Kit for collecting bodily fluid samples
The use of a permeable sheet-enclosed carrier for bodily fluid samples addresses the challenges of contamination and scatter in existing methods, ensuring efficient and accurate collection and detection of target substances.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- SHINO TEST CORP
- Filing Date
- 2025-03-03
- Publication Date
- 2026-05-25
Smart Images

Figure 0007864383000006 
Figure 0007864383000007 
Figure 0007864383000008
Abstract
Description
Technical Field
[0001] The present invention relates to articles for collecting body fluid samples, kits containing the same, and methods for detecting target substances in body fluids.
Background Art
[0002] As a method for examining the health condition and disease state of a subject, a method of examining body fluid samples such as urine and blood is known. For example, as a method for evaluating the renal function of a subject, a method of measuring creatinine, urea nitrogen, and total protein in urine is known, and as a method for examining the possibility of diabetes, hyperthyroidism, and renal glycosuria in a subject, a method of measuring the sugar concentration in urine is known. In recent years, there has been a demand for a method for simply and quickly examining whether a patient is infected with a pathogenic microorganism. For example, in neonates, for early detection of congenital diseases, the presence or absence of congenital metabolic disorders is widely examined by neonatal screening, and the presence or absence of hearing impairment is widely examined by neonatal hearing screening. In addition to these, there is also a growing demand for the implementation of neonatal screening tests for congenital cytomegalovirus (CMV) infection. CMV can cause fetal infection and may leave sequelae such as hearing loss and developmental disorders of the mind and movement. Currently, it is said that there are about 3,000 congenital CMV-infected infants in Japan every year, and it has been reported that for symptomatic congenital CMV-infected infants, early administration of antiviral drugs can reduce hearing loss and mental retardation, etc. Therefore, it is desired to detect congenital CMV-infected infants early. In addition, since it becomes difficult to distinguish between congenital and acquired CMV infections after 3 weeks of age, when congenital infection is suspected, it is required to collect urine within 3 weeks after birth and perform an examination. Also, as detection methods, there are virus culture identification methods and nucleic acid amplification detection tests, but nucleic acid amplification detection tests are frequently used in terms of their speed, simplicity, accuracy, etc. As a nucleic acid amplification detection test, a method has been proposed in which a slit is made in the surface sheet on the side of a disposable diaper that comes into contact with the skin, and filter paper is placed between the surface sheet and the absorbent material. The diaper is then used on an infant to collect urine, and the DNA in the urine collected on the filter paper is quantified (Patent Document 1: JP 2008-99622). [Prior art documents] [Patent Documents]
[0003] [Patent Document 1] Japanese Patent Publication No. 2008-99622 [Overview of the Initiative] [Problems that the invention aims to solve]
[0004] Screening tests, especially large-scale screening tests, involve handling a large number of samples, requiring the easy collection of bodily fluid samples from individual subjects. However, these numerous samples include both positive and negative samples for the target substance, making it essential to easily prevent contamination from positive to negative samples. In particular, in qualitative tests using highly sensitive methods such as PCR, even slight contamination can alter the results, making prevention of contamination extremely important. In particular, directly collecting urine from newborns is a difficult and time-consuming task, which is one of the reasons why newborn screening tests for congenital CMV infection are not widely implemented. Therefore, there is a need for items and methods to simplify the process of collecting urine from newborns. In this regard, the method described in Patent Document 1 involves making an incision in the surface sheet on the side of the disposable diaper that comes into contact with the skin, and inserting filter paper between the surface sheet and the absorbent material (paragraph
[0033] ). However, performing such work on the diapers of a large number of subjects is difficult and extremely time-consuming. Furthermore, in the method described in Patent Document 1, it is necessary to punch out a 3 mm diameter disc from the filter paper in order to place the filter paper coated with the sample into a PCR tube (paragraph
[0037] ). However, contamination from positive samples to negative samples, so-called carryover, can occur through the punching device (puncher). In this case, the negative sample will be a false positive. To prevent this contamination, the puncher needs to be cleaned each time a filter paper is punched, but it is not practical to perform this work every time a large number of test samples are examined. On the other hand, the inventors devised a method to prevent contamination via the puncher by punching out the filter paper with a puncher before bringing it into contact with the sample, and then attaching the punched-out pieces to the diaper. However, they found that this method created a new problem: the filter paper would scatter within the diaper. In this situation, there is a need for a body fluid sample collection item that (i) allows for easy collection of body fluid samples from subjects, (ii) easily prevents contamination of positive samples from negative samples between multiple samples, and / or (iii) prevents carriers for detecting target substances in body fluid samples from scattering in sanitary products such as diapers. [Means for solving the problem]
[0005] The inventors of the present invention conducted intensive research to solve the above problems and found that at least one of the above problems (i) to (iii) can be solved by using an article in which a carrier for detecting a target substance in a bodily fluid sample is enclosed in a permeable sheet, thus completing the present invention. In other words, the present invention is as follows:
[0006] [1] A collection item for body fluid samples, comprising a target substance-adhering carrier for detecting a target substance in a body fluid sample, enclosed in a permeable sheet. [2] The article according to [1] above, wherein the target substance adhering carrier is a paper carrier, a cloth carrier, or polymer beads. [3] The article according to [1] or [2] above, wherein the body fluid sample is a sample containing a body fluid selected from the group consisting of urine, saliva, blood, amniotic fluid, breast milk and exudate. [4] A device for collecting bodily fluid samples, including the articles and packaging described in any of [1] to [3] above. [5] A kit for collecting bodily fluid samples, including the items and packaging described in any of [1] to [3] above. [6] The kit for collecting bodily fluid samples as described in [5] above, further including a drying case. [7] An absorbent sanitary product comprising any of the articles described in [1] to [3] above or the collection device described in [4] above. [8] A method for detecting a target substance in a bodily fluid, comprising the following steps: (a) A step of preparing a carrier for target substance adhesion, (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet, (c) A step of bringing into contact with a bodily fluid sample an article obtained in step (b), in which the target substance-adhering carrier is enclosed in a permeable sheet. (d) Steps for detecting the target substance attached to the carrier. [9] A collection item for body fluid samples, comprising a nucleic acid-adhering carrier for detecting target nucleic acids in body fluid samples, enclosed in a permeable sheet.
[10] The article according to [9] above, wherein the nucleic acid-adhering carrier is a paper carrier, a cloth carrier, or polymer beads.
[11] The article according to [9] or
[10] above, wherein the target nucleic acid is derived from a microorganism.
[12] The article described in
[11] above, wherein the microorganism is a virus, a bacterium, or a protozoan.
[13] The article described in
[12] above, wherein the virus is a herpesvirus.
[14] The article according to any one of [9] to
[13] above, wherein the body fluid sample is a sample containing a body fluid selected from the group consisting of urine, saliva, blood, amniotic fluid, breast milk and exudate.
[15] A device for collecting bodily fluid samples, including the articles and packaging described in any of [9] to
[14] above.
[16] A kit for collecting bodily fluid samples, including the items and packaging described in any of [9] to
[14] above.
[17] The kit for collecting bodily fluid samples as described in
[16] above, further including a drying case.
[18] An absorbent sanitary product comprising any of the articles described in [9] to
[14] above or the collection device described in
[15] above.
[19] A method for detecting a target nucleic acid in a bodily fluid, comprising the following steps: (a) Steps to prepare a nucleic acid-adhering carrier, (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet, (c) A step of bringing into contact with a bodily fluid sample an article obtained in step (b), in which the nucleic acid-adhering carrier is enclosed in a permeable sheet. (d) A step of removing a nucleic acid-adhering carrier from the article that has come into contact with a bodily fluid sample, and (e) A process in which the nucleic acid-adhering carrier removed in step (d) is placed in a nucleic acid amplification container and the target nucleic acid is detected by a nucleic acid amplification reaction.
[20] The method according to
[19] , further comprising step (a) of processing the nucleic acid-adhering carrier into a form that can be stored in a nucleic acid amplification container.
[21] The method according to
[19] or
[20] , wherein step (c) further comprises placing the article into an absorbent sanitary product. [Effects of the Invention]
[0007] Compared to the prior art, the present invention allows for the easy collection of bodily fluid samples from subjects, the easy prevention of contamination of negative samples from positive samples, and / or the prevention of the carrier for detecting target substances in bodily fluid samples from scattering in absorbent hygiene products such as diapers. [Brief explanation of the drawing]
[0008] [Figure 1] It is a perspective view showing an example of an article for collecting a body fluid sample of the present invention. [Figure 2] It is a perspective view showing an example of an article for collecting a body fluid sample of the present invention. [Figure 3] It is a diagram showing the result of detecting the target nucleic acid of CMV in a sample containing a carrier contacted with a CMV-containing sample. [Figure 4] It is a diagram showing that contamination from a positive sample to a negative sample occurs through equipment for processing filter paper or the like, and as a result, false positives can occur even in negative samples. [Figure 5] It is a perspective view showing an example of an article for collecting a body fluid sample of the present invention. [Figure 6] It is a diagram showing an example of a device for collecting a body fluid sample, including an article for collecting a body fluid sample of the present invention and an outer package. a: It is a diagram showing a state where an article for collecting a body fluid sample is installed on the surface of the outer package. b: It is a diagram showing a state where the article for collecting a body fluid sample is covered with the outer package. [Figure 7] It is a diagram showing the result of detecting creatinine (CRE) in an extract from an organic compound-attaching carrier. [Figure 8] It is a diagram showing the result of detecting urea nitrogen (UN) in an extract from an organic compound-attaching carrier.
Embodiments for Carrying Out the Invention
[0009] [[ID=3l]]Hereinafter, the present invention will be described in detail. The following embodiments are examples for explaining the present invention, and the present invention is not intended to be limited only to these embodiments. The present invention can be implemented in various forms without departing from its gist. Further, this specification includes the contents described in the specification and drawings of the Japanese Patent Application (Japanese Patent Application No. 2019-215227) filed on November 28, 2019, which is the basis for claiming the priority of the present application.
[0010] 1. overview In screening tests, especially large-scale screening tests, it is necessary to rapidly test a large number of samples, requiring the easy collection of bodily fluid samples from individual subjects. However, since these numerous samples include both positive and negative samples for the target substance, it is necessary to easily prevent contamination from positive samples to negative samples. In particular, in qualitative tests using highly sensitive methods such as PCR, even slight contamination can alter the test result, so preventing this is strongly required. In particular, directly collecting urine from newborns is an extremely time-consuming task, so there is a need for items and methods to simplify the process of collecting newborn urine. In this regard, the method described in Patent Document 1 (JP 2008-99622) involves making an incision in the surface sheet on the side of the disposable diaper that comes into contact with the skin, and inserting filter paper between the surface sheet and the absorbent material (paragraph
[0033] ). However, performing such work on the diapers of a large number of subjects is not easy and is extremely time-consuming. Furthermore, in the method described in Patent Document 1, it is necessary to punch out a 3 mm diameter disc from the filter paper coated with the sample in order to place it into a PCR tube (paragraph
[0037] ). However, contamination from positive samples to negative samples can occur through the punching equipment (puncher). In this case, the negative sample will be a false positive. To prevent this contamination, the puncher needs to be cleaned each time a filter paper is punched, but it is not practical to perform this work on a large number of test samples. In response to this, the inventors devised a method to prevent contamination via the puncher by punching out the filter paper with a puncher before bringing it into contact with the sample, and then attaching the punched-out pieces to the diaper. However, it was found that in this case, the filter paper would scatter in the diaper, potentially resulting in the filter paper entering the subject's body or moving to locations other than those suitable for sample collection, thus making it difficult to collect bodily fluid samples properly. These are new problems identified by the inventors. As a result of diligent research to solve the above problems, the present inventors have found that by using an article in which a carrier for detecting a target substance in a bodily fluid sample is enclosed in a permeable sheet, (i) bodily fluid samples can be easily collected from subjects, (ii) contamination of positive samples to negative samples between multiple samples can be easily prevented, and / or (iii) the carrier for detecting a target substance in a bodily fluid sample can be prevented from scattering in sanitary products such as diapers. This invention was made based on these findings.
