CpG sites contained in each region (for example, 1 to 3 bases, 1 to 2 bases, 1 base per region), sensitivity can be accurately determined by measuring the frequency of methylation in two or more regions from regions (i) to (xvi) and determining that if a predetermined percentage or more of those regions (for example, more than half, more than 60%, more than 70%) are hypermethylated regions, the patient is determined to be a hypermethylated patient and not sensitive to drug therapy for colorectal cancer. In addition, in this embodiment, sensitivity can also be accurately determined by detecting methylation in two or more regions from regions (i) to (xvi) and determining that if less than a predetermined percentage of those regions (for example, less than half, less than 40%, less than 30%) are hypermethylated regions, the patient is determined to be a hypomethylated patient and sensitive to drug therapy for colorectal cancer.

[0060] Furthermore, in another preferred embodiment of the present invention, it is preferable to use methylation of the following CpG site as an indicator: In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably five or more locations, even more preferably seven or more locations, and most preferably ten locations) selected from the group consisting of bases 207308141, 207308149, 207308153, 207308172, 207308177, 207308181, 207308185, 207308244, 207308247, and 207308267 of chromosome 2. In this embodiment, it is preferable to detect methylation at least 207308244 of chromosome 2. If a predetermined proportion of the above bases, Ta1 or more, are methylated, the region can be determined to be a highly methylated region. The reference value Ta1 can be appropriately set within the range of, for example, 0.80 ≤ Ta1, more preferably 0.90 ≤ Ta1, and even more preferably 0.95 ≤ Ta1.

[0061] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably six or more locations, even more preferably nine or more locations, and most preferably twelve locations) selected from the group consisting of bases 241758885, 241758889, 241758896, 241758901, 241758919, 241758922, 241758931, 241758936, 241758940, 241759003, 241759005, and 241759009 of chromosome 2. In this embodiment, it is preferable to detect methylation at least at chromosome 241758901. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region. The reference value Ta1 can be set in the same way as in the embodiment described above (and so on).

[0062] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably five or more locations, even more preferably seven or more locations, and most preferably nine locations) selected from the group consisting of bases 150804417, 150804420, 150804474, 150804479, 150804486, 150804490, 150804496, 150804504, and 150804507 of chromosome 3. In this embodiment, it is preferable to detect methylation at least 150804490 of chromosome 3. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0063] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably eight locations) selected from the group consisting of bases 141348224, 141348232, 141348272, 141348282, 141348289, 141348307, 141348318, and 141348324 of chromosome 4. In this embodiment, it is preferable to detect methylation at least at chromosome 4, position 141348307. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0064] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably eight locations) selected from the group consisting of bases 186049623, 186049636, 186049659, 186049670, 186049685, 186049687, 186049689, and 186049705 of chromosome 4. In this embodiment, it is preferable to detect methylation at least 186049687 of chromosome 4. If a predetermined proportion of the bases to be detected, or more than Ta1, are methylated, the region can be determined to be a highly methylated region.

[0065] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably six or more locations, even more preferably nine or more locations, and most preferably ten locations) selected from the group consisting of bases 17216904, 17216916, 17216922, 17216940, 17216949, 17216952, 17217003, 17217011, 17217017, and 17217023 of chromosome 5. In this embodiment, it is preferable to detect methylation at least at chromosome 5, specifically at base 17216922. If a predetermined proportion of bases (Ta1 or more) among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0066] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably five or more locations, and most preferably six locations) selected from the group consisting of bases 37664352, 37664366, 37664419, 37664424, 37664451, and 37664460 of chromosome 6. In this embodiment, it is preferable to detect methylation at least 37664451 of chromosome 6. If a predetermined proportion of the bases to be detected are methylated (Ta1 or more), the region can be determined to be a highly methylated region.

[0067] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably six or more locations, even more preferably nine or more locations, and most preferably ten locations) selected from the group consisting of bases 39281692, 39281694, 39281723, 39281729, 39281735, 39281738, 39281797, 39281806, 39281808, and 39281813 of chromosome 6. In this embodiment, it is preferable to detect methylation at least at chromosome 6, 39281694. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0068] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably six or more locations, even more preferably nine or more locations, and most preferably twelve locations) selected from the group consisting of bases 42276764, 42276767, 42276769, 42276783, 42276810, 42276814, 42276816, 42276819, 42276825, 42276852, 42276862, and 42276874 of chromosome 7. In this embodiment, it is preferable to detect methylation at least at chromosome 7, specifically at base 42276816. If a predetermined proportion of the bases to be detected are methylated (Ta1 or more), the region can be determined to be a highly methylated region.

