Synthesis method of multi-component polylactic acid by transcriptional regulation
By utilizing the yliH, treA, or dps gene promoters and specific gene modifications, the production of P(LA-co-3HB) is enhanced, addressing inefficiencies in existing methods and improving yield.
Patent Information
- Application Number
- JP2022021439
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-02-15
- Publication Date
- 2026-06-03
- Estimated Expiration
- 2042-02-15
AI Technical Summary
Existing methods for producing copolymer polyesters composed of 3-hydroxybutyric acid and lactic acid (P(LA-co-3HB)) are inefficient, limiting the production of a bioplastic with promising properties.
The method involves controlling the phaC1AB gene using the promoters of the yliH, treA, or dps genes of E. coli, combined with specific modifications to the β-ketothiolase, acetoacetyl-CoA reductase, and polyhydroxyalkanoate synthase genes, to enhance P(LA-co-3HB) production.
This approach significantly increases the production efficiency of P(LA-co-3HB), offering a more effective method than conventional techniques.
Smart Images

Figure 0007869560000001 
Figure 0007869560000002 
Figure 0007869560000003
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing a copolymer polyester composed of 3-hydroxybutyric acid and lactic acid, as well as a plasmid and a microorganism used therefor.
Background Art
[0002] A number of microorganisms capable of producing polyesters using sugar as a carbon source have been reported so far. The polyesters produced by microorganisms are attracting attention as biodegradable plastics that are easily decomposed in nature and as bioplastics made from biomass such as sugar and vegetable oil.
[0003] As typical bioplastics that can be produced by natural microorganisms, poly-3-hydroxybutyric acid (P(3HB)) having 3-hydroxybutyric acid (3HB) as a monomer unit, and copolymer polyesters composed of 3HB and other 3-hydroxyalkanoic acids (for example, 3-hydroxyvaleric acid (3HV), 3-hydroxyhexanoic acid (3HH), etc.) are known.
[0004] In addition, a method for producing a copolymer polyester composed of 3-hydroxybutyric acid (3HB) and a monomer unit other than 3-hydroxyalkanoic acid using microorganisms has also been developed. The copolymer polyester composed of 3HB and lactic acid (LA) (hereinafter also referred to as "P(LA-co-3HB)") has properties not found in the 3HB homopolymer (P(3HB)), and since its properties also vary depending on the lactic acid fraction in the polymer, it is expected that a polymer exhibiting desired physical properties can be obtained by adjusting the lactic acid fraction.
[0005] Since P(LA-co-3HB) is a useful polymer, several methods for producing it have been reported (Patent Documents 1-3). Patent Document 1 describes a method for producing P(LA-co-3HB) by culturing recombinant microorganisms into which genes involved in the synthesis of 3HB-lactic acid copolymers have been introduced, in a medium supplemented with lactic acid. Patent Document 2 describes producing P(LA-co-3HB) by microbial fermentation using sugar as a raw material without adding lactic acid to the medium, by using recombinant microorganisms with a modified 3HB-lactic acid copolymer synthesis system. Patent Document 3 describes creating genetically modified Corynebacterium-type bacteria by introducing a group of genes involved in the synthesis of lactic acid polyesters into Corynebacterium-type bacteria that do not originally possess the ability to synthesize lactic acid polyesters, and using these bacteria to produce lactic acid polyesters with a high lactic acid fraction. [Prior art documents] [Patent Documents]
[0006] [Patent Document 1] Special Publication No. 2008-541719 [Patent Document 2] International Publication No. 2009 / 131186 [Patent Document 3] Japanese Patent Publication No. 2012-152171 [Overview of the project] [Problems that the invention aims to solve]
[0007] P(LA-co-3HB) is a bioplastic with excellent properties, and therefore, demand is expected to increase in the future. Against this backdrop, the present invention aims to provide a means for efficiently producing P(LA-co-3HB), for which demand is expected to increase. [Means for solving the problem]
[0008] The inventors of this invention, after diligent research to solve the above problems, discovered that controlling the phaC1AB gene, which is involved in the production of P(LA-co-3HB), with the promoter of the yliH gene, the treA gene, or the dps gene of E. coli significantly increases the production of P(LA-co-3HB), thus completing the present invention. The promoters of the yliH gene and the treA gene had not been previously recognized as high-intensity promoters (Tomohiro Shimada et al., J. Bacteriol. 2004 Nov;186(21):7112-22), so the significant increase in P(LA-co-3HB) production by using such promoters was completely unexpected. The present invention was completed based on the above findings.