[0011] 2. target substance In the present invention, "target substance" means a substance contained in bodily fluids that is subject to detection or quantification. In the present invention, any substance that can adhere to the target substance-adhering carrier of the present invention can be a target substance because it can be detected. That is, in the present invention, the target substance is not limited to any substance that can adhere to the target substance-adhering carrier of the present invention, and examples include nucleic acids, proteins, organic compounds, sugars, inorganic compounds, and cellular components, and preferably nucleic acids, proteins, organic compounds, sugars, and inorganic compounds.
[0012] In the present invention, "target nucleic acid" refers to a nucleic acid that is to be amplified, detected, or quantified. The target nucleic acid can be appropriately selected depending on the purpose of detection or quantification, but it is preferably DNA or RNA derived from a microorganism. DNA includes whole DNA, cDNA, genomic DNA, and synthetic DNA. RNA includes mRNA, rRNA, genomic RNA, and synthetic RNA (the microorganism from which the target nucleic acid originates will be described later in "3.(2) Nucleic Acid Adhering Carrier"). In the present invention, the target nucleic acid can be detected or quantified using a known nucleic acid amplification method such as PCR.
[0013] In the present invention, "target protein" refers to a protein that is to be detected or quantified. In the present invention, the target protein is not limited to any protein that can adhere to the target substance-adhering carrier of the present invention, and examples include total protein (TP), albumin, and hemoglobin in a body fluid sample. In the present invention, the target protein can be detected or quantified using known reaction reagents, test strips, measuring instruments, etc.
[0014] In the present invention, "target organic compound" refers to an organic compound other than target nucleic acids and target sugars, which is an organic compound that is subject to detection or quantification. Target organic compounds include protein metabolites. In the present invention, the target organic compound is not limited to those that can adhere to the target substance-adhering carrier of the present invention, and examples include creatinine (Cr), urea (urea nitrogen (UN)), uric acid (UA), bilirubin, ketone bodies, urobilinogen, amino acids, and acylcarnitine.
[0015] In the present invention, "target sugars" refers to sugars that are to be detected or quantified. In the present invention, target sugars are not limited to those that can adhere to the target substance-adhering carrier of the present invention, and examples include sugars (glucose (Glu)).
[0016] In the present invention, "target inorganic compound" refers to an inorganic compound that is to be detected or quantified. The target inorganic compound (including ions) is not limited to those that can adhere to the target substance-adhering carrier of the present invention, and examples include hydrogen ions (pH), nitrites, ammonia, sodium, potassium, chlorine, calcium, inorganic phosphorus, iron, magnesium, and the like.
[0017] In the present invention, the target organic compound, target sugars, and target inorganic compound can be detected or quantified using known reaction reagents, test strips, measuring instruments, etc.
[0018] In the present invention, "target cell component" refers to a cell or component thereof that is to be detected or quantified. In the present invention, the target cell component is not limited to those that can adhere to the target substance-adhering carrier of the present invention, and examples include red blood cells and white blood cells. In the present invention, target cell components can be detected or quantified using known test strips, measuring instruments, etc.
[0019] In the present invention, when the body fluid sample is a urine sample, the target substance is not limited to, but includes, for example, nucleic acids, total protein (TP), albumin, creatinine (Cr), urea (urea nitrogen (UN)), uric acid (UA), bilirubin, ketone bodies, urobilinogen, sugar, hydrogen ions (pH), nitrites, hemoglobin, red blood cells, white blood cells, and the like.
[0020] In the present invention, when the bodily fluid sample is a blood sample, the target substance is not limited to, but includes, for example, nucleic acids, amino acids, acylcarnitines, and the like.
[0021] In the present invention, when the bodily fluid sample is saliva, amniotic fluid, exudate, or other bodily fluid sample, the target substance may be, for example, nucleic acid. In the present invention, when the bodily fluid sample is a breast milk sample, the target substance may be, for example, nucleic acids. Specific examples of "nucleic acids," which were used as examples of target substances above, will be discussed later in "3.(2) Nucleic Acid Adhering Carriers."
[0022] 3. Target substance adhesive carrier (1) Target substance adhesive carrier In the present invention, "target substance adhering carrier" (hereinafter also referred to as "carrier") means a carrier having the property of being able to which a target substance can adhere. In the present invention, the target substance adhering carrier is not limited as long as it is able to which a target substance can adhere, and examples of such carriers include paper carriers, cloth carriers, polymer beads, etc. Examples of paper carriers include filter paper and various test papers, and examples of cloth carriers include filter cloth, but the invention is not limited to these. In the present invention, "test paper" refers to paper that changes color when it comes into contact with a target substance, compared to test paper before contact with the target substance or test paper that has not come into contact with the target substance. Commercially available test papers can be used, and those skilled in the art can appropriately select them according to the type of target substance. For example, if the target substance is sugar in urine, a urine sugar test paper can be selected, and if the target substance is protein in urine, a urine protein test paper can be selected. Furthermore, as a target substance-adhering carrier, a test paper that can detect various target substances at once, such as sugar, protein, albumin, creatinine (Cr), hydrogen ions (pH), hemoglobin, red blood cells, ketone bodies, bilirubin, urobilinogen, nitrite, and white blood cells, can be used. Moreover, the portion of the test paper corresponding to various target substances can be cut out from such a test paper, and the cut-out test paper can be used as a target substance-adhering carrier. In the present invention, examples of test strips include, but are not limited to, those for detecting sugar, protein, albumin, creatinine, pH, occult blood, ketones, bilirubin, urobilinogen, nitrite, and leukocytes.
[0023] In the present invention, the target substance-adhering carrier is used to detect the target substance in a bodily fluid sample. In the present invention, "body fluid sample" refers to a sample containing body fluids of a living organism. Examples of "body fluids" include urine, saliva, amniotic fluid, breast milk, blood (whole blood, serum, plasma), exudate, cerebrospinal fluid, synovial fluid, ascites, pleural fluid, ear discharge, nasal discharge, pus, bile, sputum, sweat, and other pulverized cells or tissues. Preferably, the body fluid is selected from the group consisting of urine, saliva, amniotic fluid, breast milk, whole blood, and exudate, and more preferably from the group consisting of urine, saliva, amniotic fluid, breast milk, and exudate. Here, exudate refers to body fluid that seeps out from a wound or lesion site (for example, a syphilitic lesion site). Body fluid samples may also contain cells. In the present invention, living organisms include individual animals, animal tissues, and animal cells (including cultured cells). Examples of animals include humans, mice, rats, horses, dogs, sheep, rabbits, cows, pigs, rhesus monkeys, common marmosets, and chickens, but humans, mice, and rats are preferred, and humans are even more preferred.
[0024] Furthermore, in the case of human-derived bodily fluid samples, the age of the subject (including months and days) is not limited and can be appropriately selected from the fetal period to 120 years of age depending on the purpose of detection. For example, when diagnosing or detecting congenital cytomegalovirus infection, the range is selected from the fetal period to within 21 days after birth. In the case of acquired cytomegalovirus infection, it is required to detect the virus approximately one month after birth in infants for whom congenital cytomegalovirus infection has been ruled out. When detecting or diagnosing cytomegalovirus infection in immunocompromised individuals, there is no age limit.
[0025] In the present invention, the form of the target substance-adhering carrier can be arbitrarily selected depending on the method for detecting the target substance. For example, in a method for detecting sugar in urine, when urine glucose test paper is used as the target substance-adhering carrier, the form of the target substance-adhering carrier is not limited as long as it is a form (shape, size) that can be enclosed in the permeable sheet of the present invention. Also, in a method for detecting organic compounds in urine using a reaction reagent, when filter paper is used as the target substance-adhering carrier, the form of the target substance-adhering carrier is not limited as long as it is a form that can be used to test the reaction of the target substance with the reagent. For example, such a form can be stored in a reaction container (e.g., shape, size). In the present invention, "reaction vessel" refers to a conventional container used for the reaction between a target substance and a reagent, such as tubes, vials, and plates commonly used in experiments. Since the pore size of these reaction vessels is usually 20 mm or less, a form that can be stored in the reaction vessel is preferably one with a longest side or diameter of approximately 20.0 mm or less. Furthermore, from the viewpoint of operability, a form that can be stored in the reaction vessel is preferably one with a longest side or diameter of approximately 0.1 mm or more. In other words, in the present invention, the form that can be stored in the reaction vessel is one in which the longest side or diameter is, for example, about 0.1 to 20.0 mm, about 0.1 to 15.0 mm, about 0.1 to 10.0 mm, about 0.1 to 8.0 mm, about 0.1 to 7.0 mm, about 0.1 to 6.0 mm, about 0.1 to 5.0 mm, about 0.5 to 20.0 mm, about 0.5 to 15.0 mm, about 0.5 to 10.0 mm, about 0.5 to 8.0 mm, about 0.5 to 7.0 mm, about 0.5 to 6.0 mm, about 0.5 to 5.0 mm, about 1.0 to 20.0 mm, about 1.0 to 15.0 mm, about 1.0 to 10.0 mm, about 1.0 to 8.0 mm, about 1.0 to 7.0 mm, about 1.0 to 6.0 mm, about 1.0 to 5.0 mm Examples of morphologies include those with dimensions of mm, approximately 1.0-4.0 mm, approximately 2.0-10.0 mm, approximately 2.0-8.0 mm, approximately 2.0-7.0 mm, approximately 2.0-6.0 mm, approximately 2.0-5.0 mm, approximately 2.0-4.0 mm, or approximately 3.0-4.0 mm. In the present invention, the "form" that can be stored in the reaction vessel is not limited as long as it is a form that can be placed in the reaction vessel and the lid of the vessel can be closed. Examples include disc-shaped, plate-shaped, spherical, cubic, and rectangular parallelepiped shapes. In the present invention, the reaction vessel includes a nucleic acid amplification vessel.
