Methods, systems, and devices for processing sequence data

Abstract

Embodiments of the present disclosure are directed to systems, apparatus, devices, and methods for processing sequencing data to determine the identity of DNA fragments from multiple reads contained in a sequencing data file.

Description

Technical Field

[0001] Related Applications This disclosure claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 089,432, filed Oct. 8, 2020, the entire disclosure of which is hereby incorporated by reference in its entirety.

[0002] Embodiments of the present disclosure are particularly directed to systems, devices, and methods for determining sequences, and more specifically, for example, systems, devices, and methods for determining the sequence of a gene fragment, including processing sequencing reads to remove adapter data.

[0003] Incorporation by Reference of Sequence List<on This application contains a sequence list submitted in ASCII format via EFS-Web, the entire disclosure of which is hereby incorporated by reference. A copy of the above ASCII was created on Oct. 8, 2021, named "NATE-050_001WO_SeqList_ST25.txt", and is approximately 14 kilobytes in size.

Background Art

[0004] Processing genetic data is a time-consuming and difficult task. Sequencing reads result in a large amount of data that needs to be processed to generate the data resulting in the desired gene sequence (e.g., the sequence of a gene fragment). Therefore, in order to provide faster results, a process for increasing the speed of processing such data is desirable.

Summary of the Invention

[0005] The embodiments disclosed herein enable an increase (in some embodiments, a significant increase) in the processing speed of processing genetic data and an improvement in the specificity of the results.

[0006] Accordingly, in some embodiments, a sequencing data processing method is provided to assist in determining the identity of DNA (in some embodiments, fragments of DNA) from a plurality of sequencing reads contained in a sequencing data file. The method includes performing a plurality of adapter trimming passes. The adapter trimming passes include, for each sequencing read, a first trimming pass in which adapter bp can be removed from the sequence, beginning with a base pair ("bp") that is one base longer than a known insert length (in some embodiments, at least one base longer, and in some embodiments, a predetermined number of bases longer), and a first predetermined number of bp of the adapter is used to find a match in the sequence, taking into account a limited number of possible overlaps; and a limited number of second trimming passes performed at any point along the read, each including matching one or more adapters with a first predetermined number of bp of the adapter, which is obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass, if the read is longer than a predetermined number of bp after the first trimming pass. Through a limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bps, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bps. In some embodiments, the method may also optionally include relabeling the insert bps using information from one or more trimming passes.

[0007] In such embodiments, one and / or other (in some embodiments, more than, most, substantially all, and in some embodiments, all) of the following additional features, functions, functionalities, steps, and / or clarifications give rise to further embodiments of the Disclosure. - The first trimming pass may be initiated at a specific bp (bp27 in some embodiments), - The first trimming pass is performed only if the read is at least 36 bp long (in some embodiments, at least a predetermined length of bp or a predetermined range of bp lengths). -For the first trimming pass, the first predetermined number of bp of the adapter is 10 bp (a predetermined number of bp in some embodiments), - A predetermined number of additional bp comprises 1 to 2 bp (or a predetermined number of additional bp in some embodiments), -Multiple sequencing reads from one or more sequencing data files ("SDF"), • Multiple sequencing reads comprise multiple single-ended reads and multiple paired-ended reads. Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). Regarding paired-end reeds, the first R1 of the two SDFs contains the forward-facing reed of the paired-end reed, and the second R2 of the two SDFs contains the reverse-facing reed of the paired-end reed. Each SDF comprises a predetermined number of rows (in some embodiments, multiple rows of information; in some embodiments, at least four rows of information; in some embodiments, four rows of information), the second row containing sequencing data, and the fourth row containing a quality score for the sequencing data. • The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. Regarding paired ends, the sequence rows of R1 can be from bp1 to the last bp, and the sequence rows of R2 can be from the last bp to bp1. - For multiple sequencing reads, perform at least one additional processing step selected from the group consisting of stitching, extraction, first matching, deduplication, and second matching. -Perform a stitching step that includes one or more (preferably all) of the following: For each paired-end read, the first sequencing read (R1) of the paired-end read is overlapped with the second sequencing read (R2) of the paired-end read, and the overlapping portion is compared. If the reads do not match, select either R1 or R2, whichever has the higher quality score, or if the quality scores are equal, The calculation involves progressively calculating at least one region score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​for mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. • Using numbering from R1, trim the selected reads to a predetermined number of bp (e.g., 26 bp). -The extraction step includes separating each read into a unique molecular identifier ("UMI") and a barcode. - A first matching step is performed, which involves matching each read against a library of expected barcodes (e.g., a hash table) with a given error rate. • If the barcode from the read is shortened, the last bp is given as "N", so the remaining predetermined number of bp must exactly match the identifier in the library. • If precise matching of barcodes is specified, a predetermined number of base pairs (bp) of the reads will not be matched. If no match is found, the read is saved to memory. - For each barcode ("NMBC") that does not match through the first matching, a second matching step is performed, which includes matching the UMI of the NMBC with the UMIs of barcodes that previously matched through the first matching, and if a UMI is found, the NMBC is compared with the barcode of the found UMI, and a match is confirmed, allowing for multiple mismatched bp.

