Single-domain antibody that binds to tetanus neurotoxin
High-affinity SDAs with specific amino acid sequences effectively bind and neutralize TeNT, addressing the limitations of existing antibodies by enhancing treatment efficacy for tetanus.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- SMIVET BV
- Filing Date
- 2019-03-13
- Publication Date
- 2026-05-12
AI Technical Summary
Current antibodies and their engineered variants, such as Fab and scFv, have limitations including low solubility, stability, high cost, and difficulty in manufacturing, and existing SDAs for tetanus neurotoxin (TeNT) exhibit low affinity, making them ineffective for treating tetanus.
Development of single-domain antibodies (SDAs) with high affinity for TeNT, achieving at least 70% amino acid sequence identity and 75% CDR1, CDR2, and CDR3 identity, which effectively bind to TeNT, neutralizing the toxin and preventing fatal symptoms.
The high-affinity SDAs significantly reduce free TeNT molecules, suppressing tetanus symptoms by shifting the balance towards bound TeNT molecules, providing a more effective treatment option.
Smart Images

Figure 0007857080000046 
Figure 0007857080000047 
Figure 0007857080000048
Abstract
Description
Technical Field
[0001] The present invention particularly relates to single domain antibodies (SDAs) having the ability to bind to tetanus neurotoxin, polypeptide constructs comprising such SDAs, compositions comprising such SDAs and / or polypeptide constructs, and DNA fragments encoding such SDAs and / or polypeptide constructs. Furthermore, the present invention relates to host cells comprising such DNA fragments, methods for producing such SDAs and / or polypeptide constructs, and the use of such SDAs and / or polypeptide constructs and / or compositions in treating or preventing disease after infection with Clostridium tetani.
Background Art
[0002] Tetanus is a disease caused by the bacterium Clostridium tetani and was first described in Egypt approximately 3000 years ago.
[0003] Tetanus toxemia is caused by a specific neurotoxin; tetanus neurotoxin (TeNT) produced by the bacterium Clostridium tetani. Almost all mammals, including humans, are susceptible. Humans, horses, and lambs are among the most sensitive species of all. Dogs and cats are relatively resistant. Tetanus is found worldwide, however the incidence of Clostridium tetani in the soil, as well as the incidence of tetanus in humans, horses, and lambs, is higher in the warmer parts of various continents. In most cases, the bacterium Clostridium tetani is introduced into tissues through wounds. Tetanus generally results from deep penetrating wounds that promote the growth of anaerobic bacteria. However, in lambs, and sometimes in other species, tetanus can also result from tail docking or castration.
[0004] Tetanus neurotoxin is a zinc-binding protease that cleaves synaptobrevin, a vesicle-associated membrane protein. When this protein is cleaved, it inhibits the release of neurotransmitters. The toxin is absorbed by motor neurons within the infected area and travels retrogradely from the nerve cords to the spinal cord, where it causes ascending tetanus.
[0005] TeNT is synthesized as a single polypeptide chain of 150 kDa. This polypeptide is cleaved into a 100 kDa heavy chain (H) and a 50 kDa light chain (L), which are held together by disulfide bonds to form an active toxin. Digestion of the holotoxin with papain yields the TeNT light chain and the amino-terminal half (H) of the TeNT heavy chain. N Fragment B, which consists of ), and fragment C, which contains the carboxyl-terminal half of the heavy chain (H C Or it leads to TTC). In in vitro experiments, H C While H is involved in binding with neurons via gangliosides, N The fragments were suggested to play a role in internalization and membrane translocation.
[0006] The incubation period (the time from infection to the first symptom) can range from as short as 24 hours to as long as several months after tetanus inoculation. This interval may reflect the distance the toxin must travel within the nervous system and may also be related to the amount of toxin released. The symptomatic period is the time between the first symptom and the onset of spastic paralysis. The incubation period is usually 10 to 14 days on average. Localized rigidity is often the first symptom observed, including in the masticatory and neck muscles, hind limbs, and the area of the infected wound; generalized rigidity becomes prominent after about one day, and then tonic spasms and hyperesthesia become apparent. Due to their relatively high resistance to tetanus toxin, dogs and cats often have long incubation periods and frequently develop localized tetanus; however, systemic tetanus certainly develops in these species as well. A comprehensive description of tetanus neurotoxin (and related botulinum neurotoxin) can be found in BOTULINUM AND TETANUS NEUROTOXINS, ISBN 978-1-4757-9544-8, (C)1993 Springer Science & Business Media New York. It was originally published by Plenum Press, New York in 1993. A review of tetanus, its causes and effects, and treatment methods can be found, for example, in Farrar, J.J. et al., J. Neurol Neurosurg Psychiatry 69:292~301 (2000).
[0007] Passive immunization using polyclonal human or, for example, equine tetanus antitoxin can shorten the progression of tetanus and reduce its severity. Equine antiserum (Fab) is prepared from a pool of serum collected from immunized horses and has a half-life of 12-20 hours in humans (Flanagan RJ, Jones AL. Drug Saf. 2004;27(14):1115-33). Equine (or bovine) forms are used throughout the developing world and, although they can incidentally cause anaphylactic reactions, their production is far cheaper and easier than that of human donor serum.
[0008] Treatment for tetanus disease consists of administration of antibiotics or metronidazole, treatment of the infection site (e.g., flushing, draining, and dissection), administration of antitoxin, and supportive care (e.g., skeletal muscle relaxants, sedatives, and hydration). Passive immunization using preparations containing immunoglobulins (e.g., purified and fragmented) obtained from actively immunized sheep or horses provides effective protection in unimmunized animals and humans. Tetanus antitoxin (e.g., in the form of SDA or immunoserum) can be used in at least three different scenarios: as part of standard preoperative procedures, in injured but not yet diseased animals, and thirdly, in treatment scenarios when an animal has tetanus. Depending on whether the treatment is prophylactic or therapeutic, there are differences in the dose of antitoxin used, but therapeutically, doses are 2 to 20 times higher depending on the species. In cases of tetanus, daily treatment may be necessary.
[0009] To date, the administration of antiserum proposed for, for example, horses and human volunteers, has been limited to the treatment of acute tetanus disease. In principle, possible alternatives could be provided by purified antibodies and their engineered variants, such as antigen-binding fragments (Fab) and single-chain variable fragments (scFv). Tetanus antitoxin SDA, produced in vitro while avoiding animal and human donors, has not yet been commercially available as a human or veterinary drug. An example of a single-chain variable fragment of anti-tetanus toxin is described by Nathan Scott et al. in Molecular Immunology 47:1931-1941 (2010).
[0010] However, despite their usefulness, common antibodies and their engineered variants, Fab and scFv, have several limitations. Examples of such limitations include low solubility, low stability, high cost, and animal use (Doshi, R. et al., Scientific Reports 4:6760 DOI;10.1030 / srep06760). Such common antibodies and their fragments have relatively high molecular weights: the average MW of a common antibody is about 160 kDa, Fab has a MW of 65 kDa, and even the relatively small scFv has a MW of 28 kDa.
[0011] On top of this, there is the problem of poor manufacturing feasibility: producing larger proteins is sometimes difficult to solve and, in any case, costly.
[0012] The monomeric high-frequency variable antigen-binding domain of naturally occurring homodimeric heavy-chain-only antibodies (HCAb) in some species of camels and sharks lacks many of the shortcomings of conventional antibodies and their engineered variants, Fab and scFv. To clarify, this variable domain, derived from a heavy-chain molecule that naturally lacks a light chain, is also called VHH when derived from camels and V when derived from sharks, in order to distinguish it from conventional VH of four-chain immunoglobulins. NAR It is also called [another name]. For convenience, anti-TeNT VHH is further referred to herein as a single-domain antibody (SDA).
[0013] The initial patent family relating to the structure, composition, preparations, and use of light-chain-deficient heavy-chain antibodies and their isolated antigen-binding fragments is the patent family including European Patent No. 0656946. Such single-domain molecules have also been described, notably by Hamers-Casterman, C. et al., Nature 363:446-448 (1993). Single-domain molecules can be derived from camelid species, such as camels, llamas, dromedaries, alpacas, and guanacos. Compared to conventional antibodies and their fragments, SDAs have the smallest molecular size (approximately 15 kDa). SDAs are very robust, extremely resistant to denaturation / thermal degradation, have high aqueous solubility, and are generally expressed highly and functionally using standard microbial expression systems. Furthermore, SDAs have excellent in vivo distribution and tissue penetration, which makes them attractive for clinical use.
[0014] Examples of SDAs capable of binding to tetanus toxoid are described in Arbabi Ghahroudi (M. Arbabi Ghahroudi, A. Desmyter, L. Wyns, R. Hamers, S. Muyldermans. Selection and identification of single domain antibody fragments from camel heavy-chain antibodies. FEBS Letters 414 (1997) 521-526). International Publication No. 96 / 34103 discloses SDAs capable of binding to tetanus toxoid. Mouse studies show that administration of SDAs at low toxic doses enabled the survival of approximately 40-50% of treated mice after 2-4 days. These results are also reported by Arbabi Ghahroudi et al., FEBS LETTERS (1997), 414, 521-526. Rossotti et al. (MABS, DOI:10.1080 / 19420862.2015.1068491) describe SDAs that bind to tetanus toxin.
[0015] A unique problem with Clostridium neurotoxins is their extremely high toxicity. TeNT is already toxic in humans at low concentrations of 0.1–2.5 ng / kg, and in other animals at low concentrations of 0.1–5 ng / kg. In horses, the lethal dose is, for example, 0.1–0.3 ng / kg. This means that once a tetanus infection occurs, only high-affinity antibodies capable of binding to TeNT, and subsequent inhibition of uptake in neurons, can reduce the level of free TeNT to a level that suppresses or even avoids the fatal symptoms of tetanus.
[0016] The direct measurement of biomolecular interactions plays a crucial role in the discovery and development of biotherapeutic drugs. Accurate information regarding the formation rate and stability of biomolecular complexes is a critical component of drug-target interactions. The affinity of the interaction directly influences the effective dose of a biologic. The affinity of an antibody to an antigen can be experimentally determined using any suitable method; see, for example, the methods described in Berzofsky et al., “Antibody-Antigen Interactions,” In Fundamental Immunology, Paul, WE., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company: New York, NY (1992); and Lad, L. et al., Journal of Biomolecular Screening 2015, Vol.20(4)498~507, Yang, D. et al., doi:10.3791 / 55659). In specific antibody-target protein interactions, the measured affinity may vary when measured under different conditions (e.g., salt concentration, pH). Therefore, affinity or avidity in the case of multimer SDA (e.g., K D ,k a ,k dis The measurement of ) is preferably performed using standardized antibody and antigen solutions, as well as standardized buffers.
[0017] However, until now, the K D of anti-TeNT SDA has been above 1-10 nM or even above 35 nM, indicating low affinity. This can be recognized, inter alia, by Rossotti et al. (2015, mAbs, 7:5, 820-828, DOI: 10.1080 / 19420862.2015.1068491), and Arbabi Ghahroudi of the above reference.
Summary of the Invention
[0018] In one aspect, the present invention is a single domain antibody (SDA) having the ability to bind to tetanus neurotoxin (TeNT), having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.
[0019] In a preferred embodiment, the SDA has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.
[0020] Alternatively, or in combination with the previous embodiments, in a more preferred embodiment, the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.
[0021] In further embodiments, the present invention relates to a polypeptide construct comprising at least one SDA having the ability to bind to TeNT according to the present invention, and at least one SDA having the ability to bind to a serum protein. Preferably, the serum protein is serum albumin or immunoglobulin. More preferably, the immunoglobulin is immunoglobulin G (IgG). In a preferred embodiment, the SDA having the ability to bind to serum albumin has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. In a preferred embodiment, the SDA having the ability to bind to immunoglobulin has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33, and 34, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.
[0022] In a preferred embodiment, the polypeptide construct comprises at least two SDAs capable of binding to TeNT, each of which has at least two TeNT-binding capabilities has at least 70% overall amino acid sequence identity with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, provided that at least two SDAs do not contain sequences derived from the same option, and the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.
[0023] In further embodiments, the present invention relates to a pharmaceutical composition comprising at least one SDA having the ability to bind to TeNT according to the present invention, and / or at least one polypeptide construct according to the present invention, and a pharmaceutically acceptable carrier. Preferably, the composition comprises at least two SDAs having the ability to bind to TeNT according to the present invention, and / or at least one polypeptide construct according to the present invention.
[0024] In a further embodiment, the present invention relates to an SDA having the ability to bind to TeNT according to the present invention, or to a polypeptide construct according to the present invention for use as a pharmaceutical.
[0025] In another embodiment, the present invention relates to an SDA having the ability to bind to TeNT according to the present invention, a polypeptide construct according to the present invention, or a pharmaceutical composition according to the present invention for use in the prevention or treatment of tetanus disease / symptoms.
[0026] In a further embodiment, the present invention relates to an SDA having the ability to bind to TeNT according to the present invention, or to a DNA fragment encoding a polypeptide construct according to the present invention.
[0027] In another aspect, the present invention relates to a nucleic acid comprising a DNA fragment according to the present invention, wherein the DNA fragment is operably linked to a promoter and, optionally, other regulatory elements.
[0028] In a further embodiment, the present invention relates to a host cell containing nucleic acid according to the present invention.
[0029] In a further embodiment, the present invention relates to a method for producing an SDA or a polypeptide construct according to the present invention, comprising the steps of: a) culturing host cells according to the present invention under conditions that enable the expression of the SDA or polypeptide construct; and optionally b) recovering the SDA or polypeptide construct from at least one of the host cells and the culture medium.
[0030] In one embodiment, the present invention relates to a diagnostic kit comprising at least one SDA having the ability to bind to TeNT according to the present invention. [Brief explanation of the drawing]
[0031] [Figure 1] This figure shows the sequences of TeNT-bound SDAs (SVT clones) isolated and later produced intracellularly in yeast. The SDAs are aligned and numbered based on the IMGT system. Horizontal lines indicate gaps introduced in the sequence alignment. The definitions of different complementarity-determining regions (CDRs) and framework regions (FRs) are also based on the IMGT system. Three CDR regions are shown against a gray background. Additional positions 50a–50d were inserted into FR2 to accommodate the rare insertion of four amino acids in this region of SVT06, SVT08, and SVT31. Additional residues were also introduced into CDR2 to accommodate the long CDR2 of SVT05. Additional gaps were introduced at IMGT position 60 of SVT16 and SVT25 to align residues 62 and 63 of these SDAs with the identical residues in SVT20 and SVT34. The classification of SDAs into subfamilies and into CDR3 groups is shown for each SDA.
[52] [Figure 2] This figure shows the sequences of an isolated and later intracellularly produced IgG-bound SDA (SVG clone) and two reference SDAs (sdAb-31 and sdAb-32) in yeast. The SDAs are aligned and numbered according to the IMGT system. Horizontal lines indicate gaps introduced in the sequence alignment. The definitions of different complementarity-determining regions (CDRs) and framework regions (FRs) are also based on the IMGT system. Three CDR regions are shown against a gray background. The classification of SDAs into subfamilies and into three CDR groups is shown for each SDA
[52] . [Figure 3]This figure shows the sequences of albuminbound SDAs (SVA clones) isolated and subsequently produced in yeast. The SDAs are aligned and numbered according to the IMGT system. Horizontal lines indicate gaps introduced in the sequence alignment. The definitions of different complementarity-determining regions (CDRs) and framework regions (FRs) are also based on the IMGT system. Three CDR regions are shown against a gray background. The classification of SDAs into subfamilies and into three CDR groups is shown for each SDA
[52] . [Figure 4] This figure shows the Western blot analysis of SVT SDA bound to TeNT. A blot strip of TeNT separated by reduced SDS-PAGE was incubated with biotinylated VHH, shown at the top. The positions of relevant molecular weight markers are indicated. The TeNT heavy chain is expected to migrate to approximately 100 kDa, and the light chain to approximately 50 kDa. [Figure 5A] This figure shows the SDS-PAGE analysis of monomeric and multimeric SDAs. Loaded SDAs are shown at the top of each lane. For multimeric SDAs, the pRL plasmid encoding the SDA is also shown. The positions of monomeric and multimeric SDAs are indicated by arrows on the right side of each panel. The molecular weight of the marker protein is shown on the right side. Panel A: Multimeric SDA containing SVG06 and three reference monomeric SDAs. [Figure 5B] Panel B shows a polymer SDA containing SVA12 or SVG13, and its corresponding monomer SDA. The order of TeNT-bound SDA in this gel is always SVT02, SVT16, SVT06, and SVT15-3FW4M for both monomer and polymer SDA. [Figure 6A]This figure shows the serum half-life of (im)multimerized SDA injected into piglets. SDA was injected at 0 hours, and serum was collected on days 1, 2, 4, 8, 11, 14, 21, and 28. The amount of SDA present in the serum samples was measured by ELISA. The mean and standard deviation (Panels A-D) for 6 piglets are shown. Panel A: SVT06-GS2-SVA12M2-H6 (0.2 mg / kg). [Figure 6B] Panel B: This figure shows SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (0.3 mg / kg). [Figure 6C] This is a diagram of panel C: SVT16-L123Q-GS2-SVA12M2-H6 (0.5 mg / kg). [Figure 6D] This figure shows Panel D: SVT16-L123Q-GS2-SVG13M4-H6 (0.5 mg / kg). Curve approximation for serum half-life measurement was performed using data obtained from 24-96 hours (48-hour prediction) or 96-504 hours (96-hour prediction). [Modes for carrying out the invention]
[0032] [Description of the Invention] Surprisingly, the known anti-TeNT SDA K D K is significantly lower than D It has now been found that anti-TeNT SDAs possessing tetanus toxin neutralizing activity in vivo are available. Such novel anti-TeNT SDAs have the advantage of having extremely high affinity and the ability to bind to TeNT. This shifts the balance between free TeNT molecules and bound TeNT molecules to the side of extremely bound TeNT molecules, thereby effectively suppressing the fatal symptoms of tetanus even after infection with Clostridium tetani.
[0033] KnM DSeveral groups of anti-TeNT SDAs with specific values have now been identified. Figure 1 shows the sequences of seven groups or examples for members of each group of SDAs (one member each from groups A, B, C, D, and E, F, and G). The three shaded regions indicate the location of highly variable regions or complementarity-determining regions (CDRs). As can be seen from Figure 1, several intrinsic variations certainly exist between individual SDAs. These variations may be due to differences in amino acids (maybe multiple) within the overall sequence, or due to deletions, substitutions, insertions, inversions, or additions of amino acids (maybe multiple) within the sequence. Amino acid substitutions that do not substantially alter biological and immunological activity are described, for example, by Neurath et al. in "The Proteins," Academic Press New York (1979). Amino acid substitutions between related amino acids, or substitutions that frequently occur in evolution, are particularly Ser / Ala, Ser / Gly, Asp / Gly, Asp / Asn, and Ile / Val (see Dayhof, MD, Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington DC, 1978, vol. 5, suppl. 3). Other amino acid substitutions include Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Thr / Phe, Ala / Pro, Lys / Arg, Leu / Ile, Leu / Val, and Ala / Glu. Based on this information, Lipman and Pearson developed a method for rapidly and sensitively comparing proteins (Science 227, 1435-1441, 1985) and determining the functional similarities between homologous proteins. Variations having amino acid substitutions, deletions, and / or insertions in typical embodiments of the present invention are within the scope of the present invention, provided that the resulting protein is not substantially affected in its antigenic or immunogenic properties.
[0034] This means that the SDA according to the present invention has an overall amino acid sequence identity level of about 70%, while the protein has a K<1 nM DThis explains why it can still represent the same protein in the sense that it still has a value. <1nM K D Such variations in the amino acid sequence of a particular SDA according to the present invention, which still provide an SDA having a value, are considered to "not substantially affect the antigenic or immunogenic properties of the protein."
[0035] In a first aspect, the present invention relates to an antigen-binding protein having the ability to bind to tetanus neurotoxin (TeNT), preferably a single-domain antibody (SDA), wherein the antigen-binding domain has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0036] In other words, in this embodiment, the present invention relates to an antigen-binding protein that specifically binds to tetanus neurotoxin (TeNT). Preferably, the antigen-binding protein comprises an amino acid sequence including four framework regions, FR1 to FR4, which are operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and three complementarity-determining regions, CDR1 to CDR3. Preferably, CDR1 is an amino acid sequence selected from the group consisting of CDR1 sequences of sequence numbers 13 to 26 of VHH, as shown in Figure 1, or has an amino acid sequence different from CDR1 in one or two amino acid residues; b) CDR2 is an amino acid sequence selected from the group consisting of CDR2 sequences of sequence numbers 13 to 26 of VHH, as shown in Figure 1, or has an amino acid sequence different from CDR2 in one, two, three, or four amino acid residues; and c) CDR3 is an amino acid sequence selected from the group consisting of CDR3 sequences of sequence numbers 13 to 26 of VHH, as shown in Figure 1, or has an amino acid sequence different from CDR3 in one, two, three, four, or five amino acid residues; however, as shown in Figure 1, each framework region has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity with any one of the framework amino acid sequences of sequence numbers 13 to 26. Preferably, CDR1, CDR2, and CDR3 are derived from the same sequence number. More preferably, the framework region is derived from the same sequence number as the complementarity determination region.
[0037] A specific percentage of the overall amino acid sequence identity level, e.g., about 70%, as used herein, means that the level of amino acid sequence identity of the entire antigen-binding protein is about 70% when the two sequences are aligned over their full length FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Thus, in this context, “overall” is used to include CDR1-3. “Sequence identity” or “identity” is defined herein as the association between two or more amino acid (polypeptide or protein) sequences, or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, “identity” also means, as may be, the degree of sequence association between amino acid or nucleic acid sequences, as determined by the consistency between strings of such sequences. “Similarity” between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of the second polypeptide. “Identity” and “similarity” can be readily calculated by known methods. The terms “sequence identity” or “sequence similarity” mean that two (poly)peptides or two nucleotide sequences share at least a certain percentage of sequence identity, as otherwise defined herein, when they are optimally aligned, preferably over their entire length (at least over the shortest sequence being compared), maximizing the number of matches and minimizing the number of gaps, for example, by using default parameters such as those of ClustalW(1.83), GAP, or BESTFIT. GAP aligns two sequences over their entire length using the Needleman and Wunsch global alignment algorithm, maximizing the number of matches and minimizing the number of gaps. Generally, the GAP default parameters are used, except for ClustalW(1.83) with a gap creation penalty of 50, and using the bloom matrix and default settings (gap start penalty: 10; gap extension penalty: 0.05).Sequence alignment and percent sequence identity scores can be determined using computer programs, such as the GCG Wisconsin Package, version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or open-source software, such as the program "needle" (using the global Needleman-Wunsch algorithm) or "water" (using the local Smith-Waterman algorithm), at (nucleotide) / 8 (protein) and using a gap elongation penalty of 3 (nucleotide) / 2 (protein). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). EmbossWIN version 2.10.0, a preferred multiple alignment program for aligning the protein sequences of the present invention, uses the same parameters as GAP described above, or uses default settings (for both "needle" and "water," and for both protein and DNA alignment, the default gap start penalty is 10.0 and the default gap extension penalty is 0.5; the default scoring matrix is Blossum62 for protein and DNAFull for DNA). When the sequences have substantially different full lengths, local alignment, such as alignment using the Smith-Waterman algorithm, is preferred. Alternatively, percentage similarity or identity can be determined by comparing with public databases using algorithms such as FASTA or BLAST.
[0038] Alignment of the variable domains of reconstituted antibodies may require extensive gap introduction at the terminal end of the CDR region. In particular, the CDR3 region sometimes requires such long gap extensions. While we do not intend to adhere to any theory, this is likely due to the inherent molecular processes of VDJ recombination that form the CDR3. Consequently, standard software programs for DNA or protein alignment may not be able to properly align the reconstituted SDA domain. The program IMGT / V-QUEST (Brochet, X. et al., Nucl. Acids Res. 36, W503~508 (2008)) was specifically developed for sequence analysis, including the alignment of antibody variable domains containing SDA, and is therefore a preferred program for determining alignment. It is accessible via the internet at www.imgt.org / IMGT_vquest / vquest (IMGT / V-QUEST program version 3.4.9-AMGT / V-QUEST reference directory release 201807-3 dated January 9, 2018). This provides SDA alignment and identification of three CDR and four FR regions based on the IMGT numbering system. The program also has options for identifying rare insertions and deletions. Subsequently, sequence identity of the CDR and FR regions can be determined.