[0026] In the present invention, the target substance-adhering carrier does not need to be processed from its material (paper, cloth, etc.) as long as it is in a form that can be used for detection tests of the target substance. On the other hand, if necessary, the material of the target substance-adhering carrier can be processed into a form that can be used for detection tests of the target substance. In the present invention, "processing" means modifying a material to form a desired shape. In the target substance adhesive carrier of the present invention, processing is not limited to cutting, dyeing, cutting, punching (e.g., punching), crushing, drying, bonding, welding, decoration, etc. If the target substance adhesive carrier of the present invention is test paper, the test paper can be cut into a form that can be enclosed in the permeable sheet of the present invention. Furthermore, if the test paper is capable of detecting various target substances (test items) at once, such as sugar, protein, albumin, creatinine (Cr), hydrogen ions (pH), hemoglobin, red blood cells, ketone bodies, bilirubin, urobilinogen, nitrite, and white blood cells, the portion of the test paper corresponding to each target substance can be cut out from this test paper, and the cut-out test paper can be used as a target substance adhesive carrier. Here, multiple cut-out test papers can be used for each target substance. Furthermore, if the target substance adhesive carrier of the present invention is filter paper, for example, the filter paper can be dyed with any dye.
[0027] As described above, the target substances of the present invention include, for example, nucleic acids, proteins, organic compounds, sugars, inorganic compounds, and cellular components. Therefore, examples of target substance-adhering carriers of the present invention include nucleic acid-adhering carriers, protein-adhering carriers, organic compound-adhering carriers, sugar-adhering carriers, inorganic compound-adhering carriers, and cellular component-adhering carriers.
[0028] (2) nucleic acid adhesion carriers In the present invention, when the target substance is a nucleic acid, a nucleic acid-adhering carrier can be used as the target substance-adhering carrier. In the present invention, "nucleic acid-adhering carrier" means a carrier having the property of being able to to which nucleic acids can adhere. In the present invention, the nucleic acid-adhering carrier is not limited to any carrier to which nucleic acids can adhere, and such carriers include paper carriers, cloth carriers, polymer beads, etc. Examples of paper carriers include filter paper, and examples of cloth carriers include filter cloth, but the invention is not limited to these.
[0029] In the present invention, the form of the nucleic acid-adhering carrier is not limited as long as it is a form that can be used in nucleic acid amplification reactions. For example, such a form can be stored in a nucleic acid amplification container (e.g., shape, size). In the present invention, "nucleic acid amplification container" refers to a conventional container used in nucleic acid amplification reactions, such as tubes, vials, and plates used in nucleic acid amplification reactions. Since the pore size of these nucleic acid amplification containers is usually 20 mm or less, a form that can be stored in a nucleic acid amplification container is preferably one in which the longest side or diameter is approximately 20.0 mm or less. Furthermore, from the viewpoint of operability, a form that can be stored in a nucleic acid amplification container is preferably one in which the longest side or diameter is approximately 0.1 mm or more. In other words, in the present invention, the form that can be stored in a nucleic acid amplification container is one in which the longest side or diameter is, for example, about 0.1 to 20.0 mm, about 0.1 to 15.0 mm, about 0.1 to 10.0 mm, about 0.1 to 8.0 mm, about 0.1 to 7.0 mm, about 0.1 to 6.0 mm, about 0.1 to 5.0 mm, about 0.5 to 20.0 mm, about 0.5 to 15.0 mm, about 0.5 to 10.0 mm, about 0.5 to 8.0 mm, about 0.5 to 7.0 mm, about 0.5 to 6.0 mm, about 0.5 to 5.0 mm, about 1.0 to 20.0 mm, about 1.0 to 15.0 mm, about 1.0 to 10.0 mm, about 1.0 to 8.0 mm, about 1.0 to 7.0 mm, about 1.0 to 6.0 mm, about 1.0 to 5.0 mm Examples of morphologies include those with dimensions of mm, approximately 1.0-4.0 mm, approximately 2.0-10.0 mm, approximately 2.0-8.0 mm, approximately 2.0-7.0 mm, approximately 2.0-6.0 mm, approximately 2.0-5.0 mm, approximately 2.0-4.0 mm, or approximately 3.0-4.0 mm. In the present invention, the "form" that can be stored in a nucleic acid amplification container is not limited as long as it is a form that can be placed in a nucleic acid amplification container and the lid of the container can be closed. Examples include disc-shaped, plate-shaped, spherical, cubic, and rectangular parallelepiped shapes.
[0030] In the present invention, the nucleic acid-adhering carrier does not need to be processed (paper, cloth, etc.) as long as it is in a form that can be used in nucleic acid amplification reactions. On the other hand, if necessary, the nucleic acid-adhering carrier material can be processed into a form that can be used in nucleic acid amplification reactions. In the present invention, "processing" means modifying a material to form a desired shape. In the nucleic acid-adhering carrier of the present invention, processing is not limited to cutting, dyeing, cutting (e.g., punching), crushing, drying, bonding, welding, decoration, etc. If the nucleic acid-adhering carrier of the present invention is filter paper, for example, the filter paper can be dyed with any dye.
[0031] In the present invention, when the target substance is nucleic acid, examples of target nucleic acids include nucleic acids derived from microorganisms (microbial nucleic acids). The microorganism from which the target nucleic acid is derived is not limited to those that have a nucleic acid genome, but pathogenic microorganisms are preferred. Examples of microorganisms in the present invention include viruses, bacteria, protozoa, fungi, yeasts, slime molds, etc., but viruses, bacteria, or protozoa are preferred. In the present invention, viruses include DNA viruses having DNA as their genome and RNA viruses having RNA as their genome, but DNA viruses are preferred. DNA viruses include double-stranded DNA viruses and single-stranded DNA viruses, but double-stranded DNA viruses are preferred. Examples of double-stranded DNA viruses include herpesviruses, adenoviruses, and poxviruses, but herpesviruses are preferred.
[0032] Herpesviruses are viruses that inhabit animals, and many have been discovered in mammals, birds, amphibians, reptiles, fish, and other animals. As the herpesvirus from which the target nucleic acid of the present invention is derived, human herpesviruses (human herpesviruses) are preferred. Human herpesviruses are not limited to human herpesviruses, and examples include human cytomegalovirus (HCMV), herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VSV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7), and Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8), but human cytomegalovirus (HCMV), herpes simplex virus type 1 (HSV-1), and herpes simplex virus type 2 (HSV-2) are preferred.
[0033] Human herpesviruses are involved in a variety of diseases. HCMV is involved in HCMV infection (e.g., congenital CMV infection), interstitial pneumonia, CMV retinopathy, CMV mononucleosis, and congenital giant cell inclusion body disease. HSV-1 is involved in oral herpes, genital herpes, Kaposi's varicelliform eruption, herpes encephalitis, corneal herpes, and Bell's palsy. HSV-2 is involved in genital herpes, neonatal herpes, myelitis, aseptic meningitis, and acute retinal necrosis. VSV is involved in varicella, herpes zoster, and Ramsay Hunt syndrome. EBV is involved in infectious mononucleosis, chronic active EBV infection, nasopharyngeal carcinoma, Burkitt lymphoma, and EBV-associated gastric cancer. HHV-6 is involved in roseola infantum and encephalitis / encephalopathy. Furthermore, HHV-7 is involved in roseola infantum, while HHV-8 is involved in Kaposi's sarcoma (AIDS-related, classical, and African types), Castleman disease, and malignant B lymphoma.
[0034] Examples of single-stranded DNA viruses include parvovirus (such as adeno-associated virus). RNA viruses include both double-stranded RNA viruses and single-stranded RNA viruses. Examples of single-stranded RNA viruses include rubella virus, Zika virus, retroviruses (RNA oncoviruses, human immunodeficiency virus, human T-cell leukemia virus, etc.), rhabdoviruses (rabies virus, vesicular stomatitis virus, etc.), paramyxoviruses (Sendai virus, mumps virus, measles virus, etc.), orthomyxoviruses (influenza virus, etc.), arenaviruses (lymphocytic choriomeningitis virus, lassa virus, etc.), coronaviruses (SARS (Severe Acute Respiratory Syndrome) virus (SARS-CoV, SARS-CoV-2), MARS (Middle East Respiratory Syndrome) virus (MARS-CoV), etc.), and norovirus.
[0035] Any region of viral DNA or RNA can be selected as the target nucleic acid, but for example, DNA or RNA from a conserved region with few genetic mutations can be selected as the target nucleic acid. In the case of human cytomegalovirus, for example, DNA containing the base sequences of glycoprotein B gene (SEQ ID NO: 1), glycoprotein H gene (SEQ ID NO: 2), and matrix phosphorylated protein pp65 gene (SEQ ID NO: 3) can be selected as the target nucleic acid. This genetic information can be obtained from known genetic information databases (e.g., ENA at the European Bioinformatics Institute (EBI)).
[0036] In this invention, bacteria include both Gram-positive and Gram-negative bacteria. Examples of Gram-positive bacteria include Staphylococcus species such as Staphylococcus aureus, Streptococcus species, Listeria species such as Listeria monocytogenes, Bacillus species such as Bacillus cereus, Mycobacterium species such as Mycobacterium tuberculosis, Mycoplasma species, Clostridium species such as Clostridium botulinum and Clostridium perfringens. In addition, examples of Gram-negative bacteria include bacteria of the Escherichia genus such as Escherichia coli, bacteria of the Citrobacter genus such as Treponema pallidum and Citrobacter koseri, bacteria of the Chlamydia genus such as Chlamydia trachomatis and Chlamydia pneumoniae, bacteria of the Klebsiella genus such as Klebsiella oxytoca, and other enteric bacteria, bacteria of the Vibrio genus such as Vibrio cholerae, bacteria of the Haemophilus genus such as Haemophilus influenzae, bacteria of the Salmonella genus, bacteria of the Proteus genus, bacteria of the Pseudomonas genus, and Neisseria gonorrhoeae.
[0037] In the present invention, examples of protozoa include, but are not limited to, Toxoplasma. Toxoplasma is a protozoan that causes congenital toxoplasmosis.
[0038] In the present invention, examples of microorganisms from which the target nucleic acid originates include pathogenic microorganisms of congenital infectious diseases, and such microorganisms include, but are not limited to, viruses such as herpesvirus, rubella virus, and Zika virus, bacteria such as Treponema pallidum, and protozoa such as Toxoplasma.
[0039] In the present invention, any region of bacterial DNA can be selected as the target nucleic acid. For example, DNA from a region containing a gene that causes disease (pathogenic gene) can be selected as the target nucleic acid. Examples of such pathogenic genes include, but are not limited to, the listeriolisin O(hlyA) gene of Listeria bacteria, the enterotoxin gene and invasion(invA) gene of Salmonella bacteria, the verotoxin gene of pathogenic Escherichia coli O-157, the enterotoxin gene of Staphylococcus aureus, the cereulide (vomiting toxin) gene and enterotoxin gene of Bacillus cereus, and various toxin genes of Clostridium botulinum.