[0069] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably seven locations) selected from the group consisting of bases 13043231, 13043247, 13043285, 13043288, 13043313, 13043321, and 13043333 of chromosome 10. In this embodiment, it is preferable to detect methylation at least 13043313 of chromosome 10. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0070] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably five or more locations, even more preferably seven or more locations, and most preferably nine locations) selected from the group consisting of bases 81664567, 81664573, 81664583, 81664598, 81664600, 81664606, 81664614, 81664636, and 81664656 of chromosome 10. In this embodiment, it is preferable to detect methylation at least 81664583 of chromosome 10. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0071] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably five or more locations, even more preferably seven or more locations, and most preferably nine locations) selected from the group consisting of bases 88126243, 88126250, 88126259, 88126285, 88126287, 88126291, 88126299, 88126306, and 88126310 of chromosome 10. In this embodiment, it is preferable to detect methylation at least 88126306 of chromosome 10. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0072] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably eight locations) selected from the group consisting of bases 61595796, 61595807, 61595815, 61595818, 61595820, 61595829, 61595843, and 61595852 of chromosome 11. In this embodiment, it is preferable to detect methylation at least 61595807 of chromosome 11. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0073] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably seven locations) selected from the group consisting of bases 23822015, 23822017, 23822043, 23822054, 23822073, 23822075, and 23822079 of chromosome 14. In this embodiment, it is preferable to detect methylation at least at chromosome 14, position 23822017. If a predetermined proportion of the bases to be detected, or more than Ta1, are methylated, the region can be determined to be a highly methylated region.

[0074] In this embodiment, methylation can be detected at least one location (preferably two or more locations, more preferably four or more locations, even more preferably six or more locations, and most preferably eight or more locations) selected from the group consisting of bases 44896314, 44896316, 44896324, 44896386, 44896390, 44896401, 44896424, 44896443, and 44896450 of chromosome 17. In this embodiment, it is preferable to detect methylation at least 44896424 of chromosome 17. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0075] In this embodiment, methylation can be detected at least one location (preferably three or more locations, more preferably five or more locations, even more preferably eight or more locations, and most preferably eleven locations) selected from the group consisting of bases 39522493, 39522510, 39522533, 39522537, 39522548, 39522550, 39522552, 39522582, 39522587, 39522591, and 39522608 of chromosome 19. In this embodiment, it is preferable to detect methylation at least 39522548 of chromosome 19. If a predetermined proportion of bases Ta1 or more among the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0076] In this embodiment as well, the frequency of methylation in the region to be measured can be determined by methods such as calculating the ΔCt value using real-time PCR. Specifically, for example, a primer and probe set can be designed to amplify the region to be measured, real-time PCR can be performed, the ΔCt value can be calculated, and if ΔCt is less than a predetermined value Tb, the region can be designated as a highly methylated region. Alternatively, the ΔCt value can be calculated using the above method, and if ΔCt is greater than or equal to a predetermined value Tb, the region can be designated as a low-methylated region. The reference value Tb can be set in the same way as in the embodiments described above.

[0077] Furthermore, in another preferred embodiment of the present invention, it is preferable to use methylation of the following CpG site as an indicator: In this embodiment, the region of chromosome 2 from position 207308134 to position 207308268 Region 241758885 to 241759011 of chromosome 2 Region 150804402 to 150804508 of chromosome 3 Region 141348215 to 141348329 of chromosome 4 Region 186049616 to 186049706 of chromosome 4 Region 17216901 to 17217025 of chromosome 5 Region 37664344 to 37664472 of chromosome 6 Region 39281671 to 39281814 of chromosome 6 Region 42276764–42276875 of chromosome 7 Region 13043227 to 13043334 of chromosome 10 Region 81664566 to 81664662 of chromosome 10 Region 88126243 to 88126334 of chromosome 10 Region 61595787 to 61595864 of chromosome 11 Region 23821996–23822092 of chromosome 14 Region 44896309–44896451 of chromosome 17 Region 39522493 to 39522609 of chromosome 19 Methylation at at least one site selected from the group consisting of CpG sites can be used as an indicator.

[0078] In this embodiment, the length of the region to be measured is not particularly limited, but can be appropriately set in the range of, for example, 75 to 200 bases, preferably 90 to 160 bases, and more preferably 100 to 150 bases.