[0009] In other words, the present invention provides the following [1] to [6]. [1] A plasmid having a gene and a promoter, wherein the gene is a combination of the following genes (a), (b), and (c1), or the following combination of the following genes (a), (b), and (c2), and the promoter is the DNA of (d1), (d2), (d3), (d4), (d5), (d6), (d7), (d8), or (d9), (a) A gene encoding a protein that catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA, (b) A gene encoding a protein that catalyzes the reduction reaction of acetyl-CoA, (c1) A gene encoding a protein that catalyzes the synthesis reaction of polyhydroxyalkanoates, consisting of an amino acid sequence in which one or more amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in SEQ ID NO: 21 are substituted with other amino acids. (c2) A gene encoding a protein that catalyzes the synthesis reaction of polyhydroxyalkanoates, wherein one or more amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in SEQ ID NO: 21 are substituted with other amino acids, and further, one or more amino acids other than those at positions 130, 325, 477, and 481 are deleted or substituted, or one or more amino acids are inserted. (d1) DNA consisting of the base sequence shown in Sequence ID No. 1, (d2) DNA consisting of a base sequence in which one or more bases are deleted, substituted or added in the base sequence shown in Sequence ID No. 1, and which has promoter activity. (d3) DNA consisting of a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 1, and having promoter activity, (d4) DNA consisting of the base sequence shown in Sequence ID No. 2, (d5) DNA consisting of a base sequence in which one or more bases are deleted, substituted, or added in the base sequence shown in Sequence ID No. 2, and which has promoter activity. (d6) DNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in Sequence ID No. 2, and having promoter activity, (d7) DNA consisting of the base sequence shown in Sequence ID No. 3, (d8) DNA consisting of a base sequence in which one or more bases are deleted, substituted or added in the base sequence shown in Sequence ID No. 3, and which has promoter activity. (d9) DNA comprising a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 3, and having promoter activity.
[0010] [2] The plasmid according to [1], characterized in that the promoter is (d1), (d2), (d3), (d4), (d5), or (d6).
[0011] 〔3〕Furthermore, the plasmid according to [1] or [2], characterized by having a gene encoding a protein that catalyzes the reaction in which CoA is transferred to propionic acid and / or lactic acid.
[0012] 〔4〕A microorganism transformed with the plasmid according to [3].
[0013] 〔5〕The microorganism according to [4], characterized in that the microorganism is Escherichia coli.
[0014] 〔6〕A method for producing a copolymer polyester composed of 3-hydroxybutyric acid and lactic acid, comprising: (1) a step of culturing the microorganism according to [4] or [5] in a medium containing a carbon source; and (2) a step of recovering the copolymer polyester from the culture of step (1).
Advantages of the Invention
[0015] The present invention provides a novel method for producing P(LA-co-3HB). This method can produce P(LA-co-3HB) more efficiently than conventional methods.
Brief Description of the Drawings
[0016] [Figure 1] A diagram showing the expression level of the phaC1AB gene at the mRNA level when each plasmid is used. [Figure 2] A diagram showing the production amount of P(LA-co-3HB) when each plasmid is used. The gray part in the graph indicates the amount of 3HB, the white part indicates the amount of lactic acid, and the sum of the amount of 3HB and the amount of lactic acid indicates the amount of P(LA-co-3HB). [Figure 3] A diagram showing the production amount of P(LA-co-3HB) when pTV118Npct-PyliHC1AB(STQK) is used under a high glucose concentration. The gray part in the graph indicates the amount of 3HB, the white part indicates the amount of lactic acid, and the sum of the amount of 3HB and the amount of lactic acid indicates the amount of P(LA-co-3HB).
Modes for Carrying Out the Invention
[0017] The present invention will be described in detail below. (1) Plasmid The plasmid of the present invention is a plasmid having a gene and a promoter, wherein the gene is a combination of the following genes (a), (b), and (c1), or the following combination of the following genes (a), (b), and (c2), and the promoter is the DNA of (d1), (d2), (d3), (d4), (d5), (d6), (d7), (d8), or (d9).
[0018] The gene in (a) encodes a protein that catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA. The "protein that catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA" is a protein that catalyzes the reaction in which two molecules of acetyl-CoA condense to form acetoacetyl-CoA, and is generally referred to as β-ketothiolase or acetyl-CoA-CoA-C-acetyltransferase. Hereinafter, in this invention, the "protein that catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA" will be represented as βKT.
[0019] Examples of previously reported βKT include βKT derived from Alkaligenes beijerinckii (Biochem. J., 1973, Vol. 134, pp. 225-238), βKT derived from R. eutropha (Biochem. J., 1973, Vol. 134, pp. 239-248), βKT derived from Clostridium pasteurianum (Arch. Microbiol., 1975, Vol. 103, pp. 21-30), and βKT derived from Z. ramigera (United States Patent No. 067,695).
[0020] In this invention, in addition to the βKT described above, any previously reported βKT can be used. Furthermore, as long as it is a "protein that catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA," a protein consisting of an amino acid sequence in which one or several amino acids, for example, 1 to several dozen, preferably 1 to a dozen or so, and more preferably 10 or fewer amino acids, are deleted, substituted, or added to the amino acid sequence of a known βKT can also be used.
[0021] The catalytic activity of the reaction that forms acetoacetyl-CoA from two molecules of acetyl-CoA can be measured, for example, by the method described by Slater et al. (J. Bacteriology, 1998, Vol. 180, pp. 1979-1987).
[0022] The preferred βKT in the present invention is βKT derived from R. eutropha, the amino acid sequence of which is shown in SEQ ID NO: 17, and an example of the base sequence of the nucleic acid (DNA) encoding this amino acid sequence is shown in SEQ ID NO: 16.