[0039] Optionally, when determining the degree of amino acid similarity, a person skilled in the art may also consider so-called "conservative" amino acid substitutions, as would be obvious to them. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, the group of amino acids with aliphatic side chains are glycine, alanine, valine, leucine, and isoleucine; the group of amino acids with aliphatic hydroxyl side chains are serine and threonine; the group of amino acids with amide-containing side chains are asparagine and glutamine; the group of amino acids with aromatic side chains are phenylalanine, tyrosine, and tryptophan; the group of amino acids with basic side chains are lysine, arginine, and histidine; and the group of amino acids with sulfur-containing side chains are cysteine and methionine. Preferred groups of conservative amino acid substitutions are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. The amino acid sequence substitution variants disclosed herein are variants in which at least one residue in the disclosed sequence is removed and a different residue is inserted in its place. Preferably, the amino acid changes are conserved. Preferred conserved substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu, or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.
[0040] The preferred SDA according to the present invention contains the amino acid sequence VEDG at positions 50a-50d. This is located in the center of the FR2 region adjacent to residue Arg50 (Kabat position 45), which is the most representative amino acid substitution of SDA and is frequently described in SDA literature. Conventional SDAs typically contain Leu at IMGT position 50, which causes hydrophobic contact with the VL domain. SDAs most frequently have Arg at IMGT position 50. This substitution makes the conventional VL interface more hydrophilic. Insertion of VEDG makes the FR2 region more hydrophilic, lowers its isoelectric point, increases its solubility, and reduces the chance of aggregation.
[0041] In preferred embodiments, the antigen-binding protein according to the present invention comprises one or more single-binding domains, thereby the single-binding domains do not contain a light chain, and thereby the single-binding domains possess complete antigen-binding ability. Preferably, the antigen-binding protein according to the present invention is selected from the group consisting of antibodies containing a heavy chain and lacking a light chain, fragments thereof, affibody (Nord et al. (1997) Nature Biotechnology 15:772~777), single-domain antibodies, and fragments thereof. Examples of antigen-binding proteins according to the present invention are antibodies consisting only of camel or shark heavy chains that inherently lack a light chain, and SDAs derived from affibody. Preferably, the antigen-binding protein is an antibody containing only a heavy chain and inherently lacking a light chain, or a fragment thereof, for example, VHH (derived from camels), or V NAR(Derived from sharks), etc. Alternatively, (and also preferred) the antigen-binding protein of the present invention may be derived from an antibody or fragment thereof that is originally deficient in a light chain due to modification such as mutation. Antibodies originally deficient in a light chain can be obtained, for example, by immunization of camels (e.g., llamas, camels, dromedaries, Bactrian camels, alpacas, vicuñas, and guanacos) or sharks (see further below). These antibodies contain only a heavy chain and are deficient in a light chain. Advantages of such single-domain heavy-chain antibodies include their exceptional stability and small size, and their easy production within host microorganisms, such as Saccharomyces cerevisiae.
[0042] Therefore, the antigen-binding protein of the present invention preferably comprises a variable domain derived from immunoglobulin within a single polypeptide chain, which has a complete antigen-binding site for an epitope on a target molecule. As such an antigen-binding protein, 1) Antibodies that consist only of heavy chains and are naturally deficient in light chains, obtainable from camels and sharks; 2) VHH domain or V NAR A variable domain of an antibody as defined in 1), which is commonly called a fragment and collectively referred to herein as a single-domain antibody (SDA); 3) An antibody as defined in 1), in which the framework sequence of a camelid (or shark) VHH domain is grafted onto a CDR obtained from another source, or an engineered form of the domain in 2), e.g., a "camelidized" or "camelized" antibody; 4) For example, as described in International Publication No. 04 / 108749, an engineered form of an immunoglobulin-like variable domain in which framework sequences derived from various immunoglobulin-like molecules are bound to a CDR specific to a given target molecule. These are some examples, but the list is not limited to these.
[0043] In the preferred antigen-binding protein of the present invention, a single polypeptide chain of a variable domain possessing full antigen-binding capability preferably has an amino acid sequence and structure that can be considered to consist of four framework regions or "FRs," which are referred to in the art and herein as "framework region 1" or "FR1"; "framework region 2" or "FR2"; "framework region 3" or "FR3"; and "framework region 4" or "FR4," respectively, and these framework regions are interrupted by three complementarity-determining regions or "CDRs," which are referred to in the art as "complementarity-determining region 1" or "CDR1"; "complementarity-determining region 2" or "CDR2"; and "complementarity-determining region 3" or "CDR3," respectively. These framework regions and complementarity-determining regions are preferably operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 (from the amino terminus to the carboxy terminus).
[0044] The total number of amino acid residues in a variable domain having full antigen-binding capability may be in the range of 110 to 135, but preferably in the range of 115 to 129. However, the variable domain having full antigen-binding capability according to the present invention is not particularly limited in terms of its length and / or size, as long as the domain satisfies the further functional requirements outlined herein and / or is suitable for the purposes described herein. As established by Riechmann and Muyldermans (1999, J.Immunol.Methods 231(1-2):25~38, see, for example, Figure 2 in the aforementioned reference), and by Harmsen et al. (2000, Molecular Immunology 37:579~590, see, for example, Figure 1 in the aforementioned reference), the amino acid residues of variable domains with full antigen-binding capability are numbered based on a general numbering system for VH domains devised by Kabat et al. (Sequences of Proteins of Immunological Interest (5th Edition), NIH Publication No.91-3242, USDepartment of Health and Human Services, Public Health Service, National Institutes of Health (1991)).
[0045] From this perspective, it should be noted that, as is well known in the art, the total number of amino acid residues contained in each CDR of the VH domain and VHH domain may vary and may not correspond to the total number of amino acid residues indicated by Kabat numbering. However, based on the conserved amino acids of the framework region, those skilled in the art can align each framework and complementarity-determining region based on Kabat's definition for the variable domain having complete antigen binding. Examples of this are given in the definitions of complementarity-determining regions in the amino acid sequences of TeNT, immunoglobulin, and VHH that bind to serum albumin, respectively, as shown in Figures 1-3. An alternative method for numbering amino acid residues in the VH domain can be applied in a similar manner to VHH domains derived from camels and to variable domains with complete antigen-binding ability. This method is described by Chothia et al. (Nature 342, 877-883 (1989)) and is known as the "AbM definition," the "contact definition," or the IMGT numbering system (Lefranc et al., 1999, Nucl. Acids Res. 27:209-212).
[0046] It is well known that the three highly variable regions or complementarity-determining regions (CDR1, 2, and 3) play a major role in actually determining the specificity and coupling properties of SDAs.
[0047] Note that the amino acid sequence variations within the CDR1 and CDR2 regions in the various groups shown in Figure 1 are relatively low, i.e., lower than the variations within the non-CDR-related portions of various SDAs. The CDR1 region contains an average of 8 or 9 amino acids, and the variation within this group is related to only 1 or 2 amino acids, i.e., about 25%. The CDR2 region shows nearly identical levels of variation. The level of identity in this region can be estimated to be no less than 75%. In most cases, the level of identity is even higher, i.e., 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%. Note also that the amino acid sequence variations within the CDR3 region, which is generally considered to be the most important region involved in binding, are lower than the variations within the non-CDR-related portions of various SDAs. As a mere example: The level of identity within the CDR3 region among the four members belonging to SDA group A, which have been identified so far and shown in Figure 1, is approximately 95%. The level of identity within the same region among the three members belonging to group B is approximately 92%, and in group C, it is 94%. The two SDAs belonging to group D have a CDR3 identity level of approximately 75%. For the CDR1 and CDR2 regions, it can be inferred that the level of identity within these regions will not fall below 75%. In most cases, the level of identity is much higher, namely at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%.
[0048] However, the condition that the amino acid sequence identity of the CDR1, 2, and 3 regions is at least 75% suggests that antigen-binding proteins within the scope of the present invention have CDR1, 2, and 3 regions that have at least 75% amino acid sequence identity with any of the CDR1, 2, and 3 regions within the amino acid sequences selected from the group of SEQ ID NOs. 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26.
[0049] Preferably, the antigen-binding protein having the ability to bind to TeNT has overall sequence identity of a sequence selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26, exceeding 70%, for example, at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even 100%, in such preferred order.
[0050] Alternatively, or in combination with the previous embodiments, in a preferred embodiment, the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even 100%, in the following preferred order. These sequence identities can be determined independently of each other.
[0051] Accordingly, a preferred embodiment of this embodiment relates to an antigen-binding protein according to the present invention, wherein the antigen-binding protein has overall amino acid sequence identity of at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or preferably 100%, with CDR1, CDR2, and CDR3 having at least 75% amino acid sequence identity. Therefore, a more preferred form of this embodiment is that the antigen-binding protein comprises a sequence selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26, and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 The present invention relates to an antigen-binding protein having overall amino acid sequence identity of 98, 99%, or even 100%, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even 100%.
[0052] The antigen-binding protein of the present invention, which can bind to a specific antigen, such as TeNT, has affinity for it, the ability to bind to it, and / or specificity for it, is sometimes said to be "alleletic" or "targetable" with respect to the antigen (e.g., TeNT). The term "specificity" refers to the number of different types of antigens or antigenic determinants to which a particular antigen-binding protein molecule can bind. The specificity of an antigen-binding protein can be determined based on affinity and / or avidity. Affinity is the dissociation equilibrium constant (K) between the antigen and the antigen-binding protein. DAffinity is expressed as 1 / K and is an indicator of the binding strength between the antigenic determinant and the antigen-binding site on the antigen-binding protein. Alternatively, affinity is expressed as 1 / K D The affinity constant (K A It can also be expressed as ). Affinity can be determined in a known manner depending on the specific combination of the antigen-binding protein and the target antigen. Avidity is understood herein to refer to the binding strength of a target molecule having multiple binding sites by a larger complex of binding substances, i.e., the binding strength of a multivalent bond. Avidity is related to both the affinity between the antigenic determinant on the antigen-binding molecule and its antigen-binding site, and the number of binding sites present on the antigen-binding molecule. On the other hand, affinity refers to a simple monovalent receptor-ligand system.
[0053] Generally, the antigen-binding protein of the present invention, which has the ability to bind to TeNT, is approximately 10 -5 ~10 -12 M or less, and preferably 10 -7 ~10 -12 M or less, and more preferably 10 -8 ~10 -12 Dissociation constants less than or equal to M (K D ) and / or at least 10 -7 M, preferably at least 10 -8 M, more preferably at least 10 -9 M, for example, at least 10 -10 , 10 -11 , 10 -12 It binds to TeNT with a binding affinity of M or higher. 10 -4 Any K greater than M DValues (i.e., less than 100 μM) are generally considered to indicate nonspecific binding. Preferably, the polypeptide of the present invention binds to TeNT with an affinity of less than 500 nM, preferably less than 200 nM, more preferably less than 10 nM, for example less than 500 pM. Specific binding of an antigen-binding protein to an antigen or antigenic determinant can be determined by any suitable method known in itself, including, for example, Scatchard analysis and / or competitive binding assays, such as radioimmunoassays (RIA), enzyme immunoassays (EIA), and sandwich competitive assays, and different variations thereof that are known in the art.
[0054] Tetanus toxoid is a weakened form of TeNT, such as formaldehyde-treated TeNT. The preferred antigen-binding protein of the present invention, which has the ability to bind to bacterial toxins, such as TeNT, also has the ability to bind to tetanus toxoid. The toxoid-binding ability is advantageous because it allows for the evaluation of the antigen-binding protein according to the present invention without the need to use TeNT.
[0055] Furthermore, the advantages of SDA over classical antibodies, such as binding properties, resistance to denaturation / thermal decomposition, aqueous solubility, in vivo distribution, and tissue penetration, have been addressed.
[0056] However, a drawback of SDA fragments is their relatively short serum half-life once administered to the body; they are eliminated from the blood rapidly. A typical half-life for monovalent VHH can be about 2 hours, but elimination occurs within 1 day (Harmsen, MM et al, Vaccine 23:4926~4934 (2005)). This drawback stems from their relatively low molecular weight. Roughly speaking, molecules with a minimum molecular weight of 50-60 kDa, more preferably 60-70 kDa, have significantly longer half-lives.
[0057] This drawback could be overcome, for example, through continuous intravenous administration of SDA fragments. This approach stems from considerations of animal welfare, practicality, and economics, but it is not the preferred method. For these reasons, other methods have been attempted and found to overcome this problem.
[0058] A widely used approach to reduce the rate of elimination is direct conjugation to a second molecule with an intrinsic long serum half-life. One such method is to increase the hydrodynamic size of the protein by chemical linkage with polyethylene glycol (PEG), which can produce drugs with a final half-life of up to 14 days in humans. Another approach is to express the therapeutic protein as a gene fusion with a native protein with a long serum half-life; 67 kDa serum albumin (SA) or the Fc portion of an antibody (adding an additional 60-70 kDa in its native dimer form depending on glycosylation). This provides a compound with a final half-life of several days in humans.
[0059] In the present invention, a different approach is chosen. The solution provided in the present invention and discussed in more detail below relates to a combination of at least one SDA having the ability to bind to TeNT according to the present invention, coupled via a linker, and at least another SDA targeting another (non-TeNT) protein. As used herein, the other protein that is not a TeNT protein is a protein present in the body of a human or animal, preferably in the blood, preferably a serum protein. Examples of such proteins are discussed below, and their concepts are explained in more detail.
[0060] An example of such a combination is one comprising an SDA according to the present invention having the ability to bind to TeNT, a linker, and another SDA targeting a different (non-TeNT) protein.
[0061] For example, a combination of two or more SDAs having the ability to bind to TeNT, linked via a linker and further linked via a linker to at least one SDA that targets another (non-TeNT) protein, preferably a serum protein, may even be more efficient in neutralizing TeNT. Preferably, the two or more SDAs having the ability to bind to TeNT target different epitopes of TeNT.
[0062] As used herein, any combination of at least one SDA capable of binding to TeNT, at least one linker, and at least one other SDA targeting another (non-TeNT) protein is also referred to as a polypeptide construct. The Examples section below provides sufficient examples of such polypeptide constructs.
[0063] The concept of linkers will be discussed in more detail below. Essentially, the function of a linker is to link SDAs. Linkers are relatively short peptides that adopt an unstructured, flexible three-dimensional structure. In principle, linker peptides should not, or should do not interfere with, the assembly and binding activity of the domains they link, as much as possible.
[0064] The polypeptide construct according to the present invention has a size of approximately 2 × 15 kDa for a polypeptide construct comprising, for example, one SDA capable of binding to a TeNT epitope, a linker, and a second SDA capable of binding to another protein. It has a size of approximately 3 × 15 kDa for a polypeptide construct comprising, for example, one SDA capable of binding to a first TeNT epitope, a second SDA capable of binding to a second TeNT epitope, and a third SDA capable of binding to another protein.
[0065] The advantage of such polypeptide constructs is that, due to their relatively short length, they can be easily chemically synthesized in an economically feasible manner, or the DNA fragment encoding the polypeptide construct can be expressed in a suitable expression system.
[0066] Although there is room for further consideration, such polypeptide constructs still, in principle, have relatively short half-lives (their MW is still less than 50-60 kDa or less than 60-70 kDa). However, once administered to the body, these polypeptide constructs differ significantly from the monomer constructs in that, through their "SDA (Surface Deposition Agent) capable of binding to other proteins," they bind to the other protein, thereby yielding a molecule with a significantly larger size than the polypeptide construct itself. The resulting bound polypeptide construct has a MW significantly greater than 60 kDa.
[0067] This approach has the advantage that polypeptide constructs are easily generated (see above), and at the same time, it solves the problem of the short half-life of small molecules: once administered, a larger molecule is formed that overcomes this problem.
[0068] The other (non-TeNT) protein is preferably a serum protein so that the SDA, which has the ability to bind to the other (non-TeNT) protein, can easily come into close contact with the protein after parenteral administration.
[0069] Accordingly, in one embodiment, the present invention relates to a specific form of the antigen-binding protein of the present invention: a multivalent antigen-binding protein. A multivalent antigen-binding protein comprises the amino acid sequence of at least one antigen-binding protein having the ability to bind to TeNT as defined herein, and at least one antigen-binding protein having the ability to bind to a serum protein. The amino acid sequences of at least two antigen-binding proteins are usually fused head-to-tail, i.e., the C-terminus of the N-terminal sequence is fused to the N-terminus of the second sequence, etc. The amino acid sequences of at least two antigen-binding proteins may be linked directly or fused via a linker or spacer. The multivalent antigen-binding protein of the present invention may be produced by the expression of a nucleotide sequence encoding a multivalent protein, provided that two or more coding sequences of the antigen-binding protein are operably linked together within the same reading frame. Those skilled in the art will understand how to operably fuse protein coding sequences.
[0070] Accordingly, in another aspect, the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to a serum protein. Two or more amino acid sequences are preferably linked together by gene fusion, wherein the nucleotide sequences encoding each amino acid sequence are linked together in-frame and operably by means known in the art. The amino acid sequences may be linked directly or, optionally, via spacer or linker amino acid sequences.
[0071] Furthermore, the serum protein is preferably a relatively large protein: the size of the product formed after the polypeptide construct binds to the serum protein should preferably exceed 60 kDa to achieve a longer half-life. Examples of large serum proteins include, among others, serum albumin and serum immunoglobulins (Ig), such as immunoglobulin G (IgG).
[0072] Accordingly, a preferred embodiment of this part of the present invention relates to a polypeptide construct comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to a serum protein, wherein the serum protein is serum albumin, preferably from horse, pig, cat, or dog serum albumin.
[0073] In a preferred embodiment, a polypeptide construct comprising at least one SDA having the ability to bind to serum proteins according to the present invention and at least one SDA having the ability to bind to TeNT has at least one SDA that binds to a linear epitope and at least a second SDA that binds to a higher-order epitope. More preferably, the construct has one SDA that binds to a linear epitope and two SDAs that bind to higher-order epitopes.
[0074] Accordingly, a highly preferred embodiment relates to a polypeptide construct comprising at least one antigen-binding protein, preferably SDA, having the ability to bind to a serum protein, and at least first and second antigen-binding proteins, preferably SDA each, having the ability to bind to a bacterial toxin, preferably Clostridium toxin, more preferably Clostridium tetanus, Clostridium botuli (Cl. botuli), or Clostridium difficile (Cl. Difficile) toxin, most preferably TeNT, wherein the first toxin-binding protein binds to a linear epitope, more preferably the first toxin-binding protein binds to a linear epitope, and the second toxin-binding protein binds to a higher-order epitope.
[0075] Another highly preferred embodiment relates to a polypeptide construct comprising at least first and second antigen-binding proteins, preferably each SDA, having the ability to bind a bacterial toxin, preferably Clostridium toxin, more preferably Clostridium tetanus, Clostridium botulinum, or Clostridium difficile toxin, most preferably TeNT, wherein the first toxin-binding protein binds to a linear epitope, more preferably the first toxin-binding protein binds to a linear epitope and the second toxin-binding protein binds to a higher-order epitope.
[0076] Serum albumin is present in the body at relatively high concentrations. This means that a polypeptide construct according to the present invention, which includes at least one antigen-binding protein capable of binding to serum albumin, will readily form a large product through binding to serum albumin once administered into the body. Nevertheless, even in the case of an antigen-binding protein capable of binding to serum albumin, K D The value is preferably low, for example, less than 1 microM. The present invention provides antigen-binding proteins having the ability to bind to serum albumin. Six examples of such antigen-binding proteins and their sequences are shown in Figure 3. The three shaded regions indicate the location of the highly variable region or complementarity-determining region (CDR). The present invention, in fact, provides low K values, as can be seen in Table 28. D This provides SDA that binds to serum albumin at a concentration of (0.5~300 nM).
[0077] Table 18 and Figure 6 in the Examples section show, among other things, the results of the half-lives in pigs for various polypeptide constructs in which the TeNT-binding SDA according to the present invention is coupled with the serum albumin-binding SDA according to the present invention. As is immediately apparent from the table, such polypeptide constructs have a surprisingly long average half-life of 100–150 hours. A similar half-life (117 hours) has been reported for other albumin half-life-extending single-domain antibodies (Hoefman et al., 2015). Table 33 in the Examples section (Example 23) shows the surprising finding that the polypeptide construct (in which the TeNT-binding SDA according to the present invention is coupled with the serum albumin-binding SDA according to the present invention) had an average half-life of 396–609 hours when administered to horses. A preferred polypeptide construct according to the present invention, comprising at least one SDA according to the present invention having the ability to bind to TeNT, and at least one SDA according to the present invention having the ability to bind to serum proteins (e.g., SVA12), has an average half-life of at least 200 hours, preferably at least 250 hours, more preferably at least 300 hours, even more preferably at least 350 hours, even more preferably at least 375 hours, even more preferably at least 380 hours, even more preferably at least 390 hours, even more preferably at least 395 hours, even more preferably at least 450 hours, even more preferably at least 475 hours, even more preferably at least 500 hours, even more preferably at least 550 hours, and most preferably at least 600 hours, wherein the half-life is preferably the half-life in horses, and more preferably as determined in Example 23.
[0078] Even more surprisingly, the present invention provides SDAs that exhibit a wide range of interspecies binding. Interspecies binding is understood to mean binding to serum albumins of two or more species. Six examples of SDAs having the ability to bind to serum albumins according to the present invention, and their sequences, are provided in Table 6 and discussed below.
[0079] An obvious advantage of SDAs having interspecies binding, i.e., the ability to bind to serum albumin of two or more animal species, is that such SDAs can be used in polypeptide constructs according to the present invention that are usable for two or more animal species.
[0080] Accordingly, in another embodiment, the present invention relates to an antigen-binding protein that specifically binds to serum albumin, and preferably comprises an amino acid sequence including four framework regions FR1 to FR4 and three complementarity-determining regions CDR1 to CDR3 that are operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Preferably, CDR1 has an amino acid sequence selected from the group consisting of the CDR1 sequence of VHH sequence numbers 37-42, as shown in Figure 2, or an amino acid sequence in which one or two amino acid residues are different from CDR1; b) CDR2 has an amino acid sequence selected from the group consisting of the CDR2 sequence of VHH sequence numbers 37-42, as shown in Figure 2, or an amino acid sequence in which one, two, three, or four amino acid residues are different from CDR2; and c) CDR3 has an amino acid sequence selected from the group consisting of the CDR3 sequence of VHH sequence numbers 37-42, as shown in Figure 2, or an amino acid sequence in which one, two, three, four, or five amino acid residues are different from CDR3; however, each framework region has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity with any one of the framework amino acid sequences of sequence numbers 37-42, as shown in Figure 2. Preferably, CDR1, CDR2, and CDR3 are derived from the same sequence number. More preferably, the framework region is derived from the same sequence number as the complementarity-determining region. In other words, in this embodiment, the present invention relates to an antigen-binding protein, preferably an SDA, having the ability to bind to serum albumin, having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of sequence numbers 40, 37, 38, 39, 41, or 42, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. Preferably, the antigen-binding protein has the ability to bind to serum albumin of horse, pig, cat, or dog.
[0081] Preferably, the antigen-binding protein having the ability to bind to serum albumin according to the present invention has overall sequence identity of a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41, and 42, in such preferred order, which is greater than 70%, for example, greater than at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%. Preferably, the level of identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0082] Alternatively, or in combination with the previous embodiments, in a preferred embodiment, the sequence identities of the CDR1, CDR2, and CDR3 regions are at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%, in the following preferred order. These sequence identities can be determined independently of each other.