[0040] A person skilled in the art can select any region of microbial DNA or RNA based on known genetic information and gene databases (e.g., NCBI's GenBank) and amplify it by a nucleic acid amplification reaction using a primer capable of amplifying that region. The nucleic acid sequence to be amplified may be the entire length or a portion of the target nucleic acid sequence. For example, in the case of human cytomegalovirus, DNA containing the base sequence of the human cytomegalovirus glycoprotein H gene can be selected as the target nucleic acid, and the target nucleic acid can be amplified by a nucleic acid amplification reaction using oligonucleotide primers capable of amplifying all or part of the target nucleic acid, and then detected or quantified (Eiko Fukushima, et al., Journal of Virological Methods 151 (2008) 55-60). Those skilled in the art can also detect or quantify target nucleic acids from other microorganisms using similar methods.
[0041] The base sequence of the target nucleic acid to be detected or quantified may be either the sense base sequence or the antisense base sequence, for example, in the case of a double-stranded nucleic acid. For example, by detecting or quantifying the antisense nucleic acid sequence, the complementary sense nucleic acid sequence can be detected or quantified.
[0042] (3) Protein-adhering carriers, organic compound-adhering carriers, sugar-adhering carriers, inorganic compound-adhering carriers, cellular component-adhering carriers Protein-adhering carriers, organic compound-adhering carriers, sugar-adhering carriers, inorganic compound-adhering carriers, and cellular component-adhering carriers can be manufactured and used by those skilled in the art based on the description in "(1) Target substance-adhering carriers" above.
[0043] 4. Items for collecting bodily fluid samples The body fluid sample collection article of the present invention comprises a target substance-adhering carrier for detecting a target substance in a body fluid sample, enclosed in a permeable sheet. Furthermore, the body fluid sample collection article of the present invention is an article used to collect body fluid samples derived from a subject. Here, as described above, the target substance-adhering carrier includes nucleic acid-adhering carriers, protein-adhering carriers, organic compound-adhering carriers, sugar-adhering carriers, inorganic compound-adhering carriers, and cellular component-adhering carriers. The collection article of the present invention allows for the easy collection of bodily fluid samples from a subject by placing it near the site where bodily fluids are expelled from the body (e.g., discharged or secreted). A person skilled in the art can appropriately select the position for placing the collection article of the present invention. The collection article of the present invention may be used by placing it on absorbent hygiene products or clothing (underwear, etc.) as described later, or it may be used without placing it on absorbent hygiene products or clothing. When the collection article of the present invention is used by placing it on an absorbent hygiene product and the bodily fluid is urine, a bodily fluid sample can be easily collected from a subject by placing (and fixing if necessary) the collection article of the present invention in an appropriate position on the absorbent hygiene product (e.g., a diaper). This "appropriate position" can be appropriately selected by a person skilled in the art based on known information. When the subject is a newborn boy, an appropriate position for placing the collection article is, for example, slightly forward of the center of the surface sheet (the sheet that touches the skin) of the diaper, but is not limited to this.
[0044] In the bodily fluid sample collection article of the present invention, the target substance-adhering carrier is enclosed in a permeable sheet, so that the carrier does not scatter whether the article is used as is or placed in an absorbent sanitary product. In the present invention, "permeable sheet" refers to a sheet-like material that has the property of permeating liquids. In the present invention, a permeable sheet is not limited to materials that have the property of permeating liquids (e.g., permeability to bodily fluids, water permeability, etc.), and examples include nonwoven fabrics, net-like sheet materials made by plain weaving yarn (e.g., yarn of nylon, polyethylene terephthalate, etc.), film sheet materials with numerous permeable holes, permeable woven fabrics, and paper (e.g., tissue paper). The definition of "bodily fluids" in the present invention is as described in "3. Target substance adhering carrier" above. In this invention, "nonwoven fabric" refers to a material made by joining fibers together without weaving to form a sheet. In this invention, the nonwoven fabric is not limited as long as it has the property of permeating liquids, nor is the material of the nonwoven fabric limited. Examples of such materials include, but are not limited to, cotton, linen, wool, rayon, acetate, nylon, and polyester. In the present invention, "encapsulation" refers to a state in which the target substance-adhering carrier is sealed with a permeable sheet. Here, "sealed state" means a state in which the permeable sheet is processed (e.g., folded, welded, etc.) so that the target substance-adhering carrier does not scatter from the inside of the overlapping permeable sheets (between the sheets) to the outside of the permeable sheet. In the present invention, "sealed state" does not necessarily mean a sealed state. The manner of encapsulation in the present invention is not limited as long as the target substance-adhering carrier is located inside the overlapping permeable sheets (between the overlapping permeable sheets) and does not scatter to the outside of the overlapping permeable sheets. The manner in which the target substance-adhering carrier is sealed with a permeable sheet is not limited and includes, for example, sealing by folding the permeable sheet, sealing by welding with a heat sealer, and sealing by a combination of these. The encapsulation method is not limited to the present invention. For example, in the case of a rectangular permeable sheet, one method is to fold a portion of one permeable sheet, or to heat-seal portions of two permeable sheets together to form an overlap, and then place the target substance-adhering carrier inside the overlapping permeable sheets (in this invention, the welded portion is referred to as the "welded portion"). In this embodiment, it is possible to further close any unclosed portions of the permeable sheet, but it is not necessary to close all unclosed portions as long as the target substance-adhering carrier does not scatter outside the permeable sheet. In another embodiment, for example, one method of encapsulation is to place the target substance-adhering carrier in a permeable sheet processed into a bag shape and then close any unclosed portions. The encapsulation methods of the present invention also include a method in which the target substance-adhering carrier is enclosed within a permeable sheet. Here, "confined state" refers to a state in which the target substance-adhering carrier is located inside the overlapping permeable sheets, and there are no unenclosed areas around the target substance-adhering carrier.
[0045] The number of target substance-adhering carriers to be encapsulated is not limited, as a person skilled in the art can appropriately select them according to the shape and size of the carrier and permeable sheet, the type of target substance, and the purpose of the test. In one aspect of the present invention, for example, if the longest side or diameter of the target substance-adhering carrier is approximately 3 to 10 mm and it is in the shape of a plate or disc, the number of target substance-adhering carriers to be encapsulated is, for example, 3 to 50.
[0046] In one aspect of the present invention, the target substance-adhering carrier is in a state where it is not in contact with the bodily fluid sample before being encapsulated in a permeable sheet.
[0047] In one embodiment of the present invention, the article for collecting bodily fluid samples may have a handle portion for the tester to hold the article (Figures 2 and 5). In the present invention, the handle portion is manufactured so that the target substance-adhering carrier does not enter the handle portion. For example, in the present invention, the handle portion can be manufactured by welding it with a heat sealer at an arbitrary position (for example, about 5 to 30 mm) from the edge of the overlapping permeable sheets (in the present invention, the welded portion is called the welded portion). The position and range of the handle portion are not limited, and those skilled in the art can adjust its position and range as appropriate depending on the need for the handle portion, the size of the article, etc. In the present invention, the number of handle portions is not limited, for example, 0 to 4.
[0048] In one embodiment of the bodily fluid sample collection article of the present invention, the permeable sheet enclosing the target substance-adhering carrier may be layered in multiple layers (for example, two to four layers) to increase the thickness of the permeable sheet layer. That is, one embodiment of the bodily fluid sample collection article of the present invention is a bodily fluid sample collection article in which two to four layers of permeable sheets are layered, but the number of layers and thickness of the permeable sheets are not limited.
[0049] 5. Device for collecting bodily fluid samples The bodily fluid sample collection device of the present invention includes a bodily fluid sample collection article and an outer casing. The outer casing used in the present invention is a part for covering the collection article of the present invention. The manner in which the collection article of the present invention is covered with the outer casing is not limited, and examples include covering the collection article of the present invention with the outer casing by, for example, inserting, wrapping, sandwiching, overlapping, or installing. In the present invention, by using an outer casing, when a device for collecting bodily fluid samples is placed on an absorbent sanitary product, for example, the burden on the subject's skin can be further reduced, contamination of the collection item with feces can be further reduced, and displacement when placed on an absorbent sanitary product such as a diaper can be further reduced. The outer casing is not limited to these, and examples include an outer casing made of a liquid-permeable sheet (e.g., nonwoven fabric), a cotton puff, gauze, etc. One embodiment of the sampling device of the present invention is a sampling device in which a bodily fluid sample collection article of the present invention is covered with an outer casing. An example of a collection device in which the bodily fluid sample collection article of the present invention is covered with an outer casing is shown in Figure 6 (particularly Figure 6b).
[0050] 6. Kit for collecting bodily fluid samples The bodily fluid sample collection kit of the present invention includes a bodily fluid sample collection article and outer packaging. In addition to the bodily fluid sample collection article and outer packaging of the present invention, the bodily fluid sample collection kit of the present invention may further include a case (drying case) for drying the collection article after it has come into contact with the bodily fluid sample (hereinafter also referred to as the "collection article that has come into contact with the bodily fluid sample").
[0051] The bodily fluid sample collection kit of the present invention may, in addition to the bodily fluid sample collection article, outer packaging, and drying case of the present invention, appropriately include additional permeable sheets, absorbent sanitary products, adhesive seals, cutters, tweezers, individual identification tags (e.g., seals, sheets, etc.), delivery materials, instruction manuals, etc., as necessary for collecting bodily fluid samples, as well as as necessary for removing the target substance-adhering carrier from the collection article that has come into contact with the bodily fluid sample, and as necessary for detecting or measuring the target substance.
[0052] In this invention, the drying case is a case that can be used to dry a sample collection item that has come into contact with a bodily fluid sample. By storing the sample collection item that has come into contact with a bodily fluid sample in the drying case, contamination caused by human hands touching the sample collection item during operations such as drying, delivery, opening, and detection testing can be reduced. Furthermore, the sample collection item that has come into contact with a bodily fluid sample can be delivered while still stored in the drying case. In the present invention, the drying case comprises a lid that opens and a body, the lid and body having a plurality of ventilation holes, and a volume section for receiving a sample that has come into contact with a bodily fluid sample. In one aspect of the present invention, at least one of the lid and the body may be provided with an opening hole so that, when a collection article that has come into contact with a bodily fluid sample is stored in a drying case, the stored collection article can be opened from the outside of the drying case. In one embodiment of the present invention, the drying case may have an area for attaching an individual identification tag. The individual identification tag may be an individual identification sticker or sheet. The form of individual identification is not limited, and any form such as a barcode, numbers, or non-numeric characters can be appropriately selected. In one embodiment of the present invention, the drying case may be provided with a window for bonding the collection article, which has come into contact with a bodily fluid sample, to the drying case from the outside when the collection article is stored in the drying case. Any means can be used for bonding, such as sealing or taping. The window can be provided on at least one of the lid and the body of the drying case. Because the drying case of the present invention has the above structure, the tester can open the case without touching the collection article that has come into contact with the bodily fluid sample, and further remove the target substance-adhering carrier from the article. The manner of opening the case will be described later in "10. Method for detecting target substances in bodily fluids".
[0053] In the kit of the present invention, the additional permeable sheet can be used, for example, on top of the bodily fluid sample collection article of the present invention, or it can be used as an outer covering. In the present invention, "absorbent sanitary products" means sanitary products containing absorbent materials, and such sanitary products include, but are not limited to, diapers, masks, and other absorbent pads (urine pads, breast pads, etc.). The articles of the present invention can be used by placing (fixing, if necessary) them on these absorbent sanitary products. The collection kit of the present invention may include multiple types of absorbent sanitary products. That is, the collection kit of the present invention may include at least one absorbent sanitary product selected from the group consisting of diapers, masks, and absorbent pads.
