Methods and kits for reprogramming somatic cells

Abstract

The present invention describes a method for reprogramming somatic cells into pluripotent stem cell-like cells. Such cells can express pluripotency-inducing genes, including Oct4, Nanog, and Sox2, without the introduction of exogenous genes, proteins, or chemicals. The discovery that inhibition of mechanosensitive stretch-activated ion channels in somatic cells specifically activates pluripotency-inducing factor genes led to a cell reprogramming culture method in which somatic cells are incubated with an inhibitor, GsMTX4, against mechanosensitive stretch-activated ion channels, cultured on a soft hydrogel surface, or treated with a cholesterol-depleting agent, methyl-beta-cyclodextrin (MβCD). The described method produces pluripotent stem cell-like cells, which subsequently redifferentiate into cells including adipocytes, osteocytes, and neurons. Methods can be combined to increase the efficiency of somatic cell reprogramming. A somatic cell reprogramming kit was also created using tissue culture dishes cast with hydrogel (dehydrated) and MβCD.

Description

[Technical Field]

[0001] 1. Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 933,926, filed on November 11, 2019.

[0002] 2. Sequence Listing This application includes a sequence listing, which has been filed electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on November 11, 2020, is named 001WO_SL_ST25.txt and has a size of 26,627 bytes.

[0003] The present invention relates to a method for reprogramming somatic cells to become pluripotent stem cell-like cells that retain differentiation ability. The described method, reagents, compositions, stem cell-like cells, and differentiated cells such as nerve cells, adipocytes, muscle cells, and osteocytes can be used to treat various diseases requiring regenerative therapy. [Background technology]

[0004] To understand the current molecular and cellular mechanisms of degenerative diseases, pluripotent stem cells and differentiated cells are in great demand to meet the demands of advances in regenerative medicine.

[0005] Under the homeostatic mechanisms of multicellular organisms, cells that have ultimately differentiated and become damaged are eliminated by programmed cell death, but these are immediately replaced by newly differentiated cells that retain the same function. When cell death outweighs the generation of new cells, either in a pathogenic environment or due to tissue damage where a large portion of the tissue is lost, regenerative therapy becomes essential to restore lost tissue and repair organ function. The discovery of stem cells in blastocysts that retain pluripotent differentiation potential has spurred the challenge to establish regenerative stem cell therapies that can generate differentiated cells to reconstruct part or all of a lost organ. The following are cell sources that are currently recognized as retaining differentiation potential through ex vivo manipulation to generate various types of cells useful for application in regenerative therapy.

[0006] Embryonic stem cells (ES cells) ES cells are pluripotent cells derived from early human or mouse embryos or blastocysts [Evans and Kaufman, Nature, 292:154 (1981); Martin, Proc. Natl. Acad. Sci. USA, 78:7634 (1981)], and possess the unique characteristic of being able to be cultured in vitro for long periods while maintaining the ability to differentiate into all types of cells present in the body. Human embryonic stem cells are expected to be useful in cell transplantation therapy for various diseases such as Parkinson's disease, juvenile diabetes, and leukemia, utilizing the aforementioned properties. However, ES cell transplantation, like organ transplantation, has the problem of causing rejection. Furthermore, there is much opposition to the use of ES cells, which are established by destroying human embryos, from an ethical standpoint.

[0007] hematopoietic stem cells Hematopoietic stem cells are cells isolated from the blood or bone marrow that can renew themselves, differentiate into various specialized cells, move from the bone marrow into the circulating blood, and perform programmed cell death, thereby causing harmful or unwanted cells to self-destruct. Approximately one cell for every 100,000 cells in the bone marrow is a long-term hematopoietic stem cell, and other cells present in the bone marrow include stromal cells, stromal stem cells, blood progenitor cells, as well as mature and maturing leukocytes and erythrocytes.

[0008] Mesenchymal stem cells (MSCs) MSCs are an example of “adult” stem cells, including tissue or bone marrow stromal cells, umbilical cord cells, and adipose-derived stromal / stem cells. They are “pluripotent,” meaning they can produce more than one type of specialized cell, but not all types, of the body. MSCs produce different specialized cells found in skeletal cells. For example, they can differentiate or specialize into chondrocytes, osteoblasts, and adipocytes. Each of these specialized cells has its own characteristic shape, structure, and function, and each belongs to a specific tissue. While the differentiation potential of MSCs suggests potential usefulness in cell therapies for various diseases such as myocardial repair, as well as bone and nerve cell repair, the proliferation of purified mesenchymal stem cells is not consistent across individuals, ages, and tissue origins. Furthermore, cell proliferation declines after several passages, posing a problem for preparing large numbers of cells.

[0009] induced pluripotent stem cells If differentiation of a patient's own differentiated somatic cells can be induced to establish cells with pluripotency and proliferative capacity similar to ES cells, such induced pluripotent stem cells (iPSCs) can be used as ideal pluripotent cells without rejection or ethical challenges [U.S. Patent No. 10,017,744]. iPSCs, first reported by the Yamanaka group [Takahashi and Yamanaka, Cell 126:663 (2006); U.S. Patent No. 8,048,999], are adult mouse cells genetically reprogrammed into an embryonic stem cell-like state by forcing the expression of genes and factors essential to maintain the distinct characteristics of embryonic stem cells. Human iPSCs were first reported in late 2007 [Takahashi et al., Cell 131:861 (2007); U.S. Patent Publication No. 2013 / 0065311]. Mouse iPSCs exhibited key pluripotent stem cell characteristics, including the expression of stem cell markers, tumor formation containing cells from all three germ layers, and the ability to contribute to many different tissues when injected into mouse embryos at a very early stage of development. Human iPSCs also express stem cell markers and can generate cells characteristic of all three germ layers. While iPSCs meet the definitional criteria for pluripotent stem cells, it is unknown whether iPSCs and embryonic stem cells differ in clinically significant ways.

[0010] Moloney mouse leukemia virus and lentivirus were originally used to introduce reprogramming factors into adult cells [US Patents 8,440,461]. Because this process results in viral integration, the technology needs to be modified and tested before it can provide a useful treatment for humans to avoid the potential development of cancer. In animal studies, viruses used to introduce stem cell factors sometimes cause cancer. Adenoviruses and Sendai viruses are non-integrating viruses and have also been used to introduce pluripotency that induces factor (PIF) into adult cells, but their reprogramming efficiency is low [Zhou and Freed, Stem Cells. 27:2667 (2009); Chen et al., Cell Reprogram. 15:503 (2013)]. The challenge by researchers to adopt reprogramming methods based on viral infection and genome integration as a non-viral delivery strategy has resulted in alternative technologies for inducing transient pluripotency that induces gene expression in somatic cells. These are reprogramming factor delivery systems that use episomes, RNA, and recombinant proteins, but each has drawbacks such as low efficiency or difficulties in preparation (for protein-based delivery systems) [Woltjen et al., Nature 458:766 (2009); U.S. Patent Publication 2018 / 0072999; Kogut I. et al. Nature Communications 9:745 (2018); U.S. Patent Publication 2013 / 0302295; International Patent Publication WO2009 / 077134; Zhou H. et al., Cell Stem Cell 4:381 (2009); U.S. Patent No. 9,068,170]. These technologies make it possible to “dedifferentiate” cells whose developmental fate was previously assumed to be determined. iPSC technology, by introducing reprogramming factors, offers the opportunity to generate patient-specific stem cells for human disease modeling, drug development and screening, and personalized regenerative cell therapy.

[0011] Chemically assisted, reprogrammed somatic cells (ciPSCs) The use of viral vectors and oncogenes for PI gene expression has raised legitimate concerns about the safe use of these cells in clinical settings. Therefore, the field is shifting towards reprogramming strategies based on novel chemicals / small molecules (<900 Daltons). The first reported example was the chemically assisted generation of ciPSCs, which, by using the histone deacetylase inhibitor valproic acid (VPA), eliminated the need for the oncogenes c-Myc and Klf4 (two of the four Yamanaka factors), and demonstrated a 100-fold increase in reprogramming efficiency compared to the four-transcription factor method [Huangfu et al., Nat. Biotechnol., 26:1269 (2008); U.S. Patent No. 9,982,237]. On the other hand, studies have shown that using the histone methyltransferase (HMT) inhibitor BIX-01294, calcium channels in the plasma membrane are activated, improving reprogramming efficiency using four Yamanaka factors from Ding's laboratory [Armond et al., Sci.Rep., 4:3692 (2014); Shi et al., Cell Stem Cell, 3:568 2008); Shi et al., Cell Stem Cell, 2:525 (2008); Lin et al., Nat.Methods., 6:805 (2009)]. Inhibitors of transforming growth factor-β (TGFβ) receptor and MAPK / ERK kinase (MEK) on primary human fibroblasts (CRL2097 or BJ) were transduced with retroviruses carrying genes encoding the four Yamanaka factors [Australian Patent Application No. 2015201026]. They demonstrated that a combination of seven small molecules improved the efficiency of iPSC generation from human fibroblasts by more than 200 times within one week of treatment.Subsequently, we identified specific chemical combinations that were sufficient to enable reprogramming from mouse embryonic and adult fibroblasts within three weeks in the presence of a single transcription factor, Oct4, without requiring Sox2, Klf4, and c-Myc [Li et al., Cell Res., 21:196 (2011); Yuan et al., Stem Cells, 29:549 (2011); Zhu et al., Cell Stem Cell, 7:651 (2010)]. iPSCs developed using this protocol are similar to mouse ES (mES) cells in terms of pluripotency gene expression, epigenetic status, and global gene expression profile.

[0012] Hou et al. were the first to report the complete chemical generation of mouse iPSCs from mouse embryonic fibroblasts (MEFs) with an efficiency of up to 0.2% using a combination of seven small molecule compounds: VC6TFZ:VPA, CHIR99021 (CHIR), 616452, tranylcypromine, forskolin (FSK), 2-methyl-5-hydroxytryptamine (2-Me-5HT), and D4476 [Hou et al., Science, 341:651 (2013); International Patent Publication No. WO2015 / 003643]. This method also had a higher induction efficiency compared to Yamanaka's iPSC protocol (0.01%~0.1%). The chemically induced pluripotent stem cells (ciPSCs) showed a global gene expression profile similar to that of mES cells. This study provides proof of the principle that ectopic expression of master regulator genes is not required for cell fate reprogramming by using small molecules, and thus paves the way for a total chemical reprogramming strategy that can potentially be used in generating functionally desirable cell types for cell therapy. Most small molecules that have been used to generate ciPSCs can be classified as epigenetic modifiers, modifiers of cell signaling and apoptosis, wingless integration site growth factor (WNT) signaling regulators, regulators of cellular senescence, or regulators of metabolism.