[0079] In this embodiment as well, the frequency of methylation in the region to be measured can be determined by methods such as calculating the ΔCt value using real-time PCR. Specifically, for example, a primer and probe set can be designed to amplify the region to be measured, real-time PCR can be performed, the ΔCt value can be calculated, and if ΔCt is less than a predetermined value Tb, the region can be designated as a highly methylated region. Alternatively, the ΔCt value can be calculated using the above method, and if ΔCt is greater than or equal to a predetermined value Tb, the region can be designated as a low-methylated region. The reference value Tb can be set in the same way as in the previously described embodiment. The frequency of methylation can also be determined based on a method of calculating the β value using a bead array.

[0080] In a preferred embodiment of the present invention, the following are examples of probe and primer sets for measuring the frequency of methylation in each region: Area (i) F-Primer TAGTATTCGAAGTTTCGTTCG (Sequence ID 1) R-Primer GAACCTAAAAATACTAAAACGACG (Sequence ID 2) Probe AAACGAACGTACGCCCCGC (Sequence ID 3) Area (ii) F-Primer CGGTCGTGTAACGAAGC (Sequence ID 4) R-Primer CCGAACGCGAACAACTA (Sequence ID 5) Probe CAAACGAACGAAACGAAAACTACGACG (Sequence ID 6) Area (iii) F-Primer AGTAGAGGAGGTAGGCGTC (Sequence ID 7) R-Primer CGACGAATACTCGACTACG (Sequence ID 8) Probe CTCGAACCCCGAAACGCAC (Sequence ID 9) area (iv) F-Primer GAGTCGAGGTCGTTATTTTAGC (Sequence ID 10) R-Primer AATAAACAACGCCCAAACG (Sequence ID 11) probe CCCCGAACTCAAACGTAAAACG (Sequence ID 12) area (v) F-Primer GGGGAAAGTTTTTATCGC (Sequence ID 13) R-Primer CTAATAACGTTACCCACAACCG (Sequence ID 14) probe CCCGAAAAAACTACGAAATAAAACTAACCG (Sequence ID 15) area (vi) F-Primer TCGATTACGATTTCGTTATTTC (Sequence No. 16) R-Primer ATACGAATACAAATACGAAACCG (Sequence ID 17) probe CAACTCGTTTACAACGACGCAACC (Sequence ID 18) area (vii) F-Primer TTTGTAAGAGGCGTAAAGTGC (Sequence ID 19) R-Primer CTATATTCCGAAACAACTAACTCG (Sequence ID 20) probe CATCCACTCCAAAATCCGAATCG (Sequence ID 21) area (viii) F-Primer GTTTTTTAATTTTTTGGTTTTCGC (Sequence No. 22) R-Primer CGAACCGCGAAATATACGA (Sequence ID 23) probe AACGTCGAAAACGCAAACGC (Sequence ID 24) area(ix) F-Primer GAAATTGATGTCGGAGTTGTAC (Sequence ID 25) R-Primer GACGCGAATAAATAAAAACG (Sequence ID 26) Probe TACGAACGCGCCGATAACGC (Sequence ID 27) area(x) F-Primer ATTACGGTGTGGGAGTGGTAC (Sequence ID 28) R-Primer CGAAATACTATACGACCAAACG (Sequence ID 29) probe CAACATACTAAAAATACCCGCCGACTC (Sequence ID 30) area(xi) F-Primer AGATTCGTTAATAGTTGAGTGTAGGC (Sequence ID 31) R-Primer CCGAAAACGAAATAAAACG (Sequence ID 32) probe CACGCGAACCCGATAAAACG (Sequence ID 33) Area (xii) F-Primer GTTTTTCGGGAGAGTCGAG (Sequence ID 34) R-Primer AACTAAACTAAACTAAACTAAAACGAACG (Sequence ID 35) probe CAAAACGCAAAAACGAACGCG (Sequence No. 36) Area (xiii) F-Primer ATGTTGTTTGTCGATTGTGAC (Sequence ID 37) R-Primer AAAAACAACCGTCTATACAACG (Sequence ID 38) probe AACCGACGCGAAAAAACCG (Sequence ID 39) Area (xiv) F-Primer AGATTAAGGAGGCGTTCGC (Sequence ID 40) R-Primer CTATCCTCTAACTCAATTACGCG (Sequence ID 41) Probe CAACTCGAAAAAATCCCGCTCTACAAC (Sequence ID 42) Area (xv) F-Primer GGTTTTCGTTAGTAAAGGAGTTATTC (Sequence ID 43) R-Primer AAAAACGCGATAAACCGAAC (Sequence ID 44) probe CTTTAACCCGAACGTTCACATAACGAA (SEQ ID NO: 45) Area (xvi) F-Primer GTAGTTGTTAGTTTTTCGTTCGTAAC (Sequence ID 46) R-Primer GAAATCCCACCTTAACCGC (Sequence ID 47) probe TTACGTCCGATAAATCTACGCGCG (Sequence ID 48) In this specification, the primer set of forward primer and reverse primer for region (i) is referred to as primer set 1. Similarly, the primer sets of forward primer and reverse primer for regions (ii) to (xvi) are referred to as primer sets 2 to 16, respectively. The probe for region (i) is referred to as probe 1. Similarly, the probes for regions (ii) to (xvi) are referred to as probes 2 to 16, respectively.