[0054] 7. Absorbent sanitary products equipped with articles or devices for collecting bodily fluid samples. The bodily fluid sample collection article or collection device of the present invention can be used by being placed on an absorbent sanitary product. That is, the present invention provides an absorbent sanitary product equipped with a bodily fluid sample collection article. In the present invention, "equipped with a bodily fluid sample collection article or collection device" means that the bodily fluid sample collection article or collection device is placed in an appropriate position on the absorbent sanitary product for collecting bodily fluid samples. Furthermore, if necessary, the collection article or collection device of the present invention may not only be placed in an appropriate position on the absorbent sanitary product, but may also be fixed, attached, packaged, embedded, inserted, etc., by any known method. Moreover, the "absorbent sanitary product equipped with a bodily fluid sample collection article or collection device" of the present invention includes those in which the bodily fluid sample collection article or collection device and the absorbent sanitary product are manufactured as an integrated unit. In this case, it is possible to collect bodily fluid samples simply by attaching the absorbent sanitary product to the subject, without the need to place the bodily fluid sample collection article or collection device on the absorbent sanitary product. The "absorbent sanitary product" in this invention is as described in "6. Kit for collecting bodily fluid samples" above.
[0055] 8. Method for manufacturing an article in which a target substance-adhering carrier is enclosed in a liquid-permeable sheet. The present invention provides a method for manufacturing an article in which a target substance-adhering carrier is enclosed in a liquid-permeable sheet, comprising the following steps. (a) A step of preparing a target substance-adhering carrier, and (b) A process of processing a permeable sheet to enclose the carrier within the permeable sheet.
[0056] Step (a) is a step of preparing a target substance-adhering carrier. In the present invention, "preparing" means preparing the material for the target substance-adhering carrier (filter paper, test paper, filter cloth, etc.) and, if necessary, processing the material into a form that can be used for testing the reaction between the target substance and the test paper or reagent. As one embodiment of "processing into a form that can be used for testing the reaction between the target substance and the test paper or reagent," for example, step (a) may include a step of processing the target substance-adhering carrier into a form that can be enclosed in a liquid-permeable sheet or into a form that can be stored in a reaction container. However, in the present invention, the target substance-adhering carrier does not need to be processed as long as it is in a form that can be used for detection tests of the target substance.
[0057] Step (b) is a step of processing a permeable sheet so that a target substance-adhering carrier can be inserted into it, and then encapsulating the target substance-adhering carrier in the processed permeable sheet. In this step, the processing of the permeable sheet is not limited to processing that allows for the insertion of the target substance-adhering carrier, and examples include folding, cutting, folding, stacking, welding, and processing the permeable sheet into a bag shape. Furthermore, if pre-processed permeable sheets are available, they can be used directly to encapsulate the target substance-adhering carrier without further processing. For example, permeable sheets processed into a tea bag shape are commercially available.
[0058] In the present invention, terms such as "target substance adhering carrier," "form that can be stored in a reaction container," and "processing" are as described in "3.(1) Target substance adhering carrier," and terms such as "permeable sheet" and "encapsulation" are as described in "4. Articles for collecting bodily fluid samples."
[0059] 9. Method for manufacturing an article in which a nucleic acid-adhering carrier is encapsulated in a permeable sheet. The present invention provides a method for manufacturing an article in which a nucleic acid-adhering carrier is encapsulated in a permeable sheet, comprising the following steps. (a) A step of preparing a nucleic acid-adhering carrier, and (b) A process of processing a permeable sheet to enclose the carrier within the permeable sheet.
[0060] Step (a) is a step of preparing the nucleic acid-adhering carrier. In the present invention, "preparing" means preparing the material for the nucleic acid-adhering carrier (filter paper, filter cloth, etc.) and, if necessary, processing the material into a form that can be used in a nucleic acid amplification reaction. As one embodiment of "processing the material for the nucleic acid-adhering carrier into a form that can be used in a nucleic acid amplification reaction," for example, step (a) may include a step of processing the nucleic acid-adhering carrier into a form that can be stored in a nucleic acid amplification container. However, in the present invention, it is not necessary to process the material for the nucleic acid-adhering carrier as long as the nucleic acid-adhering carrier is in a form that can be used in a nucleic acid amplification reaction.
[0061] Step (b) is a step of processing a permeable sheet so that a nucleic acid-adhering carrier can be inserted into it, and then encapsulating the nucleic acid-adhering carrier in the processed permeable sheet. In this step, the processing of the permeable sheet is not limited to processing that allows for the insertion of the nucleic acid-adhering carrier, and examples include folding, cutting, folding, stacking, welding, or processing the permeable sheet into a bag shape. Furthermore, if pre-processed permeable sheets are available, they can be used directly to encapsulate nucleic acid-adhering carriers without further processing. For example, permeable sheets processed into a tea bag shape are commercially available.
[0062] In the present invention, terms such as "nucleic acid-adhering carrier," "form that can be stored in a nucleic acid amplification container," and "processing" are as described in "3.(2) Nucleic acid-adhering carrier," and terms such as "permeable sheet" and "encapsulation" are as described in "4. Articles for collecting bodily fluid samples."
[0063] 10. Method for detecting target substances in bodily fluids The present invention provides a method for detecting a target substance in bodily fluids, comprising the following steps. (a) A step of preparing a carrier for target substance adhesion, (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet, (c) A step of bringing into contact with a bodily fluid sample an article obtained in step (b), in which the target substance-adhering carrier is enclosed in a permeable sheet. (d) Steps for detecting the target substance attached to the carrier.
[0064] Steps (a) and (b) are as described in "8. Method for manufacturing an article in which a target substance-adhering carrier is enclosed in a permeable sheet" above.
[0065] Step (c) is a step in which the article obtained in step (b), in which the target substance-adhering carrier is enclosed in a permeable sheet, is brought into contact with a bodily fluid sample. In the present invention, "to bring into contact" means to bring at least a portion of the target substance-adhering carrier enclosed in the permeable sheet into contact with the bodily fluid sample, and does not necessarily mean to bring all of the enclosed target substance-adhering carrier into contact with the bodily fluid sample. Furthermore, this process may further include, if necessary, placing an article in which a target substance-adhering carrier is enclosed in a permeable sheet, or the bodily fluid sample collection device of the present invention, onto an absorbent sanitary product. In addition, if necessary, the article or device may be fixed, attached, inserted, etc., by any known method, rather than just being placed on the absorbent sanitary product. The position for placement or fixing is as described in "4. Article for Bodily Fluid Sample Collection" above.
[0066] In the method of the present invention, if a sampling device is used, the outer packaging may be removed from the sampling article that has come into contact with the bodily fluid sample after step (c).
[0067] In the present invention, after step (c), the collection article that came into contact with the bodily fluid sample obtained in step (c) can be dried. The collection article that came into contact with the bodily fluid sample may be dried in a drying case. In the present invention, possible methods for opening a collection article that has come into contact with a bodily fluid sample and is stored in a drying case include, for example, (1) removing the collection article from the drying case and opening the removed article with scissors or a cutter, (2) (i) opening the stored collection article from the outside of the drying case with a cutter through an opening hole provided in the drying case, (ii) sealing the collection article that has come into contact with the bodily fluid sample and the drying case with tape or the like through a window provided in the drying case, and (iii) opening the case, thereby opening the collection article sealed to it without touching it, but are not limited to these.
[0068] Step (d) is a step of detecting the target substance attached to the target substance-adhering carrier. The configuration of this process can be appropriately selected depending on the type of target substance. The configuration of this process is not limited to, for example, (1) An embodiment that includes a step of detecting a target substance using various test papers as a target substance adhesion carrier, with the change in the color of the carrier as an indicator. (2) An embodiment comprising the step of removing a target substance-adhering carrier from an article that has been in contact with a bodily fluid sample, placing the removed target substance-adhering carrier into a reaction container, and detecting the target substance using the color change of the reagent or carrier produced by the reaction between the target substance and the detection reagent as an indicator. (3) An embodiment comprising the steps of removing a target substance-adhering carrier from an article that has been in contact with a bodily fluid sample, preparing an extract from the removed target substance-adhering carrier, and detecting the target substance by a reaction between the target substance in the extract and a detection reagent. (4) An embodiment comprising the step of removing a nucleic acid-adhering carrier from an article that has been in contact with a bodily fluid sample, placing the removed nucleic acid-adhering carrier in a reaction container, and detecting a target nucleic acid by a nucleic acid amplification reaction. These are some examples. The following describes the aspects (1) to (4) described above.
[0069] (1) Embodiments using various test papers as target substance adhesion carriers In this embodiment, the target substance adhesion carrier in step (a) above (step of preparing the target substance adhesion carrier) may be various test papers or processed versions thereof. The explanation of "test papers" and "processing" is as described in "3. (1) Target substance adhesion carrier" above.
[0070] In step (a), if the target substance adhering carrier is various test papers or processed thereof, step (d) includes a step of detecting the target substance using the change in color of the carrier as an indicator. In this process, a change in color refers to a change in the color of the carrier when it comes into contact with the target substance, compared to the color of the carrier before contact with the target substance or the color of the carrier that has not come into contact with the target substance. For example, if the color of the carrier before contact with the target substance or the color of the carrier that has not come into contact with the target substance (referred to as the "original color") is an arbitrary color, such as yellow, and the color of the carrier after contact with the target substance is different from the original color, such as blue, then a change in color can be said to have occurred. "Using a change in color as an indicator" means using the change in color to indicate the presence or concentration of the target substance in the sample.
[0071] In this invention, if the color of the carrier changes, this change in color indicates the presence or concentration of the target substance. On the other hand, if the color of the carrier does not change, this indicates that the target substance is not present in the sample or that the concentration of the target substance in the sample is undetectable. In other words, since the change in the color of the carrier is related to the presence or concentration of the target substance, the target substance can be detected using the change in color as an indicator. Color changes can be observed visually, or they can be confirmed using known analytical instruments. In step (d), if the change in the color of the carrier can be visually confirmed from outside the article, it is not necessarily required to remove the carrier from the article.
[0072] (2) A method for detecting a target substance using a detection reagent. In this embodiment, step (d) is, for example, (i) A step of removing a target substance-adhering carrier from the article that has come into contact with a bodily fluid sample, and (ii) A step of placing the removed target substance-adhering carrier into a reaction vessel and detecting the target substance by reaction of the target substance with a detection reagent. Includes.
[0073] Step (i) described above is the process of removing the target substance-adhering carrier from the article that was brought into contact with the bodily fluid sample obtained in step (c). The method for removing the target substance-adhering carrier is not limited to this method. For example, one method involves opening the article that has been in contact with the bodily fluid sample in step (c), and removing the target substance-adhering carrier sealed inside the article using an instrument that has been treated to remove the target substance or an unused instrument (e.g., tweezers).