[0013] Stem cell-like phenotype cells induced by specific cell culture methods Nuclear reprogramming events within the tissue microenvironment are crucial for many developmental processes and tissue maintenance [Halley-Stott et al., Development, 140:2468 (2013); Reik et al., Science, 293:1089 (2001); Lamouille et al., Nat. Rev. Mol. Cell. Biol., 15:178 (2014)]. In groundbreaking experiments, biological factors have been shown to induce nuclear reprogramming of somatic cells into iPSCs in vitro [Takahashi and Yamanaka, Cell, 126:663 (2006); De Matteis et al., Stem Cells, 27:2761 (2009); Downing et al., Nat. Mater., 12:1154 (2013)]. However, in vitro, cells differentiate and transform into different lineages in the absence of exogenous factors, suggesting that local mechanochemical factors may be important elements and sufficient to induce such changes [Guo et al., Proc.Natl.Acad.Sci.USA,111:5252(2014)]. Consistent with this, recent results have shown that culturing cells in site-specific patterns combined with reprogramming factors, or with different substrate stiffnesses, results in increased effectiveness of nuclear reprogramming [Su, et al.,Biomaterials,34:3215(2013);Kilian et al.,Proc.Natl.Acad.Sci.USA,107:4872(2010);Engler et al.,Cell,126:677(2006);Mitra et al.,Proc.Natl.Acad.Sci.USA,114:3882(2017)]. However, the role played by different mechanical cues in nuclear reprogramming in the absence of biochemical factors is not yet fully established.Mechanical constraints (e.g., substrate rigidity and cell morphology) are essential for controlling many cellular processes, including cell proliferation, apoptosis, and differentiation [Chen et al., Science, 276:1425 (1997); McGrail et al., FASEB J., 29:1280 (2015); Kshitiz et al., Integr Biol., 4:1008 (2012); Kumar et al., PLoS One 7:e33089 (2012)]. Biophysical forces have been shown to be important in regulating epithelial-to-mesenchymal deformation [Desprat et al., Dev Cell, 15:470 (2008)]. Matrix stiffness, cell morphology, and surface morphology have all been shown to direct stem cell differentiation in vitro [McGrail et al., FASEB J., 29:1280 (2015); Kshitiz et al., Integr Biol., 4:1008 (2012); U.S. Patent Publication No. 2008 / 0187995]. In addition, in vivo experiments, including applying force to developing Drosophila embryos, have shown that the differentiation program can be altered by changing the mechanisms of the tissue [Kumar et al., PLoS One, 7:e33089A (2012); Desprat et al., Dev Cell, 15:470 (2008)]. In summary, these results highlight the importance of biophysical cues in directing stem cell differentiation.

[0014] As used herein, the following terms shall have the defined meanings. Otherwise, all terms shall have the meanings commonly given by those skilled in the art.

[0015] The term "blastocyst" refers to a thin-walled, hollow structure in early embryonic development that contains a cluster of cells called the inner cell mass, from which the embryo develops.

[0016] The term "pluripotency-inducing gene" refers to a gene whose expression contributes to reprogramming somatic cells into a pluripotent state.

[0017] The term "pluripotency-inducing factor" refers to the expression product of a pluripotency-inducing gene. A pluripotency-inducing factor may be a pluripotent factor, but it does not need to be. Expression of an exogenously introduced pluripotency-inducing factor may be transient; that is, it may be necessary for at least part of the reprogramming process to induce pluripotency and / or establish a stable pluripotent state, but it does not need to maintain pluripotency thereafter. Examples of PIFs for the purpose of reprogramming somatic cells to be pluripotent in vitro include Ocl4, Nanog, Sox2, Lin28, Kit'd, c-hfyc, and any gene / protein that can replace one or more of these in a method of reprogramming somatic cells in vitro.

[0018] The term "reprogramming factor" refers to a gene, RNA, or protein that promotes or contributes to cellular reprogramming, for example, in vitro.

[0019] The term "hydrogel" refers to a three-dimensional hydrophilic polymer network capable of absorbing large amounts of water or biological fluids. Due to their high water content, porosity, and soft viscosity, they closely mimic natural biological tissues.

[0020] The term “mechanically sensitive stretch-activated ion channel (MSAIC)” refers to an ion channel that opens to allow positively charged ions (i.e., cations) to pass in and out of a cell, for example, in response to mechanical force or pressure applied to the cell expressing the channel. As used herein, the term also includes the polypeptide component of a mechanically activated cation channel, e.g., a subunit of the cation channel. In some embodiments, the mechanically activated cation channels of the present invention are involved in sensory transmission, such as pain transmission, in cells including, but not limited to, neurons.

[0021] The term "stem cell" refers to cells that have the ability to divide indefinitely during culture and produce specialized cells.

[0022] The term "somatic cell" refers to any somatic cell other than a gamete (egg or sperm).

[0023] The term "embryonic stem cell" refers to early (undifferentiated) cells that are derived from a pre-implantation embryo, can divide without differentiating for long periods in culture, and are known to give rise to cells and tissues of the three main embryonic germ layers.

[0024] The term "differentiation" refers to the process by which unspecialized embryonic cells acquire the characteristics of specialized cells such as heart cells, liver cells, or muscle cells. Differentiation is usually controlled through signaling pathways that involve proteins embedded in the cell surface and that are regulated by the interaction of a cell's genes with the physical and chemical conditions outside the cell.

[0025] The term "pluripotency" refers to the state of a single cell that can differentiate into all tissues of an organ but cannot, by itself, sustain the development of a complete organism.

[0026] The term "induced pluripotent stem cell" refers to a type of pluripotent stem cell similar to embryonic stem cells that is formed by the introduction of certain embryonic genes into somatic cells.

[0027] The term "nuclear reprogramming" refers to the description of changes in gene activity that are experimentally introduced by introducing a nucleus into a new cytoplasmic environment, and to the process by which the differentiation state of a cell changes to another state.

[0028] The term "pluripotent stem cell-like cell" refers to a cell that expresses PI factors.

[0029] The term "Yamanaka factors" refers to a set of genes, Oct3 / 4, Sox2, Klf4, and c-Myc, that are highly expressed in embryonic stem (ES) cells, and whose overexpression can induce pluripotency in both mouse and human somatic cells, suggesting that these factors regulate the developmental signaling network required for ES cell pluripotency.

[0030] The term "cyclodextrin" refers to a family of cyclic polysaccharides composed of α-(1,4)-linked glucopyranose subunits. Cyclodextrins (CDs) are useful molecular chelating agents. They maintain cage-like supramolecular structures, identical to those formed from cryptands, calixarenes, cyclophanes, spherands, and crown ethers. These compounds with supramolecular structures carry out chemical reactions involving intermolecular interactions where no covalent bonds are formed between the interacting molecules, ions, or radicals. The majority of all these reactions are of the "host-guest" type. Compared to all the supramolecular hosts mentioned above, cyclodextrins are the most important. Due to their ability to form inclusion complexes, they can significantly alter the properties of the materials they complicate. As a result of molecular complexation, CDs are widely used in many industrial products, technologies, and analytical methods. The negligible cytotoxic effects of CDs are an important property in applications such as drug carriers, food and fragrances, cosmetics, packaging, fabrics, separation processes, environmental protection, fermentation, and catalysts. [Overview of the project]

[0031] This invention is based on the discovery that specific inhibition of mechanosensitive stretch-activated ion channels (MSAICs) activates the expression of a series of PIFs in somatic cells (myeloid cells), subsequently causing the cells to acquire a pluripotent stem cell-like phenotype. Further teaching from the discovery was that somatic cells could split into two types after MSAIC inhibition: 1) those that increased PIF expression within 16 hours (e.g., myeloid cells) and 2) those that suppressed PIF expression. When the second type of cells, such as fibroblasts, were treated with MβCD, which reduces cellular cholesterol content, PIF expression increased after MSAIC inhibition within 16 hours, similar to the first type of cells. Additional findings showed that when MSAIC inhibition continued, the second type of cells that reduced PIF expression eventually increased PIF expression up to 72 hours. Thus, sustained inhibition of MSAICs activates the expression of transcription factors in somatic cells, leading to the acquisition of a pluripotent stem cell-like phenotype. The possibility of inducing a stem cell-like phenotype following MSAIC inhibition was investigated by experimental conditions that attenuate MSAIC signaling. The methods tested were: 1) inhibiting MSAIC with GsMTX4, 2) culturing cells on a soft matrix prepared with polyacrylamide gel, and 3) treating somatic cells with cholesterol-depleting compounds such as MβCD. All approaches provided evidence for the principle of the present invention, showing that attenuation of MSAIC induces a repertoire of transcription factors necessary for stem cell-like phenotypes and exhibits "re"differentiated cells with novel phenotypes. Novel phenotypes of differentiated cells in in vitro culture included adipocytes, osteogenic cells, myocytes, tendinocytes, neurons, microglia, endothelial cells, and erythrocyte progenitor cells. Finally, the application of this principle has enabled the preparation of somatic cell reprogramming kits containing softgels and cholesterol-depleting chemicals. The present invention generates stem cell-like cells that express transcription factors including but not limited to Oct4, Nanog, Sox2, and c-Myc, and subsequently differentiate into morphologically diverse somatic cells, thus demonstrating the significant benefits of the present invention for regenerative medicine. [Brief explanation of the drawing]

[0032] [Figure 1] Figure 1 shows the PI gene-specific activation by the MSAIC inhibitor GsMTX4 in bone marrow cells. [Figure 2] Figure 2 shows that specific stiffness moduli of the extracellular matrix caused induction of the PI gene in bone marrow cells. [Figure 3] Figure 3 shows the suppression of PI gene expression in spleen cells cultured for 16 hours in the presence of GsMTX4. [Figure 4] Figure 4 shows bone marrow stromal cell lines that exhibit a similar response to GsMTX4 as observed in fresh bone marrow cells. [Figure 5] Figure 5 shows embryonic fibroblast cell lines that exhibit a response to GsMTX4 similar to that observed in splenic cells. [Figure 6] Figure 6 shows the activation of the PI gene in spleen cells in cultures treated with GsMTX4 on day 3. [Figure 7] Figure 7 shows the activation of the PI gene in EF cells in a culture on day 3 using GsMTX4. [Figure 8] Figure 8 shows that treatment of spleen cells with MβCD alters the PI gene response to GsMTX4, similar to bone marrow cells. [Figure 9] Figures 9A and 9B show microscopic examinations of spheres on a hydrogel and lysed sphere cells. Figure 1A shows spheres on a hydrogel after 16 hours of incubation. Figure 1B shows spheres lysed in a cluster of round cells on a hydrogel after 14 days. [Figure 10] Figures 10A to 10C show the message analysis of PI genes in cells on a hydrogel and on the bottom of a dish. Figure 10A shows Oct4 gene expression; Figure 10B shows Nanog gene expression; and Figure 10C shows Sox2 gene expression. [Figure 11] Figure 11 shows the nucleotide sequence (SEQ ID NO: 1) of the Oct4-specific RT-PCR fragment at 1000 bps. [Figure 12] Figure 12 shows the registered genome nucleotide sequence (SEQ ID NO: 2) of mouse Oct4. [Figure 13] Figure 13 shows the nucleotide sequence (SEQ ID NO: 3) of the Nanog-specific RT-PCR fragment at 1000 bps. [Figure 14] Figure 14 shows the registered genome nucleotide sequence (SEQ ID NO: 4) of the mouse Nanog. [Figure 15] Figures 15A and 15B show the changes in morphology and PI gene expression of MβCD-treated EF cells over time. Figure 15A shows the morphological changes over time; Figure 15B shows the induction dynamics of the PI gene. [Figure 16] Figure 16 shows a microscopic image of EF cells. [Figure 17] Figures 17A to 17E show adipocyte-like cells differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. Figure 17A shows brown adipocytes; Figure 17B shows white adipocytes; and Figure 17-CE shows oil red O stained adipocytes. [Figure 18] Figures 18A to 18C show osteoblasts differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 19] Figures 19A to 19D show neuronal-like cells differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. Figure 19A shows cortical neurons; Figure 19B shows astrocytes; Figure 19C shows microglia; and Figure 19D shows oligodendrocytes. [Figure 20] Figure 20 shows endothelial cell-like cells differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 21] Figures 21A–21F show in vitro differentiated cell clusters derived from mouse EF cells treated with MβCD and hydrogel. Figure 21A shows astrocyte-like cells; Figure 21B shows microglia-like cells; Figure 21C shows a cluster of unclassified cells. Cell types were labeled based on morphology. [Figure 22]Figures 22A–22C show networks of neurons generated in vitro from mouse EF cells treated with MβCD and hydrogel. Cell types were labeled based on morphology. [Figure 23] Figures 23A–23D show unclassified aggregated cell clusters differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 24] Figure 24 shows adipocyte clusters differentiated and matured in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 25] Myoblast-like cells differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 26] Figures 26A and 26B show tendinocyte / progenitor cell-like cells differentiated in vitro from mouse EF cells treated with MβCD and hydrogel. Cell types were labeled based on morphology. [Figure 27] Figures 27A to 27E show the arrangement of cells generated in vitro from mouse EF cells treated with MβCD and hydrogel. [Figure 28] Figure 28 shows the differentiation of cells from spheres on the polystyrene surface of a tissue culture dish. [Figure 29] Figures 29A to 29C show protocols for reprogramming somatic cells into stem cell-like cells and differentiating them into de novo phenotypic cells. [Figure 30] Figure 30 shows a petri dish and lid (arrow) cast with polyacrylamide gel. [Figure 31] Figures 31A–31E show in vitro development of immature erythrocyte-like and megakaryocyte / platelet-like cells derived from MβCD cells and human peripheral blood mononuclear cells treated with hydrogel. Figures 31A–31B show clusters of erythrocyte-like cells; Figures 31C–31E show clusters of megakaryocyte / platelet-like cells. [Figure 32]Figure 32 shows the somatic cell reprogramming cluster setting as instructed by the somatic cell reprogramming kit. [Figure 33] Figure 33 shows the seeding of somatic cells onto a polyacrylamide gel. [Modes for carrying out the invention]