[0083] Accordingly, a preferred embodiment of this embodiment relates to an antigen-binding protein having the ability to bind to serum albumin according to the present invention, having an overall amino acid sequence identity of at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. Therefore, a more preferred embodiment of this embodiment is an antigen-binding protein having the ability to bind to serum albumin according to the present invention, comprising a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41, and 42, and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 The present invention relates to antigen-binding proteins having overall amino acid sequence identity of 96, 97, 98, 99, or even 100%, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%.
[0084] As described above, antigen-binding proteins that have the ability to bind to serum albumins of two or more animal species have the advantage of being usable in two or more animal species and usable in polypeptide constructs according to the present invention. The present invention provides several antigen-binding proteins that have the ability to bind to serum albumins exhibiting such interspecies binding. As can be seen in Table 6, SVA12L (SEQ ID NO: 40) and SVA06L (SEQ ID NO: 39) in particular provide strong interspecies binding in the sense that they bind to serum albumins of dogs, horses, cats, and pigs. Similarly, as can be seen in Tables 6 and 28, SVA16L (SEQ ID NO: 37) in particular provides strong interspecies binding in the sense that it binds to serum albumins of dogs, horses, and cats.
[0085] Therefore, a more preferred embodiment of this model has overall amino acid sequence identity of at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% with a sequence selected from the group consisting of SEQ ID NOs: 37, 39, and 40, however The present invention relates to an antigen-binding protein having the ability to bind to serum albumin, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%, preferably at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%.
[0086] Accordingly, a more preferred embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to serum albumin, wherein the at least one antigen-binding protein having the ability to bind to serum albumin is preferably the antigen-binding protein according to the present invention as referenced above.
[0087] Another preferred embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to a serum protein, wherein the serum protein is an immunoglobulin.
[0088] A more preferred embodiment of this model relates to a polypeptide construct according to the present invention comprising at least one antigen-binding protein having the ability to bind to TeNT, and at least one antigen-binding protein having the ability to bind to a serum protein, wherein the serum protein is IgG immunoglobulin, preferably horse, pig, mouse, guinea pig, human, cattle, cat, or canine IgG immunoglobulin.
[0089] Immunoglobulins, like serum albumin, are present in the body at relatively high concentrations. This means that a polypeptide construct according to the present invention, comprising at least one antigen-binding protein capable of binding to immunoglobulins, will readily form large products through binding with serum immunoglobulins once administered to the body. Nevertheless, even in the case of antigen-binding proteins capable of binding to immunoglobulins, low potassium D A value of, for example, less than 1 μM is preferred.
[0090] The present invention is suitable for K D Provides an antigen-binding protein that binds to Ig and has low K. D Eight examples of antigen-binding proteins according to the present invention that bind to immunoglobulins and possess the following properties, along with their sequences, are provided in Figure 2. Three shaded regions indicate the location of highly variable regions or complementarity-determining regions (CDRs).
[0091] Accordingly, in another embodiment, the present invention relates to an antigen-binding protein that specifically binds to immunoglobulin (Ig), and preferably comprises an amino acid sequence including four framework regions FR1 to FR4 and three complementarity-determining regions CDR1 to CDR3 that are operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Preferably, CDR1 has an amino acid sequence selected from the group consisting of the CDR1 sequence of VHH sequence numbers 27-34, or an amino acid sequence that differs from CDR1 in one or two amino acid residues, as shown in Figure 3; b) CDR2 has an amino acid sequence selected from the group consisting of the CDR2 sequence of VHH sequence numbers 27-34, or an amino acid sequence that differs from CDR2 in one, two, three, or four amino acid residues, as shown in Figure 3; and c) CDR3 has an amino acid sequence selected from the group consisting of the CDR3 sequence of VHH sequence numbers 27-34, or an amino acid sequence that differs from CDR3 in one, two, three, four, or five amino acid residues, as shown in Figure 3, provided that each of the framework regions has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity with any one of the framework amino acid sequences from sequence numbers 27-34, as shown in Figure 3. Preferably, CDR1, CDR2, and CDR3 are derived from the same sequence number. More preferably, the framework region is derived from the same sequence number as the complementarity-determining region. In other words, in this embodiment, the present invention relates to an antigen-binding protein having the ability to bind to immunoglobulin (Ig), preferably a single-domain antibody (SDA), which has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of sequence numbers 30, 27, 28, 29, 31, 32, 33, or 34, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.
[0092] Preferably, the antigen-binding protein having the ability to bind to Ig has overall sequence identity in such preferred order with a sequence selected from the group consisting of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, and 34, which is greater than 70%, for example, greater than at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%. Preferably, the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0093] Accordingly, a preferred embodiment of this designation relates to an antigen-binding protein having the ability to bind to Ig according to the present invention, having overall amino acid sequence identity of at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0094] More preferably, the SDA having the ability to bind to Ig is a sequence selected from the group of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, or 34, and more than 70% of the following sequences, for example in the preferred order below: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 The overall homology level is above 98, 99, or even 100%, however, preferably the identity levels of the CDR1, CDR2, and CDR3 regions are 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%, in the following preferred order.
[0095] Therefore, a more preferred embodiment of this model is a sequence selected from the group consisting of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, and 34, and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% overall The present invention relates to an antigen-binding protein having the ability to bind to Ig, which has amino acid sequence identity, wherein the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.
[0096] According to Table 7, SVG23 is specific to dogs, while SVG03 is specific to horses.
[0097] Even more surprisingly, the present invention provides SDAs that have the ability to bind to Ig exhibiting heterogeneous binding over a wide range. Again, as can be seen in Table 7, SVG06 and SVG13 in particular achieve very strong heterogeneous binding, meaning they bind to Ig (Fab fragments) from, for example, cats, dogs, horses, humans, and pigs. Again, according to Table 7, SVG24 in particular achieves very strong heterogeneous binding, meaning it binds to both dog and horse Ig (Fc fragments).
[0098] Accordingly, a more preferred embodiment of this embodiment relates to an antigen-binding protein having the ability to bind to Ig according to the present invention, having at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% overall amino acid sequence identity, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0099] A more preferred embodiment of this model is a sequence selected from the group consisting of SEQ ID NOs: 27, 30, 31, 32, and 33, and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% of the overall The present invention relates to an antigen-binding protein having the ability to bind to Ig, which has amino acid sequence identity, wherein the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.
[0100] Accordingly, another more preferred embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to a serum protein, wherein the serum protein is Ig, and the at least one antigen-binding protein having the ability to bind to Ig is preferably the antigen-binding protein according to the present invention as referenced above.
[0101] It should be noted that, generally speaking, the order of various antigen-binding proteins within the polypeptide construct according to the present invention (their positions relative to the N-terminus and C-terminus of the polypeptide construct) can vary. This is due to the fact that the hinge(s) adopt an unstructured, flexible three-dimensional structure; their primary function is to bind to various antigen-binding proteins.
[0102] As suggested above, in one embodiment, the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and at least one antigen-binding protein having the ability to bind to a serum protein. Even more surprisingly, an unexpected synergistic effect was found with the polypeptide construct according to the present invention comprising two or more SDAs having the ability to bind to TeNT. The divalent construct achieves a stronger level of binding to TeNT than, for example, a mixture of two monovalent constructs in a mouse toxin neutralization test. This effect is even more significant when the polypeptide construct comprises two or more TeNT-binding SDAs that bind to different epitopes of TeNT. This can be seen from Table 15, which outlines the epitope-binding properties of various TeNT-binding SDAs according to the present invention.
[0103] As is readily apparent from Table 12, five different options were identified for SDAs capable of binding to TeNT: Option A; SVT02, Option B; SVT03, Option C; SVT15, Option D; SVT06 / 08, and Option E; SVT13 / 16 / 22 / 34.
[0104] For example, a polypeptide construct comprising two SDAs—(i) an SDA having the ability to bind to TeNT and having an amino acid sequence based on SEQ ID NO: 17, and (ii) an SDA having the ability to bind to TeNT and having an amino acid sequence based on SEQ ID NO: 15—was found to produce a strong synergistic effect. The TeNT neutralizing ability of such a construct was significantly stronger than that of single SVT-06 and SVT-16 SDAs (see Tables 19 and 20, and Example 17).
[0105] For these reasons, in a more preferred embodiment, the polypeptide construct according to the present invention comprises at least two antigen-binding proteins having the ability to bind to TeNT according to the present invention. Preferably, each of the at least two antigen-binding proteins having the ability to bind to TeNT has at least 70% overall amino acid sequence identity with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, provided that at least two SDAs do not contain sequences derived from the same option, and the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%. In other words, each of the at least two antigen-binding proteins having the ability to bind to TeNT, (i) Sequence ID 24; (ii) Sequence ID 25; (iii) Sequence ID 20; (iv) Sequence ID 17 or Sequence ID 19; and (v) Sequence ID 22, Sequence ID 15, Sequence ID 23, or Sequence ID 14; A sequence selected from the group consisting of the following has at least 70% overall amino acid sequence identity, However, the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions must be at least 75%.
[0106] The polypeptide construct according to the present invention preferably comprises two, three, or four antigen-binding proteins having the ability to bind to TeNT according to the present invention, more preferably two or three, most preferably two antigen-binding proteins having the ability to bind to TeNT. In a preferred embodiment, the polypeptide construct according to the present invention comprises two antigen-binding proteins having the ability to bind to TeNT, and the sequence: (i) Sequence ID 15 and Sequence ID 17; (ii) Sequence ID 24 and Sequence ID 17; (iii) Sequence ID 20 and Sequence ID 17; (iv) Sequence ID 15 and Sequence ID 24; or (v) Sequence ID 24 and Sequence ID 20; It has at least 70% overall amino acid sequence identity, with at least 75% amino acid sequence identity in the CDR1, CDR2, and CDR3 regions.
[0107] The polypeptide construct according to the present invention preferably comprises one antigen-binding protein having the ability to bind to a serum protein.
[0108] As merely an example: Such a polypeptide construct according to the present invention may include, for example, an SDA having the ability to bind to TeNT, option C; having at least 70% overall amino acid sequence identity with SEQ ID NO: 20, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%. Furthermore, an SDA having the ability to bind to TeNT may also include option D; having at least 70% overall amino acid sequence identity with SEQ ID NO: 17, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.
[0109] Preferably, the antigen-binding protein having the ability to bind to TeNT of such a construct has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%, overall amino acid sequence identity with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14.
[0110] More preferably, the antigen-binding protein of such a construct comprises a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 The CDR1, CDR2, and CDR3 regions have an overall amino acid sequence identity of 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%, and the CDR1, CDR2, and CDR3 regions have an overall amino acid sequence identity of at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.
[0111] In a more preferred embodiment, the polypeptide construct according to the present invention comprises an antigen-binding protein having a sequence as shown in SEQ ID NO: 15, an antigen-binding protein having a sequence as shown in SEQ ID NO: 17, and an antigen-binding protein having a sequence as shown in SEQ ID NO: 40. More preferably, the polypeptide construct comprises SDA(SVT-06) having a sequence as shown in SEQ ID NO: 17, SDA(SVT16) having a sequence as shown in SEQ ID NO: 15, and SDA(SVA12) having a sequence as shown in SEQ ID NO: 40, in a specific order of N-terminus-SEQ ID NO: 17-SEQ ID NO: 15-SEQ ID NO: 40-C-terminus. More preferably, the polypeptide construct has an amino acid sequence such as that shown in SEQ ID NOs. 51, 77, or 78, preferably 51, or SEQ ID NOs. 51, 77, or 78, preferably 51 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94 The polypeptide construct has an amino acid sequence having sequence identity of 95, 96, 97, 98, 99, or preferably 100%, provided that the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NOs. 51, 77, or 78, preferably 51.
[0112] In a very preferred embodiment, the polypeptide construct has an amino acid sequence as shown in SEQ ID NO: 51, or SEQ ID NO: 51 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, the polypeptide construct has an amino acid sequence with 100% sequence identity, provided that the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, and most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO: 51.
[0113] In a very preferred embodiment, the polypeptide construct has an amino acid sequence as shown in SEQ ID NO: 77, or SEQ ID NO: 77 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, the polypeptide construct has an amino acid sequence with 100% sequence identity, provided that the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, and most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO: 77.
[0114] In a very preferred embodiment, the polypeptide construct has an amino acid sequence as shown in SEQ ID NO: 78, or SEQ ID NO: 78 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, the polypeptide construct has an amino acid sequence with 100% sequence identity, provided that the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, and most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO: 78.
[0115] In its most preferred form, the polypeptide construct according to the present invention has a sequence such as that shown in SEQ ID NOs: 51, 47, 48, 52, 53, 61, 62, 49, 50, 77, or 78, preferably as that shown in SEQ ID NOs: 51, 47, 48, 52, 53, 61, 62, 49, 77, or 78, more preferably as that shown in SEQ ID NOs: 51, 47, 48, 52, 53, 61, 62, or 49, most preferably as that shown in SEQ ID NO: 51, wherein the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.
[0116] Surprisingly, it was also observed that different combinations of SDAs according to the present invention, when mixed together, showed a stronger toxin neutralizing effect in the mouse tetanus toxin neutralization test (TNT). This is shown in Tables 21 to 23 of the Examples section. Tables 21 and 24 show the various combinations that were tested. Table 24 shows that the single SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 achieved 50% protection in mice at a given dilution, while the combination of SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 achieved 100% protection in mice at the same dilution.
[0117] As described above, the various SDAs in the polypeptide construct according to the present invention are preferably linked to each other via a linker peptide. A linker peptide is a sequence of amino acids commonly used to physically link polypeptide domains.
[0118] Such linkers can be any linkers known to those skilled in the art. For example, a linker can be a biocompatible polymer having a length of 1 to 100 atoms. This can be a polymer existing as, for example, poly-lysine, poly-glycine, poly-glutamic acid, poly-isoleucine, poly-serine, or poly-arginine residues, or in combination thereof. Most linker peptides consist of repeating modules of one or more amino acids, glycine and serine. As just an example, such a linker could have, for example, the following sequence: Gly4-Ser-Gly3-Ser, or (Gly4-Ser) n However, n is 2, 3, 4, 5, or 6, preferably 4, 5, or 6.
[0119] Preferably, a 15-amino acid (G4S)3 linker consisting of three consecutive repeats of the amino acid sequence (Gly)4-Ser is used. This linker was first used in the production of single-chain Fv
[27] , but is also frequently used in VHH fusions
[28] . It is a flexible linker that facilitates independent binding to different antigen sites. This linker peptide has been well characterized in the art (e.g., in the context of antibody single-chain Fv (scFv) domains) and has been shown to adopt an unstructured, flexible three-dimensional structure. Furthermore, this linker peptide does not interfere with the assembly and binding activity of the domain to which it binds (Freund, C. et al., FEBS 320:97 (1993)). Other examples of preferred hinges are presented, in particular, in European Patent No. 2655624.
[0120] Other rigid linkers for protein domain fusion are also known. Huston JS, et al., Proc Natl Acad Sci. 1988;85:5879~83,
[28] Mukherjee J, et al., PLoS ONE. 2012;7:e29941,
[29] Sepulveda J, et al., Infect Immun. 2010;78:756~63,
[30] Vance DJ, et al., J Biol Chem. 2013;288:36538~47,
[31] Klein JS, et al., Protein Eng Des Sel. 2014;27:325~30, Trinh R, et al., Mol Immunol. 2004;40:717-22.
[0121] The Examples section (see below) shows examples of linkers used in the present invention.
[0122] In a further embodiment, the present invention relates to a DNA fragment encoding an antigen-binding protein according to the present invention, or a polypeptide construct according to the present invention. Such a DNA fragment contains genetic information encoding an SDA or polypeptide construct.
[0123] In another aspect, the present invention relates to nucleic acids comprising a DNA fragment encoding an antigen-binding protein according to the present invention, or a polypeptide construct according to the present invention as defined herein. Preferred nucleic acids according to the present invention are nucleic acid constructs, such as plasmids, in which the DNA fragment is operably linked to a promoter and, optionally, other regulatory elements, such as terminators, enhancers, polyadenylation signals, signal sequences for secretion, etc. Such nucleic acid constructs are particularly useful for producing the antigen-binding protein or polypeptide construct of the present invention using recombinant techniques to express a nucleotide sequence (DNA fragment) encoding a target antigen-binding protein in a suitable host cell, as described, for example, Ausubel et al., "Current Protocols in Molecular Biology," Greene Publishing and Wiley Interscience, New York (1987) and in Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3rd edition)," Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York). As used herein, the term "operably linked" refers to the linkage of functionally related polynucleotide elements. Nucleic acids are "operably linked" when they are positioned in a functionally related manner to another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of that coding sequence. "Operatally linked" means that the linked DNA sequences are generally contiguous, and, if necessary, contiguous and within a reading frame when it is necessary to link two protein-coding regions.
[0124] A suitable promoter is one that is recognized within a host cell and promotes the expression of the gene it controls within that host cell. Suitable promoter / host cell combinations have been known in the art for several decades.
[0125] Such nucleic acids can be inserted into suitable host cells, enabling the expression of antigen-binding proteins or polypeptide constructs under the control of a suitable promoter.
[0126] Expression of DNA fragments containing nucleic acids encoding any of the SDAs or polypeptide constructs according to the present invention is possible in prokaryotic and eukaryotic host cells. All of these intracellular host cell expression systems have been known in the art for several decades.
[0127] A classic textbook describing a vast number of expression systems is "Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems" by Gerd Gellissen (ed.). ISBN: 978-3-527-31036-4, December 2004, Publisher: Wiley-Blackwell.
[0128] An overview of methods for expressing heterologous proteins in insect cells can be found in “Opportunities and challenges for the baculovirus expression system,” (Monique M. van Oers, Journal of Invertebrate Pathology, Volume 107, Supplement, July 2011, Pages S3-S15). Specific methods for expressing camel SDA in lower eukaryotic hosts, such as filamentous fungi and yeasts, are particularly presented in European Patent No. 0698097. Furthermore, the Examples section, more specifically Examples 6 and 14 (see below), provides detailed examples of SDA expression in yeast.
[0129] Accordingly, in a further embodiment, the present invention relates to a host cell comprising the nucleic acid as defined above. Preferably, the host cell is a host cell for producing an antigen-binding protein or a polypeptide construct according to the present invention.
[0130] The host cell may be any host cell capable of producing the antigen-binding protein of the present invention, including, for example, prokaryotic host cells such as Escherichia coli, or (cultured) mammalian, plant, insect, fungal, or yeast host cells, including CHO- cells, BHK- cells, human cell lines (including HeLa, COS, and PER.C6), Sf9 cells, and Sf+ cells. However, preferred host cells for producing the antigen-binding protein of the present invention are eukaryotic microorganisms, such as yeast or filamentous fungi. Preferred yeast host cells include, for example, Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Pichia angusta, and Kluyveromyces lactis. Preferred strains, constructs, and fermentation conditions for producing the antigen-binding protein of the present invention have been described by van de Laar et al. (2007, Biotechnology and Bioengineering, Vol.96, No.3:483~494). For example, the production of the antigen-binding protein can be carried out in a standard bioreactor having a working volume of 10 to 10,000 liters.
[0131] In another aspect, the present invention relates to a method for producing an antigen-binding protein or polypeptide construct according to the present invention, comprising the steps of: a) culturing host cells containing the antigen-binding protein or polypeptide construct according to the present invention under conditions that enable the expression of the antigen-binding protein or polypeptide construct; and optionally b) recovering, collecting, or purifying the antigen-binding protein or polypeptide construct from at least one of the host cells and the culture medium. Preferred conditions may include the use of a suitable medium, the presence of a suitable food source and / or suitable nutrients, a suitable temperature, and optionally the presence of a suitable inducer or compound (for example, when the nucleotide sequence of the present invention is under the control of an inducible promoter); all of these may be selected by those skilled in the art. Under such conditions, the amino acid sequence of the present invention may be expressed in a constitutive manner, in a transient manner, or only when suitably induced. The antigen-binding proteins of the present invention can then be isolated from host cells / host microorganisms and / or from the culture medium on which the host cells or host microorganisms are cultured using the isolation and / or purification techniques of proteins known in themselves, such as (concoctional) chromatography and / or electrophoresis, differential precipitation, affinity techniques (e.g., using a specific cleavable amino acid sequence fused with the amino acid sequence of the present invention), and / or concocted immunological techniques (i.e., using an antibody against the antigen-binding protein to be isolated). In one embodiment, the produced and optionally recovered antigen-binding proteins or polypeptide constructs are further mixed with a pharmaceutically acceptable carrier.
[0132] In another embodiment, the present invention relates to a pharmaceutical composition comprising at least one polypeptide construct according to the present invention, comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and / or at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and a pharmaceutically acceptable carrier. In a more preferred embodiment, the pharmaceutical composition comprises at least one polypeptide construct according to the present invention, comprising at least two antigen-binding proteins having the ability to bind to TeNT according to the present invention, and / or at least two antigen-binding proteins having the ability to bind to TeNT according to the present invention.
[0133] A pharmaceutically acceptable carrier, as used herein, may be as simple as possible, such as sterile water, physiological saline, or a buffer, such as a buffered aqueous solution at physiological ionic strength and / or osmotic pressure (e.g., PBS).
[0134] The formulation of pharmaceuticals, methods of administration, and the use of pharmaceutically acceptable additives are publicly known and customary in the art, as described, for example, in Remington; The Science and Practice of Pharmacy, 21st Edition 2005, University of Sciences in Philadelphia. The pharmaceutical compositions and pharmaceuticals according to the present invention are preferably formulated for intravenous, subcutaneous, or intramuscular administration, however, other routes of administration, such as by injection, such as mucosal administration, or intradermal and / or intracutaneous administration, are conceivable.
[0135] Such compositions, as well as the antigen-binding proteins and / or polypeptide constructs according to the present invention, can be successfully used in the treatment or prevention of clinical diseases following tetanus infection.
[0136] Accordingly, in a further embodiment, the present invention relates to an antigen-binding protein or polypeptide construct according to the present invention for use as a pharmaceutical.
[0137] In a further embodiment, the present invention relates to an antigen-binding protein, and / or a polypeptide construct, and / or a pharmaceutical composition, according to the present invention, for use in the prevention or treatment of post-tetanus disease. In other words, in this embodiment, the present invention relates to the use of an antigen-binding protein, and / or a polypeptide construct, according to the present invention, for the production of a pharmaceutical for the prevention or treatment of post-tetanus disease. Alternatively, in this embodiment, the present invention relates to a method for preventing or treating post-tetanus disease, wherein a subject in need is administered a therapeutically sufficient amount of the antigen-binding protein and / or a polypeptide construct, according to the present invention. Accordingly, in this embodiment, the antigen-binding protein, polypeptide construct, and / or pharmaceutical composition, according to the present invention, are used to prevent or treat tetanus.
[0138] As used herein, the terms “to treat,” “treatment,” or “treating” mean applying or administering the antigen-binding proteins, polypeptide constructs, and / or pharmaceutical compositions of the present invention to a subject having tetanus, for the purpose of curing, partially or completely improving, alleviating, improving, inhibiting, delaying, suppressing, slowing, or stopping the progression or severity of tetanus, or symptoms associated with tetanus. The term “to treat” includes reducing or alleviating at least one side effect or symptom of tetanus. Treatment is generally considered “effective” if one or more symptoms or clinical markers are reduced. Or, treatment is considered “effective” if the progression of tetanus is reduced or stopped. That is, “treatment” includes not only improvement of symptoms or markers, but also stopping, or at least delaying, the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, the alleviation of one or more symptoms, whether detectable or undetectable; a reduction in the scope of the disease; a stabilized (i.e., non-worsening) state of the disease; a delay or slowing of disease progression; improvement or mitigation of the disease state; and remission (whether partial or total). The term “treatment” in relation to tetanus also includes achieving relief of the symptoms or side effects of tetanus (including palliative treatment). As used herein, the terms “prevention,” “prevention,” or “prophylactic” (also called “prophylactic”) mean applying or administering the antigen-binding proteins, polypeptide constructs, and / or pharmaceutical compositions according to the present invention to subjects at risk of developing tetanus, with the aim of preventing, alleviating, improving, reducing, inhibiting the progression, decreasing the severity, and / or reducing the morbidity of one or more symptoms or characteristics of future tetanus disease. Accordingly, the antigen-binding protein, polypeptide construct, or pharmaceutical composition according to the present invention may be administered to subjects who do not show signs of tetanus and / or subjects who show only early signs of tetanus, with the aim of reducing the risk of developing pathologies associated with tetanus.
