SNP locus combinations, primer combinations, and methods for identifying honeysuckle varieties

Abstract

The present invention provides a combination of SNP loci, a combination of primers and a method for identifying honeysuckle varieties, which are related to the field of genetic engineering, and the base sequences of 150 bp around the SNP loci are shown in SEQ ID Nos. 1 to 15. The method according to the present invention is simple and rapid, can identify new honeysuckle varieties in a short time, and is low-cost. In addition, it is highly sensitive, and by combining the Sanger sequencing method with the constructed 39 honeysuckle DNA fingerprint database, it is possible to effectively detect the difference between the genotype of the sample to be tested and the genotype of existing honeysuckle varieties. With excellent specificity, the present invention designs 15 pairs of primers based on 15 high-quality SNP locus sequences, and has high specificity. The present invention has high reference value in identifying new honeysuckle varieties, and is suitable for popularization and application.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly to a combination of SNP loci, a combination of primers, and a method for identifying the varieties of Lonicera japonica for identifying the varieties of Lonicera japonica.

Background Art

[0002] Lonicera japonica Thunb. is a perennial semi-evergreen vine of the genus Lonicera in the family Caprifoliaceae. It is native to China, mainly distributed in the temperate regions of the Northern Hemisphere, and is also planted in small amounts in Japan and Korea. Honeysuckle is the dried flower buds or newly opened flowers of the plant Lonicera japonica Thunb. in the family Caprifoliaceae. It has a sweet and cold taste and a fragrant smell. It has the effect of clearing heat and detoxifying the blood without hurting the stomach. It has long been known as a good medicine for clearing heat and detoxifying. In addition to being used in medicine, it is also used in a wide range of applications such as health foods, beverages, cosmetics, feeds, and spices. Honeysuckle also plays an important role in the prevention and treatment of the current novel coronavirus infection and has great market potential.

[0003] In China, honeysuckle is mainly distributed in three production areas: Mi County and Fengqiu in Henan Province, Pingyi in Shandong Province, and Julu in Hebei Province. Honeysuckle from Henan Province has a long history of cultivation and is considered to be of the highest quality, with Fengqiu County in particular having earned the reputation that "the two flowers of the Central Plains are the best in the world, and the two flowers of Fengqiu are the best in the Central Plains." Li Shizhen's "Compendium of Materia Medica" from the Ming Dynasty in China also states, "Honeysuckle is found everywhere, but Fengqiu's is superior." In March 2003, honeysuckle from Fengqiu obtained a "Certificate of Origin Registration" issued by the General Administration of Quality Supervision, Inspection and Quarantine of China, receiving intellectual property-level protection in WTO member countries. As market demand for honeysuckle increases day by day, scientifically and accurately identifying honeysuckle varieties is becoming a challenge. Currently, honeysuckle production faces several challenges, including (1) serious loss of honeysuckle germplasm resources and limited collection and storage of these resources, (2) a lack of new and improved varieties of honeysuckle, and (3) unstable cultivation scale leading to reduced yield and quality. Due to problems such as inferior cultivation techniques, inadequate management standardization, serious pest and disease outbreaks, and an unhealthy industrial chain, honeysuckle germplasm resources are highly confused, often resulting in issues such as different varieties having the same name, the same variety having different names, and unclear genetic relationships between varieties. These problems not only lead to intellectual property disputes between varieties but also make cataloging and preserving honeysuckle germplasm resources, cultivating new varieties, and promoting and applying honeysuckle varieties extremely difficult. Therefore, there is a need to establish an accurate, rapid, simple, and low-cost method to solve the challenge of honeysuckle variety identification. Currently, the germplasm of honeysuckle is limited to morphological and chemical fingerprint analysis for variety identification. Most studies use high-performance liquid chromatography (HPLC), capillary electrophoresis (CEFP), and Fourier transform infrared spectroscopy (FTIR). Research methods using DNA molecular markers and DNA fingerprint construction remain severely lacking, and the goal of accurately, rapidly, and conveniently identifying new honeysuckle varieties has not been achieved.

[0004] Single nuleotide polymorphisms (SNPs) are molecular marker technologies based on high-throughput sequencing and DNA chip technologies, offering advantages such as high polymorphism, high codominance, efficient and convenient detection, and low cost. Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments. The greatest feature of PCR is its ability to significantly increase minute amounts of DNA, making it easier to observe sample specificity. Currently, SNP molecular marker technology and PCR technology are not used for the rapid identification of new honeysuckle varieties. [Overview of the project] [Problems that the invention aims to solve]

[0005] To solve the above problems, the present invention provides a combination of SNP loci, a combination of primers, and a method for identifying honeysuckle varieties. The present invention provides 15 high-quality SNP loci, designs 15 specific primers based on specificity, detects the genotype of a new honeysuckle variety at the 15 SNP loci using polymerase chain reaction (PCR) and first-generation sequencing techniques, and determines whether it is a new honeysuckle variety by matching and analyzing it with a constructed honeysuckle DNA fingerprint database. [Means for solving the problem]

[0006] To achieve the above objectives, the present invention proposes the following technical solution.

[0007] The present invention relates to a combination of SNP loci for identifying honeysuckle varieties, the nucleotide sequences of 150 bp before and after the SNP loci are indicated by SEQ ID No. 1 to 15.