[0081] Accordingly, in a preferred embodiment of the present invention, the region to be measured may be set to be detected using at least one of the probes 1 to 16 and / or at least one of the primer sets 1 to 16. Alternatively, in a preferred embodiment of the present invention, the region to be measured may be set to be detected using at least one of the probes 1 to 16 and / or at least one of the primer sets 1 to 16 (or at least one of the primers constituting each primer in the primer sets 1 to 16). Alternatively, in a preferred embodiment of the present invention, it is preferable that at least a portion of the indicator CpG site is included in the region where any of the primers constituting each primer in the primer sets 1 to 16 hybridize after bisulfite treatment. Alternatively, in a preferred embodiment of the present invention, it is preferable that the indicator CpG site is located within the region where either the primer sets 1 to 16 and probes 1 to 16 hybridize in the DNA obtained by bisulfite treatment of DNA containing the methylated CpG site. In the present invention, "hybridize" means hybridize under stringent conditions that are normally set in the art of the present invention. For example, this means hybridizing under the conditions of Example 2 of this application. The stringency during hybridization is known to be a function of temperature, salt concentration, primer chain length, GC content of the primer nucleotide sequence, and the concentration of the chaotropic agent in the hybridization buffer. Those skilled in the art can refer to known information such as Sambrook, J. et al. (1998) Molecular Cloning: A Laboratory Manual (2nd ed.), ColdSpringHarborLaboratory Press, New York, and adjust the above conditions as appropriate.In the present invention, in DNA obtained by bisulfite treatment of DNA containing a methylated CpG site, the region to which an oligonucleotide hybridizes refers to the region in the resulting product to which the oligonucleotide hybridizes after bisulfite treatment of the DNA containing the region. By bisulfite treatment, unmethylated cytosines in the region are converted to uracil, while methylated cytosines are not converted. The aforementioned primer sets 1 to 16 and probes 1 to 16 are designed so that all cytosines in the CpG site contained in the region to be hybridized are methylated (and therefore not converted by bisulfite treatment), and cytosines not present in the CpG site are not methylated (and therefore converted to uracil by bisulfite treatment), and hybridization occurs after bisulfite treatment of the region. As described above, in a typical embodiment, when an oligonucleotide hybridizes to a base sequence obtained by using a base sequence of a certain region in a reference sequence as a reference, while keeping the cytosines in the CpG sites in the reference base sequence as they are and converting all cytosines not present in the CpG sites to uracil, that region can be defined as "a region in DNA obtained by bisulfite treatment of DNA containing methylated CpG sites in which an oligonucleotide hybridizes."

[0082] In the present invention, the "method for testing the sensitivity of colorectal cancer to drug therapy using methylation of regions (a) to (c) as an indicator" may include not only a method that uses methylation of regions (a) to (c) as an indicator, but also a method that includes a step of detecting methylation of regions (a) to (c) and other regions to the extent that the test results do not differ. For example, the "method for testing the sensitivity of colorectal cancer to drug therapy using methylation of regions (i) to (v) as an indicator" may include not only a method that uses methylation of regions (i) to (v) as an indicator, but also a method that includes a step of detecting methylation of regions (i) to (v) and other regions ("other regions" may be regions other than regions (vi) to (xvi)) to the extent that the test results do not differ. Therefore, the method of the present invention may also include a method that includes a step of detecting methylation at at least one location selected from the group consisting of CpG sites included in regions (i) to (xvi), and detecting methylation in regions that do not substantially affect the test results.

[0083] (2. Treatment methods for colorectal cancer patients) The present invention provides a method for treating colorectal cancer patients, comprising the steps of: determining sensitivity to drug therapy for colorectal cancer using methylation at at least one site selected from the group consisting of CpG sites in regions (i) to (xvi) in DNA collected from a colorectal cancer patient as an indicator; and administering drug therapy to a colorectal cancer patient determined to be sensitive in the above step.