[0023] The gene in (b) is a gene that codes for a protein that catalyzes the reduction reaction of acetyl-CoA. The "protein that catalyzes the reduction reaction of acetoacetyl-CoA" is a protein that catalyzes the reduction reaction of acetoacetyl-CoA in the presence of a coenzyme such as NADP, which leads to the formation of D(-)-β-hydroxybutyryl-CoA, and is generally called acetoacetyl-CoA reductase. Hereinafter, in this invention, the "protein that catalyzes the reduction reaction of acetoacetyl-CoA" will be represented as AACoA-R.
[0024] Examples of AACoA-Rs reported to date include those derived from Zoogloea (Arch. Microbiol., 1977, Vol. 114, pp. 211-217), R. eutropha (Accession No. J04987), and Z. ramigera (United States Patent No. 067,695).
[0025] In this invention, in addition to the AACoA-R described above, any of the previously reported AACoA-Rs can be used. Furthermore, as long as it is a "protein that catalyzes the reduction reaction of acetoacetyl-CoA," a protein consisting of an amino acid sequence in which one or several amino acids, for example, 1 to several dozen, preferably 1 to a dozen or so, and more preferably 10 or fewer amino acids, are deleted, substituted, or added to the amino acid sequence of a known AACoA-R can also be used.
[0026] The catalytic activity of the reduction reaction of acetoacetyl-CoA can be measured, for example, by the method described by G.W. Haywood et al. (FEMS Microbiology Letters, 1988, Vol. 52, pp. 259-264).
[0027] The preferred AACoA-R in the present invention is AACoA-R derived from R. eutropha, the amino acid sequence of which is shown in SEQ ID NO: 19, and an example of the base sequence of the nucleic acid (DNA) encoding this amino acid sequence is shown in SEQ ID NO: 18.
[0028] Other known βKT and AACo-R include phaBPCA from Acinetobacter sp. RA3849 (Accession No. L37761), phaPCJ from Aeromonas caviae FA440 (Accession No. D88825), phaCAB from Alcaligenes laatus DSM1123 (Accession No. AF078795), phaCAB from Alcaligenes laatus DSM1124 (Accession No. U47026), phaA from Alcaligenes sp. SH-69 (Accession No. AF002013), phaBPCA from Alcaligenes sp. SH-69 (Accession No. AF002014), phaCEARPB from Allochromatium vinosum D (Accession No. L01112), and phaPBC from Bacillus megaterium ATCC11561 (Accession No. phaCABR derived from Burkholderia sp. DSM 9242 (Accession No. AF153086), phaCA derived from Chromobacterium violaceum DSM30191 (Accession No. AF061446), phaCA derived from Comamonas acidovorans DS-17 (Accession No. AB009273), phaCEAPB derived from Ectothiorhodospira shaposhnikovii (Accession No. AF307334), phaAB derived from Paracoccus denitrificans (Accession No. D49326), phaCABR derived from Pseudomonas acidophila, phbRBAC derived from Pseudomonas sp. 61-3 (Accession No. AB014757), phaAB derived from Ralstonia eutropha H16 (Accession No. J04987), Rrickettsia prowazedkii Madrid phaCA, phaC, phaB (Accession No.) derived from E.Examples include phaAB (Accession No. U17226) derived from *Sinorhizobium meliloti* (AJ235273), phaC (Accession No. AF031938) derived from *Sinorhizobium meliloti* Rm1021, phaCE (Accession No. D90906) derived from *Sunechocystis sp. PCC6803*, phaAB (Accession No. D90910) derived from *Sunechocystis sp. PCC6803*, phaCE (Accession No. A49465) derived from *Thiococcus pfennigii*, phaCE (Accession No. L01113) derived from *Thiococtis violacea 2311*, phaBAPC (Accession No. AE004398) derived from *Vibrio cholerae*, and phaA(B) (Accession No. J02631) derived from *Zoogloea ramigera*.
[0029] The gene (c1) is a gene that encodes a protein that catalyzes the synthesis reaction of polyhydroxyalkanoates, consisting of an amino acid sequence in which one or more amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in SEQ ID NO: 21 are substituted with other amino acids, and the gene (c2) is a gene that encodes a protein that catalyzes the synthesis reaction of polyhydroxyalkanoates, consisting of an amino acid sequence in which one or more amino acids other than those at positions 130, 325, 477, and 481 of the amino acid sequence shown in SEQ ID NO: 21 are substituted with other amino acids, and one or more amino acids other than those at positions 130, 325, 477, and 481 are deleted or substituted, or one or more amino acids are inserted. The plasmid of the present invention may contain either the gene (c1) or the gene (c2).
[0030] In gene (c2), the number of amino acids deleted, substituted, or inserted should be "one or more," but preferably "1 to several tens of," more preferably "1 to 10," even more preferably "1 to 5," and particularly preferably "1 to 3."