[0008] The present invention provides a combination of primers for amplifying the SNP locus combination described in the above technical proposal, the nucleotide sequences of the primers are indicated by SEQ ID No. 16 to 45.

[0009] Preferably, SEQ ID No. 16~17 amplifies SEQ ID No. 1, SEQ ID No. 18~19 amplifies SEQ ID No. 2, SEQ ID No. 20~21 amplifies SEQ ID No. 3, SEQ ID No. 22~23 amplifies SEQ ID No. 4. SEQ IDs 24-25 amplify SEQ ID 5. SEQ ID No. 26~27 amplifies SEQ ID No. 6, SEQ ID No. 28~29 amplifies SEQ ID No. 7, SEQ ID No. 30~31 amplifies SEQ ID No. 8. SEQ ID No.32~33 amplifies SEQ ID No.9, SEQ ID No. 34~35 amplifies SEQ ID No. 10. SEQ ID No. 36~37 amplifies SEQ ID No. 11, SEQ ID No. 38~39 amplifies SEQ ID No. 12, SEQ ID No. 40~41 amplifies SEQ ID No. 13, SEQ ID No. 42~43 amplifies SEQ ID No. 14, SEQ IDs 44-45 amplify SEQ ID 15.

[0010] The present invention provides a method for identifying honeysuckle varieties, and the method is 1) Extracting DNA from the sample to be tested, using the DNA as a template, performing PCR amplification using the primer combination described in the above technical proposal, and obtaining the amplification product; 2) Perform Sanger sequencing on the amplification product obtained in step 1) above to obtain the genotype of the sample to be tested at the SNP locus described in the above technical proposal, and to draw the DNA fingerprint. 3) The DNA fingerprint obtained in step 2) above is compared with a constructed honeysuckle DNA fingerprint database, and if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is 0, it is classified as "same variety", if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≤ 2, it is classified as "similar variety", and if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≥ 3, it is classified as "different variety".

[0011] Preferably, the PCR amplification reaction system in step 1) comprises 1 μl of template DNA, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, 1 μl of dNTP(mix), 2.5 μl of Taq Buffer, and 0.2 μl of Taq enzyme, with sterile deionized water added until the total volume reaches 25 μl.

[0012] Preferably, the PCR amplification procedure involves pre-denaturing at 95°C for 5 minutes, denaturing at 94°C for 30 seconds, annealing at 63°C for 30 seconds, lowering the annealing temperature by 0.5°C per cycle, extending at 72°C for 30 seconds, repeating 10 cycles, denaturing at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extending at 72°C for 30 seconds, repeating 30 cycles, and then repair extending at 72°C for 10 minutes.

[0013] Preferably, the honeysuckle DNA fingerprint database constructed in step 3) is constructed using 39 honeysuckle varieties in a conventional manner.

[0014] Preferably, the 39 honeysuckle varieties are Fenghua No. 1, Lufengwang, Juhua No. 1, Yate No. 1, Yate Lijing Honeysuckle, Mixian Xianhua, Mixian Wild, Mixian Damaohua, Yujin No. 1, Yujin No. 2, Terei No. 1, Fengjin No. 1, Yujin No. 4, Yujin No. 5, Mihua No. ३, Mihua No. 2, Mihua No. 1, Yujin No. 3, Jincuilei, Baiyun, Longhua, Longyao, Huajin No. 2, Huajin No. 3, Huajin No. 6, Yujin No. 6, Yujin No. 5 1-2, Jiufeng No. 1, Wild Xianhua, Changzhen Xianhua, Xiaojijiao, Dajijiao, Xizhen Guanhua, Yate Improved Variety, Yate No. 5, Yate No. 4, Fenglei and Light Red Honeysuckle.

[0015] Preferably, DNA is extracted from the young leaves of the sample to be tested.

[0016] The beneficial effects of the present invention are as follows.

[0017] The method according to the present invention is simple and rapid, can identify new varieties of honeysuckle in a short time, and is low-cost. In addition, it is highly sensitive, and by combining the Sanger sequencing method with the constructed 39 honeysuckle DNA fingerprint database, the difference between the genotype of the sample to be tested and the genotypes of existing honeysuckle varieties can be effectively detected. It has excellent specificity. The present invention designs 15 pairs of primers based on 15 high-quality SNP locus sequences and has high specificity. The present invention has high reference value in the identification of new varieties of honeysuckle and is also suitable for popularization and application.

Brief Description of the Drawings

[0018] To more clearly explain the technical solutions in the embodiments of the present invention or the prior art, the attached drawings required to be used in the embodiments are briefly described below. [Figure 1] Electrophoresis of DNA Marker1. [Figure 2] Electrophoresis of DNA Marker2. [Figure 3] The constructed 39 honeysuckle DNA fingerprint database. [Figure 4] Diagram of DNA detection and extraction. [Figure 5] PCA principal component analysis of 39 Hydrangea samples. [Figure 6] Phylogenetic tree analysis diagram of 39 Hydrangea samples. [Figure 7] Genetic population analysis of 39 Hydrangea samples. [Figure 8] Peak chart results of the verification experiment. Marker1 - 15 are SNP locus names, and Type is the genotype of each sample at the locus. [Figure 9] DNA fingerprint of the varieties in the verification experiment.

Embodiments for Carrying Out the Invention

[0019] The present invention relates to a combination of SNP loci for identifying Hydrangea varieties. The base sequences of 150 bp before and after the SNP loci are shown by SEQ ID No.1 - 15, and specifically are as follows.