[0033] Methods for producing pluripotent cells from non-pluripotent cells are provided herein, comprising: 1) contacting non-pluripotent cells with one or more cholesterol depletors; 2) contacting non-pluripotent cells with one or more MSAIC inhibitors; 3) culturing the cells on a soft matrix; or 4) any combination thereof. When combinations are used, the steps can be performed sequentially or simultaneously. In certain embodiments, the method comprises: 1) contacting non-pluripotent cells with one or more cholesterol depletors and contacting non-pluripotent stem cells with one or more MSAIC inhibitors; 2) contacting non-pluripotent cells with one or more cholesterol depletors and culturing the cells on a soft matrix; and 3) contacting non-pluripotent cells with one or more MSAIC inhibitors and culturing the cells on a soft matrix. In one embodiment, the cholesterol depletors are contacted with the non-pluripotent cells before culturing the cells on a soft matrix. In certain embodiments, the cells are contacted with the cholesterol depletors while the cells are suspended, for example, in a tube. In another embodiment, the cells are contacted with the MSAIC inhibitors before culturing the cells on a soft matrix. In one embodiment, cells are cultured on a soft matrix while simultaneously being contacted with an MSAIC inhibitor. Specific cholesterol depletors and MSAIC inhibitors, along with their concentrations and duration of contact with the cells, are provided below. Similarly, the degree of matrix flexibility, measured in kPa, is provided below.

[0034] Various non-pluripotent cells can be induced according to the disclosed methods. Mammalian cells, including human cells, are preferred. Cell types include human fibroblasts and human peripheral blood mononuclear cells. In one embodiment, non-pluripotent cells are cells that are not genetically modified to express pluripotency-inducing factors such as Oct4, Nanog, and Sox2. In one embodiment, non-pluripotent cells that are not genetically modified to express pluripotency-inducing factors are mammalian cells. In one embodiment, non-pluripotent cells that are not genetically modified to express pluripotency-inducing factors are human cells. In certain embodiments, the expression of one or more genes, Oct4, Nanog, and Sox2, is induced in pluripotent stem cells compared to non-pluripotent mammalian cells.

[0035] Various non-pluripotent cells can be induced according to the disclosed methods. Mammalian cells, including human cells, are preferred. Cell types include human fibroblasts and human peripheral blood mononuclear cells. In certain embodiments, the expression of one or more genes, Oct4, Nanog, and Sox2, is induced in pluripotent stem cells compared to non-pluripotent mammalian cells.

[0036] MSAIC inhibitors One embodiment of the present invention provides a method for inducing pluripotency in non-pluripotent (somatic) cells by contacting non-pluripotent cells with an MSAIC inhibitor. In a particular embodiment, the MSAIC inhibitor activates the transcription of PIFs in somatic cells, including but not limited to Oct4, Nanog, Sox2, and c-Myc. Known MSAIC inhibitors include gadolinium, ruthenium red, and GsMTX4. In one embodiment, the MSAIC inhibitor is an inhibitor of the piezo1 extension activation channel. A preferred embodiment of the MSAIC inhibitor is GsMTX4, which is a water-soluble 34 purified from spider venom. merIt is a peptide. For water-soluble inhibitors, it has been observed that PIF expression is suppressed by DMSO in in vitro culture, so those that dissolve only in DMSO are preferred [Czysz et al., PLoS One 10(2)(2015)]. Without being bound by theory, it is hypothesized that inhibition of MSAIC using GsMTX4 divides the microenvironment on the polystyrene cell culture surface (which inherently retains infinite elongation) into stages, simulating the environment of cells in contact with the soft extracellular matrix.

[0037] In certain embodiments, cells are contacted with an MSAIC inhibitor at concentrations of at least 1 μM, about 10 μM to about 1 μM, 10 μM to about 1 μM, about 7 μM to about 3 μM, 7 μM to 3 μM, about 5 μM, or 5 μM. In certain embodiments, the MSAIC inhibitor is GsMTX4 at concentrations of about 10 μM to about 1 μM, 10 μM to 1 μM, about 7 μM to about 3 μM, 7 μM to 3 μM, about 5 μM, or 5 μM. In preferred embodiments, cells are contacted with GsMTX4 at a concentration of 5 μM.

[0038] In one particular embodiment, cells are in contact with an MSAIC inhibitor for at least 12 hours, about 12 to about 96 hours, 12 to 20 hours, about 16 hours, 16 hours, 24 to 96 hours, 48 ​​to 96 hours, about 72 hours, or 72 hours. In one embodiment, cells are in contact with GsMTX4 at a concentration of 5 μM for 16 hours. In another embodiment, cells are in contact with GsMTX4 at a concentration of 5 μM for 72 hours.

[0039] In a particular embodiment, cells are in contact with the MSAIC inhibitor at temperatures of approximately 4°C to 42°C, approximately 20°C to 40°C, approximately 37°C, 37°C, approximately 25°C, or 25°C.

[0040] Cholesterol depletion agent One embodiment of the present invention provides a method for inducing pluripotency in non-pluripotent (somatic) cells by contacting non-pluripotent cells with a cholesterol depletor. In a particular embodiment, the cholesterol depletor activates the transcription of PIF in somatic cells, including but not limited to Oct4, Nanog, Sox2, and c-Myc. The cholesterol depletor includes cyclodextrins such as methyl-β-cyclodextrin (MβCD), hydroxypropyl-α-cyclodextrin (HPαCD), and hydroxypropyl-β-cyclodextrin (HPβCD).

[0041] Treatment with an MSAIC inhibitor such as GsMTX4 divides somatic cells into two types: the first type expresses PIF within 16 hours, while the second type expresses PIF in a delayed manner after a period of suppression. One embodiment of the present invention provides a method for in vitro converting the second type of cells to the first type by treatment with a cholesterol depletor. In one embodiment, the cholesterol depletor belongs to the cyclodextrin family. In a preferred embodiment, cellular cholesterol is depleted by treatment with MβCD (cyclic oligosaccharide). Following cellular cholesterol depletion, treatment with GsMTX4 activates the PI factor in the second type of somatic cells within 16 hours. Thus, a method for converting the second type of somatic cells to the first type of somatic cells, which are already reprogrammable into pluripotent stem cell-like cells following treatment with GsMTX4, is also provided herein. Additional embodiments of the present invention provide the synergistic use of a cellular cholesterol depletor and an MSAIC inhibitor for reprogramming somatic cells into pluripotent stem cell-like cells. A preferred embodiment that produces a synergistic effect uses MβCD and GsMTX4.

[0042] In a particular embodiment, cells are in contact with a cholesterol depletor at concentrations of at least 1 mM, about 10 mM to about 1 mM, 10 mM to 1 mM, about 7 mM to about 3 mM, 7 mM to 3 mM, about 5 mM, or 5 mM. In a particular embodiment, the cholesterol depletor is MβCD at concentrations of about 10 mM to about 1 mM, 10 mM to 1 mM, about 7 mM to about 3 mM, 7 mM to 3 mM, about 5 mM, or 5 mM. In a preferred embodiment, cells are in contact with MβCD at a concentration of 5 mM.

[0043] In a particular embodiment, cells are in contact with a cholesterol depletor for at least 12 hours, about 12 to about 96 hours, 12 to 20 hours, about 16 hours, 16 hours, 24 to 96 hours, 48 ​​to 96 hours, about 72 hours, or 72 hours. In one embodiment, cells are in contact with MβCD at a concentration of 5 mM for 20 minutes.

[0044] In a particular embodiment, cells come into contact with a cholesterol depletor at temperatures of approximately 4°C to 42°C, approximately 20°C to 40°C, approximately 37°C, 37°C, approximately 25°C, or 25°C.

[0045] Soft extracellular matrix Another embodiment of the present invention provides a method for inducing pluripotency in somatic (non-pluripotent) cells by culturing cells on a soft extracellular matrix. In one embodiment, PIF expression in cells is induced by culturing on a soft extracellular matrix. In a preferred embodiment, the soft extracellular matrix is ​​prepared from a hydrogel. Embodiments of the present invention suggest that the hydrogel is a polyacrylamide gel or a silicone gel. The flexibility of the polyacrylamide gel can be adjusted by changing the ratio of water, acrylic, and bis-acrylamide. As described above, the induction of PIF depends on a specific range of flexibility (as indicated by Pascal). Different types of cells may require different flexibility of the extracellular matrix, which can be determined by those skilled in the art who benefit from the knowledge provided by the teachings of this disclosure.

[0046] One embodiment of the present invention provides a method for maintaining precursor pluripotent stem cell-like cells expressing the non-splicing messages of the PIFs Oct4 and Nanog in in vitro culture on a soft extracellular matrix.

[0047] In preferred embodiments, the present invention provides examples of flexibility at 7.4 kPa, 3.2 kPa, and 1.7 kPa, with 3.2 kPa being a preferred embodiment. In different embodiments, the extracellular matrix has Young's modulus of approximately 20 kPa or less, approximately 15 kPa or less, approximately 10 kPa or less, approximately 7.4 kPa or less, approximately 3.2 kPa or less, approximately 1.7 kPa or less, approximately 1 kPa or less, 20 kPa or less, 15 kPa or less, 10 kPa or less, 7.4 kPa or less, 3.2 kPa or less, 1.7 kPa or less, 1 kPa or less, 20 kPa, 15 kPa, 10 kPa, 7.4 kPa, 3.2 kPa, 1.7 kPa, 20 kPa, 15 kPa, 10 kPa, 7.4 kPa, 3.2 kPa, 1.7 kPa, and 1 kPa.

[0048] Differentiated cells Therefore, one embodiment of the present invention comprises a 10% knockout serum substitute, 1 × non-essential amino acids, and 5 × 10 -5 This invention provides a method for differentiating somatic cell types in DMEM / F12 medium supplemented with M-2-mercaptoethanol. Examples of differentiated cells include oil red O-positive white and brown adipocytes, nerve cells, and alizarin-positive osteoblasts.

[0049] For example, brown adipose tissue is in demand for the treatment of obesity because it can simultaneously ingest and consume large amounts of diverse nutrients (e.g., glucose, lipids, amino acids) and participate in both anabolic and catabolic metabolism [Payab, M. et al. Int J Obes (2020) https: / / doi.org / 10.1038 / s41366-020-0616-5]. The methods provided herein include methods for differentiating pluripotent cells into various cell types, including adipocytes, neurons, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. In the case of neurons, the neuronal cell types can include cortical neurons, astrocytes, microglia, and oligodendrocytes. Methods for inducing pluripotent cells to differentiate into different lineages are known and can be used to differentiate pluripotent cells created according to the techniques of this disclosure.