[0139] In one embodiment, the subject is a human, preferably a mammal, more preferably a non-human mammal, and even more preferably an animal including a horse, dog, cat, pig, or a member of the Bovidae family of the Ruminant family (e.g., cow, goat). Preferred subjects according to the present invention are, for example, wild horse (Equus ferus), African wild ass (Equus africanus), domestic dog (Canis familiaris), domestic cat (Felis catus), pig (Sus scrofa domesticus), cow (Bos taurus), sheep (Ovis aries), and goat (Capra aegagrus hircus), most preferably wild horse.
[0140] Passive immunization against TeNT using the antigen-binding protein or polypeptide construct according to the present invention can be used in at least three different scenarios. For example, in a prophylactic scenario as part of a standard preoperative procedure, or in a prophylactic scenario in a subject that has been injured and possibly infected with tetanus, but has not yet developed the disease. Thirdly, in a therapeutic scenario when the subject has developed tetanus. Depending on whether it is a prophylactic or therapeutic treatment, there are differences in dosage, for example, in the latter case the dose is 2 to 20 times higher depending on the species. A small antitoxin dose (e.g., 1000 IU) may also be administered topically near the wound site. Several routes of administration are applicable, such as intramuscular, subcutaneous, intravenous, epidural, subarachnoid, or intrathecal routes. The antigen-binding protein and / or polypeptide construct according to the present invention, which can efficiently neutralize tetanus toxin, can be used in the following manner. The administered preparation should preferably cause a blood concentration of at least 0.01 to 0.1 IU / ml. Therefore, the dosage is preferably based on body weight / blood volume.
[0141] As a simple example: In established human cases, patients should receive 500-1000 IU / kg intravenously or intramuscularly. For SDA SVT06-SVT16-SVA12 (SEQ ID NO: 51), this results in a maximum dosage of 0.5-1 mg / kg. For small animals (cats and dogs), when administering classic equine antitoxin products to established cases, the dose is 100-1000 IU / kg intravenously. For SDA SVT06-SVT16-SVA12, this results in a maximum dosage of 0.1-1 mg / kg. Larger animals receive proportionally lower doses than smaller animals. For example, horses may receive 7500-11000 IU intramuscularly or subcutaneously as preoperative treatment, while foals up to 100 kg may receive 3000-4000 IU via either route. Injured horses (not infected with tetanus) may receive 15,000–20,000 IU intramuscularly or subcutaneously as a prophylactic measure; foals up to 100 kg may receive 6,500–8,000 IU via either route. Horses infected with tetanus should receive at least 50,000–60,000 IU via one route (if the preparation allows) or a combination of several routes.
[0142] In clinical cases, tetanus treatment may be repeated daily depending on the observed effect.
[0143] All recommended dosages typically provide passive protection for at least three weeks. Again, just as an example: the half-life of construct SVT06-SVT16-SVA12 (SEQ ID NO: 51) was shown to be such that, as can be seen in Figure 6 of Example 16, after administering 0.3 mg / kg to pigs, a serum level of 0.1 micrograms / ml (equal to greater than 0.1 IU (Example 17, Table 25)) was still detectable 21 days later. When the same construct SVT06-SVT16-SVA12 (SEQ ID NO: 51) was administered to horses (0.17 mg / kg, intramuscularly), it resulted in a serum level of 0.4-0.6 micrograms / ml (Example 23), which is a sufficiently protective level, after 21 days.
[0144] The amount of antitoxin (also called "potency" or "neutralizing capacity") is expressed in International Units (IU). The first milestone in the international standardization of tetanus toxoids was the establishment of an international standard for equine-derived tetanus antitoxin in 1928, which was superseded in 1969 (WHO Expert Committee on Biological Standardization. Twenty-second report. Geneva, World Health Organization, 1970 (WHO Technical Report Series, No. 444)). The availability and use of this preparation allowed for the assessment of toxoids regarding their ability to produce tetanus antitoxin in humans, and enabled the definition of protective units for antitoxins in International Units (IU). Neutralizing capacity can be determined, for example, as shown in Example 17 ("Analysis of SDA for Tetanus Toxin Neutralizing Capacity in a Mouse Model").
[0145] Commercially recommended antitoxin dosages vary by species and are primarily based on experimental data. Several routes of administration are applicable, such as intramuscular, subcutaneous, intravenous, epidural, subarachnoid, or intrathecal routes. Antigen-binding proteins capable of binding to TeNT and efficiently neutralizing tetanus toxin according to the present invention are also available. The antitoxin dose should preferably result in a blood concentration of at least 0.01–0.1 IU / ml. In established human cases, patients are preferably administered 500–1000 IU / kg of equine antitoxin intravenously or intramuscularly. Depending on the preparation used, up to 5000–8000 IU of human antitetanus immunoglobulin may be administered intramuscularly. The preferred dose of the classic equine antitoxin product for established cases in small animals (e.g., cats and dogs) is 100–1000 units / kg by intravenous administration. Larger animals receive proportionally lower doses than smaller animals. For example, horses may receive 7,500–8,500 IU intramuscularly or subcutaneously as preoperative treatment, and foals up to 100 kg may receive 3,000–4,000 IU via either route. Injured horses (not infected with tetanus) may receive 15,000–17,000 IU intramuscularly or subcutaneously as prophylactic treatment, and foals up to 100 kg may receive 6,500–8,000 IU via either route. Horses infected with tetanus are administered at least 50,000 IU, preferably via any route (if the preparation allows) or a combination of several routes. In clinical cases of tetanus, treatment may be repeated daily depending on the observed effect. All recommended dosages, depending on the breed and the treatment performed, usually provide passive protection for a period of 1–3 weeks. In addition to passive immunity, active vaccination, so-called passive-active immunity, should preferably be administered to the target. This provides both short-term (passive) and long-term (active) humoral immunity. When the first immunity wanes, the second immunity emerges, thus avoiding an unprotected window. Active immunity is achievable using formulated tetanus toxoids. Such tetanus-based toxoid vaccines are commercially available.Toxoid-based vaccines can be administered concurrently with SDA-based antitoxins, preferably repeated within 21 days.
[0146] In a further embodiment, the present invention relates to diagnostic tests for detecting, for example, TeNT or anti-TeNT antibodies in bodily fluids. For example, such diagnostic tests aimed at in vitro detection of toxins or anti-TeNT antibodies in the blood of humans or animals are currently very complex and time-consuming. This must be done in light of the fact that, among other things, even very low levels of TeNT in the blood can be highly toxic, and as a result such tests must be very sensitive. The present invention relates to a very high affinity for TeNT (i.e., low K), D We hereby provide antigen-binding proteins exhibiting a specific value. Diagnostic tests based on such antigen-binding proteins are, naturally, highly sensitive, and therefore highly suitable for use in diagnostic tests.
[0147] As just one example of such a test: In the classic sandwich ELISA test, which has been well known in the art for decades, a 96-well plate, or a microwell plate, a lateral flow device carrier material, or even a chip can be coated with one or more antigen-binding proteins according to the present invention. Again, as just one example, SDA SVT06 can be used in the coating step. Due to its excellent affinity properties, SDA SVT06 binds strongly to even trace amounts of TeNT, if present. In the second step, a body fluid to be screened for the presence of TeNT can be added to the wells. If TeNT is present, it binds to SDA SVT06. After the washing step, for example, conjugated SDA SVT15 can be added to the wells. If TeNT is present in the body fluid and therefore bound to SDA SVT06, the conjugated SDA SVT15 can bind to another epitope of the bound TeNT, and in the subsequent color development step, a color reaction occurs, thus revealing its presence, even if it is trace amounts of TeNT.
[0148] Similarly, in tests for detecting antibodies against TeNT in body fluids, antigen-binding proteins having the ability to bind to TeNT according to the present invention are suitable. In such tests, the body fluid to be tested can be mixed with a small amount of toxin. If anti-TeNT antibodies are present, the antibodies will bind to the toxin. Subsequently (preferably after removal of the antibody-TeNT complex), the body fluid can be subjected to the sandwich ELISA described above to determine if the toxin is still present. If it is present, this indicates that the body fluid does not contain anti-TeNT antibodies.
[0149] Similarly, SDAs possessing the ability to bind to TeNT according to the present invention are suitable for tests used to detect TeNT in which the proteolytic cleavage activity of the TeNT L-chain is captured using receptors that bind to the TeNT H-chain. Currently, such binding-cleavage (BINACLE) assays are under development (Behrensdorf-Nicol et al., 2015, ALTEX 32, 137-142). The monovalent VHH described above could serve as the binding domain in such assays. The polyvalent TeNT-binding SDA SVT06-SVT16-SVA12 is more preferable for such applications because it exhibits higher affinity and binds to two different TeNT antigen sites, increasing the chance that it will bind only to the active form of TeNT.
[0150] Accordingly, yet another embodiment of the present invention relates to a diagnostic kit comprising an antigen-binding protein having the ability to bind to TeNT according to the present invention. Such a diagnostic kit may further comprise a 96-well plate, microwell plate, or chip pre-coated with, for example, one or more of the antigen-binding proteins having the ability to bind to TeNT according to the present invention. It may further comprise, for example, one or more of the antigen-binding proteins having the ability to bind to TeNT according to the present invention in a conjugated form, additionally or alternatively. Such a diagnostic kit may further comprise instructions for performing a diagnostic test.
[0151] The present invention also relates to a diagnostic kit for detecting specific types of albumin in processed meat, such as minced beef. For example, such a diagnostic kit intended to detect equine albumin in ground meat in sausage is currently extremely complex and time-consuming. The present invention hereby provides an antigen-binding protein that exhibits high binding ability to equine albumin. Accordingly, the present invention relates to a method for detecting albumin, i) A step of providing an SDA having the ability to bind to serum albumin, preferably having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%; ii) The step of bringing the SDA from step i) into contact with the test sample, iii) A step to detect the possibility of binding between the SDA from step i) and the albumin present in the sample from step ii), This provides a method that includes [something].
[0152] The characteristics and definition of the SDA in step i) are as described separately herein. The sample in step ii) is preferably a sample containing processed meat, more preferably processed meat suspected to contain meat from two or more species. The albumin to be detected is preferably equine albumin. The detection in step iii) can be carried out using any method known in the art, such as ELISA, surface plasmon resonance, or isothermal titration calorimetry. The method is preferably in vitro. Accordingly, the present invention also relates to the use of the SDA in step i) for detecting albumin.
[0153] As just one example of such a test: In the classic sandwich ELISA test, which has been well known in the art for decades, a 96-well plate, or a microwell plate, a sensor, or, for example, a microchip, may be coated with one or more antigen-binding proteins according to the present invention. Again, just as an example, SDA SVA12 or SVA16 may be used in the coating step. Due to their very high binding properties, these SDAs capture albumin, if present, even in trace amounts. In the second step, finely chopped meat dissolved in a liquid to be screened for the presence of albumin can be added to the wells. If albumin is present, it binds to, for example, SDA SVA12 or SVA16. After the washing step, conjugated SDA SVA06 or SVA07 can be added to the wells. If albumin is present in body fluids and therefore bound to SDA SVA12 or SVA16, the conjugated SDA SVA06 or SVA07 will bind to another epitope of albumin, and a color reaction will occur in the subsequent color development step, thus revealing the presence of even trace amounts of albumin.
[0154] The present invention also relates, for example, to a biosensor platform for clarifying the affinity characterization of equine monoclonal antibodies. Such a platform may use, for example, SDA SVG24L to capture equine Ig on a sensor or microchip, after which the interaction with the target protein can be analyzed.
[0155] It is highly preferable to use SDA at low concentrations. To this end, it is preferable that, in addition to rapid association with the toxin, the dissociation from the toxin is sufficiently delayed, and that it can be recirculated for a long period of time in animals (in a toxic state), in order to prevent the toxin from exerting its activity (see Examples 16 and 22).
[0156] [Table 1] TIFF0007857080000002.tif105149
[0157] In this document and its claims, the verb “including” and its conjugations are used in their non-restrictive sense, meaning that the matters following the word are inclusive, but not excluded unless specifically stated. Furthermore, the use of the indefinite article “a” or “an” to refer to an element does not exclude the possibility of two or more elements existing, unless the context explicitly requires the existence of a unique element. The indefinite article “a” or “an” therefore usually means “at least one.”
[0158] When the word “about” or “approximately” is used in relation to a number (e.g., about 10), it preferably means that the number can be a given number (of 10) that is 0.1% greater or less than that number.
[0159] All patents and references cited herein are incorporated herein by reference without exception.
[0160] Unless otherwise stated, the practical application of the present invention employs standard conventional methods of molecular biology, virology, microbiology, or biochemistry. Such techniques are described in Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press; Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols, USA, Volumes 1 and 2; Brown (1998), Molecular Biology LabFax, Second Edition, Academic Press (UK), Volumes 1 and 2; Oligonucleotide Synthesis (edited by N. Gait); and Nucleic Acid Hybridization (edited by Hames and Higgins).
[0161] The following embodiments are provided for illustrative purposes only and are not intended in any way to limit the scope of the present invention. [Examples]
[0162] 1. Immune llamas and generation of phage display libraries Lama (Lama glama) (nos. 9236 and 9237) were immunized using the same method. A commercially available tetanus vaccine (pre-formulated type, based on tetanus toxoid) was administered intramuscularly at a dose of 1 ml per llama into the right thigh, without further adjuvant addition, on days 0, 21, and 42 (DPI) after primary immunization. A target antigen mixture was prepared consisting of 0.5 mg of chrompure horse IgG (Jackson Immunoresearch Laboratories, West Grove, PA), 0.5 mg of chrompure canine IgG (Jackson Immunoresearch Laboratories), 0.5 mg of horse albumin (Rockland Immunochemicals, Limerick, PA), 0.5 mg of canine albumin (Molecular Innovations, Novi, MI), and 8 μg of recombinant tetanus toxin fragment C (rTTC; Reagent Proteins, San Diego, CA). In vitro experiments [5] suggested that fragment C (also named Hc or TTC) is involved in the binding of tetanus toxin to neurons. The antigen mixture was emulsified with Stimune adjuvant (Thermofisher Scientific, Lelystad, the Netherlands) and intramuscularly injected into the left thigh of each llama at 0 and 21 DPI. The same antigen mixture, adjuvanted with IMS1312 adjuvant (Seppic, France), was intramuscularly injected into the left thigh of each llama at 42 DPI. Heparinized blood samples (150 ml) were taken at 28 and 49 DPI, and peripheral blood lymphocytes (PBLs) were rapidly isolated. Blood samples for serum preparation were taken at 0, 28, and 49 DPI.
[0163] Total RNA was extracted from PBL using the RNeasy Maxi kit (Qiagen) and used for dT18 priming and cDNA preparation using Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA). Three PCRs specific to SDA were performed using primers BOLI192 (AACAGTTAAG CTTCCGCTTG CGGCCGCTAC TTCATTCGTT CCTGAGGAGA CGGT, SEQ ID NO: 1), lam07 (AACAGTTAAG CTTCCGCTTG CGGCCGCGGA GCTGGGGTCT TCGCTGTGGT GCG, SEQ ID NO: 2), and a mixture of primers lam08 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTTT GGTGTCTTGG GTT, SEQ ID NO: 3) and BOLI401 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTGT GGTATCTTGG GTT, SEQ ID NO: 4), all in combination with primer VH2B (SEQ ID NO: 64)
[45] . The resulting PCR fragments were digested using PstI and NotI and inserted into the phage display plasmid pRL144
[19] . Using ligation, we performed phenotypic transformation of E. coli TG1 cells (Lucigen, Middleton, WI, USA) via electroporation, and obtained 12 libraries (named pAL808 to pAL819).
[0164] 2. Production of cAb-TT2 single-domain antibody in yeast A single-domain antibody (SDA) cAb-TT2
[46] that binds to tetanus holotoxin but not to rTTC was produced in baker's yeast for use in phage display selection of subsequent TeNT-conjugated SDA. A synthetic gene encoding this SDA as a fusion of a yeast invertase signaling sequence and a 5'-leader was generated as a SacI-BstEII fragment. Insertion of this synthetic gene into plasmid pRL188 resulted in the production of an SDA linked to a llama long-chain hinge region containing a single cysteine and his6-tag[2]. Such an expression format is particularly suitable for immobilization of the SDA onto a solid surface[3]. The cAb-TT2 SDA was produced in baker's yeast strain SU51 on a 150 ml scale, purified by immobilized metal affinity chromatography (IMAC), and a portion of the isolated SDA was biotinylated as previously described[3].
[0165] 3. Phage display selection for TeNT-bound SDA The following reagents were used for phage display selection. Yeast-produced cAb-TT2 is described in previous examples. Tetanus toxin neutralizing mAb TT10 [47, 48] was purchased from the National Institute for Biological Standards and Regulation (NIBSC; Potters Bar, UK). True tetanus holotoxin (TeNT) was purchased from List Biological Laboratories (Campbell, CA), and rTTC is described in Example 1.
[0166] Twelve libraries were used in phage rescue using the helper phage VCSM13, and phage display selection was performed as previously described
[49] . However, the procedure was modified as follows: A 96-well ELISA plate was used as an alternative to an immunotube.
[50] about 10 10 A smaller amount of phage from the transduction unit (TU) was used in each panning. Trypsin was used to elute the phage.
[74] A phage library with three isotypes (hinge primers) was pooled.
[0167] Furthermore, we used concurrent phage ELISA to monitor different panning procedures and determine which panning tests should be used further.
[0168] Phage display libraries were screened in two rounds of phage display selection for SDA bound to directly coated TeNT or rTTC.
[0169] Further selection was performed on TeNTs captured using cAb-TT2 SDA or mAb TT10. Sometimes, different antigens were used in the second phage display round compared to the first round.
[0170] To detect soluble SDA present in 10-fold diluted E. coli culture supernatant binding to directly coated antigens, an ELISA using a mouse mAb anti-myc tag PO-conjugate for SDA detection was performed as previously described
[19] . However, TeNT and rTTC were coated at 1 μg / ml using PBS buffer, while cAb-TT2 was coated at 1 μg / ml in 50 mM carbonic acid / bicarbonate buffer (pH 9.6). Only the absorption values of the SDA clones ultimately expressed in yeast are reported.
[0171] To identify individual TeNT binders, individual clones obtained from the second panning round were inoculated into eight 96-well plates and induced in the 96-well plates for soluble SDA production as previously described
[49] . Tenfold dilutions of E. coli supernatant containing different antigens and soluble SDA were used in ELISA. All clones were screened in ELISA on directly coated TeNT and rTTC, and on cAb-TT2-captured TeNT.
[0172] Furthermore, to detect SDAs that inhibit toxin-receptor interactions, all clones were screened with GT1b-TeNT binding inhibitory ELISA. TeNT-GT1b inhibitory ELISA is best suited for comparing the toxin-binding and neuronal binding blocking capabilities of different SDAs because it does not depend on, for example, biotinylation efficiency, epitope tag accessibility, and denaturation due to the coating procedure.
[0173] GT1b-TeNT inhibition ELISA was performed according to [8]. 96-well polystyrene plates were coated with 10 μg / ml of bovine brain-derived GT1b ganglioside (Sigma Aldrich, St. Louis, MO) in methanol at 100 μl / well, incubated overnight at room temperature (RT). During the overnight incubation period, methanol completely evaporated. All subsequent incubations were performed for 1 hour at RT in PBS containing 0.5% BSA and 0.05% Tween 20, after manually washing the plates with PBS. 1 μg / ml of TeNT (List Biological Laboratories) was pre-incubated with SDA, E. coli culture supernatant, or mAb in isolation 96-well polystyrene ELISA plates at 100 μl / well, and then incubated at RT for 1 hour. Next, 90 μl of these samples were transferred to GT1b-coated plates and incubated at RT for 1 hour. The plates were then incubated with 1000-fold diluted llama 9237 serum (49 DPI) at a concentration of 100 μl / well. Bounded llama IgG was detected using goat anti-llama IgG-PO conjugate (Bethyl Laboratories, Montgomery, TX). Bounded PO was detected by staining with TMB. The reaction was stopped with sulfuric acid, and the absorption at 450 nm was measured using a spectrophotometer.
[0174] To determine the SDA sequence (purified by streaking, single colony harvested), DNA fragments for sequence analysis were obtained by PCR on E. coli TG1 cells using MPE25 (TTTCTGTATGGGGTTTTGCTA, SEQ ID NO: 6) and MPE26 (GGATAACAATTTCACACAGGA, SEQ ID NO: 7) as primers. Sequence analysis was performed using a BigDye Terminator v1.1 cycle sequencing kit and an automated ABI3130 DNA sequencer (Applied Biosystems, Nieuwerkerk a / d IJssel, The Netherlands). The purified PCR fragments were used as templates in combination with the primers MPE25 and RevSeq (TCACACAGGAAACAGCTATGAC, SEQ ID NO: 8). All sequences were determined from two reactions. All sequence interpretations were performed based on the post-translational SDA sequence. The PstI site used in SDA cloning overlaps with amino acids 4 and 5 of the mature SDA. Accordingly, the sequence QVQ (amino acids 1-3) encoded by the phage display vector used was appended to the N-terminus of the SDA. The SDAs were aligned based on the IMGT numbering system for mature SDA coding regions ending in the sequence VTVSS
[51] . The SDAs were classified into subfamilies as previously done
[52] . Subfamily C represents conventional SDAs lacking the FR2 residue typical of SDAs. Such SDAs are often produced at low levels. SDAs named subfamilies 1, 2, and 3 represent three true SDA subfamilies. Subfamily X represents unclassifiable SDAs. SDAs were also classified as CDR3 groups based on having identical CDR3 lengths and at least 65% sequence identity in the CDR3. SDA sequences were also examined for the presence of potential N-glycosylation sites (Asn-X-Ser / Thr, where X is any amino acid except Pro). The clones selected for yeast expression lacked such N-glycosylation sites.
[0175] Table 2 shows 14 TeNT-binding SDA clones beginning with "SVT" followed by a number. Two SDAs, SVT02 and SVT03, selected on cAb-TT2 or mAb TT10-captured TeNT, respectively, did indeed bind to cAb-TT2-captured TeNT, but not to directly coated TeNT or rTTC, and the measured absorption was comparable to that observed for E. coli culture supernatant without SDA, thus not inhibiting GT1b-TeNT interaction (Table 2). These SDAs likely bind to TeNT epitopes whose conformation is affected by passive adsorption to polystyrene, leading to a decrease in antigenicity, as previously observed for other antigens [3, 53]. Of the 12 additional SDAs, 11 were selected on directly coated TeNT or rTTC, and they reliably bound to both directly coated TeNT and captured TeNT, as well as directly coated rTTC, and inhibited the TeNT-GT1b interaction (Table 2). Only three SDAs, SVT05, SVT06, and SVT08, showed partial inhibition of the GT1b-TeNT interaction, as their absorption values decreased from approximately 1.3 in the sample without SDAs to 0.72-0.99.
[0176] The sequences of the 14 SVT SDAs form seven CDR3 groups represented by the letters A-G (Figure 1). Clones derived from the same CDR3 group generally exhibit similar behavior in ELISA (Table 2). The 12 clones derived from CDR3 groups A, B, C, D, and G all inhibit GT1b-TeNT interaction and bind to directly coated TeNT and rTTC, as well as cAb-TT2-captured TeNT. Clones SVT02 and SVT03, which form CDR3 groups E and F, do not inhibit GT1b-TeNT interaction and do not bind to directly coated TeNT or rTTC, although they do bind to cAb-TT2-captured TeNT. Several notable characteristics of the sequences have been observed for the various SDAs considered for each CDR3 group. Four SDA clones derived from group A of CDR3, and two SDA clones forming group C of CDR3, contain Leu at IMGT position 123, which is associated with low production levels in yeast
[11] . Two SDA clones derived from group C of CDR3 also have Lys120 and Ile122, which are typical of the J7 segment encoding FR4, associated with reduced SDA production levels in yeast
[11] . This suggests that these SDAs are produced more highly with mutations K120Q, I122T, and L123Q.