[0020] SEQ ID No.1: CCGAATTGATGGCCAAGGGTGCCGTTGTTGAGATGAACCGAGTTAGGGAGGAGCATGCATTGACCATAGTTTAGTTAAAGGAAATGCATGCCTCCGAAATTTCCCAATTGGGTTCTCGGCATGAATCTGCTTTAATCGACGAGATGAACTATGGTTACAATGAGGCTTTGAGCGACTATGCGTCTGAAATGTCCAAGCTCAAGGATCTCATCTACCAAGGCGGTACAAATTCGGCCTTGAACGTGTTGGTCTCCCACTCGATCATGAACTGTTTGGTCAGGCTGCGCTATGCCCTCATGAT; SEQ ID No.2: ACGGGCACATCAGGAGACATATAATAGCCCTCCACAATACTAACAACATGACGTTCCTCATTCTATCATTTCTCAGCCCTCGTAGAACATTCTTAATTAGGGCTCGTTTAGTTCGAGTTTTGGGAATGGAATGGGCATCCTAAATTCCTGGAAACCTTTTATCATAGCATCTAGGTTGCCTTACTAATGTTTGGTTTAGACATGAATTCTTCTTTCCTAAAACGTTAAAATTACCTTTCTATATTTAGTTCAATCAAAAATATGAATAAAATACGGTGTGGATTATCAAAATATTCTTCATTT; SEQ ID No.3: GATCTAAATTGGTATACTCACAATAAAATTCTCTAATAATTTATGTTGAAAGGTTGAATCATAAATTCATGGGGTTGAAATTTTTATATAAAAATTACCATTTCGGGTTCCAAGAATGAACAAAAACTCGAACCAAACAAGCATTATGACTGCGTTTGATGTGTGTATGATAAAAGAATTCCATGTCTGGTGTTCGTCAGGATTGGACATCAGGGTGAATTATTTATCCCACTAAAGCTTCCTATCCCACTGAGCGATGATTAACAAATCCCACCTAAGAGGTAAGATTGTTTTATCCTGTT; SEQ ID No.4: CTTGCGTAGTCTTAACTCAATATTTGTGGTTTAGTTTGTCTTCTACATTGTTAATGTACAGCATCAAGGTGTTCATAGAACTGTATTTGACACCATTTTATGCCCGAGATACTATCACAGAACCTTACGTATAACCCTGATTGAGAGAGCAAGTGGGCTAGCCTAGTTGGCAAGGCACCCACACGAATTCAAGAGTAGTCCTGAGTTCGAGTCTCATTTGTAGTGGGGGATTTTCTTTATTATTGTACTATTGAAGTAAAGGGAAGAGACGACCTTCCATTTTTATTTTATTTTTTAAAAA; SEQ ID No.5: AGGATTTGAGGAGCTGGCTGCATCAGAATTCATGATGAGAGGGGTAATCTCGGTAATTGGGTAAACACAAAGAAGACTGTGTGAGAAGTGTGGGAGAGGTTCATTGAATTTAAAGGGTTTACAAAAGGGTTCAGCTTCTTAAATAGCGATATGGGAAACTTGCTGCTGGGAGACTTGTTGGTGTTGTCTAGAGAAGAAATCTGCAATGACATTATCCTTTCCTTTAACATGCTTGACTTCATAATCCCATTATGAAAACCATTCTGACCAACGTAAGAGCTGGGAATTCGGGATTTGTTTA; SEQ ID No.6: GGGACATATTGTATGAAATGAAAAATGTTCTTGTTTTACTAGAACATGGGTTTTAAGTCTTTCACATGAATTATGTTTTATTAACCCGCCGTCAGCAAATGGCACCCGAGATTAACCGGGTCCCTGAGGATAGTTTCTCTTGACGGGATTCAGGGCATCACAGGATAACATTGAAATCTTTGTTGAACGAATTTTAAAATGAGCTATGATAGTAGCTCGGAAGACTATACATGATAGAGCATTTGTAGTGATATGAGCATAGTAGTCCTTCAATGCACGTTCTTCCTCATTTTTGGATGT; SEQ ID No.7: TGTTCAAAATACATTAATGTATAAAAGCTAACGTGTAAAATTGTATAAGAGGAAAACTATGAACATGTCGTGTAACGACCTTAATGTTGTGGACAGATGTGCCCTGGTGCATGTGGTTCCAATAGATGCTAGCAGGCTATACACTATAGGTGTTCGGCAACCCCAATTCTATGCCATAGAATTGGAATTGGGGTATAATTTTAAAATTTCATTGTTTGGATGAACTAATTGATCATAGTTTTGGAATTCTAAAACCATCAATTCTATAAGATTGAATTCTATAAGGGGAGTAGGCAATTC; SEQ ID No.8: AAATTATTGGGCTAATTTTTAGTGGTATAATTAATTTTTAGTTAATCCTAGAGACTACTCAAATAAATGTGGGCCAAATGTGTAGATTCTTTATCTGGGCTTGCCAGGGTTTTATGGAAACCCTAACTAGATCCGTGCTGTTATTGTGATCGATTCTCATATTTCGCATTTATTTATCATAGATCCAGGTACGTGGTTTTATCGTGTTTAAATTAGAGAAAATCTATGTTTCTACTCATGTTATAACTTATTTATTAGGACCCAAAAACTATAATCGCCTTGTAAAGTATTTTAGGCGCGT; SEQ ID No.9: CTAAAGAGAATGAGGTTGGTCTATTTAAATTTATTTGGCATCAATGTGTTCTTCTTAAATGGTCATTTTTGGTGTGGAGGGCTTTACAACATAGTCTTCCCATTGATGATTGCTTAATCCGTAAAGATTTTTAAATGGCTTCTAAATGTAATTGTTGTGTGGAGGCTAGAGTTGAAACTATTTCTCATGTCTTTGTTACTAGTGATATTGCTCGGAATGTGTGGTCTTTTTTTTGAGGACTTGTGCAACATTCAAGGTGCAGGAACACTTCTTCAGAGTAAAATGAATACTTGGTGGATTCA; SEQ ID No.10: ATGGTTTTTTTTTATGCTATTTGCACACAATTTTTTACTTGGTTTTACTCAACTTTTTATTCACCCAAATAATAAGCGAGTAAGTGCATGTTATTCGTCCAATGATAAACAAATAAAAGCTTGAAAATGCCTTATTTGCTTGTCATTAGGCG AGTAACATGCACTTACTCACCCGATGAAGAGGCACCAAGGCCCGGGCAAACAACTGCCACTTGTGAAGGCTCCGGTACCAATAGCAAGCTACTTTGATGGACTTTTTTTGAAACATTAACCCGGTCTTGCCCTTTGATAGTCACATTATTT; SEQ ID No.11: CAGAGTCAATCTCACGTTCTTGAGGAGCATGTAGAACAATTGTGGTGGAACCCACAACACACACAGAGCACAGCCAAGAACTCCAAAAAAAGATGTAGCTTCTCTCTCAATATAATATGTGCAAGTACAGCACTGCAATACAGATACAGTACAAGTCATTGATGTAGTCAAGACCGTAGAATTCAGCATGAATAAAGAGTTTTGACTTTCTATCATACCTGATAATAATGCTGAGTGCACCAAGAGGAGTGACAAGAATGGCTGGTGCAAATGCATAGGCAGCAAAATTAGCAATTTCTCCAACA; SEQ ID No.12: CACCTTGCTCTAAAGTTTGCTCTCCATGTTCTAAGTCAACTTTTCCTTGGTGTTGATCTCTAATTCCCTGCAAATAAGACACAACAAATATAGGCAAAACAGGATTAAGATTGTTAGAACCTTGGAATTCGTCGAAACATACTTTGACCCG TAGTCTATAAACATACTATCTCGGATTGTCTTTCCTAGCCAAGCTAATGGAACTTTGACTCGTAGTCTATAAACATACTAGAACCTTGGAATTCATCGAAAGATGGAAGGTGGAAACCTCAACCCAACGCTTAAAAGATCATGAACCT; SEQ ID No.13: TGAATCTCCACCATCAATGAGCATTACCGGTGAGTCTAGTAACCGCAAATTTGACCCACATCATCTTGGGAGTTCTTATAACTTCTAGTCGTTCTTTAATTACGAAGAGCTAACCCTCTGCATCCTTGGGTCCCTTTGTTCCATCAAACAC TGGAGGCTGAAAACGAGTGAATTCTCGCAGGTAAGTGATTTCATTAGTCTCCCCTCCTGCGGTTCTTGATCCTCCTCCGAATTTTCCAAAATTGCAGGGTCCTCTTGGGCTTGGCCCTTGTTTGCACCCGCTCCATTAGTAGACCTGTGA; SEQ ID No.14: ATTCAATCATCTCCGCAAAGAAGATATCAATACAGTAATGAAGTCCTCATAAATTGTCATAAGAAATAAGAATTCTTGAAGCATCCAGATACTCTGCCATAAGCATAAGTTATAGATAAAGAGATATAAGCTCCTCGTGAGACAACATCCAAGCCATATGCTATAAGAAAACTCTAGGTGTTGCCAAGATATCATCCGATAGCTGGTTGACACAATTATAATGCACACACTGCAATTCTTACTCTTTATGATAACTAAAGGCAACACATACCACTTAAACTTCACTCATCATACATCTAAG; SEQ ID No.15: TCTTGGAATGGCTGTTGTGACTATTTTGTTTGCAGCTCTTGGATTTATGTCCCCAGCTTCTCGTGGAACCCTGATTACAGGTATGCTATTTTCCTACATGATTCTTGGAATTGCAGCCGGTTATGTTGCGGTTCGATTATGGAGAACAATG TGCTGTGGTGATCACAAAGGCTGGGTCTCAGTTTCTTGGAAGGCCGCTTGTTTCTTCCCCGGTATCGCCTTTTTTATTCTAACCACTTTGAATTTCCTTTTGTGGGTAGTCGTAGTACTGGAGCAATTCCGTTTTCTCTGTTCGTAGTC.