[0031] The proteins that catalyze the synthesis of polyhydroxyalkanoates encoded by genes (c1) and (c2) are proteins obtained by mutating a portion of the amino acid sequence of polyhydroxyalkanoate synthase derived from Pseudomonas sp. 61-3, as described in International Publication No. 2003 / 100055. Hereinafter, the protein that catalyzes the synthesis of polyhydroxyalkanoates in the present invention will be denoted as PhaCm, and all descriptions from International Publication No. 2003 / 100055 will be incorporated herein.
[0032] Preferred examples of PhaCm include single mutations in which the amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in Sequence ID No. 21 are substituted individually, double mutations in which any two amino acids are substituted, triple mutations in which any three amino acids are substituted, and quadruple mutations in which all four amino acids are substituted. The preferred protein is a double mutation in which any two amino acids are substituted, and particularly preferred is a double mutation in which Ser at position 325 is substituted with Thr and Gln at position 481 is substituted with Lys (hereinafter referred to as STQK).
[0033] The DNA encoding PhaCm can be recombinantly produced by site-directed mutagenesis, as known to those skilled in the art, based on the amino acid sequence (SEQ ID NO: 21) of polyhydroxyalkanoate synthase derived from Pseudomonas sp. 61-3 and the base sequence (SEQ ID NO: 20) of the DNA encoding it. Furthermore, as described in International Publication No. 2003 / 100055, the activity of PhaCm in catalyzing polyhydroxyalkanoate synthesis can be confirmed by obtaining host cells transformed with nucleic acids capable of expressing PhaCm and measuring the polyhydroxyalkanoate accumulation capacity of those host cells.
[0034] By selecting and using various PhaCm, the 3HB content in the copolymerized polyester can be adjusted. For example, when using STQK, a random copolymer with randomly incorporated lactic acid, where 3HB:lactic acid = 94:6, is produced. In addition to selecting PhaCm, the mole fraction of LA in the copolymerized polyester can be increased by using lactic acid-accumulating microorganisms such as E. coli strains Jw2293, Jw0885, and Jw0886 as hosts. For example, by culturing the aforementioned lactic acid-accumulating E. coli strains aerobically as hosts, the mole fraction of LA in the copolymerized polyester can be increased to about 30%. Furthermore, the mole fraction of LA in the copolymerized polyester can be further increased by implementing measures to increase the amount of LA produced by microorganisms. For example, by culturing host microorganisms transformed with the gene encoding the aforementioned protein under anaerobic conditions, the amount of LA produced by the host microorganisms themselves can be increased, thereby increasing the mole fraction of LA in the copolymerized polyester. By culturing E. coli as a host under anaerobic conditions, the mole fraction of LA in the copolymer polyester can be increased to approximately 50%.
[0035] The DNAs (d1) to (d9) are promoters that control the gene (a), the gene (b), and the gene (c1) or (c2). The plasmid of the present invention may have any one of the DNAs (d1) to (d9), but it is preferable to have any one of the DNAs (d1) to (d6), and more preferable to have any one of the DNAs (d1) to (d3).
[0036] The DNA in (d1) consists of the base sequence shown in Sequence ID No. 1 and is the promoter of the E. coli yliH gene. As shown in the examples described later, the production of P(LA-co-3HB) can be significantly increased by using this promoter.
[0037] The DNA of (d2) is a DNA consisting of a base sequence in which one or more bases are deleted, substituted, or added in the base sequence shown in Sequence ID No. 1, and is a promoter-active DNA, and is thought to be able to significantly increase the production of P(LA-co-3HB) as with the DNA of (d1). In the DNA of (d2), the number of bases deleted, substituted, or inserted may be "one or more", but preferably "1 to several tens", more preferably "1 to 10", even more preferably "1 to 5", and particularly preferably "1 to 3".
[0038] DNA (d3) is a DNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in Sequence ID No. 1, and is a promoter-active DNA, and is thought to be able to significantly increase the production of P(LA-co-3HB) similar to DNA (d1). In DNA (d3), sequence identity of 90% or more is sufficient, preferably 95% or more, more preferably 97% or more, and even more preferably 99% or more.
[0039] The DNA in (d4) consists of the base sequence shown in Sequence ID No. 2 and is the promoter of the E. coli treA gene. As shown in the examples described later, the production of P(LA-co-3HB) can be increased by using this promoter.
[0040] The DNA of (d5) is a DNA consisting of a base sequence in which one or more bases are deleted, substituted, or added in the base sequence shown in Sequence ID No. 2, and is a promoter-active DNA, and is thought to be able to increase the production of P(LA-co-3HB) similar to the DNA of (d4). In the DNA of (d5), the number of bases deleted, substituted, or inserted may be "one or more", but preferably "1 to several tens of", more preferably "1 to 10", even more preferably "1 to 5", and particularly preferably "1 to 3".
[0041] The DNA of (d6) is a DNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in Sequence ID No. 2, and is a promoter-active DNA, and is thought to be able to increase the production of P(LA-co-3HB) similar to the DNA of (d4). In the DNA of (d6), the sequence identity should be 90% or more, preferably 95% or more, more preferably 97% or more, and even more preferably 99% or more.
[0042] The DNA in (d7) consists of the base sequence shown in Sequence ID No. 3 and is the promoter of the E. coli dps gene. As shown in the examples described later, the production of P(LA-co-3HB) can be increased by using this promoter.