[0084] The drug therapy administered to colorectal cancer patients who have been determined to be sensitive to drug therapy for colorectal cancer based on the above sensitivity assessment is not particularly limited, but can be carried out, for example, by administering an effective amount of a drug used for drug therapy for colorectal cancer to the colorectal cancer patient.

[0085] The route of drug administration is not particularly limited and may be either oral or parenteral. Examples of parenteral administration include oral administration, respiratory tract administration, rectal administration, subcutaneous administration, intramuscular administration, and intravenous administration.

[0086] The formulation form of the drug is not particularly limited, and examples include oral preparations such as tablets, pills, capsules, powders, granules, and syrups; and parenteral preparations such as injections (intravenous injection, intramuscular injection, local injection, etc.), gargles, infusions, topical preparations (ointments, creams, patches, inhalants), and suppositories.

[0087] In this invention, the dosage of the drug used in pharmacotherapy varies depending on the route of administration, the patient's age, weight, symptoms, etc., and cannot be specified in general terms. However, the dosage of the active ingredient should be such that the daily dose for adults is usually about 5000 mg or less, preferably about 1000 mg or less, and more preferably 500 mg or less. The lower limit of the dosage is not particularly limited, and for example, the dosage of the active ingredient for adults can be appropriately set within the range of usually 1 mg or more, preferably 10 mg or more, and more preferably 100 mg or more. If administered once a day, this amount should be contained in one formulation, and if administered three times a day, one-third of this amount should be contained in one formulation.

[0088] (3. Other Embodiments) Although the present invention has been described above using specific embodiments, the present invention is not limited to such embodiments. As mentioned above, the present invention is based on the novel finding that the above regions (i) to (xvi) are useful as indicators of sensitivity to drug therapy for colorectal cancer. Accordingly, the present invention also includes, for example, the following embodiments: a method to assist in determining sensitivity to drug therapy for colorectal cancer, using methylation at at least one site selected from the group consisting of CpG sites included in the following regions (i) to (xvi) in DNA collected from colorectal cancer patients as an indicator; a method for determining sensitivity to drug therapy for colorectal cancer, using methylation at at least one site selected from the group consisting of CpG sites included in the aforementioned regions (i) to (xvi) in DNA collected from colorectal cancer patients as an indicator; methylation at at least one site selected from the group consisting of CpG sites included in the aforementioned regions (i) to (xvi) in DNA collected from colorectal cancer patients A kit for determining susceptibility to drug therapy for colorectal cancer, including means for detecting; a program for a computer to implement a first function that obtains a score indicating the frequency of methylation at at least one location selected from the group consisting of regions (i) to (xvi) in DNA taken from a colorectal cancer patient; a second function that determines a region to be a hypermethylated region if the score indicating the frequency of methylation obtained by the first function is less than or equal to a preset value for each region; and a third function that determines that there is no susceptibility to drug therapy for colorectal cancer if more than half of the regions (i) to (xvi) from which scores were obtained by the first function are determined to be hypermethylated regions by the second function.

[0089] Details regarding the DNA collected from colorectal cancer patients in these embodiments, drug therapy, and descriptions of each region; as well as the method for detecting methylation in each region, are as described above. In the embodiments of the kit described above, examples of means for detecting methylation include sets of probes and primers used in the method described above. The kit of the present invention may also include other components as needed. Other components include, but are not limited to, tools for collecting samples (e.g., syringes). It may also include a document describing the procedure for performing the above testing method.

[0090] Furthermore, while specific embodiments of the present invention will be described in more detail below using examples, it is clear that the present invention is not limited to such embodiments. [Examples]

[0091] Reference Example 1: Comprehensive DNA methylation analysis using 97 cases of colorectal cancer. Comprehensive DNA methylation analysis was performed using Infinium 450K (Illumina) on formalin-fixed, paraffin-embedded (FFPE) tissue samples from surgically resected colorectal cancer tumor tissues from 97 patients with colorectal cancer who had a history of using anti-EGFR antibody drugs. The study included only patients who did not show a mutation in KRAS exon 2 using the Sanger method.

[0092] For each of the 486,428 target CpG sites, the β value (methylated probe / methylated probe + unmethylated probe) was calculated, and unsupervised hierarchical cluster analysis was performed using 3,163 probes whose β value distribution standard deviation exceeded 0.25, according to the method described in Patent Document 1.