[0008] In some embodiments, a sequencing data processing method is provided to assist in determining the identity of DNA fragments from multiple reads contained in a sequencing data file, comprising, for each paired-end read, overlapping the first sequencing read (R1) of the paired-end read with the second sequencing read (R2) of the paired-end read and comparing the overlapping portions. If the reads do not match, one of R1 and R2 with a higher quality score is selected, or if the quality scores are equal, at least one region score is progressively calculated for R1 and R2 until one of R1 and R2 has a higher quality score, the calculation comprising adding the quality score values ​​of the mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, selecting the read with the higher total quality score, and trimming the selected read to a predetermined number of bp (e.g., 26 bp) using numbering from R1.

[0009] In such embodiments, one and / or other of the following additional features, functions, capabilities, steps, and / or clarifications (in some embodiments, more than, the majority, substantially all, and in some embodiments, all) give rise to further embodiments of the Disclosure. - For multiple sequencing reads, perform at least one additional processing step selected from the group consisting of adapter trimming, extraction, first matching, deduplication, and second matching. -Adapter trimming includes, for each sequencing read, a first trimming pass that includes removing adapter bp from the sequence, which is a first trimming pass that may begin with a bp that is one nucleotide longer than the known insert length, and includes using a predetermined number of bp of the adapter to find a match in the sequence considering a limited number of possible overlaps, -Optionally, after the first trimming pass, if the read is longer than a predetermined number of bp, a limited number of second trimming passes are made at any point along the read, each involving matching one or more adapters to the first predetermined number of bp of the adapter with a predetermined number of additional bp from the previous trimming pass, so that each single-ended read may ultimately be trimmed to a specific number of bp of single-ended, and each paired-ended read may ultimately be trimmed to a specific number of bp of paired-ended, and optionally, the insert bp are relabeled using information from one or more trimming passes. - The first trimming pass may start at bp27 (or a predetermined bp in some embodiments), - The first trimming pass is performed only when the read is at least 36 bp long (or, in some embodiments, a predetermined length of bp). -For the first trimming pass, the first predetermined number of bp of the adapter is 10 bp (a predetermined number of bp in some embodiments), - A predetermined number of additional bp comprises 1 to 2 bp (or a predetermined range of bp in some embodiments), -Read multiple sequencing reads from one or more sequencing data files ("SDF"), • Multiple sequencing reads comprise multiple single-ended reads and multiple paired-ended reads. Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). Regarding paired-end reeds, the first R1 of the two SDFs contains the forward-facing reed of the paired-end reed, and the second R2 of the two SDFs contains the reverse-facing reed of the paired-end reed. Each SDF comprises a predetermined number of rows (in some embodiments, multiple rows of information; in some embodiments, at least four rows of information; in some embodiments, four rows of information), the second row containing sequencing data, and the fourth row containing a quality score for the sequencing data. • The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. Regarding paired ends, the R1 sequence row can be from base pair ("bp") 1 to the last bp, and the R2 sequence row can be from the last bp to bp1. -The extraction process involves separating each read into a unique molecular identifier ("UMI") and a barcode. - A first matching is performed, which involves matching each read against a library of expected barcodes (e.g., a hash table) with a given error rate. • If the barcode from the read is shortened, the last bp is given as "N", so the remaining predetermined number of bp must exactly match the identifier in the library. • If precise matching of barcodes is specified, a predetermined number of base pairs (bp) of the leads will not be matched. If no match is found, the read is saved to memory. - For each barcode ("NMBC") that does not match through the first matching, a second matching is performed, which includes matching the UMI of the NMBC with the UMI of the barcodes that previously matched through the first matching, and if a UMI is found, the NMBC is compared with the barcode of the found UMI, and a match is confirmed, allowing for multiple mismatched bp.