[0074] Step (ii) described above involves placing the target substance-adhering carrier removed in step (i) into a reaction vessel and detecting the target substance by a reaction between the target substance and a detection reagent. In the present invention, the target substance-adhering carrier removed in step (i) may be washed, dried, or otherwise treated before being placed in the reaction vessel.
[0075] In the present invention, the "reaction vessel" is as described in "3.(1) Target substance adhering carrier" above. Step (ii) above includes the step of adding a reagent that reacts with the target substance to a reaction vessel. The reagent may be added before or after adding the target substance-adhering carrier to the reaction vessel. The reagent is not limited to reagents that react with the target substance, and those skilled in the art can select and obtain commercially available reagents that react with the target substance according to the type of target substance. Multiple types of reagents can be used.
[0076] In step (ii) above, the method of "detecting the target substance by a reaction between the target substance and the detection reagent" includes, for example, a method of detecting the target substance using the change in the color of the reagent due to the reaction between the target substance and the detection reagent as an indicator.
[0077] In this process, a change in color refers to a change in the color of the reagent or carrier when it comes into contact with the target substance, compared to the color of the reagent or carrier before contact with the target substance or the color of the reagent or carrier that has not come into contact with the target substance. For example, if the color of the reagent or carrier before contact with the target substance or the color of the reagent or carrier that has not come into contact with the target substance ("original color") is any color, such as transparent or white, and the reagent or carrier that comes into contact with the target substance is a different color from the original color, such as purple, then a change in color can be said to have occurred. "Using a change in color as an indicator" means using the change in color to indicate the presence or concentration of the target substance in the sample.
[0078] In this invention, if the color of the reagent or carrier changes, this color change indicates the presence or concentration of the target substance. On the other hand, if the color of the reagent or carrier does not change, this indicates that the target substance is not present in the sample or that the concentration of the target substance in the sample is undetectable. In other words, since the color change of the reagent or carrier is related to the presence or concentration of the target substance, the target substance can be detected using the color change as an indicator. Color changes can be observed visually, or they can be confirmed by measuring absorbance using known analytical instruments.
[0079] One embodiment of this process includes, for example, placing the target substance-adhering carrier and detection reagent extracted in step (i) into a reaction container (e.g., a tube), heating it, and examining whether or not there is a change in color. This process further includes other steps necessary for detection (e.g., stirring, centrifugation, etc.). Multiple types of reagents may be used in this process. The reaction conditions between the target substance and the reagent (e.g., reaction temperature, reaction time, amount of reagent, etc.), as well as the types and conditions of other necessary steps, can be appropriately determined by a person skilled in the art based on the reagent's instructions.
[0080] (3) A method for detecting a target substance using an extract prepared from a target substance-adhering carrier. In this embodiment, step (d) is: (i) A step of removing a target substance-adhering carrier from an article that has come into contact with a bodily fluid sample, and (ii) A step of preparing an extract from the target substance-adhering carrier that has been removed, and detecting the target substance by a reaction between the target substance in the extract and a detection reagent. Includes. Step (i) described above is as described in "(2) A manner for detecting a target substance using a detection reagent". Step (ii) above includes a step of preparing an extract from the target substance-adhering carrier removed from the article. In one embodiment of this step, for example, the target substance-adhering carrier and a liquid solvent (e.g., water) can be placed in a reaction vessel (e.g., a tube) and stirred with a reaction vessel mixer or the like to prepare the extract. Furthermore, step (ii) above further includes a step of placing the extract into a reaction vessel and detecting the target substance by reaction of the target substance with a detection reagent. One embodiment of this step is, for example, placing the extract prepared above into another container, adding a detection reagent thereto, and detecting the target substance by analyzing the solution produced by the reaction of the target substance in the extract with the detection reagent (for example, by measuring the absorbance of the solution). In this step, if detection is performed using an automated analyzer, the detection reagent may be added automatically by the analyzer. The reaction conditions between the target substance and the reagent (e.g., reaction temperature, reaction time, amount of reagent, etc.), as well as the types and conditions of other necessary steps, can be appropriately determined by a person skilled in the art based on the instructions for the reagent or analytical instrument.
[0081] The aspect of (4) described above will be explained below in "11. Method for detecting target nucleic acids in bodily fluids".
[0082] 11. Method for detecting target nucleic acids in bodily fluids The present invention provides a method for detecting target nucleic acids in bodily fluids, comprising the following steps. (a) Steps to prepare a nucleic acid-adhering carrier, (b) A step of processing a permeable sheet to enclose the carrier in the permeable sheet, (c) A step of bringing into contact with a bodily fluid sample an article obtained in step (b), in which the nucleic acid-adhering carrier is enclosed in a permeable sheet. (d) A step of removing a nucleic acid-adhering carrier from the article that has come into contact with a bodily fluid sample, and (e) A process in which the nucleic acid-adhering carrier removed in step (d) is placed in a nucleic acid amplification container and the target nucleic acid is detected by a nucleic acid amplification reaction.
[0083] Steps (a) and (b) are as described in "9. Method for manufacturing an article in which a nucleic acid-adhering carrier is enclosed in a permeable sheet" above.
[0084] Step (c) is a step in which the article obtained in step (b), in which the nucleic acid-adhering carrier is enclosed in a permeable sheet, is brought into contact with a bodily fluid sample. In the present invention, "to bring into contact" means to bring at least a portion of the nucleic acid-adhering carrier enclosed in the permeable sheet into contact with the bodily fluid sample, and does not necessarily mean to bring all of the enclosed nucleic acid-adhering carrier into contact with the bodily fluid sample. Furthermore, this process may further include, if necessary, a step of placing an article in which a nucleic acid-adhering carrier is enclosed in a permeable sheet, or the body fluid sample collection device of the present invention, onto an absorbent sanitary product. In addition, if necessary, the article or device may be fixed, attached, inserted, etc., by any known method, in addition to being placed on the absorbent sanitary product. The position for placement or fixing is as described in "4. Article for Body Fluid Sample Collection" above.
[0085] In the method of the present invention, if a sampling device is used, the outer packaging may be removed from the sampling article that has come into contact with the bodily fluid sample after step (c).
[0086] In the present invention, after step (c), the collection article that came into contact with the bodily fluid sample obtained in step (c) can be dried. The collection article that came into contact with the bodily fluid sample may be dried in a drying case. In the present invention, the manner in which the collection article that has come into contact with the bodily fluid sample and is stored in a drying case is as described in "10. Method for detecting target substances in bodily fluids" above.
[0087] Step (d) is the step of removing the nucleic acid-adhering carrier from the article that was in contact with the bodily fluid sample obtained in step (c). The method for removing the nucleic acid-attached carrier is not limited to this method. For example, one method involves opening the article that has been in contact with the bodily fluid sample in step (c), and removing the nucleic acid-attached carrier enclosed in the article using an instrument that has undergone nucleic acid removal treatment or an unused instrument (e.g., tweezers).
[0088] Step (e) is a step in which the nucleic acid-adhering carrier removed in step (d) is placed in a nucleic acid amplification container and the target nucleic acid is detected by a nucleic acid amplification reaction. In the present invention, the nucleic acid-adhering carrier removed in step (d) may be washed, dried, or otherwise treated before being placed in the nucleic acid amplification container. However, the present invention does not involve cutting (e.g., punching) the nucleic acid-adhering carrier after it has been removed from an article containing a nucleic acid-adhering carrier enclosed in a permeable sheet and brought into contact with a bodily fluid sample, before placing the carrier into a nucleic acid amplification container. This makes it possible to easily prevent contamination (e.g., carryover) from positive samples to negative samples between multiple samples.
[0089] In the present invention, the "nucleic acid amplification container" is as described in "3.(2) Nucleic acid-adhering carrier" above. In the present invention, the detection of the target nucleic acid can be performed by a method utilizing any nucleic acid amplification reaction (nucleic acid amplification method). Nucleic acid amplification reactions are well known and include reactions involving temperature changes (temperature cycles) and isothermal nucleic acid amplification reactions that do not involve temperature changes. Methods that utilize reactions involving temperature changes include PCR (White, TJ et al., Trends Genet., 5, 185 (1989)), RT-PCR, and LCR (Ligase Chain Reaction: Barany, F., Proc. Natl. Acad. Sci. USA, Vol.88, p.189-193, 1991). Furthermore, methods utilizing isothermal nucleic acid amplification reactions include, but are not limited to, the SmartAmp (Smart Amplification Process) method (Japanese Patent No. 3897805), the LAMP (Loop-Mediated Isothermal Amplification) method (Japanese Patent No. 3313358), the SDA (Strand Displacement Amplification: Edward L. Chan et al, Arch. Pathol. Lab. Med., 124:1649-1652, 2000), the ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids) method, the TMA (Transcription Mediated Amplification) method, the NASBA (Nucleic Acid Sequence-Based Amplification) method, the RCA (rolling circle amplification) method, the TRC (Transcription Reverse Transcription Concerted Reaction) method, and the HDA (Helicase-dependent isothermal DNA amplification) method. In the present invention, the amplification of the target nucleic acid is preferably performed by a method selected from the group consisting of PCR, RT-PCR, LCR, SmartAmp, LAMP, RT-LAMP, SDA, ICAN, TMA, NASBA, RCA, TRC, and HDA. In the present invention, "SmartAmp" also includes the SmartAmp2 (Smart Amplification Process 2) method.
[0090] PCR, RT-PCR, LCR, SmartAmp, LAMP, SDA, ICAN, TMA, NASBA, RCA, TRC, and HDA are well-known technologies to those skilled in the art and can be easily implemented by those skilled in the art based on publicly available information. Furthermore, those skilled in the art can appropriately select primers and other reagents used in these nucleic acid amplification methods.
[0091] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. [Examples]
[0092] [Example 1] Preparation of an article in which a target substance-adhering carrier is encapsulated in a permeable sheet. In this example, an article was produced in which a target substance-adhering carrier was enclosed in a liquid-permeable sheet by the following steps. (1) Steps to prepare a target substance adhesion carrier. Filter paper (qualitative filter paper No. 2 or No. 131, manufactured by Toyo Filter Paper Co., Ltd.) or urine test strips (Class II general-purpose test series multi-parameter test strip kit Uropaper III 'Eiken', Eiken Chemical Co., Ltd.) were used as the material for the target substance-adhering carrier. The filter paper was punched out into a circular shape with a diameter of approximately 3 mm using a hand punch (1 / 8 inch standard, Fiskars) to obtain a disc-shaped target substance-adhering carrier. In one example, filter paper dyed with a dye was also used as the material for the target substance-adhering carrier. The urine test strips were detached into sections (approximately 5 mm long x 4 mm wide) for each test item (glucose, protein), and multiple plate-shaped target substance-adhering carriers were obtained for each test item.