[0093] Based on the above results, the cases analyzed were classified into two groups: the Highly-Methylated Colorectal Cancer (HMCC) group (34 cases) with high methylation levels, and the Low-Methylated Colorectal Cancer (LMCC) group (63 cases) with low methylation levels.

[0094] Example 1 Statistical analysis was performed on the β values ​​of each CpG site in 63 cases in the LMCC group and 34 cases in the HMCC group, as classified in the above reference examples. Furthermore, the β values ​​of CpG sites were also measured for normal colonic mucosal samples (n=10) that were measured and calculated separately from the above 97 cases. Taking these results into consideration, and further narrowing down of CpG sites by focusing on the agreement between methylation determination and actual treatment outcomes, 16 base CpG sites were selected from the 486,428 CpG sites targeted by the comprehensive DNA methylation analysis described above. As a result of this selection, it is thought that by using the methylation of some or all of the 16 bases listed in Table 1 as an indicator, it is possible to determine whether a subject belongs to the LMCC group or the HMCC group, that is, whether or not they are sensitive to drug therapy for colorectal cancer.

[0095] [Table 1]

[0096] Example 2 Of 83 retrospectively collected cases of advanced or recurrent colorectal cancer with a history of treatment with anti-EGFR antibody drugs (18 cases with RAS gene mutations, n=65 cases with RAS gene wild-type), 65 cases with wild-type RAS genes underwent DNA methylation status measurement by real-time PCR using the following procedure and were classified into either the HMCC group or the LMCC group.

[0097] Methylation detection using real-time PCR For each case, the DNA sample was treated with bisulfite under the following conditions, and then the ΔCt value was determined by real-time PCR: • Bisulfite treatment - Bisulfite Kit: EZ DNA Methylation Gold Kit - DNA quantity: 500-600 ng / rxn • Reagent configuration for methylation detection system - Amount of DNA used for qPCR: 10-50 ng / well - Enzyme used: GoTaqG2 Hot Start Master Mix (MgCl2 final concentration 2.0mM) - Target: Primer final concentration l000nM / Probe (FAM) final concentration 500nM - Control: Primer final concentration 500nM / Probe (HEX) final concentration 250nM - ACTB Promoter region(GenBank Y00474.1) Reaction temperature conditions 95℃: 2min→(95℃ 15sec→55℃ 30sec→72℃ 1min) x 50cycles ·Measuring equipment: Bio-Rad CFX96 The target primer probe set and control primer probe set used for real-time PCR are as follows:

[0098] [Table 2]

[0099] Based on the results of real-time PCR using the 16 primer-probe sets for the analysis regions and one control primer-probe set, a ΔCt value of less than 4 was determined to indicate positive methylation in the analysis region. Cases with 8 or more methylation-positive regions out of the 16 analysis regions were classified as the HMCC group, and cases with fewer than 8 methylation-positive regions were classified as the LMCC group. The treatment outcomes (progression-free survival: PFS and response rate) with anti-EGFR antibody drugs (cetuximab or panitumumab) were then compared for each group.

[0100] First, the proportions of the 83 cases into the RAS gene mutation group, the HMCC group, and the LMCC group are shown in Table 3 below.

[0101] [Table 3]

[0102] Furthermore, the response rates for each group are shown in Table 4 below.

[0103] [Table 4]

[0104] Furthermore, Figure 1 shows a graph summarizing the progression-free survival (PFS) for each group. As can be seen from these results, by measuring the DNA methylation status, we were able to identify the group of patients with RAS wild-type advanced or recurrent colorectal cancer who were resistant to anti-EGFR antibody drugs.

[0105] Example 3 It is known that the prognosis of advanced colorectal cancer differs depending on the location of the primary tumor. Therefore, we further classified the 65 cases of advanced or recurrent colorectal cancer from Example 2 above according to the location of the primary tumor (right colon and left colon) and investigated which classification method was superior in predicting treatment effectiveness. First, Table 5 below shows the response rates for the HMCC and LMCC groups and the response rates by primary tumor location.