[0010] In some embodiments, a sequencing data processing method is provided for determining the identity of DNA fragments from a plurality of reads contained in a sequencing data file, and includes reading a plurality of sequencing reads from one or more sequencing data files ("SDF"). The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, each single-ended read comprising a single SDF ("R1") and each paired-ended read comprising two SDFs ("R1", "R2"). For a paired-ended read, the first R1 of the two SDFs comprises the forward read of the paired-ended read, and the second R2 of the two SDFs comprises the reverse read of the paired-ended read. Each SDF contains four rows of information, the second row of which contains sequencing data, and the fourth row of which contains a quality score for the sequencing data. The sequencing data for each read includes insert data related to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data related to the bp of the corresponding adapter at the end of the insert, where, for paired ends, the R1 sequence row may be from base pair ("bp") 1 to the last bp, and the R2 sequence row may be from the last bp to bp 1.

[0011] The method further includes performing multiple processing steps on multiple sequencing reads, the processing steps being selected from the group consisting of trimming, stitching, extraction, first matching, deduplication, and second matching.

[0012] In some embodiments, trimming involves performing multiple adapter trimming passes. An adapter trimming pass is a first trimming pass that begins with a bp that is one base longer than a known insert length and includes removing adapter bps from the sequence by using a first predetermined number of bps of the adapter to find matches within the sequence considering a limited number of possible overlaps. Trimming also includes, after the first trimming pass, if the read is longer than a predetermined number of bps, performing at any location along the read a limited number of second trimming passes each including matching one or more adapters with the first predetermined number of bps of the adapter plus or minus a predetermined number of additional bps from the previous trimming pass.

[0013] In some embodiments, the limited number of trimming passes results in each single-end read ultimately being trimmed to a specific number of bps for single-end and each paired-end read ultimately being trimmed to a specific number of bps for paired-end. Optionally, the insert bps can be relabeled using information from one or more trimming passes.

[0014] In some embodiments, stitching involves overlapping R1 of a paired-end read with R2 of the paired-end read, comparing the overlapping portions, and if the reads do not match, selecting one of R1 and R2 that has a higher quality score. However, in some embodiments, if the quality scores are equal, at least one region score can be progressively calculated for R1 and R2 until one of R1 and R2 has a higher quality score. In some embodiments, the calculation includes adding the quality score values of non-matching bps, one bp to the left of the non-matching bps, and one bp to the right of the non-matching bps for each of R1 and R2 and selecting the read with the higher total quality score. The selected read can then be trimmed to 26 bps using the numbering from R1.

[0015] In some embodiments, the method further includes extraction, which includes separating each read into a unique molecular identifier ("UMI") and a barcode.

[0016] In some embodiments, the method further includes a first matching that includes matching each read against a library of expected barcodes (e.g., a hash table) at a given error rate. If the barcode from the read is truncated, the last bp is given as "N", so the remaining predetermined number of bps exactly match the identifier in the library. If an exact match for the barcode is defined, no collation of a predetermined number of bps of the read is performed, and if no match is found, the read is stored in memory.

[0017] In some embodiments, the method also includes deduplicating a plurality of reads.

[0018] In some embodiments, the method also includes a second matching that includes matching the UMI of each barcode that did not match via the first matching ("NMBC") against the UMIs of the barcodes that matched previously via the first matching. If a UMI is found, the NMBC can be compared to the barcode of the found UMI, allowing for a plurality of mismatched bps to confirm a match.