[0177] The three SDA clones derived from group B of CDR3 all contain a rare insertion of the amino acid sequence VEDG at positions 50a–50d. This is located in the center of the FR2 region adjacent to residue Arg50 (Kabat position 45) and is often described in SDA literature as the most typical amino acid substitution in SDA. Conventional SDAs typically contain Leu at IMGT position 50, which makes hydrophobic contact with the VL domain. SDAs almost always have Arg at IMGT position 50. This substitution makes the conventional VL interface more hydrophilic [1]. The insertion of the hydrophilic residues D(Asp) and E(Glu) within the VEDG insertion is also very likely to make the FR2 region more hydrophilic. Partly due to these acidic residues, the predicted isoelectric points (IEPs) of these clones are low. Low IEPs are more frequently observed in SDAs and are associated with increased solubility of SDAs
[54] . The extremely long CDR2 and CDR3 regions are also noteworthy. Long CDR3s are very common in SDAs [1, 52]. Long CDR2s are less common and are likely to result from somatic high-frequency mutations
[55] .
[0178] Clones SVT13 and SVT22, which form the D group of CDR3, have a Cys at IMGT position 55 and a Cys within the CDR3 that is typical of SDA of subfamily 3 and is very likely to form an additional disulfide bond
[52] . Although the CDR3 sequences are clearly homologous, SVT13 and SVT22 are highly diverse and also differ by 32 amino acids.
[0179] The single clone SVT05, derived from CDR3 group G, has a very long CDR2 consisting of 17 residues (see the above discussion regarding CDR3 group B) and low IEP.
[0180] 4. Phage display selection of IgG-bound SDA The phage display selection of IgG-bound SDAs was substantially carried out using directly coated canine or equine IgG, as described in previous examples. In order to select SDAs that bind to both canine and equine IgG, the second round of panning was performed not only on IgG of the same species origin but also on IgG from other species.
[0181] To identify individual IgG binders, individual clones obtained from the second panning round were inoculated into six 96-well plates, and the production of soluble SDA was induced in the 96-well plates
[49] . All clones were screened for binding to directly coated IgG, Fab, and Fc fragments of different species by ELISA as previously described
[19] . Equine and canine IgG antigens are described in Example 1. Equine IgG Fc was obtained from Fitzgerald Industries (Tompkinsville, KY), and canine Fab was obtained from Rockland Immunochemicals.
[0182] We report only the absorption values of the SDA clones that were ultimately expressed in yeast. For this purpose, we preferentially selected IgG-binding clones that bind to antigens of both dogs and horses, and preferably more species. Furthermore, we preferentially selected clones that bind to Fab fragments. These SDAs are most suitable for therapeutic use because interference with the binding of Fc(Brambell) receptors in the neonatal period, which is involved in the half-life of IgG, is not expected for Fab-binding SDAs, and because they recognize multiple species, it is unlikely that they would become unable to recognize IgG in specific individual animals even with allotyped IgG variations.
[0183] Table 3 shows eight IgG-binding SDA clones, each beginning with "SVG" followed by a number. The background absorption value for equine IgG using E. coli culture supernatant without SDA was 0.26, significantly higher than other IgG samples. This may suggest binding of equine IgG to the peroxidase conjugate used. Maximum absorption in ELISA was also highly variable among the different SDAs, likely because the antigens used for coating were not pure proteins, but rather mixtures of different IgGs with different isotypes and variable domains. SVG03 and SVG24 of SDA bind to equine-derived Fc fragments but not to canine or equine-derived Fab fragments. SVG23 of SDA binds only to canine IgG. Since SVG23 does not bind to canine Fab, it likely binds to canine Fc. SVG03 binds to equine-derived IgG but not to canine, human, pig, bovine, or guinea pig-derived IgG. SVG24 binds to dog, horse, and pig IgG, but not to human, bovine, or guinea pig IgG. Therefore, the three Fc-specific SDAs also possess species specificity. SDAs SVG06, SVG07, SVG13, SVG18, and SVG19 bind to Fab fragments derived from dogs and horses, but not to horse Fc fragments. These SDAs bind to IgG from all six species mentioned above. Therefore, the five Fab-specific SDAs also possess fairly broad species specificity.
[0184] Sequence analysis was performed as described in previous examples. Eight clones selected for intrayeast production (Figure 2) all belong to different CDR3 groups. All three SDAs bind to Fab fragments of canine and equine IgG, and to IgG of all six species tested. All three SDAs, and SVG06, are conventional SDAs (subfamily C). They all lack the substitution of a hydrophilic residue, often Lys, from Trp118 (residue 103 according to the Kabat numbering scheme) which is often observed in such SDAs
[56] . SVG13 further has Lys at position 120 and Leu at position 123, while SVG06 has mutations of Glu at position 120 and Leu at position 123, both of which are typical of the use of the J7 segment in FR4, associated with reduced levels of intrayeast SDA production
[11] .
[0185] Most SDAs are similar to human VH3 family VHs. However, SVG07 is more similar to human VH4 family VHs. Such SDAs have been observed previously
[57] . For reference, two VH4 family SDAs (sdAb-31 and sdAb-32) isolated from camels are included in the SDA alignment (Figure 2). The amino acid sequences of FR1, FR2, and FR3 of SVG07 are identical to those of sdAb31 and / or sdAb32, and differ from other SDAs at IMGT positions 9, 14, 16, 17, 18, 20, 22, 24, 25, 39, 42, 45, 53, 54, 68, 69, 71, 74, 77, 82, 83, 86, 87, 92, 94, and 95.
[0186] 5. Phage display selection for albumin-bound SDAs Phage display selection of albumin-bound SDAs was carried out substantially as described in previous examples, using directly coated albumins derived from dogs or horses as described in Example 1. A second round of panning was performed not only on albumins of the same species but also on albumins of other species to select SDAs that bind to both dog and horse albumins.
[0187] To identify individual albumin binders, individual clones obtained from the second panning round were inoculated into two 96-well plates, and the production of soluble SDA in the 96-well plates was induced
[49] . All clones were screened for binding to directly coated canine, equine, and human albumins by ELISA, as previously described
[19] . Human albumins were obtained from a commercial supplier (Jackson Immunoresearch Laboratories).
[0188] Only the absorption values of the SDA clones that were ultimately expressed in the yeast are shown. For this purpose, albumin-binding clones that bind to both canine and equine antigens were preferentially selected. Table 4 shows six albumin-binding clones, starting with "SVA" followed by a number. None of the SDAs bind to human albumin. All SDAs bind to equine albumin. SVA07 of SDAs does not bind to canine albumin, while SVA02, SVA04, SVA06, SVA12, and SVA16 of SDAs do indeed bind to canine albumin. Thus, five SDAs that bind to both canine and equine albumin were obtained.
[0189] Sequence analysis was performed as described in previous examples. The six clones selected for in vivo production in yeast (Figure 3) all belong to different CDR3 groups. They are all true SDA of subfamily 1
[52] . They all lack specific protein sequence characteristics, such as long insertions, or FR4 residues associated with reduced SDA production in yeast
[11] .
[0190] 6. Endogenous production of novel SDA isolated by phage display in yeast Fourteen SVT SDAs (Table 2), eight SVG SDAs (Table 3), and six SVA SDAs (Table 4) were generated by expression in secretory yeast. For this purpose, the SDA coding region was amplified by PCR from phage display plasmids (Examples 3-5), then cut using PstI and BstEII, and ligated with similarly cut pUR4585 plasmids. pUR4585 is a yeast-E. coli shuttle vector suitable for SDA expression with c-myc and his6 tags fused at the C-terminus. SDAs generated in this manner are indicated by the suffix "L". Plasmids derived from pUR4585 encoding such SDAs are represented by the SDA name and prefix "p" with the suffix "L" added. Furthermore, three mutant SVT SDAs with mutations in the FR4 region that increase the level of yeast intracellular production were generated (see Example 3 and
[11] ): SDA SVT15L-3FW4M is a derivative of SVT15L containing mutations K120Q, I122T, and L123Q. SDA SVT20L-L123Q is a derivative of SVT20L containing the L123Q mutation. SDA SVT34L-L123Q is a derivative of SVT34L containing the L123Q mutation.
[0191] These mutations were introduced by generating synthetic PstI-BstEII fragments containing these mutations and subsequent insertion into plasmid pUR4585. The BstEII region used in subcloning is a highly conserved region in FR4, but is missing in some SDAs. This is the case for SVT16, SVT20, SVT25, and SVT34. Therefore, this region was introduced aphenotypically into these four true SDAs, as well as SVT20L-L123Q and SVT34L-L123Q, by generating synthetic PstI-BstEII fragments and subsequent insertion into pUR4585. For all yeast expression plasmids, sequence validation was performed using purified plasmid DNA as a template, as described in Example 3, but in combination with primers BOLI166 (ATGATGCTTTTGCAAGCCTTC, SEQ ID NO: 9) and BOLI188 (TTCAGATCCTCTTCTGAGATGAG, SEQ ID NO: 10). The plasmid derived from pUR4585 encoding SVT29 encoded an aphenotypic mutation from A to G at position 60 after the PstI site (a mutation from CCTGTCGAGCCTACG (sequence ID 11) to CCTGTCGGGCCTACG (sequence ID 12)), but it was ignored because it was aphenotypic.
[0192] Plasmids derived from pUR4585 were introduced into Saccharomyces cerevisiae strain W303-1a (ATCC number 208352; MATa, ade2-1, ura3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100) by selection for the nutrient-requiring leu2 marker. Plasmids pSVT13L, pSVT15L, pSVT20L, and pSVT34L were also introduced into SU51, a strain more commonly used for SDA production [19, 58]. Yeast cultures for SDA production and purification of SDA from culture supernatants using IMAC were carried out as previously described [19, 58]. Purified SDA was concentrated and then buffer-exchanged with phosphate-buffered saline (PBS) using an Amicon Ultra 3kDa molecular weight cutoff centrifugal concentrator (Millipore, Bedford, MA). SDA concentration was determined using the Biorad (Hercules, CA) protein assay and bovine IgG standards. From these stocks, samples were biotinylated with sulfo-NHS-LC-biotin (Pierce, Rockford, IL) at a protein-to-biotin weight ratio of 5. Mouse mAbs, equine and canine albumins and IgGs, and TeNT were similarly biotinylated.
[0193] Based on the yield of purified SDA, the production level of SDA secreted by yeast per liter of culture volume was also determined (Table 5). SDA was mainly produced in the baker's yeast strain W303-1a, but four SVT SDAs were also produced in the SU51 strain to compare the levels of production within the yeast
[58] . The increase in production levels when using the SU51 strain varied from 2.5 to 13.6 times, depending on the properties of the SDA. Mutant SDAs containing various FR4 mutations were generated at levels 2.6 to 5.2 times higher than wild-type SDA (Table 5), which is consistent with previous findings
[11] .
[0194] The low production level of SVG07L, 0.15 mg / L, may be related to the similarity of this SDA to the SDA of the human VH4 gene family. Conventional SDAs (subfamily C in Table 5) have previously been suggested to be produced at low levels
[61] . However, three conventional SDAs, SVG06L, SVG13L, and SVG19L, are produced at reasonably high levels of at least 1.59 mg / L (Table 5).
[0195] 7. Antigen binding of yeast-produced SVA and SDA The binding of SVA SDA to albumins from different species was analyzed by ELISA, primarily using unlabeled SDA, with antigens coated onto plates and detection utilizing myc tags for SDA detection. The ELISA was carried out substantially as described in Example 3. Purified serum albumin was coated at a concentration of 5 μg / ml. The sources of horse and canine albumins are described in Example 1. Bovine albumins and chicken albumins were obtained from Sigma Aldrich, human albumin from Jackson Immunoresearch Laboratories, and mouse, sheep, and porcine albumins from Antibodies Online (Beijing, CN). Feline albumin was captured from 500-fold diluted normal cat serum (Agrisera Antibodies, Vannas, Sweden) on plates coated with 1000-fold diluted immunoaffinity-adsorbed goat anti-feline albumin IgG (Antibodies Online). Next, plates were incubated with a 2-fold dilution series of SDA across 12 wells, starting with an SDA concentration of 1 μg / ml. SDA was detected using a 0.5 μg / ml anti-myc clone 9E10 mAb peroxidase conjugate (Roche Applied Science). Absorption data were evaluated using the Excel® spreadsheet template (Microsoft Corporation, Redmond, USA), and the maximum A450 value was calculated. By approximating the absorption and SDA concentrations with a 4-parameter logistic curve and interpolating the effective concentration (EC), an absorption value of 0.2 was obtained for each SDA in each ELISA.
[0196] Negative controls that were not coated with antigen, did not contain SDA, or contained nonspecific SDA (SVT06L) all yielded values less than 0.15 (Table 6). Absorption values greater than 0.15 were considered to suggest albumin binding. Clones SVA12L and SVA16L bind to equine and canine albumin with high (>1) absorption values. SVA12L also binds to porcine albumin with high absorption values and to feline albumin with lower absorption values. Feline albumin was captured from normal serum using coated polyclonal antibodies. As a result, the observed lower absorption values do not necessarily suggest that it does not bind to feline albumin as efficiently as albumin from other species. In fact, in Example 18 (Table 28), it is clear that SVA12L and SVA06L bind to feline albumin (commercial product) with very similar affinities. Furthermore, SVA12L and SVA06L were found to bind to equine and canine albumins with similar affinity (Example 18). In a competitive assay (ELISA), SVA06L and SVA12L were found to recognize different epitopes (data not shown).
[0197] Both SVA12L and SVA16L exhibit low SDA concentration titers of approximately 10 ng / ml in ELISA. SVA02L, SVA04L, SVA06L, and SVA07L also bind to several albumin species, but often have lower absorption values and higher SDA titers than SVA12L and SVA16L. SVA02L and SVA06L also bind to mouse albumins.
[0198] None of the SDAs bind to human, sheep, cattle, or chicken albumins. ELISA binding of yeast-derived SVA SDA is consistent with binding to the corresponding SDA produced in E. coli (Example 5; Table 4), with one important exception: clone SVA04L did not bind to canine albumins, while its E. coli-derived counterpart bound to canine albumins with a high absorption value of 1.533. This may be due to the fact that the E. coli-derived clone is not monoclonal, but rather a mixture of two clones producing different SDAs. Since yeast-derived SDAs are clonal and have been tested more thoroughly as an SDA dilution series rather than in a single well, results based on yeast-derived SDAs are more reliable.
[0199] Clone SVA12L was selected for the development of multimerized SDA because it binds to horse, dog, pig, and feline albumins and is efficiently produced in yeast (3.85 mg / L using strain W303-1a) (see Examples 14, 15, 16, 17, and 18). SVA12L does not bind to mouse albumins in ELISA and is therefore unlikely to achieve half-life extension in mice (Example 17). SVA06L is a suitable candidate for SDA half-life extension in mice.
[0200] 8. Antigen binding of yeast-produced SVG SDA The binding of eight yeast-derived SVG SDAs to IgGs of different species origins, and antibody fragments Fab, F(ab')2, and Fc from several species, was analyzed in the same manner as described in previous examples. Some sources of IgGs and their fragments are described in Example 4. Gamma globulin (GG) from mouse, cat, sheep, cattle, and guinea pigs, as well as the equine F(ab')2 fragment, were obtained from Jackson Immunoresearch Laboratories. The canine Fc fragment was obtained from Rockland Immunochemicals. The results are shown in Table 7. The three ELISAs contained relatively high background, likely due to cross-reactivity between the mouse anti-myc mAb PO-conjugate and the coated antigen (footnote b in Table 7). Therefore, the background was subtracted from the absorption values in these ELISAs (footnote b in Table 7). An absorption value greater than 0.2 after subtracting the background was considered to indicate antigen binding.
[0201] ELISA binding of yeast-derived SVG SDA is consistent with binding of the corresponding SDA produced in E. coli (Example 4), but with two exceptions. First, yeast-derived SDA SVG07L bound only to canine IgG, while the corresponding E. coli-derived SDA bound to IgG of all species analyzed. This is likely partly explained by an excessively high arbitrary cutoff value of A450=0.2 selected for binding. Second, yeast-derived clone SVG24L did not bind to porcine IgG, while its E. coli-derived counterpart did. This, too, may be attributable to an excessively high arbitrary cutoff value of A450=0.2 selected for binding. Alternatively, the binding of such E. coli-derived clones may also be due to the fact that these clones are not monoclonal. Such artifacts cannot occur for yeast-derived SDA. Therefore, the ELISA binding data for yeast-derived SDA are more reliable.
[0202] When the absorption value after subtracting the background exceeds 0.2, which is interpreted as suggesting antigen binding, SDA SVG06L and SVG13L bind to Fab fragments and IgG from all analyzed species except chicken. Since most other SDAs have absorption values of less than 0.08 in this ELISA, the absorption value of 0.164 for SVG13 on chicken IgG likely represents binding to chicken IgG. SDA SVG19L shows considerable sequence similarity to SDA SVG13L (Example 4) and exhibits a similar binding pattern to SVG13L, but does not bind to mouse, sheep, and pig IgG with an absorption value of 0.2 above the background. SVG03L is specific to equine Fc, and SVG23L is specific to canine Fc fragments. SVG24L recognizes primarily equine and canine Fc.
[0203] SDA SVG13L binds to Fab and IgG of all analyzed species and is produced in sufficient quantities within yeast (even without optimization) (1.6 mg / L), making it ideally suited for the development of multimerized SDA.
[0204] SDA SVG06L also binds to Fab and IgG from all analyzed species except chicken, and is also produced sufficiently within yeast (even without optimization) (1.8 mg / L), making it suitable for the development of multimerized SDA.
[0205] 9. Species specificity of IgG-bound SDA The binding of four previously isolated porcine IgG-conjugated SDA (VI-clones)
[19] to IgG from various species in ELISA was compared to SDA SVG13L, which reacts with IgG from most species. The ELISA was performed as described in Example 8. The results (Table 8) show that SDA VI-4L, VI-8L, VI-11L, and VI-14L do not bind to bovine, cat, dog, mouse, and human IgG. They likely bind to sheep IgG, as their maximum absorption is slightly increased above the background without SDA. SDA VI-11L also binds to horse IgG. However, in all cases, SVG13L yields considerably higher absorption values for IgG from all species except porcine IgG. Conversely, for porcine IgG, all VI clones yield higher absorption values than SVG13L.
[0206] 10. Antigen binding of yeast-produced SVT SDA Several yeast-derived endogenous SDAs and six anti-TeNT mAbs were analyzed for antigen binding in ELISA using a method similar to that described for SVA and SVG SDA. The anti-TeNT mAbs were obtained from different suppliers. Their origins and information provided by the suppliers regarding TeNT neutralization in mouse bioassays or antigen binding in Western blotting are listed in Table 9. Some of these mAbs were biotinylated as described in Example 6.
[0207] The binding of unlabeled SDA or mAbs to directly coated TeNT, rTTC, or unlabeled polystyrene plates, as well as to TeNT captured by passively adsorbed cAb-TT2 SDA, was analyzed. See Examples 1 and 3 for such antigen coating procedures. These plates were then incubated with a dilution series of unlabeled SDA or mAbs and further processed as described in Example 7, but using a 2000-fold diluted rabbit anti-mouse immunoglobulin PO conjugate (Dako, Glostrup, Denmark) to detect mouse mAbs, and without escalating SDA on rTTC coated plates. Furthermore, the binding of biotinylated SDA or mAbs to directly coated TeNT and cAb-TT2-captured TeNT was analyzed in a similar manner, using a 0.5 μg / ml streptavidin-PO conjugate (Jackson Immunoresearch Laboratories) to detect SDA. Finally, the GT1b-TeNT interaction inhibition of unlabeled SDA or mAb was analyzed as described in Example 3, using a 2-fold dilution series of SDA or mAb across 11 wells, starting at a concentration of 1 μg / ml per SDA or 10 μg / ml per mAb.
[0208] The results are shown in Table 10. Absorption values were less than 0.07 in plates without specific TeNT antigen coating. In ELISAs using the control SDA SVA12L, except for the GT1b-TeNT inhibitory ELISA, the maximum absorption values were 0.155 (directly coated TeNT and biotinylated SDA or mAb) or 0.072 (other ELISAs). Therefore, absorption values greater than 0.2 suggest antigen binding. ELISAs using biotinylated SDA or mAb on directly coated TeNT or captured TeNT were generally consistent with similar ELISAs using unlabeled SDA or mAb. Neither biotinylated SDA nor mAb were negative in the ELISAs, but their unlabeled counterparts were positive. This indicates that biotinylation does not invalidate antigen binding. In many cases, biotinylated SDAs resulted in slightly higher absorption values in captured TeNT (e.g., three SDAs from CDR3 group B: SVT06L, SVT08L, and SVT31L). Notable exceptions include mAb B417M and 11n185, which generally yielded lower absorption values and >50 times higher EC when biotinylated, suggesting that biotinylation was not very effective or affected antigen binding by these mAbs. In the case of mAb B417M, the presence of 0.5% HSA as a stabilizer may have reduced its biotinylation efficiency.
[0209] Generally, ELISA binding of yeast-produced SVT SDAs is consistent with ELISA binding of their E. coli-produced counterparts (Example 3; Table 2). As previously noted in Example 3, all SDAs, with the exception of SVT02L and SVT03L, bind to rTTC. As previously noted, the inability to detect binding of SVT02 and SVT03 to rTTC may be due to the direct coating of rTTC. These SDAs did not bind to directly coated TeNT, but they certainly bound to captured TeNT. Furthermore, as previously observed, SVT05L, in addition to the three CDR3 group B SDAs SVT06L, SVT08L, and SVT31L, only partially inhibits the TeNT-GT1b interaction, with a minimum absorption value of approximately 0.5 and a relatively high EC value. Furthermore, as previously observed, SDA SVT03L does not inhibit the TeNT-GT1b interaction. However, while the yeast-derived endogenous clone SVT02L also showed partial TeNT-GT1b inhibition at EC values >1000 ng / ml, its E. coli-derived endogenous counterpart showed no inhibition at all. This difference may simply be due to the use of excessively low SDA concentrations in the case of E. coli-derived endogenous SDA, which was obtained by diluting E. coli supernatant with an unknown SDA concentration 10-fold. Binding of biotinylated yeast-derived endogenous SVT03L to directly coated TeNT was observed only at the highest concentration of SDA analyzed, but this too had not been observed previously and could similarly be explained by the use of higher SDA concentrations (see Example 11).
[0210] The three mutant SDAs, SVT15L, SVT20L, and SVT34L, exhibit similar maximum absorption and EC values to their wild-type counterparts in ELISAs using biotinylated SDA and GT1b-TeNT inhibitory ELISAs. This suggests that the Framework 4 mutations introduced to increase antigen binding do not affect TeNT binding. Here, the EC values are similar to those of 50% inhibition (IC) of TeNT-GT1b inhibition. 50 It is determined at the absorption value corresponding to ). 50The values vary between 34 and 986 ng / ml. Clones derived from CDR3 group B have higher IC50 than clones derived from CDR3 groups A, C, and D (34-133 ng / ml). 50 The values are (317-986 ng / ml). These are clone ICs derived from the same CDR3 group. 50 The values can differ by up to four times. Six mAbs were included in the analysis. mAb 11n185 was selected because it binds to the TeNT light chain. Five additional mAbs were selected because they neutralize TeNT in mouse bioassays. The mAbs bind to different ELISAs as follows: 1. mAb 14F5 and 6F55, similar to SVT02L and SVT03L, bind to directly coated TeNT less efficiently than captured TeNT.
[0211] 2. Only mAb6E7 and 6F57 inhibit TeNT-GT1b interaction in ELISA. Both inhibit the IC50 of most SDAs. 50 It has a significantly higher IC50 than [another component].
[0212] 3. While most SDAs bind to rTTC, only two of the six mAbs bind to rTTC. This suggests that the neutralization of TeNT by the three mAbs is not based on inhibition of the TeNT-GT1b interaction.