[0043] The DNA of (d8) is a DNA consisting of a base sequence in which one or more bases are deleted, substituted, or added in the base sequence shown in Sequence ID No. 3, and is a promoter-active DNA, and is thought to be able to increase the production of P(LA-co-3HB) similar to the DNA of (d7). In the DNA of (d8), the number of bases deleted, substituted, or inserted may be "one or more", but preferably "1 to several tens of", more preferably "1 to 10", even more preferably "1 to 5", and particularly preferably "1 to 3".
[0044] The DNA of (d9) is a DNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in Sequence ID No. 3, and is a promoter-active DNA, and is thought to be able to increase the production of P(LA-co-3HB) similar to the DNA of (d7). In the DNA of (d9), the sequence identity should be 90% or more, preferably 95% or more, more preferably 97% or more, and even more preferably 99% or more.
[0045] The arrangement of each gene and DNA is as follows: DNA (d1) to (d9) are promoters that control gene (a), gene (b), and gene (c1) or (c2), so they need to be placed upstream of these genes, but there are no other particular limitations. However, it is preferable that they be arranged in the following order from upstream: DNA (d1) to (d9), gene (c1) or (c2), gene (a), and gene (b).
[0046] The plasmid of the present invention can be prepared by inserting the above-mentioned gene and DNA into a known plasmid (e.g., pBR322, pUC18, pBLuescriptII, etc.). The insertion of the gene and DNA can be performed using genetic engineering techniques known to those skilled in the art. The plasmid of the present invention may also optionally include terminator sequences, enhancer sequences, splicing signal sequences, poly(A) addition signal sequences, ribosome-binding sequences (SD sequences), and selection marker genes that can be used in the microorganism to which the gene and DNA are to be introduced. Examples of selection marker genes include drug resistance genes such as ampicillin resistance genes, tetracycline resistance genes, neomycin resistance genes, kanamasin resistance genes, and chloramphenicol resistance genes, as well as genes involved in the intracellular biosynthesis of nutrients such as amino acids and nucleic acids, or genes encoding fluorescent proteins such as luciferase.
[0047] The plasmid of the present invention preferably contains, in addition to the above-mentioned genes and DNA, a gene encoding a protein that catalyzes the transfer of CoA to propionic acid and / or lactate. The "protein that catalyzes the transfer of CoA to propionic acid and / or lactate" is a protein that has the activity to catalyze the transfer of CoA from a suitable CoA substrate to propionic acid and / or lactate. Such a protein is generally called propionylCoA transferase (Pct). Hereinafter, in the present invention, this protein will be referred to as Pct.
[0048] Examples of Pcts reported to date include those derived from Clostridium propionicum (Eur. J. Biochem., 2002, Vol. 269, pp. 372-380), those derived from Megasphaera elsdenii (United States Patent 7186541), those derived from Staphylococcus aureus (Eur. J. Biochem., 2002, Vol. 269, pp. 372-380), and those derived from Esherichia coli (Eur. J. Biochem., 2002, Vol. 269, pp. 372-380).
[0049] In this invention, in addition to the Pct described above, any Pct reported to date can be used. Furthermore, as long as it is a "protein that catalyzes the reaction in which CoA is transferred to propionic acid and / or lactate," a protein consisting of an amino acid sequence in which one or several amino acids, for example, 1 to several dozen, preferably 1 to a dozen or so, and more preferably 10 or fewer amino acids, are deleted, substituted, or added to the amino acid sequence of a known Pct can also be used.
[0050] The catalytic activity of the reaction in which CoA is transferred to propionic acid and / or lactic acid can be measured according to the method described, for example, AE Hofmeister et al. (Eur. J. Biochem., Vol. 206, pp. 547-552).
[0051] The preferred Pct in the present invention is a Pct derived from Megasphaera elsdenii, the amino acid sequence of which is shown in SEQ ID NO: 23, and an example of the base sequence of the nucleic acid (DNA) encoding the amino acid sequence is shown in SEQ ID NO: 22.
[0052] The gene encoding Pct is preferably controlled by a promoter different from the DNA of (d1) to (d9). The promoter may be the original promoter of the gene encoding Pct, or another promoter. Examples of other promoters include the trp promoter, lac promoter, PL promoter, PR promoter, and T7 promoter.
[0053] The gene encoding Pct may be located either upstream or downstream of DNA (d1) to (d9), but it is preferable to have it located upstream.
[0054] (2) Microorganisms The microorganisms of the present invention are characterized by being transformed with the plasmid of the present invention.
[0055] The transformation method is not particularly limited and can include, for example, the calcium phosphate method, electroporation method, spheroplast method, lithium acetate method, joint transfer method, and method using calcium ions.
[0056] The types of microorganisms are not particularly limited, but examples include bacteria of the genera Pseudomonas, Ralstonia, Bacillus, Escherichia, Corynebacterium, Saccharomyces, and Candida. Escherichia coli is a particularly suitable microorganism.