[0106] [Table 5]

[0107] Furthermore, Figure 2 shows graphs summarizing the progression-free survival (PFS) for each group: the HMCC group with a primary tumor in the left colon (L-HMCC group), the HMCC group with a primary tumor in the right colon (R-HMCC group), the LMCC group with a primary tumor in the left colon (L-LMCC group), and the LMCC group with a primary tumor in the right colon (R-LMCC group). As shown in Figure 2, among cases with a primary tumor in the left colon, there were cases in both the HMCC group and the LMCC group, and there was a statistically significant difference in the median PFS between the two groups. Similarly, among cases with a primary tumor in the right colon, there were cases in both the HMCC group and the LMCC group, and there was a statistically significant difference in the median PFS between the two groups. Therefore, it can be seen that methylation as an indicator is useful as an indicator separate from the location of the primary tumor. Furthermore, Table 6 shows the results of the analysis of differences in PFS for each of the following: location of the primary tumor, RAS gene mutation, and methylation status.

[0108] [Table 6]

[0109] As shown in Table 6, the hazard ratio for methylation status was the smallest, suggesting that among these indicators, the method using methylation as an indicator is superior in predicting treatment efficacy.

[0110] Example 4 The subjects of measurement were 83 patients with advanced or recurrent colorectal cancer who had the wild-type KRAS gene as described above. ΔCt values ​​were determined by real-time PCR in the same manner as in Example 2, except that only probe ID1, which targets the region containing cg07319626, was used (therefore, primer set 1 and probe 1 were used). Based on the results of the real-time PCR, patients with a ΔCt value of less than 4 were classified as the HMCC group, and patients with a ΔCt value of 4 or more were classified as the LMCC group. Then, the treatment outcomes (progression-free survival: PFS and response rate) with anti-EGFR antibody drugs (cetuximab or panitumumab) were compared for each group. Figure 3 shows a graph summarizing the progression-free survival (PFS) for each group. Figure 4 also shows a graph summarizing the PFS for the HMCC group and LMCC group for 65 cases of advanced or recurrent colorectal cancer with wild-type KRAS genes out of 83 cases. As these results show, by using methylation in only one region as an indicator, it was possible to identify the group resistant to anti-EGFR antibody drugs in advanced or recurrent colorectal cancer.

[0111] Example 5 Figures 5-20 show graphs illustrating the β values ​​calculated by comprehensive DNA methylation analysis of surrounding CpG sites using Infinium 450K (Illumina) for each of the 16 CpG sites used as indicators in the above example. In each figure, each column represents a different case. In the figures, "Target ID" is the ID of the CpG site, "CHR" is the chromosome number, and "MAPINFO" indicates which base on the chromosome is intended to be methylated. In each figure, β values ​​less than 0.4 are shown in dark gray, β values ​​greater than 0.3 and 0.4 or less are shown in light gray, and β values ​​of 0.3 or less are shown in white.

[0112] As shown in Figures 5-20, the β values ​​tend to be higher in HMCC cases than in LMCC cases, even in the CpG sites before and after the 16 CpG sites used as indicators in Example 1. Therefore, for example, by using the methylation of one of the 16 regions shown in Figures 5-20 (for example, region (i)) of chromosome 2, position 207307150-207309004 as an indicator, it is possible to determine whether a subject belongs to the LMCC group or the HMCC group, and therefore whether or not they are sensitive to drug therapy for colorectal cancer. For example, in Figure 5, TargetID cg24399540, TargetID cg27380819, TargetID cg04307977, TargetID cg06123396, TargetID cg09454676, TargetID cg08804846, TargetID cg26258845, TargetID cg07319626, TargetID cg16778809, TargetID Using cg09553380 and TargetID cg21823149 as indicators, if the β value is 0.4 or higher, the CpG site is defined as a hypermethylated region, and if there are 8 or more hypermethylated regions, it is determined to be HMCC. When this is done, the median PFS is 82 days and 224 days, respectively (p = < 0.001), and the HMCC group and LMCC group can be classified with a statistically significant difference.