[0050] The embodiments of the present invention described above provide a method for attenuating mechanosensitive stretch-activated ion channels by combining multiple methods (Figure 29). For example, embryonic fibroblasts were treated with MβCD and then cultured on a soft hydrogel made of polyacrylamide. In another example, embryonic fibroblasts were treated with GsMTX4 and then cultured on a soft hydrogel made of polyacrylamide. In one embodiment, the combined use of a cell-cholesterol-depleting compound and a soft extracellular matrix induces more frequent reprogramming and an increased emergence of cells retaining novel differentiated phenotypes. In an additional embodiment, a somatic cell reprogramming kit is provided, the components of which include a cholesterol-depleting agent, e.g., MβCD, and a low-elasticity hydrogel, e.g., polyacrylamide, in a Petri dish. In a particular embodiment, the polyacrylamide gel is cast into a 3.5 cm diameter Petri dish and then air-dried. Rehydration of the dried polyacrylamide using reprogramming medium prepares a low-elasticity cell culture matrix surface. A cholesterol-depleting solution is prepared by dissolving a fixed amount of a cholesterol-depleting agent, such as MβCD powder, in a test tube containing a culture medium. In one embodiment, somatic cells that come into contact with the cholesterol-depleting agent have their cholesterol content reduced and are cultured on a low-elasticity polyacrylamide gel to generate stem cell-like cells.

[0051] The invention also provides pharmaceutical compositions comprising pluripotent cells produced according to the disclosed method, differentiated cells produced according to the disclosed method, and reagents used in the method, such as tissue culture media and cell culture vessels. The cell culture vessels include dishes, bottles, plates, and multiwell plates.

[0052] Overall, embodiments of the present invention provide novel methods and necessary tools for reprogramming somatic cells into PSC-like cells and then subdividing them into various somatic cells useful for regenerative medicine. It is intended that the present invention encompasses one or more arbitrary aspects of any of the embodiments presented herein, or any combination of one or more embodiments.