[0021] The present invention further provides a combination of primers for amplifying the SNP locus combination described in the above technical proposal, the base sequences of the primers are indicated by SEQ ID No. 16 to 45, and specifically are as follows.

[0022] SEQ ID No.16-F:TTGAGATGAACCGAGTTAGGG; SEQ ID No.17-R:GCAGCCTGACCAAACAGTTC; SEQ ID No.18-F:ACGGGCACATCAGGAGAC; SEQ ID No.19-R:AGAATATTTTGATAATCCACACG; SEQ ID No.20-F:TCATTCCAGGGATCTAAATTGG; SEQ ID No.21:1-R:GGTGGGATTTGTTAATCATCG; SEQ ID No.22-F:GCATCAAGGTGTTCATAGAACTG; SEQ ID No.23-R:CTTCGACACAATCCATGTCAC; SEQ ID No.2:4-F:TTGGGAGAGGAGGATTTGAG; SEQ ID No.25-R:TCCCAGCTCTTACGTTGGTC; SEQ ID No. 26-F: TTGTACTTGGGACCTCATTGGAG; SEQ ID No. 27-R: GTCCATAAATCCGAGTCCAGATTC; SEQ ID No.28-F:AAGAGGAAAACTATGAACATGTCG; SEQ ID No. 29-R:ATAACATTTAGAATTGCCTACTCCC; SEQ ID No. 30-F: AGAGACTACTCAAATAAAATGTGGGC; SEQ ID No. 31-R: CTTTACAAGGCGATTATAGTTTTTG; SEQ ID No. 32-F: CTTCTTGGGATGTGTGTAGGG; SEQ ID No. 33-R: AAGAAGTGTTCCTGCACCTTG; SEQ ID No. 34-F:TTTTATTCACCCAATAATAAGCGAG; SEQ ID No. 35-R:AGTCCATCAAAGTAGCTTGCTATTG; SEQ ID No. 36-F: GCAAGATCCCACACTTCTGTC; SEQ ID No. 37-R: CATTTGCACCAGCCCATTC; SEQ ID No. 38-F: CCTGCTTACCAACACCTTGC; SEQ ID No. 39-R:TGAGGTTTCCACCTTCCATC; SEQ ID No. 40-F: GGACTGCTTGCTGAATCTCC; SEQ ID No. 41-R: GTGCAAACAAGGGCCAAG; SEQ ID No. 42-F: TTCAATCATCTCCGACAAGAAG; SEQ ID No. 43-R: AAGTGGTATGTGTTGCCTTTAG; SEQ ID No. 44-F: TTCTTGGAATGGCTGTTGTG; SEQ ID No.45-R:AGAAAACGGAATTGCTCCAG.

[0023] In this invention, SEQ ID No. 16~17 amplifies SEQ ID No. 1, SEQ ID No. 18~19 amplifies SEQ ID No. 2, SEQ ID No. 20~21 amplifies SEQ ID No. 3, SEQ ID No. 22~23 amplifies SEQ ID No. 4, SEQ ID No. 24~25 amplifies SEQ ID No. 5, SEQ ID No. 26~27 amplifies SEQ ID No. 6, SEQ ID No. 28~29 amplifies SEQ ID No. 7, and SEQ ID No. 30~31 amplifies SEQ ID No. 8. SEQ IDs 32-33 amplify SEQ ID 9, SEQ IDs 34-35 amplify SEQ ID 10, SEQ IDs 36-37 amplify SEQ ID 11, SEQ IDs 38-39 amplify SEQ ID 12, SEQ IDs 40-41 amplify SEQ ID 13, SEQ IDs 42-43 amplify SEQ ID 14, and SEQ IDs 44-45 amplify SEQ ID 7.

[0024] The present invention provides a method for identifying honeysuckle varieties, and the method is 1) Extracting DNA from the sample to be tested, using the DNA as a template, performing PCR amplification using the primer combination described in the above technical proposal, and obtaining the amplification product; 2) Perform Sanger sequencing on the amplification product obtained in step 1) above to obtain the genotype of the sample to be tested at the SNP locus described in the above technical proposal, and to draw the DNA fingerprint. 3) The DNA fingerprint obtained in step 2) above is compared with a constructed honeysuckle DNA fingerprint database, and if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is 0, it is classified as "same variety", if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≤ 2, it is classified as "similar variety", and if the number of different loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≥ 3, it is classified as "different variety".

[0025] According to the present invention, DNA is extracted from a sample to be tested, and PCR amplification is performed using the DNA as a template and the primer combination described in the above technical proposal to obtain an amplification product. According to the present invention, DNA is preferably extracted from young leaves of the sample to be tested. In the present invention, there are no particular limitations on the method of DNA extraction, and those skilled in the art may follow general methods for extracting DNA from plant tissue. In the present invention, the PCR amplification reaction system preferably comprises 1 μl of template DNA, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, 1 μl of dNTP(mix), 2.5 μl of Taq Buffer, and 0.2 μl of Taq enzyme, to which sterile deionized water is added until the total volume is 25 μl. In the present invention, preferably, the PCR amplification procedure involves pre-denaturing at 95°C for 5 minutes, denaturing at 94°C for 30 seconds, annealing at 63°C for 30 seconds, lowering the annealing temperature by 0.5°C per cycle, extending at 72°C for 30 seconds, performing 10 cycles, denaturing at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extending at 72°C for 30 seconds, and after 30 cycles, repair extension at 72°C for 10 minutes.

[0026] According to the present invention, Sanger sequencing is performed on the amplification product obtained in step 1) above to obtain the genotype of the sample to be tested at the SNP locus described in the above technical proposal, and a DNA fingerprint is drawn. After sequencing is completed, the peak chart file (.abl) can be opened using Chromas software or SeqMan software, and the sequence of the sample to be tested can be compared with the 15snp sequence using SeqMan software to obtain the genotype of the sample to be tested.