[0093] (2) A process of processing a permeable sheet and encapsulating the carrier within the permeable sheet. Approximately 10 of the disc-shaped target substance-adhering carriers obtained in (1) above were placed in a nonwoven fabric bag [Tea Pack M (manufactured by Tokiwa Kogyo Co., Ltd.) (approximately 95 mm x approximately 70 mm) or Heatron GSP-S (manufactured by Sankei Tokushu Shigyo Co., Ltd.) (approximately 55 mm x approximately 75 mm)]. In addition, several of the plate-shaped target substance-adhering carriers obtained in (1) above were placed in the nonwoven fabric bags, one for each test item. Next, one open side of the nonwoven fabric bag was heat-sealed (P-200, Fuji Impulse Co., Ltd.) (the welded part is called the "welded part"), and the target substance-adhering carriers were sealed inside the nonwoven fabric. Through the above process, we were able to produce an item (an item for collecting bodily fluid samples) in which a target substance-adhering carrier was enclosed in a permeable sheet (Figure 1).
[0094] As another example, the target substance-adhering carrier obtained in (2) above was sealed in a nonwoven fabric, and the top and / or bottom of the article were heat-sealed approximately 10 mm from the top and / or bottom (the welded portion is called the "welded portion") to create a handle portion. At this time, care was taken to prevent the sealed target substance-adhering carrier from entering the handle portion. A version with one handle portion (Figure 2) and a version with two handle portions (Figure 5) were produced.
[0095] As another example, a nonwoven fabric processed into a bag shape as described in (2) above was doubled, tripled, or quadrupled, and a target substance-adhering carrier was placed inside to create an item for collecting bodily fluid samples in which the permeable sheet was doubled, tripled, or quadrupled.
[0096] [Example 2] Preparation of articles in which nucleic acid-adhering carriers are encapsulated in permeable sheets. In this example, an article was prepared in which a nucleic acid-adhering carrier was enclosed in a liquid-permeable sheet by the following steps. (1) Filter paper (qualitative filter paper No. 2, manufactured by Toyo Filter Paper Co., Ltd.) was used as the material for the nucleic acid-adhering carrier. The filter paper was punched out into a circular shape with a diameter of approximately 3 mm using a hand punch (1 / 8 inch standard, Fiskars Corporation) to obtain a disc-shaped nucleic acid-adhering carrier [Step to prepare the nucleic acid-adhering carrier]. In one example, filter paper stained with a dye was also used as a material for nucleic acid adhesion carriers. (2) Approximately 10 nucleic acid-adhering carriers obtained in (1) above are placed in a nonwoven fabric bag (Tea Pack M (manufactured by Tokiwa Kogyo Co., Ltd.)) (approximately 95 mm in length x approximately 70 mm in width), and one open side of the nonwoven fabric bag is heat-sealed (P-200, Fuji Impulse Co., Ltd.) (the heat-sealed portion is called the "heat-sealed portion"), thereby sealing the nucleic acid-adhering carriers in the nonwoven fabric [process of processing a permeable sheet and sealing the carriers in the permeable sheet]. Through the above process, we were able to produce an item (an item for collecting bodily fluid samples) in which a nucleic acid-adhering carrier was enclosed in a permeable sheet (Figure 1).
[0097] As another example, the nucleic acid-adhering carrier obtained in (2) above was sealed in a nonwoven fabric, and a handle portion was created by heat sealing the top or bottom of the article approximately 10 mm from the top or bottom (the sealed portion is called the "sealed portion"). At this time, care was taken to prevent the sealed nucleic acid-adhering carrier from entering the handle portion. Products with one handle portion (Figure 2) and products with two handle portions (Figure 5) were produced.
[0098] As another example, a nonwoven fabric processed into a bag shape as described in (2) above was doubled, tripled, or quadrupled, and a nucleic acid-adhering carrier was placed inside to create an item for collecting bodily fluid samples in which the permeable sheet was doubled, tripled, or quadrupled.
[0099] [Example 3] Manufacturing of devices for collecting bodily fluid samples In this embodiment, a body fluid sample collection device was manufactured, which includes the body fluid sample collection article and outer packaging prepared in Example 1 or 2. Specifically, a nonwoven fabric or gauze was processed into a bag shape to create an outer casing, and the items for collecting bodily fluid samples were placed inside to create a collection device. As another example, a collection device was created by using nonwoven fabric or gauze as an outer covering and wrapping the items for collecting bodily fluid samples in the nonwoven fabric or gauze (Figure 6). As another example, a cotton puff with a pocket was used as the outer casing, and a collection device was created by inserting items for collecting bodily fluid samples into the pocket.
[0100] [Example 4] Manufacturing of kits for collecting bodily fluid samples In this embodiment, a body fluid sample collection kit was manufactured, comprising a body fluid sample collection article prepared in Example 1 or 2 and an outer casing prepared in Example 3. In addition, a body fluid sample collection kit was manufactured that included a drying case in addition to the collection article and outer casing. In this embodiment, a drying case with a barcode sticker attached was manufactured. The kit prepared in this embodiment may also include absorbent hygiene products, instructions for use, and equipment and materials necessary for collecting and testing bodily fluid samples.
[0101] [Example 5] Manufacturing of absorbent hygiene products equipped with articles or devices for collecting bodily fluid samples. In this embodiment, a diaper equipped with a body fluid sample collection article or collection device was manufactured by placing the body fluid sample collection article prepared in Example 1 or 2 or the collection device prepared in Example 3 on the surface sheet of a commercially available diaper (the part that comes into contact with the subject's skin).
[0102] [Example 6] Detection of target substances 1. Detection of target nucleic acids In this example, as the positive sample of the bodily fluid sample containing the target nucleic acid, 1 x 10⁶ solution was added to the buffer solution (Tris-EDTA buffer solution, 93283-100ML, Merck). 8 A solution containing CMV (Towne strain) to achieve a cp / ml count (CMV-containing sample) was used. The buffer solution (blank solution) was used as the negative sample. In this example, real-time PCR was used as the gene amplification and detection method. The composition of the reaction solution used for PCR is as follows. The primer and probe concentrations at the final reaction were 500 nM and 250 nM, respectively. Brilliant III Ultra-Fast QPCR Master Mix was purchased from Agilent. [Table 1] F-Primer: CGAATACCTCAGCGACCTGTACA (Sequence ID 4) R-Primer: CGTTCGAGCGAGTGATCG (Sequence ID 5) Probe: CCTGTTCCAGTAGCGGGCGACG (SEQ ID NO: 6) (Fluorescence: FAM / TAMRA)
[0103] First, 200 μL of the CMV-containing sample or blank solution was dropped onto the collection article for body fluid samples prepared in Example 2, thereby bringing the collection article into contact with the CMV-containing sample or blank solution. The article was then dried. Next, the permeable sheet (specifically, nonwoven fabric) in the form of a bag containing the item was opened, and the nucleic acid-attached carrier was removed from the item. The nucleic acid-attached carrier was then placed in 30 μL of the reaction solution dispensed into each well of a measurement plate, and PCR was performed. PCR was performed under the following conditions: one cycle of [95°C for 60 seconds], followed by 50 cycles of [95°C for 20 seconds, 60°C for 20 seconds], and then one cycle of [37°C for 60 seconds]. A Cobas z480 PCR machine (Roche Diagnostics) was used. As a result, we were able to detect the target nucleic acid of CMV in a sample containing a nucleic acid-adhering carrier, which was extracted from a sampling material that had been in contact with a CMV-containing sample (Figure 3). This embodiment demonstrates that target nucleic acids can be detected in bodily fluids.
[0104] 2. Detection of target sugars and target inorganic compounds A 1000 mg / dL glucose aqueous solution (prepared by dissolving glucose (Nisshoku Medicalose (Nippon Shokuhin Kako Co., Ltd.)) in pure water) was used as the sample. Pure water was used as the negative control. As the target substance adhesion carrier, only the glucose test strip portion was cut out from a urine test strip containing multiple test items. One mL of the sample or negative control was dropped onto the sampling device prepared in Example 3, which contained several glucose test strips, thereby bringing the sampling device into contact with the sample or negative control. After contact, the change in color of the test strips before and after sample application was observed. The results are shown in Table 2 below. In the table, "○" indicates that the color of the test paper (the carrier) changed, and "×" indicates that the color of the test paper did not change. [Table 2] As shown in the table above, when the glucose aqueous solution sample was dropped onto the sampling device, the color of the test strip, which is the target substance-adhering carrier, changed, while when the negative control was dropped onto the sampling device, the color of the test strip did not change. This test demonstrated that target sugars in body fluids can be detected using the article of the present invention. Furthermore, these results demonstrate that, instead of glucose test strips, target inorganic compounds (including ions) such as nitrite test strips, calcium test strips, chlorine test strips, and pH test strips can be used as the target substance adhesion carrier material to detect target inorganic compounds in bodily fluids.
[0105] 3. Detection of target proteins (1) Detection using test strips Protein standard solution (Fujifilm Wako Pure Chemical Industries, Ltd.) was used as the sample. Pure water was used as a negative control. As the target substance adhesion carrier, only the protein test strip portion was cut out from a urine test strip containing multiple test items. One mL of the sample or negative control was dropped onto the collection device prepared in Example 3, which contained several protein test strips, thereby bringing the collection device into contact with the sample or negative control. After contact, the change in color of the test strips before and after sample application was observed. The results are shown in Table 3 below. In the table, "○" indicates that the color of the test paper (the carrier) changed, and "×" indicates that the color of the test paper did not change. [Table 3] As shown in the table above, the color of the test strip, which is the target substance-adhering carrier, changed when the protein standard solution (the sample) was dropped onto the collection device, while the color of the test strip did not change when the negative control was dropped onto the collection device. This study demonstrated that target proteins (total proteins) in bodily fluids can be detected by using protein test paper as the material for a target substance-adhering carrier.
[0106] (2) Detection using detection reagents In this study, the target protein in the sample was detected by immersing a target protein-adhering carrier that had come into contact with the sample in a detection reagent and visually observing the color change of the carrier or reagent after a certain period of time. Specifically, the procedure was as follows:
[0107] The following samples were used: (i) protein standard solution (Fujifilm Wako Pure Chemical Industries, Ltd.), (ii) TP / ALB standard serum (Sinotest Co., Ltd.) diluted 7 times with pure water (hereinafter referred to as "TP / ALB standard serum dilution"), (iii) adult pooled urine to which TP / ALB standard serum (Sinotest Co., Ltd.) was added (hereinafter referred to as "urine with TP / ALB standard serum") at approximately 70 mg / dL, and (iv) urine with TP / ALB standard serum added at approximately 700 mg / dL. Pure water was used as a negative control for samples (i) and (ii), and adult pooled urine was used as a negative control for samples (iii) and (iv). MicroTP-AR(2 / PM-R1) (Fujifilm Wako Pure Chemical Industries, Ltd.) was used as the detection reagent. The disc-shaped target substance adhesion carrier prepared in Example 1 was used as the target substance adhesion carrier.