[0053] 8. Embodiments Embodiments explicitly intended include: 1. A method for inducing non-pluripotent mammalian cells into induced pluripotent stem cells, wherein the non-pluripotent mammalian cells are as follows: a. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; b. One or more cellular cholesterol reducers in an amount sufficient to reduce cholesterol levels in mammalian cells; c. Soft extracellular matrix with a Young's modulus of 20 kPa or less A method that involves bringing two or more of them into contact. 2. The method of Embodiment 1, wherein non-pluripotent mammalian cells are not genetically engineered to express pluripotency-inducing factors. 3. The method of Embodiment 1, wherein the mechanosensitive stretch-activated ion channel inhibitor is selected from the group consisting of the L-enantiomer of GsMTX4, the D-enantiomer of GsMTX4, a peptide having a sequence that is at least 90% identical to the sequence of GsMTX4, or a mixture thereof. 4. The method of Embodiment 1, wherein the mechanosensitive stretch-activated ion channel inhibitor is GsMTX4. 5. The method of Embodiment 3, wherein the mechanosensitive extension-activated ion channel inhibitor is present at a concentration of approximately 10 μM to approximately 1 μM. 6. The method of Embodiment 3, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of 10 μM to 1 μM. 7. The method of Embodiment 3, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of approximately 7 μM to approximately 3 μM. 8. The method of Embodiment 3, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of 7 μM to 3 μM. 9. The method of Embodiment 3, wherein the mechanosensitive extension-activated ion channel inhibitor is present at a concentration of approximately 5 μM. 10. The method of Embodiment 3, wherein the mechanosensitive extension-activated ion channel inhibitor is present at a concentration of 5 μM. 11. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for about 12 to about 96 hours. 12. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 12 to 20 hours. 13. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for approximately 16 hours. 14. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 16 hours. 15. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 24 to 96 hours. 16. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 48 to 96 hours. 17. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for approximately 72 hours. 18. The method of Embodiment 3, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 72 hours. 19. The method of Embodiment 1, wherein the cellular cholesterol-reducing agent is cyclodextrin. 20. The method of Embodiment 19, wherein the cyclodextrin is methyl-β-cyclodextrin. 21. The method of Embodiment 20, wherein the cyclodextrin is at a concentration of approximately 10 mM to approximately 1 mM. 22. The method of Embodiment 20, wherein the cyclodextrin is at a concentration of 10 mM to 1 mM. 23. The method of Embodiment 20, wherein the cyclodextrin is at a concentration of approximately 7 mM to approximately 3 mM. 24. The method of Embodiment 20, wherein the cyclodextrin is concentrated to a concentration of 7 mM to 3 mM. 25. The method of Embodiment 20, wherein the cyclodextrin is at a concentration of approximately 5 mM. 26. The method of Embodiment 20, wherein the cyclodextrin is at a concentration of 5 mM. 27. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for about 15 to about 60 minutes. 28. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for 15 to 60 minutes. 29. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for about 20 to about 40 minutes. 30. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for 20 to 40 minutes. 31. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for about 15 to about 30 minutes. 32. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for 20 to 30 minutes. 33. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for approximately 20 minutes. 34. The method of Embodiment 20, wherein cells are in contact with cyclodextrin for 20 minutes. 35. The method of Embodiment 20, wherein the cells are in contact with cyclodextrin for approximately 30 minutes. 36. The method of Embodiment 20, wherein cells are in contact with cyclodextrin for 30 minutes. 37. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 38. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 39. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 40. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 41. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 42. The method of Embodiment 1, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 43. The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 44. The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 45. The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 46. ​​The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 47. The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 48. The method of Embodiment 3, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 49. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 50. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 51. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 52. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 53. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 54. The method of Embodiment 19, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 55. The method of Embodiment 1, wherein the extracellular matrix is ​​a hydrogel. 56. The method of Embodiment 55, wherein the extracellular matrix is ​​a polyacrylamide gel. 57. The method of Embodiment 1, wherein the extracellular matrix is ​​a silicone gel. 58. The method of Embodiment 1, wherein induced pluripotent stem cells can differentiate into types selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. 59. The method of Embodiment 58, wherein pluripotent stem cells are capable of differentiating into nerve cells, and the nerve cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. 60. The method of Embodiment 1, wherein the non-pluripotent mammalian cells are human cells selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 61. The method of Embodiment 1, wherein the expression of one or more genes Oct4, Nanog, and Sox2 is induced in induced pluripotent stem cells compared to non-pluripotent mammalian cells. 62. A method for inducing non-pluripotent mammalian cells into induced pluripotent stem cells, wherein the non-pluripotent mammalian cells are as follows: a. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; b. One or more cellular cholesterol reducers in an amount sufficient to reduce cholesterol levels in mammalian cells; c. Soft extracellular matrix with a Young's modulus of 20 kPa or less This includes contact with two or more of the following: Non-pluripotent mammalian cells have not been genetically engineered to express pluripotency-inducing factors; If present, one or more mechanosensitive stretch-activated ion channel inhibitors, comprising GsMTX4 at a concentration of approximately 5 μM; If present, one or more cholesterol-reducing agents are methyl-β-cyclodextrin at a concentration of about 5 mM; and If present, the soft extracellular matrix has a Young's modulus of approximately 7.5 kPa. Embodiments, including methods. 63. A method for inducing non-pluripotent mammalian cells into induced pluripotent stem cells, wherein the non-pluripotent mammalian cells are as follows: a. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; b. One or more cellular cholesterol reducers in an amount sufficient to reduce cholesterol levels in mammalian cells; c. Soft extracellular matrix with a Young's modulus of 20 kPa or less This includes contact with two or more of the following: Non-pluripotent mammalian cells have not been genetically engineered to express pluripotency-inducing factors; If present, one or more mechanosensitive stretch-activated ion channel inhibitors, comprising GsMTX4 at a concentration of approximately 5 μM, and non-pluripotent mammalian fat in contact with GsMTX4 for approximately 16 hours; If present, one or more cholesterol-reducing agents are methyl-β-cyclodextrin at a concentration of about 5 mM, and non-pluripotent mammalian cells are in contact with methyl-β-cyclodextrin for about 20 minutes; and If present, the soft extracellular matrix has a Young's modulus of approximately 7.5 kPa. Embodiments, including methods. 64. The method of Embodiment 62, wherein induced pluripotent stem cells can differentiate into cell types selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. 65. The method of Embodiment 62, wherein pluripotent stem cells are capable of differentiating into nerve cells, and the nerve cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. 66. The method of Embodiment 62, wherein the non-pluripotent mammalian cells are human cells selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 67. The method of Embodiment 62, wherein the expression of one or more genes Oct4, Nanog, and Sox2 is induced in induced pluripotent stem cells compared to non-pluripotent mammalian cells. 68. The method of Embodiment 63, wherein induced pluripotent stem cells can differentiate into cell types selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. 69. The method of Embodiment 63, wherein pluripotent stem cells can differentiate into nerve cells, and the nerve cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. 70. The method of Embodiment 63, wherein the non-pluripotent mammalian cells are human cells selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 71. The method of Embodiment 63, wherein the expression of one or more genes Oct4, Nanog, and Sox2 is induced in induced pluripotent stem cells compared to non-pluripotent mammalian cells. 72. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition that converts animal cells from a first non-pluripotent cell type, and the composition is a. Non-pluripotent mammalian cells, as follows: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol-reducing agents in an amount sufficient to reduce the cholesterol levels of mammalian cells; iii. Soft extracellular matrix with a Young's modulus of 20 kPa or less To bring into contact with two or more of them, and b. Induce differentiation of cells from step (a) into a second non-pluripotent cell type. A pharmaceutical composition comprising inducing non-pluripotent mammalian cells of a first cell type into induced pluripotent stem cells. 73. The composition of Embodiment 72, wherein neither the first non-pluripotent mammalian cell nor the second non-pluripotent mammalian cell is genetically engineered to express a pluripotency-inducing factor. 74. The composition of Embodiment 72, wherein the mechanosensitive stretch-activated ion channel inhibitor is selected from the group consisting of the L-enantiomer of GsMTX4, the D-enantiomer of GsMTX4, a peptide having a sequence that is at least 90% identical to the sequence of GsMTX4, or a mixture thereof. 75. The composition of Embodiment 72, wherein the mechanosensitive stretch-activated ion channel inhibitor is GsMTX4. 76. The composition of Embodiment 74, wherein the mechanosensitive stretch-activated ion channel inhibitor is present in a concentration of approximately 10 μM to approximately 1 μM. 77. The composition of Embodiment 74, wherein the mechanosensitive stretch-activated ion channel inhibitor is present in a concentration of 10 μM to 1 μM. 78. The composition of Embodiment 74, wherein the mechanosensitive stretch-activated ion channel inhibitor is present in a concentration of approximately 7 μM to approximately 3 μM. 79. The composition of Embodiment 74, wherein the mechanosensitive extension-activated ion channel inhibitor is present in a concentration of 7 μM to 3 μM. 80. The composition of Embodiment 74, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of approximately 5 μM. 81. The composition of Embodiment 74, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of 5 μM. 82. An embodiment according to claim 74, wherein the cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for about 12 to about 96 hours. 83. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for about 12 to about 20 hours. 84. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for about 16 hours. 85. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 16 hours. 86. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 24 to 96 hours. 87. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 48 to 96 hours. 88. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for about 72 hours. 89. The composition according to Embodiment 74, wherein cells are in contact with a mechanosensitive stretch-activated ion channel inhibitor for 72 hours. 90. The composition of Embodiment 72, wherein the cellular cholesterol-reducing agent is cyclodextrin. 91. The composition of Embodiment 90, wherein the cyclodextrin is methyl-β-cyclodextrin. 92. The composition of Embodiment 91, wherein the cyclodextrin is present in a concentration of approximately 10 mM to approximately 1 mM. 93. The composition of Embodiment 91, wherein the cyclodextrin is present in a concentration of 10 mM to 1 mM. 94. The composition of Embodiment 91, wherein the cyclodextrin is concentrated at a concentration of approximately 7 mM to approximately 3 mM. 95. The composition of Embodiment 91, wherein the cyclodextrin is present in a concentration of 7 mM to 3 mM. 96. The composition of Embodiment 91, wherein the cyclodextrin is present at a concentration of approximately 5 mM. 97. The composition of Embodiment 91, wherein the cyclodextrin is present at a concentration of 5 mM. 98. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for approximately 15 to 60 minutes. 99. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for 15 to 60 minutes. 100. The composition of Embodiment 91, wherein the cells are in contact with cyclodextrin for about 20 to about 40 minutes. 101. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for 20 to 40 minutes. 102. The composition of Embodiment 91, wherein the cells are in contact with the cyclodextrin for about 15 to about 30 minutes. 103. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for 20 to 30 minutes. 104. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for approximately 20 minutes. 105. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for 20 minutes. 106. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for approximately 30 minutes. 107. The composition of Embodiment 91, wherein cells are in contact with cyclodextrin for 30 minutes. 108. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 109. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of about 10 kPa or less. 110. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 111. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 112. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 113. The composition of Embodiment 72, wherein the extracellular matrix has a Young's modulus of about 1 kPa or less. 114. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 115. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of about 10 kPa or less. 116. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 117. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 118. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 119. The composition of Embodiment 74, wherein the extracellular matrix has a Young's modulus of about 1 kPa or less. 120. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of about 15 kPa or less. 121. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of about 10 kPa or less. 122. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 123. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 124. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 125. The composition of Embodiment 90, wherein the extracellular matrix has a Young's modulus of about 1 kPa or less. 126. The composition of Embodiment 72, wherein the extracellular matrix is ​​a hydrogel. 127. The composition of Embodiment 126, wherein the extracellular matrix is ​​a polyacrylamide gel. 128. The composition of Embodiment 72, wherein the extracellular matrix is ​​a silicon gel. The composition of Embodiment 72, wherein the 129.2nd non-pluripotent cell type is selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. The composition of Embodiment 129, wherein the 130.2nd non-pluripotent cell type is a neuronal cell type selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. The composition of Embodiment 72, wherein the 131.1 non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 132. The composition of Embodiment 72, wherein the expression of one or more of the genes Oct4, Nanog, and Sox2 is induced in the first non-pluripotent cell type. 133. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition that converts animal cells from a first non-pluripotent cell type, and the composition is a. Non-pluripotent mammalian cells, as follows: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol-reducing agents in an amount sufficient to reduce the cholesterol levels of mammalian cells; iii. Soft extracellular matrix with a Young's modulus of 20 kPa or less To bring into contact with two or more of them, and b. Induce differentiation of cells from step (a) into a second non-pluripotent cell type. This includes inducing non-pluripotent mammalian cells of the first cell type into induced pluripotent stem cells; Non-pluripotent mammalian cells have not been genetically engineered to express pluripotency-inducing factors; If present, one or more mechanosensitive stretch-activated ion channel inhibitors, comprising GsMTX4 at a concentration of approximately 5 μM; If present, one or more cholesterol-reducing agents are methyl-β-cyclodextrin at a concentration of about 5 mM; and If present, the soft extracellular matrix has a Young's modulus of approximately 7.5 kPa. Pharmaceutical composition. The composition of Embodiment 133, wherein the second non-pluripotent cell type is a cell type selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. The composition of Embodiment 133, wherein the second non-pluripotent cell type is a neuronal cell type, and the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. The composition of Embodiment 133, wherein the 136.1st non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 137. The composition of Embodiment 133, wherein the expression of one or more of the genes Oct4, Nanog, and Sox2 induces a first non-pluripotent cell type. 138. A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition that converts animal cells from a first non-pluripotent cell type, and the composition is a. Non-pluripotent mammalian cells, as follows: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol-reducing agents in an amount sufficient to reduce the cholesterol levels of mammalian cells; iii. Soft extracellular matrix with a Young's modulus of 20 kPa or less To bring into contact with two or more of them, and b. Induce differentiation of cells from step (a) into a second non-pluripotent cell type. This includes inducing non-pluripotent mammalian cells of the first cell type into induced pluripotent stem cells; Non-pluripotent mammalian cells have not been genetically engineered to express pluripotency-inducing factors; If present, one or more mechanosensitive stretch-activated ion channel inhibitors, comprising GsMTX4 at a concentration of approximately 5 μM, and non-pluripotent mammalian fat in contact with GsMTX4 for approximately 16 hours; If present, one or more cholesterol-reducing agents are methyl-β-cyclodextrin at a concentration of about 5 mM, and non-pluripotent mammalian cells are in contact with methyl-β-cyclodextrin for about 20 minutes; and A pharmaceutical composition wherein, if present, the soft extracellular matrix has a Young's modulus of approximately 7.5 kPa. The composition of Embodiment 138, wherein the 139.2nd non-pluripotent cell type is a cell type selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. The composition of Embodiment 138, wherein the 140.2nd non-pluripotent cell type is a neuronal cell type, and the neuronal cell type is selected from the group consisting of cortical neurons, astrocytes, microglia, and oligodendrocytes. The composition of Embodiment 138, wherein the 141.1 non-pluripotent cell type is a human cell selected from the group consisting of fibroblasts and peripheral blood mononuclear cells. 142. The composition of Embodiment 138, wherein the expression of one or more genes Oct4, Nanog, and Sox2 induces a first non-pluripotent cell type. 143.a. Cell culture medium, b. Below: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol reducers in an amount sufficient to reduce the cholesterol levels of mammalian cells. One or more mammalian cells treated with one or both of the following; and c. Soft extracellular matrix with a Young's modulus of 20 kPa or less A cell culture vessel containing a cell culture vessel. 144. A container of Embodiment 143 in which mammalian cells have not been genetically engineered to express pluripotency-inducing factors. 145. A vessel of Embodiment 143, wherein the mechanosensitive stretch-activated ion channel inhibitor is selected from the group consisting of the L-enantiomer of GsMTX4, the D-enantiomer of GsMTX4, a peptide having a sequence that is at least 90% identical to the sequence of GsMTX4, or a mixture thereof. 146. A vessel of Embodiment 143 in which the mechanosensitive stretch-activated ion channel inhibitor is GsMTX4. 147. A container of Embodiment 145, containing a mechanosensitive extension-activated ion channel inhibitor at a concentration of approximately 10 μM to approximately 1 μM. 148. A container of Embodiment 145, containing a mechanosensitive stretch-activated ion channel inhibitor at a concentration of 10 μM to 1 μM. 149. A container of Embodiment 145, containing a mechanosensitive extension-activated ion channel inhibitor at a concentration of approximately 7 μM to approximately 3 μM. 150. A container of Embodiment 145, containing a mechanosensitive extension-activated ion channel inhibitor at a concentration of 7 μM to 3 μM. 151. A container of Embodiment 145 containing a mechanosensitive extension-activated ion channel inhibitor at a concentration of approximately 5 μM. 152. A container of Embodiment 145, containing a mechanosensitive extension-activated ion channel inhibitor at a concentration of 5 μM. 153. A container of Embodiment 143, wherein the cellular cholesterol-reducing agent is cyclodextrin. 154. A container of Embodiment 153, wherein the cyclodextrin is methyl-β-cyclodextrin. 155. A container of Embodiment 154, in which cyclodextrin is present at a concentration of approximately 10 mM to approximately 1 mM. 156. A container of Embodiment 154, in which cyclodextrin is present at a concentration of 10 mM to 1 mM. 157. A container of Embodiment 154, in which cyclodextrin is present at a concentration of approximately 7 mM to approximately 3 mM. 158. A container of Embodiment 154, in which cyclodextrin is present at a concentration of 7 mM to 3 mM. 159. A container of Embodiment 154, in which cyclodextrin is present at a concentration of approximately 5 mM. 160. A container of Embodiment 154, in which cyclodextrin is present at a concentration of 5 mM. 161. A container of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 162. A container of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 163. A vessel of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 164. A vessel of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 165. A vessel of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 166. A container of Embodiment 143, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 167. A vessel of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 168. A vessel of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 169. A vessel of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 170. A vessel of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 171. A vessel of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 172. A container of Embodiment 145, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 173. A vessel of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 15 kPa or less. 174. A container of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 10 kPa or less. 175. A vessel of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. 176. A vessel of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 3.2 kPa or less. 177. A vessel of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 1.7 kPa or less. 178. A vessel of Embodiment 153, wherein the extracellular matrix has a Young's modulus of approximately 1 kPa or less. 179. A container of Embodiment 143, wherein the extracellular matrix is ​​a hydrogel. 180. A container of Embodiment 179, wherein the extracellular matrix is ​​a polyacrylamide gel. 181. A container of Embodiment 143, wherein the extracellular matrix is ​​a silicone gel. 182.a. Cell culture medium, b. Below: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol reducers in an amount sufficient to reduce the cholesterol levels of mammalian cells. One or more mammalian cells treated with one or both of the following; and c. Soft extracellular matrix with a Young's modulus of 20 kPa or less Includes, Non-pluripotent mammalian cells have not been genetically engineered to express pluripotency-inducing factors; If present, one or more mechanosensitive stretch-activated ion channel inhibitors, comprising GsMTX4 at a concentration of approximately 5 μM; If present, one or more cholesterol-reducing agents are methyl-β-cyclodextrin at a concentration of about 5 mM; and A cell culture vessel in which, if present, the soft extracellular matrix has a Young's modulus of approximately 7.5 kPa. 183. A method for increasing the expression of endogenous pluripotency-inducing transcription factors in somatic cells, comprising modifying cell membrane receptor signaling. 184. The method of Embodiment 183, wherein the somatic cells are fibroblasts. 185. The method of Embodiment 183, wherein the pluripotency-inducing transcription factor is selected from Oct-4, Sox-2, Nanog, and c-Myc. 186. The method of Embodiment 183, wherein the cell membrane receptor is a mechanosensitive and / or stretch-activated ion channel. 187. The method of Embodiment 183, wherein cell membrane receptor signaling is modified by contacting the cell with a mechanosensible and / or stretch-activated ion channel-specific inhibitor. 188. The method of Embodiment 187, wherein the inhibitor is GsMTX4. 189. The method of Embodiment 183, wherein cell membrane receptor signaling is modified by the depletion of at least one cellular lipid. 190. The method of Embodiment 189, wherein at least one cellular lipid is cholesterol. 191. The method of Embodiment 189, wherein extracellular lipid depletion is achieved by bringing cells into contact with molecules of the cyclodextrin family. 192. The method of Embodiment 191, wherein the molecule is methyl-beta-cyclodextrin. 193. The method of Embodiment 183, wherein cell membrane receptor signaling is modified by culturing cells in a low-elasticity extracellular matrix. 194. The method of Embodiment 193, wherein the matrix is ​​a polyacrylamide gel. 195. The method of Embodiment 194, wherein the elasticity of the polyacrylamide gel is less than 7.4 k Pascals. 196. Cell membrane receptor signaling, a. Contacting cells with mechanosensible and / or stretch-activated ion channel-specific inhibitors; b. Depletion of at least one cellular lipid; and c. Culture cells in a low-elasticity extracellular matrix. The method of Embodiment 183, modified by... 197. Cells produced by the method of Embodiment 183, which express endogenous pluripotent transcription factors. 198. Cells produced by the method of Embodiment 183, which express a pluripotency-inducing transcription factor. 199. A differentiated cell, derived from the cell of Embodiment 198. 200. A kit for carrying out the method of Embodiment 183. 201. A kit of Embodiment 200 comprising a cholesterol-depleting compound and a low-elasticity extracellular matrix. 202. A kit of Embodiment 200 comprising methyl-β-cyclodextrin and a dried polyacrylamide gel.

[0054] 9. Examples The following examples, which highlight certain features and characteristics of representative embodiments of the invention described herein, are provided for illustrative purposes only and are not limiting. 9.1. Example 1 9.1.1. Materials and Methods Mice, cells, and antibodies

[0055] C57BL / 6 male mice (4-6 weeks old) were purchased from Jackson Laboratory. Bone marrow and splenocytes were obtained from 4-6 week old male C57BL / 6 mice. Cells in single-cell suspension were depleted of red blood cells before use. Bone marrow stromal cells were cultured and passaged in T75 culture flasks as described in [Tormo et al., Bio-protocol 4:e1031 (2014)]. Embryonic fibroblasts were prepared from 13-day-old C57BL / 6 fetuses as described in [Qiu et al., Bio-protocol 6:e1859 (2016)]. Cells used for reprogramming were cultured for 2 to 4 passage periods.