[0057] (3) Method for producing copolymer polyester The present invention provides a method for producing a copolymer polyester comprising 3-hydroxybutyric acid and lactic acid, characterized by comprising the steps of (1) culturing the microorganism of the present invention in a culture medium containing a carbon source, and (2) recovering the copolymer polyester from the culture obtained in step (1).
[0058] Microbial culture should preferably be carried out under general culture conditions for each type of recombinant microorganism, except for the culture medium composition. In particular, culturing the microorganisms under anaerobic conditions is advantageous because it can increase the mole fraction of lactic acid in the copolymer polyester.
[0059] While a culture medium with a special composition is not particularly required, it is preferable to use a medium that restricts either a nitrogen source other than a carbon source, inorganic salts, or other organic nutrients. For example, a culture medium for recombinant microorganisms in which nucleic acids have been incorporated into bacteria of the genus Ralstonia or Pseudomonas may be used, for instance, a medium in which the nitrogen source is restricted to 0.01-0.1%.
[0060] Examples of carbon sources include carbohydrates such as glucose, fructose, sucrose, and maltose. Oils and fats with four or more carbon atoms can also be used as carbon sources. Examples of oils and fats with four or more carbon atoms include natural oils such as corn oil, soybean oil, safflower oil, sunflower oil, olive oil, coconut oil, palm oil, rapeseed oil, fish oil, whale oil, oats, or beef oil; fatty acids such as butanoic acid, pentanoic acid, hexanoic acid, octanoic acid, decanoic acid, lauric acid, oleic acid, palmitic acid, linolenic acid, linoleic acid, or myristic acid, or esters of these fatty acids; octanol, lauryl alcohol, oleyl alcohol, or palmityl alcohol, or esters of these alcohols. Glucose is a particularly suitable carbon source. The concentration of the carbon source in the culture medium is not particularly limited, but for example, if the carbon source is glucose, it is preferably 2.5 to 3.5 (w / v)%.
[0061] Examples of nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium phosphate and other ammonium salts, as well as peptone, meat extract, yeast extract, and corn steep liquor. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, and sodium chloride.
[0062] Culturing is usually carried out under aerobic conditions, such as shaking culture, at a temperature of 25-37°C for at least 24 hours after the transcription and expression of the protein encoded by each gene. When culturing under anaerobic conditions, the aforementioned time is preferably 48 hours or longer. Antibiotics such as kanamycin, ampicillin, and tetracycline may be added to the culture medium during cultivation.
[0063] In the present invention, the recovery of copolymerized polyester can be carried out by methods known to those skilled in the art for recovering copolymerized polyester from microorganisms. For example, after collecting microorganisms from a culture medium by centrifugation, washing them, drying them, suspending the dried microorganisms in chloroform, and heating them, the target copolymerized polyester can be extracted into a chloroform fraction. Methanol can then be added to this chloroform solution to precipitate the polyester, and after removing the supernatant by filtration or centrifugation, the purified copolymerized polyester can be obtained by drying.
[0064] Confirmation that the recovered polyester is a copolymer polyester consisting of 3HB and lactic acid can be performed using conventional methods, such as gas chromatography or nuclear magnetic resonance spectroscopy. [Examples]
[0065] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.
[0066] (A) Method (1) Method for producing plasmids Using pTV118NpctphaC1AB(STQK) as a template, an 8.6 kb fragment (vector) was amplified using KOD-Plus-Neo(TOYOBO) with the primers 5'-TTATTTTTTCAGTCCCATGGGACCG-3' (SEQ ID NO: 4) and 5'-ATGAGTAACAAGAATAGCGATGACTTGA-3' (SEQ ID NO: 5). Additionally, using the genome of E. coli strain BW25113 as a template, DNA fragments (inserts) for each promoter were amplified using the primer pairs shown below (F and R, respectively). Using a Gibson assembly system (a reaction solution prepared in-house using enzymes and buffers similar to the method described at https: / / www.nebj.jp / f / 541), the vector was mixed to 50 ng and each insert to 100 ng. The mixture was reacted at 50°C for 15 minutes to ligate, and E. coli strain JM109 was transformed and selected on LB-Amp agar. Plasmids were extracted from the formed E. coli colonies, and the insertion of the inserted DNA sequence was confirmed using sequencing primers. The confirmed plasmids were named pTV118Npct-PyliHC1AB(STQK), pTV118Npct-PtreAC1AB(STQK), and pTV118Npct-PdpsC1AB(STQK), respectively. Insert DNA fragment (E. coli promoter), amplification primers yliH-F gggactgaaaaaataaGTGATTTCCAGCACTTTCGGG(Sequence No. 6) yliH-R attcttgttactcatACTTCGATCCTCCTCTTCC(Sequence ID 7) treA-F gggactgaaaaaataaGCGATACAACCAGAAGAAACGC(Sequence ID 8) treA-R attcttgttactcatCAATCATTCTCCTTTGGCGAAAC(Sequence ID 9) dps-F gggactgaaaaaataaCTCGCTACTTTTCCTCTACACC(Sequence ID 10) dps-R attcttgttactcatAATTTCATATCCTCTTGATGTTATGTC(Sequence ID 11)