[0027] According to the present invention, the obtained DNA fingerprint is compared with a constructed honeysuckle DNA fingerprint database. If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is 0, it is classified as the "same variety." If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is ≤2, it is classified as a "similar variety." If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is ≥3, it is classified as a "different variety."

[0028] In the present invention, there are no particular limitations on the method for constructing the pre-constructed honeysuckle DNA fingerprint database. It can be constructed using general methods, for example, by utilizing SNP molecular marker technology, and the operating methods are also general methods.

[0029] In a specific embodiment of the present invention, the method for constructing the constructed honeysuckle DNA fingerprint database preferably includes the following steps.

[0030] (1) DNA extraction and library construction DNA was extracted from the honeysuckle sample (the DNA extraction process is the same as described above, so the explanation is omitted), the mass and concentration of the DNA were measured using a NanoDrop2000 UV spectrophotometer, 500 ng of genomic DNA was collected, 0.6 U of EcoRI (NEB), T4 DNA ligase (NEB), ATP (NEB), and EcoRI linker (containing an index sequence to distinguish the samples) were added, and the mixture was reacted at 37°C for 3 hours, followed by annealing at 65°C for 1 hour. Next, restriction endonuclease NlaIII (NEB) and NlaIII linker were added, and the mixture was reacted at 37°C for 3 hours. After the reaction is complete, the endonuclease is inactivated by leaving the PCR instrument at 65°C for 30 minutes. Then, fragments of the ligation product are selected using agarose gel electrophoresis, and 400-600 bp are selected to recover the enzyme-cleaved product. DNA quantification is performed on the recovered product using Qubit3.0 (Life Technology). Equal volumes of the 24 samples are mixed, and finally, a DNA library is constructed from the mixed product using the Illumina TruSeq kit.

[0031] (2) Simplified ddRAD sequencing and data quality control After library construction using an Illumina NovaSeq 6000 PE150, sequencing was performed on the samples. Low-quality sequences in the raw data were filtered and removed using the software fastp (version: 0.20.0) to obtain clean data. The parameters were set to -q 5 -n 5 to remove mainly the following reads: 1. Reads with N < 5 unknown bases. 2. Reads with a base quality value of less than 5 at 50% length. 3. Linker sequences were removed.

[0032] (3) Matching with a reference genome The genome is matched against a reference genome using BWA (Burrows-Wheeler Aligner, 0.7.17-r1188) (reference genome name: GWHAAZE00000000.genome.fasta, download URL: https: / / ngdc.cncb.ac.cn / search / ?dbId=gwh&q=SAMC097356), and the parameters are set to -M -R. The sam file generated by the match is converted to bam format using samtools (version: 1.9) software. Next, PCR duplications are marked using picard MarkDuplicates (version: 2.21.2). After that, only high-quality proper reads are kept for later analysis.

[0033] (4) SNP detection and annotation SNP detection is primarily performed using the GATK (version: 4.1.4.1) software toolkit. Based on the results of the reference genome localization in Clean Reads, single nucleotide polymorphisms are detected using GATK to obtain the final set of SNP loci, and SNP statistics are performed. The main detection procedures are as follows: 1. Duplicates are removed from the results obtained by BWA matching using the Mark Duplicate tool in Picard (version: 0.7.17-r1188) to eliminate the influence of PCR duplication. 2. Variant calling is performed using GATK, mainly including SNPs and InDel. 3. Quality recalibration of variant loci (VQSR) is performed using GATK.

[0034] 4. Use GATK to filter the obtained mutation results and select reliable mutation results.

[0035] (5) Genetic structure analysis of the population 1. Principal Component Analysis (PCA). Based on SNPs, principal component clustering results for 39 samples were obtained using the software GCTA (version: 1.92.1) (http: / / cnsgenomics.com / software / gcta / #Overview). Individuals with different traits and characteristics were clustered and classified into different subgroups, and the results are shown in Figure 5.

[0036] 2. Evolutionary phylogenetic tree analysis. Using the maximum likelihood (ML) method of the software FastTree (version: 2.1.9), an evolutionary phylogenetic tree explaining the evolutionary relationships among the 39 samples was constructed, and the results are shown in Figure 6.

[0037] 3. Genetic Structure Analysis of the Population. The genetic structure analysis of the population was performed using admixture software (version: 1.3.0) (http: / / software.genetics.ucla.edu / admixture / ). The number and similarity of ancestors in 39 honeysuckle samples were observed. The results are shown in Figure 7.

[0038] (6) Construction and analysis of DNA fingerprints. The goal of simplicity, efficiency, and economy was achieved by following the principle of DNA fingerprint construction to identify as many varieties as possible using as few markers as possible. Based on the magnitude of the marker's PIC value and distribution frequency, 15 core markers with high detection rates, high polymorphism, and the ability to distinguish all varieties were selected, and a DNA fingerprint was constructed. The efficiency of marker identification is shown in Figure 3.