[0056] MSAIC inhibition assay using GsMTX4 Place the cells in groups of 3 in a 6-well plate (10 7Cells were cultured in a well. GsMTX4 dissolved in PBS was added to the experimental group at a concentration of 5 μM. After 16 hours, spleen cells and bone marrow cells were collected by scraping and pelleted for total RNA extraction using RNeasy (Qiagen) or Trizol (Invitrogen). For EF cells and BM stromal cells, the cell culture medium was drained and the cells were resuspended directly in the cell lysis buffer in the culture wells. The extracted RNA was subjected to cDNA synthesis (Applied Bioscience), and messages specific to the mouse PI gene and control gene were analyzed by a real-time PCR thermocycler (Bio-Rad, CFX384).The primers used were: Oct4(5':CTACAGTCCCAGGACATGAA (SEQ ID NO: 5), 3':TGGTCTCCAGACTCCACCTC (SEQ ID NO: 6), Sox2(5':ATGATGGAGACGGAGCTGAA (SEQ ID NO: 7), 3':TTGCTGATCTCCGAGTTGTG (SEQ ID NO: 8), Nanog(5':AAGTACCTCAGCCTCCAGCA (SEQ ID NO: 90), 3':GCTTGCACTTCATCCTTTGG (SEQ ID NO: 10), CFBP / α(5':CGACTTCTACGAGGTGGAGC (SEQ ID NO: 11), 3':TCGATGTAGGCCGCTGATGTC (SEQ ID NO: 12), c-Myc(5':CACCATGCCCCTCAACGTGA (SEQ ID NO: 13), 3':TTATGCACCAGAGTTTCG (SEQ ID NO: 14), RUNX1(5':CGTATCCCCGTAGATGGCAG (SEQ ID NO: 15), 3':GCCAGGGTGGT CAGCTAGTA (SEQ ID NO: 16), PU.1 (5':AGAGCATACCAACGTCCAATGC (SEQ ID NO: 17), 3':GTGCGGAGAAATCCCAGTAGTG (SEQ ID NO: 18), IRF8 (5':CGTGGAAGACGAGGTTACGCTG (SEQ ID NO: 19), 3':GCTGAATGGTGTGTGTCATAGGC (SEQ ID NO: 20), FOXP1 (5':ATCCCAGAACGGGTCCAGCGGTGGCAACCAC (SEQ ID NO: 21), 3':GATCTGCTGCATTTGTTGAGGAGTGATAAC (SEQ ID NO: 22), KLF4 (5':GGTGCAGCTTGCAGCAGTAA (SEQ ID NO: 23), 3':AAAGTCTAGGTCCAGGAGGTCGTT (SEQ ID NO: 24), Actin (5':GTGACGAGGCCCAGAGCAAGAG (SEQ ID NO: 25), 3':AGGGGCCGGACTCATCGTACTC (SEQ ID NO: 26), GAPDH 5' was CATCACCATCTTCCAGGAGCG (SEQ ID NO: 27), and 3' was ACGGACACATTGGGGGTAGG (SEQ ID NO: 28). The value of each Cq(Ct) was applied to a formula to estimate the message level (indicated by an index value) of each specific gene, compared to the message levels of actin or GAPDH housekeeping genes.

[0057] Low-elasticity tissue culture plates and hydrogel casting in culture plates Tissue culture plates with defined elastic surfaces (0.2 kPa, 4 kPa, 50 kPa) were purchased from Matrigen. 3.5 cm Petri dishes were used to cast the polyacrylamide gel into the dishes. 330 μL of polyacrylamide gel cocktail was placed in each dish, and a fitted lid (polypropylene) was immediately placed on top (Figure 30). Three different elasticities of polyacrylamide gel were prepared during the study. The ratios of [acrylamide (40%):bis-acrylamide (2%):water] were determined according to published data [Tse ​​and Engler, Curr. Protoc. Cell Biol. Chapt. 10 Unit 10.16 (2010)]. They were (75:112.5:812.5) at 1.7 kPa, (100:150:750) at 3.2 kPa, and (250:30:720) at 7.4 kPa. A slice of a 50ml conical centrifuge tube cap was used as a drop lid (indicated by the arrow in Figure 30).

[0058] After 90 minutes, the drop lid was carefully removed, and the gel in the dish was washed five times with 3 ml of sterile water. Each aspiration of water from the dish was performed gently using a 1 ml micropipette. During washing, the cast acrylamide gel detached from the bottom. Finally, the gel was saturated with DMEM / F12 medium for 2 hours prior to use. Each component for the polyacrylamide gel, except for TEMED, was filter-sterilized. The drop lid was sterilized with 70% Et-OH and dried in a tissue culture hood. The entire process was performed in a tissue culture hood.

[0059] Cell treatment and reprogramming culture using MβCD The cells were placed in a 15 ml centrifuge tube, 2 × 10 6 The cells were suspended in DMEM containing 5 mM MβCD at a concentration of / ml. The cell suspension was incubated at 37°C for 30 minutes, gently agitated every 5 minutes. The cells were washed once with DMEM / F12 warmed to 37°C and then added to a small amount of complete medium (30 μl / 2 × 10⁶).6 Cells) [DMEM / F12 (Corning), 20% knockout serum substitute (Gibco), 1% non-essential amino acids (Gibco), 5 × 10⁻¹⁰] -5 The cells were resuspended in M ​​2-mercaptoethanol. To initiate reprogramming culture on the hydrogel, 2.5 ml of complete medium was added to a petri dish, and then 30 μl of the cell suspension was placed on the hydrogel. Multiple dishes were placed in a 15 cm diameter petri dish containing 6 cm petri dishes filled with water and without lids. Cells on the gel and on the bottom of the dishes were observed daily, and cells exhibiting notable phenotypes were recorded using the EVOS cell monitoring system (Thermo Fisher). Cells exhibiting various phenotypes were characterized by assays of cell lineage-specific markers (e.g., oil red O for adipocytes, alizarin for calcium-depositing cells) as a commonly available method.

[0060] RT-PCR assay for PI gene expression in EF cell reprogramming culture Cells derived from MβCD-treated and hydrogel-exposed cultures in petri dishes were subjected to total RNA extraction using Trizol. cDNA was prepared as described above, and standard PCR was performed (35 cycles) using the primers listed above for PCR mastermix (BioTools) and real-time PCR assays. PCR products were degraded using 1.5% agarose gel and ethidium bromide staining, and results were obtained using a gel documentation system (Bio-Rad). 9.2. Example 2 Nuclear reprogramming of human peripheral blood mononuclear cells (PBMCs)

[0061] Human PBMCs are an attractive source of somatic cells for reprogramming into stem cells using available iPSC technologies. Peripheral blood sampling is a common method in medicine and can be obtained in individual, specific forms. Purification of PBMCs is also a standard method by Ficol gradient centrifugation. Previously, standard iPSC techniques using lentiviruses resulted in the establishment of a series of iPSCs [Simara, Pavel et al. Stem cells and development vol.27,10-(2018), US9447382B2]. To investigate whether the method of the present invention can be applied to reprogram human PBMCs into stem cell-like cells and to differentiate them into a de novo phenotype in vitro, we performed experiments in which cells were treated with MβCD and then cultured on a soft polyacrylamide gel as described below (infula).

[0062] Human peripheral blood was collected from the left forearm vein into heparinized tubes (corrected). Hematopoietic mononuclear cells were isolated using the Ficol-Hyperc method (density, 1.077; Pharmacia Biotech, Uppsala, Sweden). Cells were incubated twice with 5 mM MβCD in DMEM for 20 minutes at 37°C and pelletized by centrifugation at 900g at room temperature. They were washed once with DMEM / F12 warmed to 37°C and then treated with a small amount of complete medium (30 μl / 2 × 10⁶). 6 Cells) [DMEM / F12 (Corning), 20% knockout serum substitute (Gibco), 1% non-essential amino acids (Gibco), 5 × 10⁻¹⁰] -5 The cells were resuspended in M ​​2-mercaptoethanol. Cells in cultured petri dishes were monitored daily under a microscope, and novel phenotypic cells were recorded. As shown in Figures 31A–31D, we observed novel phenotypic cells resembling erythrocytes, erythrocyte progenitor cells, dendritic cell-like cells, lymphocyte-like small cells, and platelet-like small particles. These cells were recognized after 1 week of culture, and the number of immature erythrocyte-like cells increased with longer culture periods than 2 weeks. Control cultures, which were not treated with MβCD or soft hydrogel, showed numerous cell deaths, and no similar situation was observed by microscopic examination.

[0063] Figures 31A–31D show in vitro development of immature erythrocyte-like and megakaryocyte / platelet-like cells derived from MβCD cells and human peripheral blood mononuclear cells treated with hydrogel. Figures 31A–31B show clusters of erythrocyte-like cells, and Figures 31C–31E show clusters of megakaryocyte / platelet-like cells.

[0064] Importantly, it is known that red blood cell production is strictly limited to cells derived from bone marrow cells rather than peripheral blood mononuclear cells [Dzierzak and Sjaak, Cold Spring Harbor perspectives in medicine vol.3,4 a011601.1Apr.2013,doi:10.1101 / cshperspect.a011601]. Therefore, the present invention provides a unique and valuable opportunity to generate cells to meet the demand and to transfuse blood cells for anemia and lymphopenia. 9.3. Example 3 Somatic cell reprogramming kit

[0065] Current findings have taught that somatic cells can be reprogrammed into pluripotent stem cell-like cells after the attenuation of mechanical stress. In this regard, in vitro culture on a low Pascal (e.g., 3.2 kPa) acrylamide gel surface deforms fibroblasts into pluripotent stem cell-like cells. In addition, cellular cholesterol depletion using MβCD reprograms fibroblasts into pluripotent stem cell-like cells. Potentially, these techniques could generate a novel platform for reprogramming somatic cells into stem cells and subsequently differentiating them into different cell types. A kit enabling a standard expert to reprogram somatic cells includes a 3.5 cm diameter petri dish with a cast soft polyacrylamide gel and aliquots of MβCD powder in a tube. The following describes the "Materials, Methods, and Procedures" related to the "Somatic Cell Reprogramming Kit". 9.3.1. Materials and Methods

[0066] Tubes containing reprogramming reagent (MβCD). Each tube is for reprogramming one cell type. Set a 35 mm Petri dish containing a dry stem cell matrix (acrylamide gel). Each Petri dish has a dry polyacrylamide gel with different elasticities after rehydration, with one having 1.7 kPa, the second having 3.2 kPa, and the third having 7.4 kPa. Therefore, the different flexibilities of the matrix in each dish can be selected for the optimal reprogramming of specific somatic cells of interest and subsequent redifferentiation. DMEM with antibiotics Complete medium: antibiotics, knockout serum (20%), non-essential amino acids (1×), 5×10 -5 DMEM / F-12 with 2-mercaptoethanol at 1× Petri dishes (14 cm diameter; 6 cm diameter) Disposable 10 ml syringe Syringe filter (0.22 μm) A cell imaging system for keeping records, such as an EVOS cell imaging system (Thermo Fisher).