[0213] 11. SDA (rTTC binding) characterized by binding of TeNT to fragment C The two SDAs (SVT02L and SVT03L) did not bind to the directly coated TeNT, and therefore, regarding their binding to the directly coated fragment C(rTTC) (also named Hc or TTC) of TeNT, no conclusions have been reached regarding particle specificity (Example 10). This is because passive adsorption may have invalidated antigen binding. The binding of these SDAs to rTTC captured using mAb6E7 was therefore analyzed in the same manner as described in Example 10. Six wells of a 96-well plate were coated with TeNT (0.75 μg / ml), and 18 wells were coated with mAb6E7 (1 μg / ml). The six mAb6E7-coated wells were then incubated with 2 μg / ml rTTC, and six additional wells with 0.75 μg / ml TeNT, while the remaining six mAb6E7-coated wells were incubated with ELISA buffer (negative control). Subsequently, six SDAs were incubated at an SDA concentration of 2 μg / ml in four wells coated with different antigens. Binding SDAs were detected by incubation with anti-mycMAb PO-conjugates. The results (Table 11) show the following: The negative control SVA12L and the mAb6E7 coating without captured antigen were negative (absorption < 0.07).
[0214] The capture of TeNT or rTTC using mAb6E7, or the direct coating of TeNT, is successful because it is detected by SVT16L (high absorption) and SVT15-3FW4M (lower absorption).
[0215] SVT02L and SVT03L are functional because they bind to the captured TeNT.
[0216] SVT03L has a lower A450 than captured TeNT, but it certainly binds to directly coated TeNT, whereas SVT02L does not bind to directly coated TeNT at all.
[0217] SVT02L and SVT03L do not bind to rTTC captured using mAb6E7. This is because they recognize different antigen sites than mAb6E7 (Example 13), and therefore this is not due to the use of mAb6E7 for capture.
[0218] Therefore, SVT02L and SVT03L bind to a TeNT moiety different from the one present in rTTC. This observation is consistent with the fact that these SDAs cannot inhibit the TeNT-GT1b interaction (Example 10).
[0219] 12. Western blot analysis of TeNT binding in SVT SDA The binding of SVT clones to the light or heavy chain of TeNT was analyzed by Western blotting using 2.5 μg of genuine TeNT per gel, as previously performed
[19] , and 0.5 μg / ml of biotinylated SDA (Example 6) and 0.1 μg / ml of streptavidin PO conjugate (Jackson Immunoresearch Laboratories) for immunoblotting (Figure 4). SDA SVA12L was used as a negative control. Most SDAs did not show binding to either the light or heavy chain in Western blotting. This may be due to such SDAs recognizing higher-order structural epitopes. However, SDA SVT06 and SVT08 bound to a polypeptide of approximately 100 kDa, which undoubtedly corresponds to the TeNT heavy chain. These clones belong to the same CDR3 group (group B) and recognize the same antigenic site (Table 12). Both SDAs also bind to rTTCs derived from the heavy chain (Tables 2 and 10). Therefore, the binding of SDA SVT06 and SVT08 to the TeNT heavy chain in Western blot is consistent with previous observations.
[0220] 13. Mapping of tetanus toxin antigens using SDA (SVT) The antigenic sites of SVT SDA and six anti-TeNT mAbs were mapped using blocking / competitive ELISA with biotinylated SDA and mAbs. Where possible, two representative examples from each CDR3 group were used for this purpose. SDA's IC in TeNT-GT1b interaction 50 Based on the values, selection was primarily made. However, the amount of SVT29L produced in the yeast was only 0.07 mg / L, and therefore it was replaced with SVT15L-3FW4M. A competitive / blocking ELISA was performed using an ELISA procedure similar to that described in previous examples, but with 0.5 μg / ml TeNT used for direct coating. A biotinylated SDA or mAb concentration that yielded nearly maximum absorption was used, and this SDA or mAb was made to compete with and block by using various unlabeled SDA or mAbs at 5 μg / ml. The TeNT-coated plates were first incubated with unlabeled SDA or mAb in 90 μl / well for 30 minutes (blocking step). Next, 10 μl of 50 μg / ml biotinylated SDA or mAb was added and incubated for a further 30 minutes (competition step). In the case of biotinylated SVT02 and SVT04, these SDAs bound only to captured TeNT and not to directly coated TeNT; therefore, TeNT was captured using cAb-TT2. In all other cases, directly coated antigens were used. This included controls without antigen coating and controls without biotinylated SDAs. The inhibition rate (%) of antigen binding due to SDA competition / blocking was then calculated as 100 - 100 × ([A450 with competing SDA or mAb] - [A450 without Ag coating]) / ([A450 without competing SDA or mAb] - [A450 without Ag coating]). All SDAs and mAbs blocked the binding of their biotinylated counterparts by at least 75%, suggesting that the assay was valid.
[0221] At least five independent antigenic sites, represented by the letters A-E, were identified (Tables 12 and 13). As expected, SDAs derived from the same CDR3 group are always parts of the same antigenic site. SVT02L, mAb14F5, and mAb6F55 form antigenic site A. These three SDAs or mAbs also exhibit other similar characteristics in other ELISAs. Most notably, they bind to captured TeNT more efficiently than directly coated TeNT. This suggests that their binding is highly dependent on the correct TeNT tertiary structure. SVT03L is a single SDA that forms antigenic site B. SVT15L, and its variant derivative SVT15L-3FW4M, form antigenic site C. SVT06L, SVT08L, mAb6E7, and mAb6F57 form antigenic site D. Since these SDAs also bind to TeNT in Western blotting, they are expected to be less dependent on the correct three-dimensional structure of the antigen site (Example 12).
[0222] In line with this concept, partial competition by clones derived from other antigen sites does not occur for these four SDAs or mAbs. SDAs SVT13, SVT16, SVT22, and SVT34, representing the two CDR3 groups, form antigen site E. The results for SVT clones are summarized in Table 12. Generally, the results are consistent with the general consensus regarding the Ag specificity of SDA and the antigenic structure of TeNT: SDAs belonging to the same CDR3 group are classified as belonging to the same antigenic site. SDAs or mAbs from the same antigen site exhibit similar antigen-binding specificity: The SDA or mAb at antigen site A shows reduced binding to direct coating of TeNT, thus binding to structurally sensitive epitopes. The SDA at antigen site D binds to TeNT Hc in Western blotting.
[0223] The SDAs and mAbs of antigen sites C, D, and E all inhibit the TeNT-GT1b interaction, while the SDAs or mAbs of antigen sites A and B do not inhibit it.
[0224] Both SDAs and mAbs that inhibit TeNT-GT1b interaction bind to rTTC.
[0225] It is noteworthy that clone SVT02 binds to the same antigenic site as two mAbs reported to neutralize TeNT in mouse bioassays. This strongly suggests that SVT02, while not inhibiting the TeNT-GT1b interaction, may still neutralize TeNT. TeNT-neutralizing mAbs that do not inhibit the GT1b interaction have been previously described
[68] . Similarly, clones SVT06 and SVT08 likely neutralize TeNT as they compete with the two neutralizing mAbs (Example 17). Clones SVT06 were produced at higher levels and are therefore most suitable for further study. SDAs derived from antigenic sites C and E do not compete with either of the neutralizing mAbs. However, these SDAs certainly inhibit the TeNT-GT1b interaction. Therefore, these SDAs are likely to neutralize TeNT, although this has not yet been demonstrated in in vivo assays (Example 17). SDA SVT02L, SVT06L, SVT15L-3FW4M, and SVT16L are therefore recommended building blocks for producing the SDA polymer (Table 13).
[0226] 14. Endogenous production of multimer SDA in yeast To increase SDA production levels, multimerized SDA was generated by creating stable MIRY implements in yeast strain SU50 using plasmid pRL44
[69]
[70]
[75] . Such MIRY implements had, on average, a 5-fold increase in SDA production compared to 2-micron-based plasmids. Twelve plasmids encoding multimerized SDA were generated, consisting of fusions of TeNT-conjugated SVT-SDA and Alb-conjugated SVA12SDA (5 plasmids), IgG-conjugated SVG06SDA (2 plasmids), or IgG-conjugated SVG13SDA (5 plasmids) (Table 14). The elements from which these multimerized SDAs were created are as follows: GS3: Previously described (G4S) 3-linker
[27] GS2: (G4S)2 linker derived from the pRL144 plasmid
[19] Similar to H6:pRL188, it has a his6 tag, a double stop codon, and a HindIII site[2] SVG06M4: SVG06 with four mutations: Q1E, Q5V, E120Q, L123Q SVG13M4: SVG13 with four mutations: Q1E, Q5V, K120Q, L123Q SVA12M2: SVA12 with two mutations: Q1E and Q5V SVT15-3FW4M: SVT15 lacking an internal SacI site and possessing three mutations: K120Q, I122T, and L123Q. SVT16-L123Q: SVT16 with a non-expressionally restored BstEII site and L123Q mutation. Synthetic SacI-HindIII fragments were generated and then subcloned into plasmid pRL44 using the SacI and HindIII sites
[69] to obtain plasmids pRL482-pRL501 (Table 14).
[0227] Baker's yeast strain SU50 (MATa; cir°; leu2-3, -112; his4-519; can1;
[70] ) was transformed by electroporation using HpaI-linear plasmids pRL482-pRL501
[71] , and the leu+ nutrient requirement was selected. A single colony-purified transformant was induced for SDA expression in a 0.5 L shaker flask, and SDA was purified from the culture supernatant by IMAC
[58] . SDA was further purified by cation exchange chromatography on an SP Sepharose column, as previously described
[44] , but with some modifications. SP Sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate, pH 4.7 buffer were used to conjugate SDA to the column. The bound SDA was eluted in binding buffer using a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8, and 1 M NaCl. Bound SDA generally eluted in NaCl between 0.4 and 0.8 M (Table 14). This was concentrated using a 3 kDa molecular weight cutoff centrifugal concentrator and then exchanged for PBS. SDA concentrations were determined using the bicinchoninic acid assay (BCA, Pierce catalog no. 23212) and bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on the purified SDA yield, the production level of multimer SDA in yeast was calculated (Table 14).
[0228] Monomeric and multimeric SDA were analyzed by reduced SDS PAGE using NuPage Novex 4%-12% bis-Tris gel containing MOPS electrophoresis buffer (Invitrogen), and staining with Gelcode Blue reagent (Thermo Scientific). In contrast to multimeric SDA, monomeric SDA contains a myc tag attached to the his6 tag. Monomeric SDA containing the myc tag yielded an additional molecule with a molecular weight approximately 2 kDa higher than that observed in most multimeric SDA lacking the myc tag (Figures 5A and 5B). This additional molecule likely corresponds to a partial O-glycosylation dependent on the presence of the myc tag. Such molecules have been observed previously
[44] . Addition to this presumed O-glycosylation variant, SVT15-3FW4M SDA produces a molecule with a molecular weight approximately 2 kDa lower, likely corresponding to degraded SDA (Figure 5B).
[0229] SDS-PAGE analysis of two examples of multimer SDA containing SVG06M4 revealed a double band at the SDA2 position (Figure 5A), which was not observed in multimer SDA containing SVA12M2 or SVG13M4 SDA (Figure 5B). Since this SDA is always located at the C-terminus of the multimer SDA, the possibility of degradation at the C-terminus of SVG06M4 is extremely high. This may be due to the introduction of mutations E120Q and L123Q at the C-terminus of SVG06M4 within the multimer SDA. This would mean the loss of the his6 tag in such SDA. Since the SDA was initially purified by IMAC, this means that such degradation occurred after IMAC purification.
[0230] All of the multimer SDAs containing SVG13M4 and SVA12M2 migrated to the expected positions based on their predicted molecular masses (Figure 5B). Monomer SVG13L SDA migrated slightly faster than SVA12L SDA, aligning with SVA12L, which has a molecular weight approximately 1 kDa lower. A similar pattern is observed when comparing multimer SDAs containing SVG13L and SVA12L, which consist of two (SDA2) or three (SDA3) SDA domains.
[0231] 15. Bispecific or bivalent antigen binding of multimer SDA. The binding capabilities of several target antigens of various multimeric yeast-produced SDAs were specifically evaluated using ELISA. Controls of monovalent SDAs forming the constituent blocks of these multimeric SDAs were included. The ELISAs were performed basically as described in previous examples. Seven different ELISAs were performed (Tables 15 and 16). The GT1b-TeNT inhibitory ELISA has already been described in Examples 3 and 10. Three further ELISAs, in which both anti-his-tagged mAbs and polyclonal anti-SDA serum were used for SDA detection, were useful in measuring the binding of monovalent SDAs to passively adsorbed TeNT (0.75 μg / ml), Alb (5 μg / ml), or IgG (5 μg / ml). To measure bispecific binding of TeNT and IgG or Alb, or divalent TeNT binding, TeNT and horse Alb were biotinylated using sulfo-NHS-LC-biotin (Pierce, Rockford, IL) with a protein-to-biotin weight ratio of 5, as previously described
[72] . These were used in three ELISAs to measure the following: Bispecific binding to coated canine IgG or Alb (5 μg / ml) and biotinylated TeNT (0.25 μg / ml). Bispecific binding to TeNT (0.75 μg / ml) captured using passively adsorbed cAb-TT2 (1 μg / ml), and to biotinylated horse alb (1 μg / ml). Divalent binding to coated TeNT (0.75 μg / ml) and biotinylated TeNT (0.25 μg / ml)
[0232] Polystyrene 96-well plates were coated overnight at 4°C with 100 μl / well of the required antigens dissolved in either PBS (TeNT) or 50 mM NaHCO3, pH 9.2 (for all further antigens). After washing the plates at RT for 1 hour with 100 μl / well of ELISA buffer (1% skim milk; 0.05% Tween 20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH2PO4; 8.1 mM Na2HPO4; pH 7.4), all subsequent incubations were performed. The cAb-TT2 coated plates were then incubated with TeNT in ELISA buffer. The plates were then incubated with a 2x SDA dilution series across 12 wells, starting with an SDA concentration of 1 μg / ml. In some ELISAs, conjugated SDA was directly detected using a 1000-fold dilution of anti-his6 clone BMG-his-1MAb PO conjugate (hisPO; Roche Applied Science) or a 10,000-fold dilution of goat anti-llama Ig PO conjugate (GALPO; Bethyl Laboratories). In other ELISAs, plates containing conjugated SDA were incubated with biotinylated TeNT or biotinylated horse albumin. The biotinylated antigen was then detected using a 0.5 μg / ml streptavidin PO conjugate (StrepPO; Jackson Immunoresearch Laboratories). The conjugated PO was then detected by staining with 3,3',5,5'-tetramethylbenzidine. After stopping the reaction with the addition of 0.5 M sulfuric acid (50 μl per well), the absorption at 450 nm was measured using a spectrophotometer. Absorption data was evaluated using an Excel® spreadsheet template (Microsoft Corporation, Redmond, USA). This was used to calculate the maximum A450 value. A four-parameter logistic curve was approximated to the absorption and SDA concentrations using appropriate computer software.This curve was used to interpolate the effective concentration (EC), yielding specific absorption values for each SDA in each ELISA. The precise absorption values used for SDA concentration interpolation (see Table 14) varied between different ELISAs, depending on the background absorption value in the absence of SDA and the maximum absorption value observed for different SDAs. The results of various ELISAs are presented, showing both the maximum absorption achieved (or minimum absorption in the case of TeNT-GT1b inhibitory ELISA; Table 15) and the effective concentration of SDA (Table 16). From these ELISAs, the following conclusions can be drawn: GT1b-TeNT inhibitory ELISA shows that it does not inhibit SVT02-containing SDA, nor monomeric SVA, and SVG SDA, but it does inhibit all further monomeric and polymeric SDA. This is consistent with previous observations in monomeric SDA SVT06L, SVT15L, and SVT16L (Example 10).
[0233] ELISA using TeNT and biotin-TeNT showed the expected high maximum absorption values of 1.63 and 1.72 for multimeric SDAs, but also lower absorption values of up to 1.12 for some bispecific multimeric SDAs, and a slightly increased absorption value of up to 0.35 for some monomeric SDAs (which was unexpected). Background absorption was approximately 0.14. Bridging may be present due to IgG or albumin, which are present in milk and used as blocking agents. Nevertheless, these results suggest divalent TeNT binding by two divalent SDAs and bispecific SDAs.
[0234] As previously observed, the SDA multimer containing the SVT02 SDA domain never binds to directly coated TeNT.
[0235] In ELISA using TeNT captured by cAb-TT2 and biotinylated equine Alb, all multimeric SDAs containing SVA12 SDA, such as monomeric SVA12L SDA which did not bind, and SVT02-GS2-SVA12M2-H6 which did not bind to directly coated TeNT, did bind indeed.
[0236] SVT15-3FW4M SDA and SVT15-3FW4M-GS2-SVG06M4-H6 SDA seem to be inefficiently recognized by anti-his6MAb PO-conjugate, but are well detected using GALPO or in GT1b-TeNT inhibition ELISA. This is consistent with the C-terminal proteolysis of the his6 tag also observed in SDS-PAGE (Example 14).
[0237] SVT02-GS2-SVG06M4-H6 (Example 14) showed degradation in SDS-PAGE (suggesting loss of the his6 tag from most SDA molecules), which can explain the low absorption values in ELISA on canine IgG using anti-his6mAb for SDA detection. In the case of this specific bispecific SDA, SVT02 does not bind to directly coated TeNT and also does not inhibit in GT1b-TeNT ELISA, so this cannot be confirmed using GALPO to demonstrate binding to TeNT or in GT1b-TeNT inhibition ELISA.
[0238] As demonstrated by ELISA using canine IgG or canine Alb-coated TeNT and biotinylated TeNT, all multimeric SDAs including SVT02-GS2-SVG06M4-H6 and SVT15-3FW4M-GS2-SVG06M4-H6 bind to both TeNT and either Alb or IgG. Monomeric SDA does not show binding in these ELISAs.
[0239] STV02-GS2-SVG13M4-H6 yields a significantly lower maximum absorption value of 0.18 in canine IgG compared to other multimer SDAs containing SVG13M4, but is comparable to the value of 0.16 for monomeric SVG13L and clearly exceeds the background value of 0.05-0.06 observed for nonspecific monomeric SVT-SDA. This suggests that STV02-GS2-SVG13M4-H6 binds to canine IgG. This is confirmed by the higher absorption value when biotinylated TeNT is used to detect STV02-GS2-SVG13M4-H6 bound to a plate coated with canine IgG.
[0240] Considering all of these factors, all multimer SDAs exhibit bispecific binding to TeNT and either IgG or Alb; however, some SDAs do not bind directly to coated TeNT (SVT02-containing SDAs), or they do not inhibit GT1b-TeNT interactions (SVT02-containing SDAs), or they have lost their C-terminal his-tag (SVT02-GS2-SVG06M4-H6 and SVT15-3FW4M-GS2-SVG06M4-H6), and therefore do not show strong binding in specific ELISAs.
[0241] To confirm the bispecific / bivalent nature of multimeric SDAs, a second, completely different assay system was used. Biolayer interferometry (BLI) was used as an analytical technique to measure interactions between TeNT (holotoxin), albumin (horse), and several SDAs. BLI is an optical technique that analyzes the interference pattern of light waves reflected from two surfaces. Changes in the number of molecules bound to the biosensor cause a spectral shift in the interference wavelength pattern, which is measured (in real time) and reported as a nanometer (nm) shift. The Octet® platform thus provides a means to obtain accurate information about the biomolecular complex formation rate between SDAs and target antigens. The Octet Red96 instrument (ForteBio) was equipped with a streptavidin (SAX) biosensor. In the measurements, a ligand, either 10 μg / ml biotinylated TeNT (bio-T, Table 17a) or biotinylated equine albumin (bio-Ah, Table 17b), was coupled to the SAX sensor for 10 minutes. The sensor (loaded with each target antigen) was transferred to a solution containing a specific SDA (monomer or multimer) at 100 nM, and the interaction was measured for 4 minutes. In the next step, the sensor (bound to the monomer or multimer SDA) was transferred to a solution and reacted with a second analyte, either an unlabeled toxin (TeNT, 100 nM) or equine albumin (Ah, 100 nM), for 5 minutes. The interaction (nm shift) between the sensor and the analyte was monitored again. The results were analyzed, and Tables 17a and 17b below show the results for different SDAs (monomer and multimer).
[0242] From the results, we can conclude the following: SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 exhibits divalent bonding to two TeNT-TeNT molecules.
[0243] SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS2-SVA12M2-H6 exhibit bispecific binding to TeNT and equine albumin in two different test configurations.
[0244] SVT16-L123Q-GS2-SVG13M4-H6 and SVT16L could be coupled to TeNT.
[0245] As expected, SVT16-L123Q-GS2-SVG13M4-H6 and SVG13L were unable to interact with equine albumin.
[0246] 16. Analysis of the serum half-life of multimer SDA in pigs Several in vitro assays using monomeric and multimerized SDAs (Examples 4, 5, 7, 8, 9, 15, and 18) demonstrated that these SDAs can bind to blood components of several species (e.g., horses, dogs, cats, and pigs). Animal studies were conducted to evaluate the in vivo characteristics of some SDAs in terms of serum half-life extension. Since SDAs were produced using only horse and canine proteins, the animal studies were conducted in pigs to ensure true interspecies control. For this purpose, 24 piglets, approximately 6 weeks old, consisting of 12 males and 12 females, were used. They were weighed for 10 days prior to inoculation with multimerized SDAs and divided into four groups of 6 piglets each, with equal sex distribution, preferably equal mean body weight, and preferably equal piglet distribution based on sow origin. The groups (Table 18) are indicated by the names of the plasmids encoding the bispecific SDAs administered by intramuscular injection (pRL489, pRL490, pRL495, and pRL499). Three piglets (two males and one female) in group pRL489 also received a second bispecific SDA encoded by plasmid pRL276, called M8ggsVI4q6e
[44] . This bispecific SDA contains the same IgG-binding SDA domain as SDA2 K609ggsVI-4q6e, a different fusion SDA domain that has been previously used to measure half-life
[19] but is specific to the foot-and-mouth disease virus (FMDV) antigen.
[0247] Piglets were weighed one day before SDA inoculation (-1 day). Based on these body weights, the dose of multimerized SDA was calculated (Table 18). The dose was increased from 0.2 to 0.3–0.5 mg / kg for each group. Filter-sterilized SDA diluted in PBS was administered intramuscularly to a single site in the posterior thigh in a volume of approximately 5 ml. Blood samples for serum preparation were collected from the jugular vein immediately before SDA inoculation and on days 1, 2, 4, 8, 11, 14, 21, and 28 after SDA inoculation. Piglet body weight was also determined at the end of the experiment on day 28 to correct for serum half-life for animal growth.
[0248] Serum SDA levels were measured by ELISA using TeNT holotoxin or FMDV and anti-tagged MAb PO-conjugate. For this purpose, 96-well polystyrene plates were coated overnight at 4°C with 100 μl / well using SDA M23F[2], which is specific to FMDV O1 manisa, dissolved in PBS with 2 μg / ml TeNT holotoxin or coating buffer (50 mM NaHCO3, pH 9.2 buffer). After washing the plates with buffer, all subsequent incubations were performed at RT for 1 hour. The M23F-coated plates were then incubated in ELISA buffer with 146S of 5 μg / ml FMDV O1 manisa. The plates were then incubated with both 1 μg / ml and 0.1 μg / ml SDA standards, starting at their respective concentrations, in two 2-fold dilution series of SDA across 8 wells, and 5-fold dilution of piglet serum. Serum from piglets inoculated with SVT06 or SVT16-containing polymer SDA was incubated on TeNT-coated plates, while serum from piglets inoculated with M8ggsVI4q6e was incubated on FMDV-coated plates. The TeNT-coated plates were then incubated with an anti-his6 mAb-PO conjugate, and the FMDV-coated plates with an anti-mycMAb-PO conjugate. The bound PO was then detected by staining with 3,3',5,5'-tetramethylbenzidine. After stopping the reaction with 0.5 M sulfuric acid, the absorption at 450 nm was measured using a spectrophotometer. A four-parameter logistic curve was approximated to standard absorption and SDA concentrations. This curve was used to interpolate SDA concentrations, yielding specific absorption values for each serum sample in each ELISA. The calculated serum SDA concentrations were exported to an Excel® spreadsheet template (Microsoft Corporation, Redmond, USA).