[0039] In this invention, homozygous genotypes C / C, A / A, T / T, and G / G are represented by four colors: yellow, green, blue, and purple, respectively. Heterozygous genotypes are represented by gray, and knockout genotypes are represented by white. The varieties corresponding to the sample numbers are shown in Table 1 below. Table 1 Honeysuckle varieties and numbers JPEG0007861253000001.jpg8077

[0040] To further illustrate the present invention, the invention will be described in detail below with reference to examples, but these should not be understood as limitations on the scope of protection of the present invention. Example 1

[0041] 1. Extraction of template DNA (1) Grind 50-100 mg of fresh plant tissue thoroughly into a powder in liquid nitrogen and transfer to a 1.5 ml centrifuge tube.

[0042] (2) Add 600 μl of Buffer PCB preheated to 65°C and 12 μl of β-mercaptoethanol. Shake to mix until homogeneous, then place in a 65°C water bath for 25 minutes, mixing intermittently until homogeneous.

[0043] (3) Add 600 μl of chloroform, mix well, and centrifuge at 12000 rpm for 5 minutes. Aspirate the upper aqueous phase into a clean 1.5 ml centrifuge tube, then repeatedly mix with an equal volume of phenol:chloroform (1:1, pH 8.0), centrifuge at 12000 rpm for 5 minutes, take the supernatant, and repeat the extraction 1 to 3 times.

[0044] (4) Add an equal volume of Buffer BD to the upper layer water, and invert and mix 3 to 5 times until homogeneous. Then add an equal volume of anhydrous ethanol to the upper layer water and mix well until homogeneous. Add the entire mixture to the adsorption column using a pipette and let it stand at room temperature for 2 minutes. Centrifuge at 10,000 rpm for 1 minute and discard the waste liquid in the collection tube.

[0045] (5) Return the adsorption column to the collection tube, add 500 μl of PW Solution, centrifuge at 10,000 rpm for 1 minute, and discard the waste liquid in the collection tube.

[0046] (6) Return the adsorption column to the collection tube, add 500 μl of Wash Solution, centrifuge at 10,000 rpm for 1 minute, and discard the waste liquid in the collection tube.

[0047] (7) Return the adsorption column to the collection tube and centrifuge at 12000 rpm for 2 minutes.

[0048] (8) Remove the adsorption column and transfer it to a new 1.5 ml centrifuge tube. Add 50 μl of TE Buffer to the center of the adsorption membrane. Let stand for 3 minutes, then centrifuge at 12000 rpm for 2 minutes. Store the resulting DNA solution at -20°C or use it directly in subsequent experiments.

[0049] 2. Polymerase chain reaction (PCR) 2.1 PCR reaction system Table 2 PCR reaction system JPEG0007861253000002.jpg93141

[0050] The base sequences of the primers are shown in SEQ ID No. 16-45.

[0051] 2.2 PCR reaction conditions Table 3 PCR reaction conditions JPEG0007861253000003.jpg73102

[0052] 2.3 Electrophoresis detection strips Take 5 μl of PCR product and perform 11% agarose gel electrophoresis. Electrophoresis parameters: 150V, 100mA, 10-20 minutes of electrophoresis observation (see electrophoresis diagram). There are two types of DNA markers; refer to Figures 1 and 2 for each.

[0053] 3. Sanger sequence determination 3.1 Purification and Recovery of PCR Products (1) Separate the target DNA fragment as much as possible from other fragments by agarose gel electrophoresis, cut out the agarose gel block containing the target DNA fragment with a clean scalpel blade, and weigh it in a 1.5 mL centrifuge tube.

[0054] (2) Depending on the weight and concentration of the gel block, add 300 to 600 μl of Buffer B2 per 100 mg of agarose (if the gel block is less than 100 mg, add water to make it 100 mg).

[0055] (3) Place the centrifuge tube in a 50°C water bath for 5 to 10 minutes, and mix intermittently until the gel block is completely dissolved and homogeneous.

[0056] (5) Transfer all of the dissolved solution to the adsorption column and centrifuge at 8000Xg for 30 seconds. Discard the liquid in the collection tube and place the adsorption column back into the same collection tube.

[0057] (6) Add 300 μl of Buffer B2 to the adsorption column and centrifuge at 9000Xg for 30 seconds. Discard the liquid in the collection tube and place the adsorption column back into the same collection tube.

[0058] (7) Add 500 μl of WashSolution to the adsorption column and centrifuge at 9000Xg for 30 seconds. Discard the liquid in the collection tube and place the adsorption column back into the same collection tube.

[0059] (8) Repeat step 7 once.

[0060] (9) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9.000Xq for 1 minute.

[0061] (10) Add 15-40 μl of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1-2 minutes, and then centrifuge at 9000Xg for 1 minute. Store the obtained DNA solution at -20°C or use it for subsequent experiments.

[0062] 3.2 Data Analysis Results can be searched within the result group, analyzed using sequence analysis software, and the sequence of the sample to be tested can be compared with a 15-snp sequence using SeqMan software to obtain the genotype of the sample to be tested.

[0063] 4. Determining the Results: Using Excel software, the DNA fingerprints of the genotype at 15 SNP loci of the sample under test are plotted and compared with the constructed honeysuckle DNA fingerprint database (Figure 3). If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is 0, it is classified as "same variety". If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is ≤2, it is classified as "similar variety". If the number of different loci between the sample under test and the honeysuckle DNA fingerprint database is ≥3, it is classified as "different variety".