[0067] (2) Measurement of expression levels (RNA extraction ~ RT-qPCR) Competent cells of E. coli strain BW25113, prepared using the CaCl2 method, were transformed with each plasmid and plated onto agar plates in LB-ampicillin (final concentration 50 μg / ml). After culturing overnight (approximately 14 hours), the formed colonies were treated as E. coli strains retaining each plasmid. First, the cells were inoculated into 3 ml of LB liquid medium supplemented with ampicillin (final concentration 50 μg / ml) and pre-cultured for 8 hours. Then, 20 ml of the same medium was mixed with 2% glucose at its final concentration and the main culture was performed (1 / 100th the amount added from the pre-culture). The main culture was performed at 30°C and 180 rpm, and total RNA was extracted from the E. coli cells after 24 hours. Isogen (Nippon Gene) was used for RNA extraction. cDNA was synthesized from the total RNA using the THUNDERBIRD SYBR qPCR RT kit (Toyobo). Using the cDNA as a template, primers for each gene detection were mixed with THUNDERBIRD SYBR qPCR mix (Toyobo), and qPCR analysis was performed using a LightCycler 96 system real-time PCR instrument (Roche). The primers used were as shown below. The qPCR mix consisted of 10 μl THUNDERBIRD SYBR qPCR mix, 1 μl of each primer (50 μM), 7 μl ddH2O, and 1 μl cDNA, and PCR was performed in the following cycle (95 °C for 2 minutes; 95 °C for 10 seconds, 55 °C for 20 seconds for 45 cycles; and then incubated at 72 °C for 20 seconds). mRNA levels of the pha gene group were quantified by measuring phaC1, and 16S rRNA (rrsA) was used as the internal standard for analysis using Relative Quantification software (Roche). The results were averaged from three samples, and the error is shown. Primers for qPCR qPCR phaC1(STQK)-F TGCGTGGAAAAGATCTGCTG (SEQ ID NO: 12) qPCR phaC1(STQK)-R TCAGCTCGATGCCAAAATGC (SEQ ID NO: 13) qPCR rrsA-F TGCATCTGATACTGGCAAGC (Sequence ID 14) qPCR rrsA-R TACGCATTTCACCGCTACAC (Sequence ID 15)
[0068] (3) Measurement of P(LA-co-3HB) production volume (GC-FID method) Competent cells of E. coli strain BW25113, prepared using the CaCl2 method, were transformed with each plasmid and plated onto agar plates in LB-ampicillin (final concentration 50 μg / ml). After incubation overnight (approximately 14 hours), the formed colonies were treated as E. coli strains retaining each plasmid. First, 3 ml of LB liquid medium supplemented with ampicillin (final concentration 50 μg / ml) was inoculated and pre-cultured for 8 hours. Then, 20 ml of the same medium was mixed with 2% glucose at its final concentration and the main culture was performed (1 / 100th the amount added from the pre-culture). The culture was carried out at 30°C and 180 rpm, and after 48 hours, the cells were harvested and the production of P(LA-co-3HB) was measured.
[0069] The collected bacterial cells were washed once each with 100% methanol, 50% methanol, and ddH2O, and then freeze-dried for 48 hours (-20°C for 6 hours, -10°C for 6 hours, 0°C for 12 hours, and 20°C for 24 hours). Subsequently, 2 ml of chloroform, 1.7 ml of methanol, and 0.3 ml of sulfuric acid were added to the dried bacterial cells in that order, and the mixture was reacted at 100°C for 2 hours to methylate the polymer. The reaction solution was cooled to room temperature, 1 ml of ddH2O was added, and the mixture was thoroughly stirred, followed by centrifugation at 6000 rpm for 10 minutes. The lower chloroform layer was then collected and used as the analytical sample.
[0070] 150 μl of the analytical sample was mixed with 150 μl of a liquid containing chloroform and the internal standard methyl benzoate in a 1000:1 ratio to make 300 μl. From this mixture, 1 μl was taken as a sample and analyzed using GC-FID (GC353B, inert cap 1, HG260, GL Sciences). The amount of polymer produced was calculated by creating a calibration curve using methyl DL-lactic acid and methyl 3-hydroxybutyrate as standard substances, and the concentration in chloroform and the area ratio of the internal standard methyl benzoate to the standard substances.
[0071] (B) Results (1) Measurement of expression levels at the mRNA level Using four plasmids, pTV118NpctphaC1AB(STQK), pTV118Npct-PyliHC1AB(STQK), pTV118Npct-PtreAC1AB(STQK), and pTV118Npct-PdpsC1AB(STQK), the mRNA expression levels of the phaC1AB gene, which is involved in P(LA-co-3HB) production, were measured (Figure 1). pTV118NpctphaC1AB(STQK) is the original promoter of the phaC1AB gene (P re pTV118Npct-PyliHC1AB(STQK) has the promoter of the E. coli yliH gene, pTV118Npct-PtreAC1AB(STQK) has the promoter of the E. coli treA gene, and pTV118Npct-PdpsC1AB(STQK) has the promoter of the E. coli dps gene.