[0249] The weight of the piglets increased by approximately 10 kg to 25 kg during the 4 weeks of serum collection. When weight increased during serum half-life measurement, the following correction was made: For each piglet, the hourly weight gain was assumed to depend on the initial weight, and the formula BW(t) = BW(0) was used. * T t (T=10 (log10(BW(t) / BW(0)) / t) This was applied to the formula (which can be rewritten as follows). In the formula, t is time (hours), BW(t) is the body weight at time t, BW(0) is the body weight at time 0, and T is the weight increase per hour.
[0250] This allows for the calculation of factor T from the weight of the piglet on day -1 and day 28. At an intermediate point between day -1 and day 28, then T t Weight gain was corrected by multiplying the VHH concentration measured using [the specified method].
[0251] The final serum half-life was calculated based on the following formula: SDA(t) = SDA(0) * (0.5 (t / T1 / 2β) ), where t is time (hours), SDA(0) is the SDA concentration at the first time point used (corrected for weight gain in the half-life calculation), and SDA(t) is the SDA concentration at time t, T 1 / 2 β is the final half-life.
[0252] The 28-day samples contained lower SDA levels, as evidenced by the absorption values, which were often less than three times the background absorption values; therefore, these data were excluded from the analysis. Serum half-lives were calculated from samples from days 4 to 21. For each individual piglet, the Solver function in Microsoft Excel was used to fit the SDA concentration to time based on the above formula. 1 / 2 The mean and standard deviation of β were calculated as follows:
[0253] The biodistribution volume of intravenously administered IgG in humans is 60 ml / kg body weight, according to reference
[73] . Therefore, the initial (days 1-2) concentration of SDA in the blood is expected to be slightly lower than 1 / 0.06 = 16.67 times the injected dose, since most SDA is initially present in the blood. This fits well for the three albumin-bound SDAs and the control SDA M8ggsVI-4q6e, which have initial SDA concentrations above 2 mg / L (Figure 6), but is extremely low for SVT16-L123Q-GS2-SVG13M4-H6, consistent with its short half-life.
[0254] SDA's T starts on day 4 (96 hours) 1 / 2 Calculate β (including weight correction) and summarize it in Table 18. T of M8ggsVI-4q6e 1 / 2 β is the T value of K609ggsVI-4q6e, which was measured previously. 1 / 2 It is lower than β.
[19] This may be due to different fused SDAs or differences between the two animal studies.
[0255] All three albumin-bound polymers SDA showed a T interval of 111–135 hours. 1 / 2 It showed β, and its standard deviation was small. This is the 82-hour T of the positive control SDA M8ggsVI-4q6e. 1 / 2 It is higher than β. All three of these multimer SDAs contained an albumin-binding SDA domain SVA12M2, which fused to either SVT06, SVT16-L123Q, or both of these SVT SDA domains to form a multimer SDA. Clearly, the half-life provided by SVA12M2 is not affected by the specific SVT SDA fused to it, nor by the number of SDAs fused to it.
[0256] SVT16-L123Q-GS2-SVG13M4-H6 containing IgG-targeting SVG13 SDA 1 / 2 Beta is only 20 hours. 1 / 2 β does not bind to serum proteins, and T1.8 hours 1 / 2It was significantly increased compared to the monomer SDA K609ggsK812
[19] of the control having β, suggesting that the half-life was prolonged. Nevertheless, this is the T of the Alb-binding multimer SDA 1 / 2 Much lower than β. In ELISA, when SVG13L binds to porcine IgG, as a result, when compared with feline, equine, canine, and human IgG, porcine IgG had a lower maximum absorption value and also a lower EC value (Table 8). This suggests that the binding of SVG13L to other IgGs than porcine IgG has a higher affinity and thus results in a longer serum half-life in these species.
[0257] The affinity of SVA12L for equine, canine, and feline albumin varied from 10 to 270 nM and was approximately 159 nM for porcine albumin (Example 18). Thus, a similar or even better serum half-life of SVA12 can be expected in vivo in horses, dogs, and cats when included in the multimer SDA.
[0258] The positive control M8ggsVI-4q6e contains the SDA domain VI-4 as also included in VI-4L (Example 9). SDA VI-4L, VI8L, VI11L, and VI14L have an affinity (K D ) of 1 to 33 nM for porcine IgG [19,44]. As shown for SDA VI4L, VI8L, VI11L, and VI14L for porcine IgG, SDA SVG13 showed equivalent EC values for equine, canine, and feline IgG (Table 8). Thus, a similar serum half-life of SVG13 can be expected in vivo in horses, dogs, and cat species.
[0259] 17. Analysis of SDA for tetanus toxin neutralization ability in a mouse model In vitro assays (Examples 3, 10, 11, 12, 13, 15, and 18) were performed using monomeric and polymeric SVT-based SDAs, demonstrating that these SDAs can effectively bind to tetanus holotoxin in several experimental test configurations. To evaluate the in vivo characteristics of some of these SDAs, animal experiments were conducted to assess their tetanus toxin neutralizing ability. Six candidate SDA samples (see Table 19) were tested for anti-tetanus toxin efficacy using a mouse toxin neutralization test. One monomeric SDA (SVT03L), four bispecific SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT153FW4M-GS2-SVG13M4-H6, SVT16L123Q-GS2-SVG13M4-H6), and one bispecific (against albumin and tetanus) and divalent (against tetanus toxin) SDA (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) were evaluated using the mouse toxin neutralization test (TNT). The tests were performed according to a method similar to that described in the European Pharmacopoeia Monograph 0091 concerning tetanus antitoxins. To accurately determine the neutralization endpoint of SDA, the assay was performed using a higher sensitivity level than that described in Ph Eur monograph 0091, allowing for the detection of lower amounts of toxin-neutralizing antibodies. The tetanus toxin (NIBSC: AWX4664, diluted to 1 / 100) dose level in the assays performed was Lp / 200. In each test, a reference tetanus antitoxin TE3 (pre-diluted to 0.025 IU / ml to 1 / 400 in the first dilution) was included (4 mice per group) to allow for the determination of potency for each test sample. Each time, a fixed volume of toxin (0.35 ml) was mixed with 2.15 ml of pre-diluted SDA test sample and, after standing for 30 minutes, injected into the mouse (0.5 ml sc, left thigh). Each pre-diluted sample was serially diluted with buffer to create 2-fold or 4-fold dilution series. Each SDA dilution had n=4 mice. Animals were observed for 96 hours for signs of tetanus paralysis. In each assay, the reference TE3 was diluted with buffer (2-fold or 4-fold).Each of the studies (1, 2, and 3) used female NIH mice weighing 16-20g and aged 5-6 weeks. A total of three studies were conducted consecutively.
[0260] In Experiment 1, SDA samples were diluted so that the starting concentration of each SDA in the assay mixture was 1000 nM for all candidates except SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (the amount in the mixture was 100 nM). Each candidate was then serially diluted to create a 2-fold dilution series consisting of 5 or 6 dilutions in total (see Table 19). Each dilution was mixed with a fixed amount of tetanus toxin and, after standing for 30 minutes, injected into mice (0.5 ml sc, left thigh). Each dilution group had n=4 mice. The animals were observed for signs of tetanus paralysis for 96 hours. The percentage of protected mice in each dilution is shown in Table 19.
[0261] For SDA SVT02-GS2-SVG13M4-H6, SVT03L, and SVT16-L123Q-GS2-SVG13M4-H6, no tetanus toxin neutralizing effect was observed in vivo at a level of 1000 nM.
[0262] Both SDAs, SVT06-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6, provided protection at concentrations of 1000 nM and 500 nM. Both SDAs were able to efficiently neutralize tetanus toxin when tested in this in vivo model.
[0263] The SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 SDA provided complete protection in all six dilutions. Despite being administered at a 1 / 10th lower concentration, this bivalent (i.e., against TeNT) SDA was more potent than all other bispecific SDAs. Furthermore, the SVA12L SDA fused to the two-fusion SVT SDA (SVT06-GS3-SVT16-L123Q) does not bind to mouse albumin (in vitro). Therefore, this multimeric SDA neutralizes tetanus toxin very efficiently within the set incubation time of 30 minutes. Based on the concentration of the reference antitoxin TE3 (pre-diluted 1 / 400 to 0.025 IU / ml in the first dilution) at the endpoint (intermediate between dilution steps 2 and 3), the potency for each test sample can be expressed in IU / ml. Note that if an endpoint is not obtained, efficacy is expressed as < (0% protection in all dilutions) or > (100% protection in all dilutions). The data is shown in Table 20.
[0264] The endpoint for the reference antitoxin was at the intermediate dilution of 2 and 3 in the assay mixture = 1.3 ml (0.0325 IU in the assay mixture). For the unknown sample, at the endpoint, 0.0325 IU was present in the assay mixture = 0.0325 IU in 2.15 ml = 0.0151 IU / ml. This value can then be multiplied by the respective total dilution factors of the relevant SDA.
[0265] The trivalent SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 exhibits the highest potency among all samples tested (protecting at concentrations lower than 3.1 nM). The trivalent SDA with SVA12 as one of the three linked SDAs binds to several types of albumin. The other two SDAs (SVT06 and SVT16) have high affinity (low K). D The tetanus toxin binds to the tetanus toxin at the tetanus toxin (value), and each binds to a different domain (Examples 13, 15, 18).
[0266] Subsequently, another TNT had to be performed to determine the protective endpoint for SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (Study 2). Furthermore, references [7,42] describe that mixing mouse monoclonal antibodies targeting different epitopes may have a synergistic effect on tetanus toxin neutralization levels. A similar effect was observed for scFv, which can neutralize tetanus toxin
[67] . Other sources
[24] have published that divalent anti-tetanus toxin nanobodies do not result in a strong improvement in efficacy compared to monomeric forms. Therefore, this second test further evaluated whether combinations of these different multimer SDAs, when mixed together in solution, exhibit a stronger toxin neutralization effect (synergistic effect) than when tested individually. See Table 21 for the scheme tested. The assay was performed as described above.
[0267] The results of the second mouse toxin neutralization test are shown in Tables 22a, 22b, and 23. The endpoint for the reference antitoxin was the same as in Test 1, with the intermediate between dilutions 2 and 3 being 1.3 ml in the assay mixture (0.0325 IU in the assay mixture). Therefore, the same potency calculation as shown in Test 1 (based on the relevant concentration at the initial dilution) is applied to group 7 (single SDA). When SDAs are used in combination, the relative contribution of each SDA is unknown, making it impossible to provide an estimate of the potency of each SDA in the mixture. However, the potency of the mixture can be described as the lowest concentration (nM) at which the SDA mixture achieved 100% protection (Table 22b).
[0268] When the polymeric SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 were mixed with SVT06-GS2-SVG13M4-H6 at 62.5 nM (groups 1 and 3), they provided at least >125 times higher protection than when SVT06-GS2-SVG13M4-H6 was tested as a single molecule (500 nM) (the final concentration of both SDAs was 3.91 nM overall). Thus, clear evidence of a strong synergistic effect between these SDAs was demonstrated (see Tables 21a and 21b).
[0269] The mice in group 5 were not protected, which indicates that no synergistic effect was found in this mixture for SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 at these concentrations of the relevant SDA.
[0270] SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 also achieved complete protection in all dilutions. The final dilution in which complete protection was found had an SDA amount equivalent to 0.2 nM (Table 23). The potency of this SDA is therefore >1478 IU / mg.
[0271] From the data of Test 2, the synergistic effect of other SDAs in the mixture was present individually in the final dilution, so it cannot be ruled out that SDAs SVT02-GS2-SVG13M4-H6 and SVT03L may have a synergistic effect. However, the final concentrations of the individual SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 in groups 2 and 4 were half lower than the final concentrations of the same SDAs in groups 1 and 3 when mixed with SVT06-GS2-SVG13M4-H6. Complete protection was found at the lowest concentration (0.97 nM in the final dilution step). Subsequently, a third test was conducted to determine the efficacy endpoint of candidate SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (see Table 24 below). In this study, it was decided to perform a 4-fold dilution at each step. Furthermore, this group was also included to investigate whether the single polymer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 was more potent on its own than when two SDA SVT06-GS2-SVG13M4-H6 molecules and SVT16-L123Q-GS2-SVG13M4-H6 molecules were mixed and similarly diluted.
[0272] To investigate whether SVT15-3FW4M-GS2-SVG13M4-H6 further increases the potency of the single SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, both mixtures were also tested in a separate group.
[0273] In Experiment 3, the endpoint for the reference antitoxin (TE-3) differed slightly from that obtained in Experiments 1 and 2, with only 75% of animals protected at dilution 2 (Table 24). Using the Spearman-Karber method to calculate the 50% protective dose, the antitoxin concentration at the endpoint was calculated as 0.034 IU in the assay mixture (in Steps 1 and 2, the endpoint relative to the reference was intermediate between dilutions 2 and 3 = 0.0325 IU in the assay mixture).
[0274] In SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, it was tested individually, but the endpoint was dilution 1 (50% of the animals were protected), and dilution 1 contained 0.034 IU in the assay mixture (= 0.034 IU in 2.15 ml of test sample, i.e., 0.0158 IU / ml). The neutralizing titer can be calculated by multiplying the total dilution factor corresponding to the sample by the concentration of the antitoxin at the endpoint, as shown in Table 25.
[0275] The extremely high tetanus toxin neutralizing capacity of SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 was reaffirmed. The potency of the master stock for this particular multimer SDA was calculated from the results of this specific assay as 11,474 IU / ml (equivalent to over 1500 IU per mg of protein). The neutralizing capacity of this SDA can be determined more accurately in other assays using smaller dilution steps from 0.2 nM and beyond.
[0276] In particular, SVA12L does not bind to mouse albumin, and therefore is unlikely to result in an extension of its half-life in mice or contribute to the efficacy measurements after administration to mice (Example 7).
[0277] The synergistic effect of using SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 together was demonstrated at a total SDA of 0.4 nM, achieving complete protection.
[0278] No protection was observed in this assay for the combined candidates SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. Therefore, based on the above results, it can be concluded that the total concentration of this pair of SDAs required to provide complete protection is in the range of 0.4–4 nM, and the amount of individual SDAs in the mixture is 0.2–2 nM or lower.
[0279] Therefore, from the three tests conducted, it can be seen that the single divalent and bispecificity polymer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 provides a very high level of protection against extremely potent tetanus toxin. Furthermore, it was superior to the strong synergistic effect observed after mixing the two single bispecificity SDAs, SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. SVG13L SDA was found to bind to mouse IgG (Example 8) after administration of the mixture to mice, which may contribute to the potency of these bispecificity SDAs. The divalent bispecificity SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, as a single molecule, has higher potency than the hypersynergistic tetanus toxin neutralizing properties exhibited by the mixture, which is a remarkable characteristic.
[0280] 18. Determination of the affinity that different SDAs have for TeNT, albumin, and immunoglobulins. Several SDAs were tested for their target binding properties (TeNT, albumin, and immunoglobulins from different species). Tetanus toxin binding properties are particularly important in each SVT SDA's ability to neutralize tetanus toxin in vivo (Example 17). Once fused with an SVT SDA, SVA and SVG SDAs help to extend the final serum half-life of the SVT SDA. Therefore, binding properties to different blood components [19, 22, 23, 25] are important for SVA and SVG SDAs. For veterinary purposes, it is further important to address species differences among such blood components. For certain interspecies disease targets (e.g., tetanus), it is preferable to use a single SDA for therapeutic applications targeting several species, rather than developing separate therapeutic SDAs for each species.
[0281] Here, biolayer interferometry (BLI) technology was used to measure the interactions between TeNT, different species of albumin, different species of immunoglobulin, and several monomeric and multimeric SDAs. BLI is an optical analysis technique that analyzes the interference patterns between waves of light. A change in the number of molecules (analytes) bound to a biosensor (coated with ligands) causes a spectral shift (nm shift) in the interference wavelength pattern (=signal), which is measured in real time. D k is the affinity constant or equilibrium dissociation constant, which is an indicator of how firmly a ligand binds to its analyte. It represents the ratio of the association rate to the dissociation rate, and k a and k dis It can be calculated using K. D It is expressed in molar units (M). D This corresponds to the concentration of analyte at which 50% of the ligand binding sites are occupied at equilibrium, or the concentration at which the number of ligand molecules bound to analyte is equal to the number of ligand molecules not bound to analyte. D If there is an inverse correlation between affinity and affinities, and the affinity constant is smaller, it suggests a stricter interaction or a stronger affinity of the analyte to the ligand.
[0282] To measure the interaction between the target and SDA, the Octet Red96 instrument (Pall Life Sciences) was equipped with streptavidin (SA / SAX), Anti-Penta-HI (HIS1K), or, for example, Ni-NTA (NTA) Dip and Read (trademark) biosensor (ForteBio).
[0283] To determine the binding affinity of SDA to tetanus toxin, 2 μg / ml of biotinylated TeNT (see Example 3) was coupled to the SA sensor. SDA was then coupled to PBS buffer (PBS10 × Fischer Scientific, cat) containing 0.02% Tween 20 (ACROS ORGANICS, catalog no. 233362500). The solution was diluted in BP399-1, and WFI, Hyclone (catalog number SH3022110) (PBSTween) as a 2x dilution series from 100 nM to 1.56 nM (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT16L123Q-GS2-SVG13M4-H6), or as a 2x dilution series from 10 nM to 0.156 nM (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6). The SDA dilution series was incubated with a TeNT coupling sensor for 5 minutes (starting concentration of 100 nM) or 10 minutes (starting concentration of 10 nM), and then a dissociation step was performed in PBS-tween for a further 10 minutes (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT16L123Q-GS2-SVG13M4-H6) or 60 minutes (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-SVA1212M2-H6).
[0284] To determine the binding affinity of SDA SVT06L, SVT15L, and SVT16L to tetanus toxin, each biotinylated SDA at 5 μg / ml was coupled to an SA sensor, and tetanus toxin (2-fold dilution series from 75 nM to 4.69 nM) was incubated with the SDA coupling sensor for 5 minutes, followed by a further 30-minute dissociation step in PBS-tween.
[0285] Next, we analyze the results using ForteBio data analysis software and determine the affinity constant (K D , k diss / k a The following was determined. Table 27 shows affinity data for several purified SDAs.
[0286] The bispecific and monomeric SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06L, SVT15L, SVT16L, SVT16L123Q-GS2-SVA12M2-H6, SVT16L123Q-GS2-SVG13M4-H6) bound to TeNT with sub-nanomole to picomole affinity. This is a crucial feature for their TeNT neutralizing ability. The rapid association and extremely slow dissociation of SVT-based SDAs inhibit the toxin from exerting its activity in a rapid and prolonged manner, even at the low toxin concentrations typically found in injected animals.
[0287] In particular, the stability of the tetanus toxin-SDA complex is important because it inhibits toxin uptake in neurons, for example. Very low dissociation (Kdis) values were found for SDA SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVG06M4-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6.
[0288] Three of these four fragment C-bound SDAs (SVT06-GS2-SVG13M4-H6, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) demonstrated excellent toxin neutralization properties when tested in vivo in TNT, both as single SDAs (at <4 μg / ml and <30 ng / ml levels) and as a mixture (at <30 ng / ml levels, see Example 17).
[0289] Avidity (K) of three SDAs containing two SVT domains (SVT06-GS3-SVT02-GS2-SVG06M4-H6, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) to TeNT D The avidity is within the picomolar range. In the case of SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, the measured avidity was 13 picomoles, and this SDA showed excellent tetanus toxin neutralization properties in an in vivo toxin neutralization model (Example 17).
[0290] This SDA has an affinity approximately 10 times higher than comparable monomeric SDA or multimeric VHH containing only one corresponding TeNT-bound SDA domain (SVT06 or SVT16) (low K). D The presence of the value suggests that both SDA domains present in SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 have the ability to bind to the antigen simultaneously.
[0291] Several assays were performed to determine the binding affinity of SDA to serum albumin. First, 1.0 (SVA06L) or 1.5 (SVA12L, SVA16L) micrograms / ml of SDA was coupled to a Ni-NTA sensor (loading time 15 minutes). For SVA06L, equine, canine, or feline albumin was added as an analyte in a 2-fold dilution series ranging from 76.9 nM to 4.81 nM (equine, canine, or feline albumin). For SVA12L, a 2-fold dilution series of 307.7 nM to 19.2 nM (equine or canine albumin) or 615.4 nM to 38.5 nM (feline albumin) was used. For SVA16L, a 2-fold dilution series of 100 nM to 3.1 nM (equine, canine, and feline albumin) was used. Albumin was reacted on SDA (SVA06L and SVA12L) coated sensors for 1 minute, followed by a dissociation step in PBSTween for another 2 minutes, except for SVA16L, where the intervals were 3 minutes and 5 minutes, respectively.
[0292] To determine the affinity of SVA12L for porcine albumin, a 2-fold dilution series ranging from 250 to 15.6 nM was used, employing a 1-minute association and dissociation step.
[0293] Next, the results were analyzed using ForteBio data analysis software. Table 28 shows the data for the SDAs that were tested.
[0294] Several SDAs that bind to the Fc portion of equine or canine immunoglobulins were also tested for their binding properties. Initially, to determine the affinity of SDA SVG03L, SVG23L, and SVG24L when bound to equine IgG(Fc) (Fitzgerald, catalog number 31C-CH0804), a configuration of 0.5 μg / ml SDA coupled to an NTA sensor was used. Scout assays showed that SVG23L did not bind to the equine Fc protein used. For SDA SVG03L, equine IgG(Fc) was diluted in PBSTween as a 2-fold dilution series from 50 nM to 3.13 nM. For SDA SVG24L, equine IgG(Fc) was diluted in PBSTween as a 2-fold dilution series from 100 nM to 6.25 nM. The Fc dilution series was incubated with an SDA coupling sensor for 3 minutes (association phase), followed by a 10-minute dissociation step during PBSTween.
[0295] To determine the affinity of SDA SVG03L, SVG23L, and SVG24L for binding to canine IgG(Fc) (Rockland, catalog no. 004-0103), a configuration of 1 μg / ml SDA coupled to an NTA sensor was used. Scout assays showed that SVG03L did not bind to the canine Fc protein used. For SDA SVG23L, canine IgG(Fc) was diluted in PBSTween as a 2-fold dilution series from 40 nM to 2.5 nM. For SDA SVG24L, canine IgG(Fc) was diluted in PBSTween as a 2-fold dilution series from 400 nM to 18.80 nM. The Fc dilution series was incubated with the SDA coupling sensor for 70-100 seconds (association phase), followed by a 5-minute dissociation step in PBSTween.
[0296] Next, the results were analyzed using ForteBio data analysis software. Table 35 shows the data for SDA tested against the Fc portion of equine or canine immunoglobulins.
[0297] Since albumin and immunoglobulins are abundant serum proteins, the affinity of SDA to albumin or immunoglobulins does not need to be very high for most SDA molecules to bind to these targets. Consistent with this concept, the extension of the serum half-life of protein therapies using genetically engineered bacterial albumin-binding domains has been observed to be largely independent of their affinity for albumin. D When the value was lower than 100 nM (indicating increased binding affinity), the serum half-life was not affected by affinity. D Only when the value approached 1 μM did the serum half-life decrease slightly [36,37].
[0298] For SDA SVA06L, SVA12L, and SVA16L, affinity for albumin of porcine, equine, canine, or feline origin varied from 1 to 275 nM, all below 1000 nM. For the multimer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, a serum half-life of approximately 110 to 145 hours was estimated in young pigs. On day 21 after administration, SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (0.3 mg / kg), SVT06-GS2-SVA12M2-H6 (0.2 mg / kg), and SVT16-L123Q-GS2-SVA12M2-H6 (0.5 mg / kg) were still detectable in pig serum. Therefore, in the case of SDA SVA12L, the dosage, the amount of SDA fused to it, and the type of SDA did not significantly affect the half-life in pigs. Since all SVA SDAs were produced using equine and canine albumin, similar half-life profiles can be expected for these SDAs in horses, dogs, and cats.