[0064] Experimental results: Three honeysuckle varieties—'Yateli Ben', 'Hyakuno No. 2', and 'Gizi'—which are not included in the 39-variety honeysuckle DNA fingerprint database, were selected, and verification experiments were conducted according to the experimental procedure described above to verify the reliability and effectiveness of this method. The experimental results are as follows. Table 4. Genotype results from validation experiments JPEG0007861253000004.jpg8883

[0065] Note: REF is the genotype of the reference genome, and ALT is the validation result. Genotypes: R=A / G, Y=C / T, M=A / C, K=G / T, S=C / G, W=A / T. Table 5: Matching results with 39 honeysuckle DNA fingerprint databases. JPEG0007861253000005.jpg22878

[0066] According to "Table 5: Results of matching with 39 honeysuckle DNA fingerprint databases," when comparing "Atolic Bon," "Hyakuno No. 2," and "Gizi" with the fingerprint database, all loci differing from the 39 existing varieties in the database are >3, indicating that they belong to "different varieties."

[0067] Through verification experiments, it was further demonstrated that the method according to the present invention can obtain the genotype of honeysuckle varieties in a short time, identify new honeysuckle varieties, and possesses low cost, high sensitivity, and good specificity, making it highly valuable as a reference for identifying new honeysuckle varieties and suitable for widespread adoption and application.

[0068] Although the present invention has been described in detail by the above-described embodiments, these are not all embodiments of the present invention, but only some embodiments. All embodiments that can be obtained by those skilled in the art without any creative work fall within the scope of the protection of the present invention.

Claims

1. To identify the variety of honeysuckle, a combination of 15 pairs of primers, each consisting of two primers, primer F and primer R, is used to amplify 15 SNP loci in the genomic DNA of the honeysuckle sample, where the base sequences within 150 bp before and after each SEQ ID No. 1 to 15. The base sequences of the aforementioned primers are shown in SEQ ID No. 16-45. SEQ ID No. 16-17 amplifies SEQ ID No. 1, SEQ ID No. 18-19 amplifies SEQ ID No.

2. SEQ ID No. 20-21 amplifies SEQ ID No. 3, SEQ ID No. 22-23 amplifies SEQ ID No. 4, SEQ ID No. 24-25 amplifies SEQ ID No.

5. SEQ ID No. 26-27 amplifies SEQ ID No. 6, SEQ ID No. 28-29 amplifies SEQ ID No. 7, SEQ ID No. 30-31 amplifies SEQ ID No.

8. SEQ ID No. 32-33 amplifies SEQ ID No. 9, SEQ ID No. 34-35 amplifies SEQ ID No.

10. SEQ ID No. 36-37 amplifies SEQ ID No.

11. SEQ ID No. 38-39 amplifies SEQ ID No. 12, SEQ ID No. 40-41 amplifies SEQ ID No.

13. SEQ ID No. 42-43 amplifies SEQ ID No. 14, SEQ ID No. 44-45 amplifies SEQ ID No.

15. A combination of primers characterized by the following features.

2. A method for identifying varieties of honeysuckle, 1) Extracting DNA from the sample to be tested, using the DNA as a template, performing PCR amplification using each of the 15 pairs of primers from the primer combination described in claim 1, and obtaining amplification products from each, 2) Performing Sanger sequencing on each of the amplification products obtained in step 1) to obtain the genotypes of the 15 SNP loci of the sample to be tested, and drawing a DNA fingerprint, 3) The DNA fingerprint obtained in step 2) above is compared with the constructed honeysuckle DNA fingerprint database. If the number of different SNP loci between the sample to be tested and the honeysuckle DNA fingerprint database is 0, it is classified as "same variety". If the number of different SNP loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≤ 2, it is classified as "similar variety". If the number of different SNP loci between the sample to be tested and the honeysuckle DNA fingerprint database is ≥ 3, it is classified as "different variety". A method for identifying a variety of honeysuckle characterized by containing [a certain substance].

3. The PCR amplification reaction system in step 1) above comprises 1 μl of template DNA, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, 1 μl of dNTP(mix), 2.5 μl of Taq Buffer, and 0.2 μl of Taq enzyme, and sterile deionized water is added until the total volume is 25 μl. The method according to feature 2.

4. The PCR amplification procedure described above involves pre-denaturing at 95°C for 5 minutes, denaturing at 94°C for 30 seconds, annealing at 63°C for 30 seconds, lowering the annealing temperature by 0.5°C per cycle, extending at 72°C for 30 seconds, repeating 10 cycles, denaturing at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extending at 72°C for 30 seconds, repeating 30 cycles, and then repair extending at 72°C for 10 minutes. The method according to feature 2 or 3.

5. The honeysuckle DNA fingerprint database constructed in step 3) above is constructed using 39 honeysuckle varieties. The method according to feature 2.

6. The 39 honeysuckle varieties are Fenghua No. 1, Lufengwang, Giant Flower No. 1, Yatoku No. 1, Yatoku Real Gold and Silver Flower, Mixian Line Flower, Mixian Wild, Mixian Big Hair Flower, Yujin No. 1, Yujin No. 2, Special Bud No. 1, Fengjin No. 1, Yujin No. 4, Yujin No. 5, Mihua No. 3, Mihua No. 2, Mihua No.

1. , Yu Jin No. 3, Golden green bud, Baiyun, Dragon flower, Long Yao, Hua Jin No. 2, Hua Jin No. 3, Hua Jin no. The method according to specification 5.

7. Extracting DNA from young leaves of the sample to be tested. The method according to claim 2, characterized by the above.

Images