[0072] The yliH gene, treA gene, and dps gene are all genes expressed when Escherichia coli transitions from exponential growth to the stationary phase. The inventors have previously investigated the promoter strength of such stationary-phase genes (Tomohiro Shimada et al., J. Bacteriol. 2004 Nov;186(21):7112-22). Among the many promoters investigated by the inventors, the yliH gene promoter was relatively moderate in strength, the treA gene promoter was low in strength, and the dps gene promoter was high in strength.
[0073] As shown in Figure 1, the expression levels of pTV118Npct-PdpsC1AB(STQK) (D in the figure), pTV118Npct-PyliHC1AB(STQK) (Y in the figure), and pTV118Npct-PtreAC1AB(STQK) (T in the figure) are as follows: re The expression levels of the phaC1AB gene were approximately 6.7 times, 5.5 times, and 0.5 times, respectively, and the expression levels of the phaC1AB gene corresponded to the promoter strength.
[0074] (2) Measurement of P(LA-co-3HB) production volume We used four plasmids—pTV118NpctphaC1AB(STQK), pTV118Npct-PyliHC1AB(STQK), pTV118Npct-PtreAC1AB(STQK), and pTV118Npct-PdpsC1AB(STQK)—to measure the production of P(LA-co-3HB) (Figure 2).
[0075] As shown in Figure 2, the production of P(LA-co-3HB) is highest for pTV118Npct-PyliHC1AB(STQK) (Y in the figure), and pTV118NpctphaC1AB(STQK) (P in the figure) reThe production volume was approximately 2.1 times that of pTV118Npct-PtreAC1AB(STQK) (T in the figure), despite low expression levels of the phaC1AB gene (Figure 1), and the production volume of P(LA-co-3HB) was high, not much different from that of pTV118Npct-PdpsC1AB(STQK) (D in the figure).
[0076] (3) Measurement of P(LA-co-3HB) production at high glucose concentrations As described above, the use of pTV118Npct-PyliHC1AB(STQK) increased the production of P(LA-co-3HB), which may have led to an increase in glucose consumption as a raw material. Therefore, the glucose concentration in the culture medium was changed from 2% to 3%, and the culture was performed to measure the production of P(LA-co-3HB) (Figure 3).
[0077] As shown in Figure 3, pTV118NpctphaC1AB(STQK)(P in the figure) re The production of ) was similar to that at a glucose concentration of 2%, but the production of pTV118Npct-PyliHC1AB(STQK) (Y in the figure) increased to approximately 3.5 times that at a glucose concentration of 2%. [Industrial applicability]
[0078] This invention is applicable to industries related to bioplastics.
Claims
1. A plasmid having a gene and a promoter, wherein the gene is a combination of the following genes (a), (b), and (c1), or the following combination of the following genes (a), (b), and (c2), and the promoter is the following DNA (d1), (d3), (d4), or (d6), (a) A gene encoding a protein comprising the amino acid sequence shown in Sequence ID No. 17, which catalyzes the reaction in which acetoacetyl-CoA is formed from two molecules of acetyl-CoA. (b) A protein comprising the amino acid sequence shown in Sequence ID No. 19, comprising a gene encoding a protein that catalyzes the reduction reaction of acetyl-CoA, (c1) A gene encoding a protein that catalyzes the synthesis reaction of polyhydroxyalkanoic acid, consisting of an amino acid sequence in which one or more amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in SEQ ID NO: 21 are substituted with other amino acids. (c2) A gene encoding a protein that catalyzes the synthesis reaction of polyhydroxyalkanoates, wherein one or more amino acids at positions 130, 325, 477, and 481 of the amino acid sequence shown in Sequence ID No. 21 are substituted with other amino acids, and furthermore, 1 to 10 amino acids other than those at positions 130, 325, 477, and 481 are deleted or substituted, or 1 to 10 amino acids are inserted. (d1) DNA consisting of the base sequence shown in Sequence ID No. 1, (d3) DNA consisting of a base sequence having 90% or more sequence identity with the base sequence shown in Sequence ID No. 1, and having promoter activity, (d4) DNA consisting of the base sequence shown in Sequence ID No. 2, (d6) DNA comprising a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID No. 2, and possessing promoter activity.
2. Furthermore, the plasmid according to claim 1 is characterized by having a gene encoding a protein that catalyzes a reaction in which CoA is transferred to propionic acid and / or lactate.
3. A microorganism characterized by being transformed with the plasmid described in claim 2.
4. The microorganism according to claim 3, characterized in that the microorganism is Escherichia coli.
5. A method for producing a copolymerized polyester comprising 3-hydroxybutyric acid and lactic acid, characterized by comprising: (1) a step of culturing a microorganism described in claim 3 or 4 in a culture medium containing a carbon source; and (2) a step of recovering the copolymerized polyester from the culture obtained in step (1).
Citation Information
Patent Citations
Cells or plants capable of producing polylactic acid or its copolymer, and method for producing polylactic acid or its copolymer using the same
JP2008541719A
Gene-recombinant coryneform bacterium, and method for producing lactic acid-containing polyester
JP2012152171A
Mutant poly-3-hydroxyalcanoic acid synthases
WO2003100055A1
Method for production of polyester copolymer using genetically modified microorganism
WO2009131186A1