[0299] For SDA SVG03L, SVG23L, and SVG24L, the affinity constant K for the Fc portion of equine or canine immunoglobulins is used. DThe levels varied from 0.1 to 4 nM, all below 10 nM. The use of these binders may be beneficial in interfering with different immunological processes, particularly complement pathway activation, type I hypersensitivity reactions, allergies, and atopic dermatitis.
[0300] 19. Construction and production of further polymer SDAs for TeNT Furthermore, two more multimer SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) were generated in yeast strain SU50
[70] by creating stable MIRY integrations
[75] using plasmid pRL44
[69] . The elements from which these multimer SDAs were created are as follows: GS3: Previously described (G4S) 3-linker
[27] GS2: (G4S)2 linker derived from the pRL144 plasmid
[19] H6: Similar to pRL188, it has a his6 tag, a double stop codon, and a HindIII site.[2] SVG13M5: SVG13 has five mutations: Q1E, Q5V, W118R, K120Q, and L123Q. SVA12M2: SVA12 with two mutations: Q1E and Q5V SVT15-3FW4M: SVT15 lacking an internal SacI site and possessing three mutations: K120Q, I122T, and L123Q. SVT16-L123Q: SVT16 with a non-expressionally restored BstEII site and L123Q mutation. Synthetic SacI-HindIII fragments were generated and then subcloned into plasmid pRL44
[69] using the SacI and HindIII sites to obtain plasmids pRL505 and pRL506 (Table 34).
[0301] Baker's yeast strain SU50 (MATa; cir°; leu2-3, -112; his4-519; can1;
[70] ) was transformed by electroporation using HpaI-linear plasmids pRL505 and pRL506
[71] , and the leu+ nutrient requirement was selected. Single-colony purified transformants were induced for SDA expression on a 0.5 L scale, and SDA was purified from the culture supernatant by IMAC
[58] . SDA was further purified by cation exchange chromatography on an SP Sepharose column, as previously described
[44] , but with some modifications. SP Sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate, pH 4.7 buffer were used to conjugate SDA to the column. The bound SDA was eluted in binding buffer using a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8, and 1 M NaCl. Bound SDA generally eluted in 0.4–0.6 M NaCl (Table 34). This was concentrated using a 3 kDa molecular weight cutoff centrifugal concentrator and exchanged for PBS. SDA concentration was determined using a bicinchoninic acid assay (BCA, Pierce catalog no. 23212) and bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on the purified SDA yield, the production level of multimer SDA in yeast was calculated (Table 34).
[0302] Multimeric SDA was analyzed by reduced SDS PAGE using NuPage Novex 4%-12% bis-Tris gel containing MOPS electrophoresis buffer (Invitrogen), and by staining with Gelcode Blue reagent (Thermo Scientific). All multimeric SDA molecules migrated to the expected position based on their predicted molecular mass. Samples were biotinylated from stock using the appropriate weight ratio of protein to biotin (sulfo-NHS-LC-biotin, Pierce, catalog number 21335, lot number OE185235A).
[0303] 20. Further coupling properties of several SDAs to TeNT Further assays were performed to test the binding of selected SDAs when compared to cAb-TT1 and cAb-TT2
[46] , using an Octet Red96 instrument (Pall Life Sciences), and equipped with a streptavidin (SA) biosensor. For this purpose, the binding affinity of SDAs SVT06L, SVT15L, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, cAb-TT1, and cAb-TT2 to tetanus toxin was evaluated.
[0304] To determine the binding affinity to tetanus toxin, biotinylated SDA was coupled to an SA sensor (see Example 18). A 2-fold dilution series of tetanus toxin was prepared; see Table 29 for assay details. After further optimization of the assay, SDA was incubated with different dilutions of tetanus toxin, followed by an association step (2–8 minutes) and then a dissociation step in PBS-tween (2–10 minutes). The results were then analyzed using ForteBio data analysis software, and the affinity constant (K) was determined. D The following was determined. Table 29 shows affinity data for each SDA.
[0305] Previous test results for SVT06L, SVT15L, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (see Table 27) were repeated in this assay configuration, confirming high affinity for tetanus toxin. For cAb-TT1 and cAb-TT2, lower affinities were observed, as previously reported. In particular, rapid dissociation was significant in both cAb-TT1 and cAb-TT2. However, this is consistent with results from a mouse toxin neutralization test, as described in International Publication 96 / 34103, in which 75% of mice died 4 days after application of 4 μg of cAb-TT2. In contrast, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, when used at low nanogram levels (20-30 ng / ml), protected mice from more than five times the lethal dose of tetanus toxin in several consecutive TNT studies.
[0306] For two additional macromer SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6), a configuration coupled with 4 μg / ml biotinylated TeNT to an SA sensor was used to determine its affinity when binding to tetanus toxin. SDAs (including SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) were diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) as a 2-fold dilution series ranging from 10 nM to 0.62 nM. The SDA dilution series was incubated with the TeNT-coupling sensor for 3 minutes (association phase), followed by a dissociation step in PBS-Tween for a further 15 minutes. Next, we analyze the results using ForteBio data analysis software and determine the affinity constant (K) for each SDA. D ) was decided.
[0307] From this study, bispecific (binding to tetanus toxin and albumin or IgG) and divalent (to tetanus toxin) SDAs bound to TeNT with sub-nanomole to picomole affinity. See Table 30. Based on the results provided in Example 17, these SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) are expected to achieve effective neutralization of tetanus toxin in vivo at low nanogram levels.
[0308] 21. Further binding properties of several multimer SDAs to horse, human, or canine albumin. For the selected divalent and bispecific (multimeric) SDAs, additional assays were performed to determine their binding affinity to horse, canine, and human serum albumin.
[0309] For three multimer SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6), to determine their affinity when bound to equine albumin, a configuration was used in which 2.5 micrograms / ml of biotinylated (sulfo-NHS-LC-biotin, Pierce, catalog number 21335, lot number OE185235A, in an appropriate weight ratio of protein to biotin) equine albumin, or 5.0 micrograms of human albumin, after optimization, was coupled to an SA sensor. After further optimization, these two SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6) were diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) as a 2-fold dilution series ranging from 10 nM to 0.62 nM. The SDA dilution series was incubated with a horse albumin coupling sensor for 6 to 10 minutes (association phase), followed by a dissociation step in PBS-Tween for another 10 minutes. For SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6, a concentration of 100 nM was selected.
[0310] The monomer SDA SVA12L and all three SDA polymers were evaluated for their affinity binding properties to human albumin at a concentration of 100 nM.
[0311] For three multimer SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6), a configuration was used in which a 1.25 microgram / ml biotinylated multimer SDA (see Example 19), after optimization, was coupled to an SA sensor to determine its affinity when bound to inialbumin. Inialbumin was diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) as a 2-fold dilution series from 500 nM to 16 nM. The albumin dilution series was incubated with each SDA coupling sensor for 4-5 minutes (association phase), followed by a dissociation step in PBS-tween for an additional 5-10 minutes.
[0312] Next, the results were analyzed using ForteBio data analysis software. Tables 31a and 31b show the data from tests performed on SDA. As expected, neither monomeric nor multimeric SDA was found to bind to human albumin. The multimeric SDA SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6 was found not to bind to horse, human, or canine albumin, as expected.
[0313] For the polymer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, the affinity constant K for albumin of horse or canine origin is DThe levels varied between 0.5–1.5 nM and 250–400 nM, respectively. For the multimer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, a serum half-life of approximately 110–145 hours (4.5–6 days) was found in pigs (see Example 16), and a serum half-life of approximately 510 hours (21.25 days) was found in horses (see Example 23). Based on affinity data, similar half-lives can be expected for SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 in pigs and horses.
[0314] 22. Affinity of several SDAs to TeNT, determined by another method (Creoptix WAVE system) For several SDAs, the affinity constants for the target TeNT were in the pM range when determined by the Octet Red96 instrument. To confirm this finding, an additional technique, grating-coupled interferometry (GCI)
[76] , specifically for Creoptix® sensors, was used. GCI is a waveguide interferometry-based method for monitoring and characterizing intermolecular interactions and determining the dynamic velocity, affinity constants, and concentrations of interacting analytes. Like other optical label-free methods, such as surface plasmon resonance (SPR), waveguide interferometry detects refractive index changes occurring in the evanescent field near the sensor surface due to mass changes resulting from complex formation of interacting molecules. The combination of two extremely sensitive methods, namely interferometry and plane optical waveguide sensing, enables very low detection limits.
[0315] Affinity (KD) experiments for several monomeric and polymeric SDAs using TeNT as the target were conducted at 30°C using a Creoptix WAVE instrument (Creoptix AG, Waedenswil, Switzerland). The conditioning of the chip (4PCP-S), protein immobilization, and reaction rate experiments followed the protocols in the WAVE control software. Standard chemicals were used.
[0316] Biotinylated tetanus toxin (10 micrograms / ml) was immobilized on a PCH-streptavidin tip by injecting 10 microliters / min over 120 seconds through the relevant channel. All experiments were performed using PBS buffer containing 0.02% Tween 20 (PBSTween) as the electrophoresis buffer. Binding characteristics were evaluated for several SDAs (monomers and polymers) at five concentrations (100–1.2 nM, 3-fold dilution step). The association phase for the evaluated SDAs was 4 minutes. For SVT 03L, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6, the dissociation period was 6000 seconds. For SVT06-SVT16-L123Q-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6, the dissociation period was set to 1000 seconds and 12000 seconds, respectively. Next, the results were analyzed using Creoptix data analysis software, and the affinity constant (K) was calculated. D The decision was made. The results are shown in Table 32.
[0317] The results confirm previous findings regarding the slow dissociation and fast association of each SDA tested. D The pressure fluctuated between 1.0 and 25 pM.
[0318] 23. Analysis of the serum half-life of multimer SDA in horses The serum half-lives of SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 were determined in horses. Since SDA was produced using only horse and canine albumin proteins, these are relevant target species. For this purpose, three female ponies aged 4.5–6.5 years were used. They were weighed before intramuscular inoculation. Based on body weight, the required amount of multimer SDA per animal was calculated (administered at 0.17 mg / kg). Filter-sterilized SDA was dissolved in PBS and intramuscularly injected at a single site into the posterior thigh in a volume of approximately 2.5 ml. Blood samples for serum preparation were collected from the jugular vein immediately before SDA inoculation, and then on days 1, 2, 4, 7, 10, 13, 17, and 21 thereafter.
[0319] Serum SDA levels were measured by ELISA using TeNT holotoxin and anti-tagged mAb PO-conjugate. For this purpose, 96-well polystyrene plates were coated with 2 μg / ml TeNT holotoxin in PBS dissolved in coating buffer (50 mM NaHCO3, pH 9.2 buffer) at 4°C overnight, with a capacity of 100 μl / well. After washing the plates with ELISA buffer (1% skim milk; 0.05% Tween 20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH2PO4; 8.1 mM Na2HPO4; pH 7.4, 100 μl / well), all subsequent incubations were performed at RT for 1 hour. TeNT-coated plates were incubated with a 2x dilution series across 8 wells. Each column was started with both 1 microgram / ml and 0.1 microgram / ml SDA standards; column 3 was spiked with 1 microgram / ml SDA-spiked null serum, and columns 4-12 were started with serum from 9 collected animals. The serum was initially diluted 5x and then 2x across the 8 wells. After washing, the TeNT-coated plates were incubated with an anti-his6mAb-PO conjugate (1 / 1000, Roche, catalog no. 11965085001). The conjugated PO was then detected by staining with 3,3',5,5'-tetramethylbenzidine (Surmodics; catalog no. TMBW-1000-01). After stopping the reaction with the addition of 0.5 M sulfuric acid, the absorption at 450 nm was measured using a spectrophotometer. The absorption data were evaluated using a suitable commercially available software program. A four-parameter logistic curve was used to approximate standard absorption and SDA concentrations. This curve was used to interpolate SDA concentrations to obtain specific absorption values for each serum sample in each ELISA. The calculated serum SDA concentrations were exported to an Excel® spreadsheet template (Microsoft Corporation, Redmond, USA).
[0320] The final serum half-life was calculated based on the following formula: SDA(t) = SDA(0) * (0.5 (t / T1 / 2β) ), where t is time (hours), SDA(0) is the SDA concentration at the first time point used (corrected for weight gain in the half-life calculation), and SDA(t) is the SDA concentration at time t, T 1 / 2 β is the final half-life.
[0321] The serum half-life was calculated from data taken from samples taken from day 2 to day 21. The Solver function in Microsoft Excel was used to approximate the SDA concentration over time for each individual animal, based on the above formula. 1 / 2 The mean and standard deviation of β were calculated as follows (see Table 33).
[0322] (Horse) Animals inoculated with albumin-bound divalent and bispecific polymer SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 showed an average T of 510 hours. 1 / 2 β was observed. This multimer SDA contains the albumin-binding SDA domain SVA12M2 and links with the SVT06 and SVT16-L123Q SDA domains to form the multimer SDA. On day 21 after SDA administration, serum levels of 0.4–0.6 micrograms / ml were measured in three animals, and therefore, based on the data shown in Example 17, all animals would have been protected from tetanus as this level is much higher than the minimum required level (0.1 IU / ml). As expected, in horses, the serum half-life calculated for SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 exceeded the serum half-life measured and calculated for pigs. This supports calculations predicting that a similar long serum half-life can be expected in dogs as well.
[0323] [Table 2] TIFF0007857080000004.tif224149
[0324] Table 3
[0325] Table 4
[0326] Table 5 TIFF0007857080000008.tif226149
[0327] Table 6
[0328] Table 7 TIFF0007857080000011.tif225149
[0329] Table 8
[0330] Table 9
[0331] Table 10 TIFF0007857080000015.tif226149
[0332] Table 11
[0333] Table 12
[0334] Table 13 TIFF0007857080000019.tif191149
[0335] Table 14
[0336] Table 15
[0337] Table 16 TIFF0007857080000023.tif129149
[0338] Table 17
[0339] Table 18
[0340] Table 19
[0341] Table 20
[0342] Table 21
[0343] Table 22
[0344] Table 23
[0345] Table 24
[0346] Table 25
[0347] Table 26
[0348] Table 27
[0349] Table 28
[0350] Table 29
[0351] Table 30
[0352] Table 31
[0353] Table 32
[0354] Table 33
[0355] Table 34
[0356] Table 35
[0357] Table 36
[0358] Table 37
[0359] Table 38
[0360] References [1] Hamers-Casterman C et a. Nature.1993;363:446-8. [2] Harmsen MM et al. Vet Microbiol. 2007;120:193-206. [3] Harmsen MM et al. J ImmunoassayImmunochem. 2012;33:234-51. [4] Rossetto O et al. Tetanusneurotoxin. Toxicon. 2013;66:59-63. [5] Herreros J et al. Biochem J. 2000;347Pt 1:199-204. [6] Fitzsimmons SP et al. Vaccine.2000;19:114-21. [7] Yousefi M et al. Human vaccines & immunotherapeutics. 2014;10:344-51. [8] Scott N et al. Mol Immunol.2010;47:1931-41. [9] Sagt CM et al. Appl Environ Microbiol.2000;66:4940-4.
[10] Liu L. J Pharm Sci. 2015;104:1866-84.
[11] Gorlani A et al. Protein Eng Des Sel.2012;25:39-46.
[12] Liu JL et al. Microbial cell factors. 2015;14:158.
[13] Goldman ER et al. Protein Expr Purif.2014;95:226-32.
[14] Van de Laar T et al. BiotechnolBioeng. 2007;96:483-94.
[15] Batra SK et al. Curr Opin Biotechnol.2002;13:603-8.
[16] Iznaga-Escobar N et al. Methods FindExp Clin Pharmacol. 2004;26:123-7.
[17] Kontermann RE. Curr Opin Biotechnol.2011;22:868-76.
[18] Klooster R et al. J Immunol Methods.2007;324:1-12.
[19] Harmsen MM et al. Vaccine.2005;23:4926-34.
[20] Coppieters K et al. Arthritis Rheum.2006;54:1856-66.
[21] Holliger P et al. Nat Biotechnol.1997;15:632-6.
[22] Holt LJ et al. Protein Eng Des Sel.2008;21:283-8.
[23] Hutt M et al. J Biol Chem.2012;287:4462-9.
[24] Rossotti MA et al. mAbs. 2015;7:820-8.
[25] Walker A et al. Protein Eng Des Sel. 2010;23:271-8.
[26] Terryn S et al. PLoS ONE.2014;9:e109367.
[27] Huston JS et al. Proc Natl Acad Sci.1988;85:5879-83.
[28] Mukherjee J et al. PLoS ONE.2012;7:e29941.
[29] Sepulveda J et al. Infect Immune. 2010;78:756-63.
[30] Vance DJ et al. J Biol Chem.2013;288:36538-47.
[31] Klein JS et al. ProteinEng Des Salt. 2014;27:325-30.
[32] Trinh R et al. MolImmunol. 2004;40:717-22.
[33] Beirnaert E. Improved nanobodies(TM)against tumor necrosis factor-alpha. 2006.
[34] WO2011064382
[35] Conrath KE et al. J Biol Chem.2001;276:7346-50.
[36] Hopp J et al. ProteinEng Des Sel. 2010;23:827-34.
[37] Jacobs SA et al.Protein Eng Des Sel. 2015;28:385-93.
[38] Fridy PC et al. NatMethods. 2014;11:1253-60.
[39] Chaudhury C et al. J Exp Med.2003;197:315-22.
[40] Nagel J et al. J Immunol. 1973;110:1388-95.
[41] Mizuguchi J et al. Naturwissenschaften. 1982;69:597-8.
[42] Volk WA et al. Infect Immun. 1984;45:604-9.
[43] Harmsen MM et al. Appl MicrobiolBiotechnol. 2009;84:1087-94.
[44] Harmsen MM et al. Vet Microbiol.2008;132:56-64.
[45] Frenken LGJ et al. J Biotechnol.2000;78:11-21.
[46] Arbabi-Ghahroudi M et al. FEBS Lett.1997;414:521-6.
[47] Xing DK et al. Biologicals.1996;24:57-65.
[48] Coombes L et al. Biologicals. 2012;40:466-72.
[49] McCafferty J, Johnson KS. In: Phagedisplay of peptides and proteins. 1996. p. 79-111.
[50] Lou J et al. J Immunol Methods.2001;253:233-42.
[51] Lefranc MP, Methods Mol Biol.2004;248:27-49.
[52] Harmsen MM et al. Mol Immunol.2000;37:579-90.
[53] Butler JE. Methods. 2000;22:4-23.
[54] Arbabi-Ghahroudi M et al. Protein engineering, design & selection: PEDS. 2009;22:59-66.
[55] de Wildt RM et al. J Mol Biol. 1999;294:701-10.
[56] Desmyter A et al. J Biol Chem.2001;276:26285-90.
[57] Deschacht N et al. J Immunol.2010;184:5696-704.
[58] Van der Vaart JM in Methods Mol Biol. Totowa, NJ: Humana Press; 2002. p. 359-66.
[59] Harmsen MM et al. Appl MicrobiolBiotechnol. 1996;46:365-70.
[60] Harmsen MM et al. Appl MicrobiolBiotechnol. 2002;60:449-54.
[61] Harmsen MM et al. Appl MicrobiolBiotechnol. 2007;77:13-22.
[62] Sheppard AJ et al. Infect Immun.1984;43:710-4.
[63] Emsley P et al. J Biol Chem.2000;275:8889-94.
[64] Fotinou C et al. JBiol Chem. 2001;276:32274-81.
[65] Chen C, Baldwin MR, Barbieri JT.Biochemistry. 2008;47:7179-86.
[66] Chen C, Fu Z, Kim JJ, Barbieri JT,Baldwin MR. J Biol Chem. 2009;284:26569-77.
[67] Wang H, Yu R, Fang T, Yu T, Chi X, ZhangX, et al. Toxins. 2016;8.
[68] Kenimer JG et al. Infect Immun.1983;42:942-8.
[69] Harmsen MM et al. Vet Microbiol.2005;111:89-98.
[70] Joseph ML et al. Appl EnvironMicrobiol. 1993;59:52-9.
[71] Becker DM, Guarente L. MethodsEnzymol. 1991;194:182-7.
[72] Harmsen MM et al. Vaccines.2011;29:2682-90.
[73] Van Oers JW, Tilders FJ. Endocrinology.1991;128:496-503.
[74] Verheesen & Laeremans. Methods MolBiol 2012; 911: 81–104.
[75] Gorlani A et al. Methods Mol Biol.2012;911:277-86
[76] Kozma, F. et al. Biosensors andBioelectronics 2014 , 58:287-307.
Claims
1. Tetanus neurotoxin (TeNT) contains less than 1 nM of potassium. D A single-domain antibody (SDA) having the ability to bind by value, having at least 90% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 15, 20, and 25, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.
2. The SDA according to claim 1, having at least 95% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 15, 20, and 25.
3. The SDA according to claim 1 or 2, having 100% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 15, 20, and 25.
4. A polypeptide construct comprising at least one SDA having the ability to bind to TeNT as described in any one of claims 1 to 3, and at least one SDA having the ability to bind to serum proteins.
5. The polypeptide construct according to claim 4, wherein the serum protein is serum albumin or immunoglobulin.
6. The polypeptide construct according to claim 5, wherein the SDA having the ability to bind to serum albumin has 100% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.
7. The polypeptide construct according to claim 5, wherein the immunoglobulin is immunoglobulin G (IgG).
8. The polypeptide construct according to claim 5 or 7, wherein the SDA having the ability to bind to the immunoglobulin has 100% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33, and 34, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.
9. A polypeptide construct according to any one of claims 4 to 8, comprising at least two SDAs having the ability to bind to TeNT, wherein each of the at least two SDAs having the ability to bind to TeNT has at least 95% overall amino acid sequence identity with a sequence selected from option A: SEQ ID NO: 24, or option B: SEQ ID NO: 25, or option C: SEQ ID NO: 20, or option D: SEQ ID NO: 17 or 19, or option E: SEQ ID NO: 22, 15, 23, or 14, provided that the at least two SDAs do not include sequences derived from the same option, and the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.
10. A pharmaceutical composition comprising at least one SDA according to any one of claims 1 to 3, and / or at least one polypeptide construct according to any one of claims 4 to 9, and a pharmaceutically acceptable carrier, wherein at least one SDA having the ability to bind to TeNT according to any one of claims 1 to 3 has at least 90% overall amino acid sequence identity with SEQ ID NO: 17 or 20, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.
11. The pharmaceutical composition according to claim 10, comprising at least two SDAs having the ability to bind to TeNT as described in any one of claims 1 to 3, and / or at least one polypeptide construct as described in claim 9.
12. A composition for use as a pharmaceutical, comprising an SDA according to any one of claims 1 to 3, and / or a polypeptide construct according to any one of claims 4 to 9.
13. A composition comprising the SDA according to any one of claims 1 to 3 and / or the polypeptide construct according to any one of claims 4 to 9, or the pharmaceutical composition according to claim 10 or 11, for use in the prevention or treatment of diseases / symptoms of Clostridium tetanus.
14. A DNA fragment encoding an SDA according to any one of claims 1 to 3, or a polypeptide construct according to any one of claims 4 to 9.
15. A nucleic acid comprising the DNA fragment described in claim 14, wherein the DNA fragment described in claim 14 is operably linked to a promoter and, optionally, other regulatory elements.
16. A host cell containing the nucleic acid described in claim 15.
17. A method for producing an SDA according to any one of claims 1 to 3, or a polypeptide construct according to any one of claims 4 to 9, comprising: a) culturing the host cells according to claim 16 under conditions that enable the expression of the SDA or polypeptide construct; and optionally b) recovering the SDA or polypeptide construct from at least one of the host cells and the culture medium.
18. A diagnostic kit comprising at least one SDA having the ability to bind to the TeNT described in any one of claims 1 to 3.