Claims

1. A method for assisting in classifying colorectal cancer patients into the HMCC group or the LMCC group, The step includes determining the methylation state of at least one region selected from the group consisting of regions (i) to (xvi) in the DNA collected from the patient, The aforementioned determination result suggests whether the patient is classified into the HMCC group or the LMCC group. Region (i) is the region of chromosome 2, 207307150–207309004, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 207307150, 207307490, 207307544, 207307622, ​​207307732, 207308004, 207308087, 207308375, and 207309003. Region (ii) is the region of chromosome 2, from 241758282 to 241760510, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 241758282, 241758399, 241758805, 241758901, 241759279, 241759414, 241760025, 241760164, 241760190, and 241760509. Region (iii) is the region of chromosome 3, from 150802997 to 150805168, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 150803295, 150803307, 150803666, 150804063, 150804313, 150804490, 150804696, 150804719, and 150805167. Region (iv) is the region of chromosome 4, positions 141347993 to 141348489, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 141347993, 141348043, 141348167, and 141348307. Region (v) is the region of chromosome 4, from 186048714 to 186050048, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 186048714, 186048907, 186049926, and 186050047. Region (vi) is the region of chromosome 5, from 17216679 to 17219240, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 17216679, 17216922, 17217093, 17217877, 17218089, 17218278, 17218308, 17218547, 17218778, 17219020, 17219128, 17219226, and 17219239. Region (vii) is the region of chromosome 6, from 37663982 to 37664539, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 37663982, 37664451, and 37664538. Region (viiii) is the region of chromosome 6, from 39281183 to 39282332, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 39281183, 39281421, 39281450, 39281541, 39281694, 39282164, and 39282331. Region (ix) is the region of chromosome 7, from position 42273390 to 42277951, and the methylation states in this region are 42275601, 42275813, 42275870, 42275872, 42276004, 42276819, 42276848, 42276881, 42276890, The determination is made based on the detection of methylation of at least one base selected from the group consisting of the 42276941st, 42276981st, 42277044th, 42277066th, 42277071st, 42277347th, 42277375th, 42277394th, 42277410th, and 42277807th bases. Region (x) is the region between 13039715 and 13043422 of chromosome 10, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 13039715, 13041989, 13043313, and 13043421. Region (xi) is the region of chromosome 10, from 81664401 to 81665076, and the methylation state in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 81664401, 81664567, 81664583, 81664698, 81664955, and 81665075. Region (xii) is the region of chromosome 10, from 88126287 to 88127189, and the methylation state in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 88126287, 88126291, and 88127188. Region (xiiii) is the region of chromosome 11, from 61595807 to 61596627, and the methylation state in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 61595956, 61596068, 61596307, 61596333, and 61596626. Region (xiv) is the region of chromosome 14, from 23820337 to 23822266, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 23820337, 23821149, 23821229, 23821435, 23821445, 23821596, 23821902, 23822017, and 23822265. Region (xv) is the region of chromosome 17, from position 44895317 to 44896749, and the methylation state in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 44895317, 44896080, 44896147, 44896162, 44896166, 44896168, 44896212, and 44896223. Region (xvi) is the region between chromosome 19, positions 39520228 and 39523159, and the methylation status in this region is determined based on the detection of methylation of at least one base selected from the group consisting of bases 39520228, 39521931, 39522418, 39522747, 39522944, 39523083, and 39523158.

2. A method for classifying a patient into the HMCC group or the LMCC group, wherein the detection result indicates whether the patient is classified into the HMCC group or the LMCC group, by detecting methylation at at least one site selected from the group consisting of the following CpG sites in DNA collected from a colorectal cancer patient. Chromosome 2, positions 207307150, 207307490, 207307544, 207307622, ​​207307732, 207308004, 207308087, 207308375, 207309003, 241758282, 241758399, 241758805, 241758901, 241759279, 241759414, 241760025, 241760164, 241760190, 241760509, Chromosome 3, positions 150803295, 150803307, 150803666, 150804063, 150804313, 150804490, 150804696, 150804719, 150805167, Chromosome 4, positions 141347993, 141348043, 141348167, 141348307, 186048714, 186048907, 186049926, 186050047, Chromosome 5, positions 17216679, 17216922, 17217093, 17217877, 17218089, 17218278, 17218308, 17218547, 17218778, 17219020, 17219128, 17219226, 17219239, Chromosome 6, positions 37663982, 37664451, 37664538, 39281183, 39281421, 39281450, 39281541, 39281694, 39282164, 39282331, Chromosome 7, positions 42275601, 42275813, 42275870, 42275872, 42276004, 42276819, 42276848, 42276881, 42276890, 42276941, 42276981, 42277044, 42277066, 42277071, 42277347, 42277375, 42277394, 42277410, 42277807, Chromosome 10, positions 13039715, 13041989, 13043313, 13043421, 81664401, 81664567, 81664583, 81664698, 81664955, 81665075, 88126287, 88126291, 88127188, Chromosome 11, positions 61595956, 61596068, 61596307, 61596333, 61596626, Chromosome 14, positions 23820337, 23821149, 23821229, 23821435, 23821445, 23821596, 23821902, 23822017, 23822265, Chromosome 17, positions 44895317, 44896080, 44896147, 44896162, 44896166, 44896168, 44896212, 44896223, Bases 39520228, 39521931, 39522418, 39522747, 39522944, 39523083, and 39523158 of chromosome 19.