[0067] Daily protocol Day 1 In the tissue culture hood, place the Petri dish into a 14 cm Petri dish containing a 5.5 cm Petri dish without a lid filled with clean water. Add 3 ml of complete medium to a 3.5 cm Petri dish with a stem cell matrix (dry polyacrylamide gel). See, for example, Figure 32. Day 2 Monitor the Petri dish for contamination and the presence of reconstituted stem cell matrix. Day 3 Monitor the Petri dish for contamination. Prepare the reprogramming solution immediately before use. Dissolve the reprogramming reagent in 5 ml of DMEM in a tube. Vortex well to mix / dissolve completely and sterilize with a syringe filter. Warm at 37 °C. Embryonic fibroblasts (30 to 50 billion cells) are collected in a 15 ml conical tube. Wash once with DMEM. Resuspend the cell pellet in half the volume of reprogramming MβCD solution (approximately 2.5 ml) and incubate at 37°C for 20 minutes, mixing every 5 minutes. Rotate to pelletize, remove the supernatant, and resuspend again in the remaining half of the reprogramming solution (approximately 2.5 ml), continuing incubation at 37°C for another 20 minutes, mixing every 5 minutes. Spin down (no washing required) and resuspend the pellet in 20 to 30 μl of complete medium. Using a 200 μl pipette, gently seed the cells into the stem cell matrix of a 35 mm petri dish. Seed approximately 20 μl per petri dish onto the matrix (Figure 33). Wait 20 minutes in a tissue culture hood for the cells to settle on the matrix. Gently transfer the entire petri dish combo to a 37°C CO2 incubator and begin reprogramming / differentiation culture. Day 7 Add βFGF (10 ng / ml). From day 8 onwards Monitor the cells on the matrix and the bottom of the culture.

[0068] 9.4. Discussion A study was conducted to test whether MSAIC signaling in bone marrow cells could activate the expression of pluripotency-inducing (PI) genes. To modify MSAIC signaling, GsMTX4 was employed [Gnanasambandam et al., Biophys.J.112:31(2017)], which retains specific functional blocking activity against MSAIC [Park et al., PAIN,137:208(2008)]. GsMTX4 is a water-soluble 34-34 venom purified from the venom of tarantulas (Tricholopteridae), which has been previously used to enhance the mechanical thresholds of touch, pressure, proprioception, and pain in sensory neurons. merIt is a peptide [Bowman et al., Toxicon, 49:249 (2007)]. To characterize PI gene expression, water-soluble GsMTX4 was useful because it was known that some other MSAIC inhibitors (e.g., HC067047 [Everaerts et al., Proc. Natl. Acad. Sci. USA 107:19084 (2010)]) dissolve only in DMSO or alcohol and alter PI gene expression on their own [Czysz et al., PLoS One, 10(2) (2015); Ogony et al., Stem Cells Dev., 22:2196 (2013)].

[0069] In the experiment, mouse bone marrow cells were cultured in vitro at 37°C for 16 hours in the presence of 5 μM GsMTX4. The cells were then assayed for PI gene messages, as listed on the left in Figure 1. During this cell culture, the cells were exposed to a rigid polyethylene surface that inherently possesses unlimited stretchability. The presence of GsMTX4 in the culture was expected to prevent the cells from detecting strong stretch stress induced by MSAIC. Notably, cells cultured in the presence of GsMTX4 expressed Oct4 messages more than 100 times more strongly than control cells (Figure 1). Furthermore, Sox2, C / EBPα, and RUNX1, which have been reported to be involved in the phenotype of hematopoietic stem cells, were also significantly activated intracellularly [Hasemann et al., PLoS Genet. 10(1):e1004079 (2014); North et al., Stem Cells. 22:158 (2004)]. Therefore, the data showed that treatment with GsMTX4 significantly activated the expression of specific genes important to the stem cell phenotype.

[0070] Fresh bone marrow cells were cultured for 16 hours in DMEM supplemented with 10% FBS in a 6-well plate containing GsMTX4 (5 μM). Gene-specific messages listed on the left were characterized by real-time PCR and presented as relative indicators compared to β-actin message values. Each experimental value shown is the mean and standard deviation of a triplicate sample. The results shown represent three experiments with similar results.

[0071] When RNA assays were performed for the expression of non-PI genes, IRF8 and FOXP1, the changes in expression were small and not comparable to those of PI genes. Therefore, GsMTX4 enhanced PI gene expression in a gene-specific manner. The study showed that stretch injury detected by MSAIC sensitively / dominantly suppressed PI gene expression in bone marrow cells. This can be interpreted as more rigid extracellular matrix-stimulated MSAIC signaling promoting stem cell differentiation by reducing pluripotent differentiation potential.

[0072] GsMTX4-mediated inhibition of MSAIC is hypothesized to provide cells with a microenvironment in contact with the soft extracellular matrix. In this context, to gain deeper insights, we investigated the response of myelocytes cultured in tissue culture wells of various stiffness levels. The selected stiffness levels were 0.2 kPascals, 4 kPascals, and 50 kPascals. Cells were cultured in the wells for 16 hours and assayed for PI gene expression as described above. Importantly, significant PI gene expression was observed at specific stiffness levels, with the highest induction at 4 kPascals and the lowest levels at 0.2 kPascals or 50 kPascals (Figure 2).

[0073] Bone marrow cells were cultured in 6-well plates coated with matrices of specific stiffness levels, as listed on the left. The messages of the genes listed on the left were characterized by qPCR, as shown in Figure 1. The results suggested that PI gene activation was dependent on a specific range of extracellular matrix stiffness levels, as excessive softness or stiffness did not significantly increase PI gene expression.

[0074] The regulation of the PI gene by GsMTX4 in spleen cells is inconsistent with that observed in bone marrow cells. When spleen cells were cultured in the presence of GsMTX4 for 16 hours, no activation of the PI gene was observed; instead, although the expression level was low, PI gene expression was consistently suppressed (Figure 3). Spleen cells were cultured in a 6-well plate as shown in Figure 1. Gene expression listed on the left was evaluated using the same method as shown in Figure 1.

[0075] To more clearly investigate cells that retain opposite phenotypes when exposed to the same pressure and stretch stress, the study was extended by preparing bone marrow-derived stromal cell lines and embryonic fibroblast (EF) cells. When bone marrow stromal cell lines were cultured O / N in the presence of GsMTX4, the activation of the PI gene in the cells was similar to that of fresh bone marrow cells (Figure 4). Bone marrow stromal cell lines were treated with GsMTX4 as shown in Figure 1. Gene expression, listed on the left, was evaluated using the same method as shown in Figure 1. Similarly, EF cells responded as observed in the study of fresh spleen cells (Figure 5). Embryonic fibroblasts were treated with GsMTX4 as shown in Figure 1. Gene expression, listed on the left, was evaluated using the same method as shown in Figure 1.

[0076] The data indicated that the regulatory patterns of PI genes induced by mechanical stress may be inherited by cell lines adapted in vitro. The data also suggested that specific phenotypes in response to MSAIC signaling are not due to transient mechanisms resulting from in vivo-to-in vitro adaptation, but rather to inherently programmed mechanisms. This stable phenotype of PI gene regulation by MSAIC may be related to mechanisms that preserve pluripotency in somatic cells.

[0077] In further experiments, PI gene regulation in spleen and EF cells was investigated 3 days after the start of GsMTX4 treatment to gain insight into whether repression persisted. When PI gene expression was assayed, repression was no longer detected; instead, significant activation of the PI gene was observed (Figure 6).

[0078] Splenocytes were cultured in a 6-well plate as shown in Figure 1. Cells were harvested on day 3 and assayed for the expression of the pluripotent stem cell transcription factors listed on the left using the same method as shown in Figure 1. Using a similar method, it was observed that the expression of the PI gene in EF cells was activated 3 days after GsMTX4 treatment (Figure 7). EF cells were cultured in a 6-well plate as shown in Figure 1. Cells were harvested on day 3 and assayed for the expression of PIF listed on the left using the same method as shown in Figure 1.

[0079] The data showed that the repression of the PI gene in response to the MSAIC inhibitor was transient. Therefore, the origin of the cell appeared to influence the initial response to mechanical stress, as measured by the expression of the PI gene. The results appear to reveal an unprecedented receptor mechanism in which the same input of stimulation elicits completely different results depending on the cell type, possibly due to different stages of cell differentiation.

[0080] The results suggested the existence of distinct types of somatic cells following the attenuation of MSAIC signaling; one immediately activating the PI gene, and the other responding in a delayed mode, activating the PI gene after transient suppression. The data also showed that long-term attenuation of MSAIC signaling may reprogram both somatic cell types to acquire a stem cell-like phenotype retaining high levels of the PI gene.

[0081] Cholesterol depletion from spleen cells modified them to respond to GsMTX4 in a manner similar to that of bone marrow cells.

[0082] To gain insight into the molecular mechanisms by which spleen cells are distinguished from bone marrow cells after MSAIC inhibition, we investigated the roles of different shear moduli and potential cell membrane signaling. Cholesterol levels, known to be higher in the spleen than in the bone marrow under stable temperature physiological conditions, alter cell membrane shear moduli [Los and Murata, Biochim. Biophys. Acta. 1666:142 (2004); Simons and Sampaio, Cold Spring Harb. Perspect Biol. 3(10) (2011)]. Cholesterol also plays a central role in membrane receptor signaling by forming lipid rafts where MSAICs are present and initiate mechanesensory signaling [Szoke et al., Eur. J. Pharmacol. 628:67 (2010)]. Spleen cells were investigated for PI gene expression after treatment with MβCD, which depletes cholesterol from the cell membrane [Mahammad and Parmryd, Methods Mol. Biol. 1232:91 (2015)]. Surprisingly, spleen cells treated with MβCD showed activation of the PI gene in response to GsMTX4 treatment in O / N culture (Figure 8).

[0083] As shown in Figure 1, spleen cells were treated with MβCD at 37°C before in vitro culture using GsMTX4. Gene expression, as listed on the left, was evaluated using the same method as shown in Figure 1. ND: Not detected.

[0084] The results showed that cholesterol levels in the cell membrane determined PI gene expression obtained in response to MSAIC inhibitors.

[0085] EF cells are converted into pluripotent stem cell-like cells by depletion of cellular lipids and / or soft extracellular matrix.

[0086] We developed a cell culture method in which cells acquire pluripotent stem cell activity, as observed in EF cells gene-transfected with the PI gene [Takahashi and Yamanaka, Cell, 126:663 (2006)]. Cells were treated with MβCD and then seeded on low-Pascal hydrogels (1.7 kPa, 3.2 kPa, and 7.4 kPa). Within 60 minutes of the start of culture, the cells firmly adhered to the hydrogel, and subsequently, the formation of spheres of various sizes was observed in O / N culture (Figure 9A).

[0087] To investigate PI gene expression, total RNA from cells adhering to the bottom of the spheres and wells (those spilled from the gel surface during the seeding procedure) was characterized by RT-PCR using 1.5% agarose gel electrophoresis.

[0088] EF cells were treated with MβCD and cultured in petri dishes cast with hydrogels for 7 days prior to RNA extraction. The stiffness of the hydrogels was listed above each lane. Total RNA from cells attached to the spheres and dishes was analyzed for PI gene expression by RT-PCR. PCR-amplified fragments were dissolved in 1.5% agarose gel and stained with ethidium bromide. Total RNA from mouse embryonic stem (mES) cells was used as a positive control. From left to right: a; Oct4 analysis, b; Nanog analysis, c; Sox2 analysis.

[0089] As shown in Figure 10, after one week of culture, cells adhering to the bottom at the predicted size showed significant messages for Oct4, Nanog, and Sox2. However, RNA obtained from spheres did not show the predicted band specific to Oct4, but instead showed a prominent band of approximately 1000 bps (Figure 10A). However, these bands completely disappeared when the predicted-size band appeared. Similar results were observed in assays for Nanog expression (Figure 10B). However, Sox2, a gene that does not contain introns, did not show a large-sized band [Nagai, Jpn.J.Hum.Genet.41:363(1996)] (Figure 10C). It was hypothesized that these approximately 1000 bps bands in Oct4 and Nanog-specific RT-PCR studies represented fragments derived from unspliced ​​messages. The sequencing results from the purified fragment of approximately 1000 bps (Figure 11) (SEQ ID NO: 1) were indeed consistent with the reported sequence containing exons 3 and 5 of Oct4 (Figure 12) (SEQ ID NO: 2), including the intron (Figure 14) (SEQ ID NO: 4), as well as exons 2 and 3 of Nanog (Figure 13) (SEQ ID NO: 3). Correspondingly, the presence of unspliced ​​mouse Oct4 precursor mRNA in cancer cells was previously identified as Oct4 in a report [Liu et al., J. Cell. Physiol. 233:5468 (2018)].