[0108] First, 500 μL of the above-mentioned sample or negative control was dropped onto the collection article for bodily fluid samples prepared in Example 1, thereby bringing the collection article into contact with the sample or negative control. The article was then dried. Next, the permeable sheet (specifically, nonwoven fabric) in the bag containing the item was opened, and the carrier was removed from the item. The carrier was placed in each of the 8-tube PCR strips (Watson Co., Ltd.), 60 μL of detection reagent was added, and the tubes were heated at 37°C for 10 minutes using a heat block (Mini Block Bath MyBL-10) (AS ONE). The color of the reagent at the time of adding the detection reagent and the color of the reagent after heating were compared. The results are shown in Table 4 below. In the table, "○" indicates that the color of the target substance-adhering carrier or reagent changed, and "×" indicates that the color of the carrier or reagent did not change. [Table 4] As shown in the table above, the color of the carrier or reagent changed in samples containing the carrier taken from collection materials that were in contact with the protein standard solution (sample (i)), TP / ALB standard serum diluent (sample (ii)), TP / ALB standard serum-added urine of approximately 70 mg / dL (sample (iii)), and TP / ALB standard serum-added urine of approximately 700 mg / dL (sample (iv)). In contrast, the color of the carrier and reagent did not change in samples containing the carrier taken from collection materials that were in contact with the negative control. This result indicates that the presence of protein in the sample could be detected. Therefore, this test demonstrated that target proteins in body fluids can be detected using the article of the present invention.
[0109] 4. Detection of target organic compounds (1) Detection using detection reagents In this study, the target organic compound (biochemical substance) in the sample was detected by immersing a target organic compound-adhering carrier that had come into contact with the sample in a detection reagent and visually observing the color change of the reagent after a certain period of time. Specifically, the procedure was as follows:
[0110] The following samples were used: (i) a 100 mg / dL aqueous solution of creatinine (hereinafter referred to as "CRE") (Nacalai Tesque Co., Ltd.) dissolved in pure water; (ii) a 10 mg / dL aqueous solution of sample (i) diluted 10-fold with pure water; and (iii) two adult pooled urine samples of different bases ("adult pooled urine A" and "adult pooled urine B"). Pure water was used as a negative control. Cygnus Auto CRE (Sinotest Co., Ltd.) was used as the detection reagent. The disc-shaped target substance adhesion carrier prepared in Example 1 was used as the target substance adhesion carrier.
[0111] First, 500 μL of the above-mentioned sample or negative control was dropped onto the collection article for bodily fluid samples prepared in Example 1, thereby bringing the collection article into contact with the sample or negative control. The article was then dried. Next, the permeable sheet (specifically nonwoven fabric) in the bag containing the item was opened, and the carrier was removed from the item. The carrier was placed in each of the 8-tube PCR strips (Watson Co., Ltd.), 45 μL of the detection reagent R1 was added, and the mixture was heated at 37°C for 5 minutes using a heat block (Mini Block Bath MyBL-10) (AS ONE). Then, 15 μL of the detection reagent R2 was added, the mixture was stirred using a vortex mixer, spun down, and then heated at 37°C for 5 minutes using a heat block. The color of the reagent at the time of adding the detection reagent R2 was compared with the color of the reagent after heating. The results are shown in Table 5 below. In the table, "○" indicates that the reagent's color changed, and "×" indicates that the reagent's color did not change. [Table 5] As shown in the table above, the reagent color changed in samples containing the carrier extracted from collection materials that had been in contact with a 100 mg / dL CRE aqueous solution (sample (i)), a 10 mg / dL CRE aqueous solution (sample (ii)), and adult pooled urine A and B (sample (iii)). In contrast, the reagent color did not change in samples containing the carrier extracted from collection materials that had been in contact with a negative control. This result indicates that the presence of CRE in the sample could be detected. Therefore, this test demonstrated that target organic compounds (biochemical substances) in bodily fluids can be detected using the article of the present invention.
[0112] (2) Detection using analytical instruments In this test, an extract of the target organic compound was prepared from a target organic compound-adhering carrier that had come into contact with the sample, and the target organic compound contained in the extract was detected using an automated biochemical analyzer. Ta. (2-1) Creatinine detection The specimens, negative control, detection reagents, and target substance adhesion carriers used in this test are the same as those described in (1) above.
[0113] First, the sample or negative control was dropped onto the collection article for bodily fluid samples prepared in Example 1, thereby bringing the collection article into contact with the sample or negative control. The article was then dried. Next, the permeable sheet (specifically, nonwoven fabric) in the bag containing the item was opened, and the carrier was removed from the item. The carrier was placed in a 1.5 mL tube, 200 μL of pure water was added, and the mixture was stirred for 30 seconds using a vortex mixer to prepare an extract. The extract was then measured using an automated biochemical analyzer (Hitachi 7180) equipped with detection reagents. The analytical parameters used were those specified by the manufacturer. As a result, extracts prepared from carriers removed from collection materials that had come into contact with a 100 mg / dL CRE aqueous solution (sample (i)), a 10 mg / dL CRE aqueous solution (sample (ii)), and adult pooled urine A and B (sample (iii)) showed significantly higher CRE content compared to the negative control (Figure 7). This result indicates that the presence of CRE in the samples could be detected. Therefore, this test demonstrated that target organic compounds (biochemical substances) in bodily fluids can be detected using the article of the present invention.
[0114] (2-2) Detection of urea nitrogen The samples used were (i) UN (urea nitrogen) standard solution (Sinotest Co., Ltd.) and (ii) two adult pooled urine samples with different bases ("adult pooled urine A" and "adult pooled urine B"). Pure water was used as a negative control. The detection reagent used was Cygnus Auto UN (Sinotest Co., Ltd.). The target substance adhesion carrier used was the disc-shaped target substance adhesion carrier prepared in Example 1.
[0115] First, 500 μL of the above-mentioned sample or negative control was dropped onto the collection article for bodily fluid samples prepared in Example 1, thereby bringing the collection article into contact with the sample or negative control. The article was then dried. Next, the permeable sheet (specifically, nonwoven fabric) in the bag containing the item was opened, and the carrier was removed from the item. The carrier was placed in a 1.5 mL tube, 200 μL of pure water was added, and the mixture was stirred for 30 seconds using a vortex mixer to prepare an extract. The extract was then measured using an automated biochemical analyzer (Hitachi 7180) equipped with detection reagents. The analytical parameters used were those specified by the manufacturer. As a result, extracts prepared from carriers removed from collection materials that had been in contact with UN standard solution (sample (i)) and adult pooled urine A and B (sample (ii)) showed significantly higher UN content compared to the negative control (Figure 8). This result indicates that the presence of UN in the samples could be detected. Therefore, this test demonstrated that target organic compounds (biochemical substances) in bodily fluids can be detected using the article of the present invention.
[0116] [Comparative Example 1] Contamination via the puncher (carryover) Unlike the present invention, in a method of processing the filter paper with a puncher after bringing the filter paper into contact with the sample, the following procedure was used to test whether contamination from a positive sample to a negative sample occurs via the puncher. (1) The filter paper before processing with the puncher was brought into contact with the CMV-containing sample used in "1. Detection of Target Nucleic Acid" of Example 6 and dried. Also, the filter paper before processing with the puncher was brought into contact with the blank solution and dried. (2) Next, the filter paper that had been in contact with the CMV-containing sample was punched out using a puncher. (3) The filter paper that had been in contact with the blank solution was punched out using the puncher used in (2) above without cleaning it. (4) The process described in (3) above, namely punching out the filter paper that has been in contact with the blank solution using an unwashed puncher, was performed a total of five times in succession. (5) PCR was performed on each of the disc-shaped filter paper pieces obtained by punching with a puncher, in the same manner as performed in "1. Detection of target nucleic acids" of Example 6.
[0117] As a result, it was found that even after punching a total of five times using an unwashed puncher, following the punching of filter paper that had been in contact with the CMV-containing sample in (2) above, false positives persisted (Figure 4). In Figure 4, "after CMV-containing sample" refers to a sample containing a piece of filter paper obtained by punching a piece of filter paper that had been in contact with the blank solution using the same puncher that had punched the filter paper that had been in contact with the CMV-containing sample. The sample labeled "after CMV-containing sample" in Figure 4 was obtained by punching filter paper that had been in contact with a blank solution. However, because the puncher used to punch the filter paper that had been in contact with the CMV-containing sample was used, it is understood that the filter paper that had been in contact with the blank solution was contaminated by nucleic acids derived from CMV that had adhered to the puncher. The results above indicate that with conventional technology, contamination from positive samples to negative samples can occur through equipment used to process filter paper, potentially leading to false positives. [Industrial applicability]
[0118] The bodily fluid sample collection article of the present invention is useful for collecting bodily fluid samples from a subject. [Explanation of symbols]
[0119] 1. Permeable sheet 2 Target substance adhesive carrier 3. Handle 4 Welded area 5 Welded area 6. Items for collecting bodily fluid samples 7. Exterior 8. Devices for collecting bodily fluid samples [Sequence Listing Free Text]
[0120] Sequence IDs 4-6: Synthetic DNA
Claims
1. A collection article for body fluid samples, comprising a plurality of target substance-adhering carriers for detecting a target substance in a body fluid sample, and overlapping permeable sheets, wherein the plurality of carriers are located between the overlapping permeable sheets, the carriers have a longest side or diameter less than or equal to the pore diameter of a reaction vessel, the pore diameter being 20.0 mm, and the body fluid sample is a sample containing a body fluid selected from the group consisting of urine, saliva, amniotic fluid, breast milk, blood, exudate, cerebrospinal fluid, synovial fluid, ascites, pleural fluid, ear discharge, nasal discharge, pus, bile, sputum, and pulverized cell or tissue.
2. The collecting article according to claim 1, wherein the carrier is a paper carrier, a cloth carrier, or polymer beads.
3. The collection article according to claim 1 or 2, wherein the bodily fluid sample is a sample containing urine.
4. The collection article according to claim 1 or 2, wherein the body fluid sample is a sample containing a body fluid selected from the group consisting of saliva, blood, amniotic fluid, breast milk, and exudate.
5. A device for collecting bodily fluid samples, comprising a collection article and an outer casing as described in any one of claims 1 to 4.
6. A kit for collecting bodily fluid samples, comprising a collection article and packaging according to any one of claims 1 to 4.
7. A kit for collecting bodily fluid samples according to claim 6, further comprising a drying case.
8. An absorbent sanitary product comprising a collection article according to any one of claims 1 to 4 or a collection device according to claim 5.
9. The following steps: (a) A step of preparing a plurality of carriers that adhere to a target substance, wherein the carriers are processed such that the longest side or diameter is less than or equal to the pore diameter of the reaction vessel, and the pore diameter is 20.0 mm, (b) A step of processing the permeable sheet so that the multiple carriers that adhere to the target substance are located between the overlapping permeable sheets, (c) A step of bringing the multiple carriers that adhere to the target substance obtained in step (b) into contact with an article located between overlapping permeable sheets and a bodily fluid sample, and (d) Steps for detecting the target substance attached to the carrier. A method for detecting a target substance in bodily fluids, including, The detection method wherein the bodily fluid sample is a sample containing a bodily fluid selected from the group consisting of urine, saliva, amniotic fluid, breast milk, blood, exudate, cerebrospinal fluid, synovial fluid, ascites, pleural fluid, ear discharge, nasal discharge, pus, bile, sputum, and pulverized cell or tissue.