[0090] We expanded our research by investigating the activation dynamics of PIF messages induced in cells attached to the bottom of the wells (Figures 15A-15B).

[0091] EF cells were treated with MβCD and cultured in petri dishes. Microscopic morphological observations on days 1, 4, and 7 after the start of the experiment are shown in A. Total RNA was extracted at the points listed above. The messages for each PI gene were analyzed as shown in Figure 1 and are shown in B.

[0092] Surprisingly, we detected unspliced ​​messages within 24 hours of cholesterol depletion. Spliced ​​messages were present only in cells cultured for 7 days. The results suggest that 1) cholesterol depletion activated PI gene precursor transcription within 24 hours, 2) expression of spliced ​​messages began 7 days prior, but 4 days later, and 3) the soft hydrogel prevented splicing of PI gene precursor messages. Therefore, the flexibility of the extracellular matrix significantly regulated the activation and splicing mechanisms of PI genes in somatic cells.

[0093] To investigate whether the differentiation of cells with a novel phenotype continued with continued culture from these PI gene-activated pluripotent stem cell-like cells, the cells were cultured for an extended period. Within 14 days, most of the spheres on the gel dissolved into clusters of round cells (Figure 9B). Simultaneously, the adhesion of the cells to the hydrogel weakened, and the cells appeared to be released to the bottom of the dish. Surprisingly, differentiation of cells with a distinctive phenotype was observed at the bottom of the culture dish within one week. In EF cell studies, little proliferation or morphological change of cells adhering to the hydrogel was observed. Therefore, the results suggest that cells seeded on the surface of the petri dish and cells spilled from the acrylamide gel onto the surface of the petri dish differentiated into cells with a distinctive phenotype. Examples of cells with a distinctive phenotype that appeared at the bottom of the dish are shown in Figures 17 to 27.

[0094] Specifically, EF cells were treated with MβCD and cultured in petri dishes cast with a 3.2 kPa hydrogel. Differentiated cells were observed and photographed at the bottom of the dish. Based on the phenotypes of different cell lineages reported, each cell characteristic of the original EF cells (Figure 16) was tentatively labeled as shown above the photograph. Cells that were clearly different from the original EF cells but could not be assigned a specific cell type name were labeled as "unclassified." The white bars in the panel indicate a size reference of 100 μm.

[0095] The cell clusters resembled immature adipocytes, and these cells transformed into mature adipocytes within a few days (Figures 17A-17B). These cells were sun-stained with the lipid-specific dye, Oil Red O (Figures 17C-17E).

[0096] Brown adipocytes (Figure 17A) and white adipocytes (Figure 17B) were frequently observed throughout the 10-day culture. To characterize them as adipocytes, the cells were stained with oil red O (Figures 17C–17E).

[0097] On the other hand, staining with alizarin revealed calcium deposition and osteoblasts in specific areas of the culture (Figures 18A-18C).

[0098] The presence of osteoblasts / osteocytes was indicated by alizarin staining, as shown in Figures 18A to 188C.

[0099] We observed nerve cell-like cells (Figures 19A-19D) and endothelial cell-like cells (Figure 20) with a size of 100-500 μm.

[0100] In many cases, nerve cells, including cortical neuron-like cells (Figure 19A), astrocyte-like cells (Figure 19B), microglia-like cells (Figure 19C), and oligodendrocyte-like cells (Figure 19D), were observed within 10 days. Endothelial cell-like cells connected by a circle were also observed at the same time (Figure 20).

[0101] Similar phenotypic cells tended to cluster in specific regions of the basal surface (Figures 21A–21F).

[0102] Figures 21A to 2F show colonies of similar phenotypic cells differentiated from mouse EF cells treated with MβCD and hydrogel.

[0103] After three weeks, well-developed nerve cell clusters (Figures 22A-22C) and independently aggregated unclassified cell clusters became prominent (Figure 23). Fully mature adipocyte aggregates were also clearly visible (Figure 24). After four weeks, myoblast-like cells (Figure 25) and tendinocyte / progenitor cell-like cells became prominent (Figures 26A-26B). Furthermore, after four weeks of culture, cell chain interactions were observed to construct ultrastructures (Figures 27A-27E).

[0104] Five examples of cells that interacted and formed alignment are shown.

[0105] Therefore, the results suggest that pluripotent stem cell-like cells derived from EF cells actively differentiated into various cell lineages in vitro.

[0106] As shown in Figure 9, spheres were recovered from the surface of a 3.2 kPa acrylamide gel by trypsin treatment. The cells were washed and re-seed on the surface of polystyrene in a 24-well tissue culture plate.

[0107] While hydrogels alone can activate the PI gene in EF to generate stem cell-like cells, the efficiency is low, and a long incubation period is required before the reprogrammed and differentiated cells begin to proliferate at the bottom of the petri dish.

[0108] Treatment with MβCD alone induces stem cell-like cells within one week with higher efficiency than treatment with hydrogel alone.

[0109] In the combined treatment with MβCD and hydrogel, the most efficient development of differentiated cells occurred at the bottom of the petri dish.

[0110] The examples presented above suggest that the present invention can reprogram somatic cells into pluripotent stem cell-like cells that retain the ability to differentiate into various phenotypic cells with different functions. The discovery is that MSAIC signaling suppresses PI gene expression, and inhibition of MSAIC signaling allows somatic cells to express the PI gene and acquire pluripotency. The discovery taught several methods to attenuate MSAIC signaling in somatic cells: cholesterol depletion using specific inhibitors, GsMTX4, soft polyacrylamide gel, and MβCD. All methods can activate the PI gene and reprogram somatic cells. The discovery also taught that combining different methods enhances somatic cell reprogramming. The discovery also taught that the redifferentiation of pluripotent stem cell-like cells generates a large repertoire of somatic cells. All of these differentiated cells are expected to be useful in regenerative therapy. Among them, for example, osteocytes are useful for reconstructing fractures, and nerve cells are expected to restore nerve damage and brain diseases, Parkinson's disease, and Alzheimer's disease. Based on these embodiments, the present invention is also expected to provide novel methods for treating diseases that enhance or suppress cell regeneration. The present invention will broadly encompass the use of PS-like cells and redifferentiated cells for the treatment or prevention of diseases in which the enhancement of the presence of certain types of somatic cells is desirable.

[0111] It should be understood that the present invention is not limited to the embodiments described above, and that rights are reserved to the exemplary embodiments and all modifications that fall within the scope of the following claims.

[0112] Various references to journals, patents, and other publications cited herein are incorporated by referencing them as if they were fully described, including the most advanced technology. In certain embodiments, for example, the following are provided: (Item 1) A method for inducing non-pluripotent mammalian cells into induced pluripotent stem cells, wherein the non-pluripotent mammalian cells are as follows: a. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit the ion channels of the mammalian cells; b. One or more cellular cholesterol-reducing agents in an amount sufficient to reduce the cholesterol levels of the mammalian cells; c. Soft extracellular matrix with a Young's modulus of 20 kPa or less A method that involves bringing two or more of them into contact. (Item 2) The method according to item 1, wherein the non-pluripotent mammalian cells are not genetically modified to express pluripotency-inducing factors. (Item 3) The method according to item 1, wherein the mechanosensitive stretch-activated ion channel inhibitor is selected from the group consisting of the L-enantiomer of GsMTX4, the D-enantiomer of GsMTX4, a peptide having a sequence that is at least 90% identical to the sequence of GsMTX4, or a mixture thereof. (Item 4) The method according to item 1, wherein the mechanosensitive stretch-activated ion channel inhibitor is GsMTX4. (Item 5) The method according to item 3, wherein the mechanosensitive extension-activated ion channel inhibitor is present at a concentration of approximately 5 μM. (Item 6) The method according to item 1, wherein the cellular cholesterol-reducing agent is cyclodextrin. (Item 7) The method according to item 6, wherein the cyclodextrin is methyl-β-cyclodextrin. (Item 8) The method according to item 7, wherein the cyclodextrin is at a concentration of approximately 5 mM. (Item 9) The method according to item 1, wherein the extracellular matrix has a Young's modulus of about 15 kPa or less. (Item 10) The method according to item 1, wherein the extracellular matrix has a Young's modulus of approximately 7.4 kPa or less. (Item 11) The method according to item 1, wherein the induced pluripotent stem cells can differentiate into cell types selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts. (Item 12) The method according to item 1, wherein the expression of one or more of the genes Oct4, Nanog, and Sox2 is induced in the induced pluripotent stem cells compared to the non-pluripotent mammalian cells. (Item 13) A pharmaceutical composition comprising an isolated population of cells having a second non-pluripotent cell type, wherein the cells are obtained by a composition that converts animal cells from a first non-pluripotent cell type, and the composition is a. The non-pluripotent mammalian cells are: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit the ion channels of the mammalian cells; ii. One or more cellular cholesterol-reducing agents in an amount sufficient to reduce the cholesterol levels of the mammalian cells; iii. Soft extracellular matrix with a Young's modulus of 20 kPa or less To bring into contact with two or more of them, and b. Inducing differentiation of the cells from step (a) into the second non-pluripotent cell type. A pharmaceutical composition comprising inducing non-pluripotent mammalian cells of a first cell type into induced pluripotent stem cells. (Item 14) a. Cell culture medium, b. Below: i. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit ion channels in mammalian cells; ii. One or more cellular cholesterol reducing agents in an amount sufficient to reduce the cholesterol levels of the mammalian cells. One or more of the mammalian cells treated with one or both of the following; and c. Soft extracellular matrix with a Young's modulus of 20 kPa or less A cell culture vessel containing a cell culture vessel.

Claims

1. A method for inducing non-pluripotent mammalian cells into pluripotent stem cells, wherein the non-pluripotent mammalian cells are: a. One or more mechanosensitive stretch-activated ion channel inhibitors in an amount sufficient to inhibit the ion channels of the non-pluripotent mammalian cells, wherein the mechanosensitive stretch-activated ion channel inhibitor is a peptide having a sequence that is at least 90% homologous to the amino acid sequence of GsMTX4, wherein the amino acid sequence of GsMTX4 is GCLEFWWKCNPNDDKCCRPKLKCSKLFKLCNFSF; b. One or more cyclodextrins in an amount sufficient to reduce cholesterol levels in the non-pluripotent mammalian cells; or c. Soft extracellular matrix with a Young's modulus of 20 kPa or less A method comprising bringing into contact with at least one species from each of two or more groups selected from there.

2. The method according to claim 1, wherein the non-pluripotent mammalian cells are not genetically modified to express pluripotency-inducing factors.

3. The method according to claim 1, wherein the mechanosensitive extension-activated ion channel inhibitor is GsMTX4.

4. The method according to claim 3, wherein the GsMTX4 is the L-enantiomer of GsMTX4, the D-enantiomer of GsMTX4, or a mixture thereof.

5. The method according to claim 4, wherein the mechanosensitive stretch-activated ion channel inhibitor is present at a concentration of about 5 μM.

6. The method according to claim 1, wherein the cyclodextrin is selected from one or more of methyl-β-cyclodextrin, hydroxypropyl-α-cyclodextrin, or hydroxypropyl-β-cyclodextrin.

7. The method according to claim 6, wherein the cyclodextrin is methyl-β-cyclodextrin.

8. The method according to claim 7, wherein the cyclodextrin is present at a concentration of about 5 mM.

9. The method according to claim 1, wherein the extracellular matrix has a Young's modulus of about 15 kPa or less.

10. The method according to claim 1, wherein the extracellular matrix has a Young's modulus of about 7.4 kPa or less.

11. The method according to claim 1, wherein the pluripotent stem cells can differentiate into cell types selected from the group consisting of adipocytes, nerve cells, osteocytes, endothelial cells, erythrocytes, dendritic cells, platelets, lymphocytes, and myoblasts.

12. The method according to claim 1, wherein the expression of one or more of the genes Oct4, Nanog, and Sox2 is induced in the pluripotent stem cells compared to the non-pluripotent mammalian cells.

Images