[0019] In such embodiments, one and / or another of the following additional features, functions, functionalities, steps, and / or clarifications (in some embodiments, a plurality, a majority, substantially all, in some embodiments, all) give rise to further embodiments of the present disclosure, - The first trimming pass can start at bp27 (in some embodiments, a predetermined bp), - The first trimming pass is only performed if the read / a read is at least 36 bp in length (in some embodiments, at least a predetermined length of bp or a predetermined range of lengths of bp), -For the first trimming pass, the first predetermined number of bp of the adapter is 10 bp (a predetermined number of bp in some embodiments), - A predetermined number of additional bp comprises 1 to 2 bp (or a predetermined number of additional bp in some embodiments), -During the first matching, the remaining number of bp had 11 bp, -During the second matching, the number of allowed mismatch bps is 1 bp or 2 bp (or a predetermined number of bp in some embodiments).

[0020] In some embodiments, a system and / or device is provided that performs any of the methods described above / disclosed herein. Such a system / device may include at least one computer, which may be a server, desktop, laptop, smartphone, tablet, and / or similar, that runs an application and / or computer instruction (which may be in the form of one or more application programs) configured on the system / device to cause the system / device to perform any of the embodiments of the methods described above / disclosed herein.

[0021] Accordingly, in some embodiments, the system / device includes at least one processor that accesses computer instructions configured to operate on the system / device and cause the system / device to perform any of the methods described above / disclosed herein.

[0022] In some embodiments, a data storage device or system is provided that stores data and / or computer instructions (which may be in the form of one or more application programs) that run on one or more processors, in order to cause one or more processors to perform any of the methods described above / disclosed herein.

[0023] It should be understood that any and all combinations of the above concepts and any additional concepts disclosed herein (provided that such concepts are not contradictory) are assumed to be part of the subject matter of the invention disclosed herein. In particular, all combinations of the subject matter of the claims appearing at the end of this disclosure are assumed to be part of the subject matter of the invention disclosed herein. It should also be understood that any terminology explicitly adopted herein, which may also appear in any disclosure invoked by reference, should be given meanings that are most consistent with the specific concepts disclosed herein.

[0024] The embodiments described above will become even clearer by referring to the following detailed description and accompanying drawings.

[0025] Those skilled in the art will understand that the drawings in this disclosure are for illustrative purposes only and are not intended to limit the scope of the subject matter of the inventions described herein. [Brief explanation of the drawing]

[0026] [Figure 1] Figure 1 shows sequence determination data read from 10 sequence determination reads (e.g., paired-end reads) from a data sequence determination file (e.g., fastq) according to one embodiment, where the depicted sequences correspond to sequence numbers 3 to 22.

[0027] [Figure 2A] Figure 2A shows the result of a trimming process applied to the first paired-end reads of 10 sequencing reads from Figure 1, according to one embodiment, where the depicted sequences correspond to sequence numbers 23-32.

[0028] [Figure 2B] Figure 2B shows the result of a trimming process applied to the second read of the paired-end reads of 10 sequencing reads from Figure 1, according to one embodiment, where the depicted sequences correspond to sequence numbers 33-42.

[0029] [Figure 3] Figure 3 shows the results of a stitching process applied to 10 sequencing reads from Figure 1 according to one embodiment, where the depicted sequences correspond to sequence numbers 43-52.

[0030] [Figure 4] Figure 4 shows the result of a first matching process of reads from Figure 1 according to one embodiment, where the depicted sequences correspond to sequence numbers 53-64.

[0031] [Figure 5] Figure 5 shows a preferred system and its components for performing sequence determination data processing according to one embodiment. [Modes for carrying out the invention]

[0032] Embodiments of this disclosure relate to methods, systems, and devices for processing sequencing data, particularly methods, systems, and devices for performing various processes on sequencing reads. Accordingly, some embodiments provide sequencing data processing methods for determining the identity of DNA fragments from a plurality of reads contained in a sequencing data file.

[0033] One notable feature of at least some embodiments of the present disclosure is the utilization of known fragment / insert sizes of sequencing reads, which allows for speeding up at least some processing steps of at least some embodiments of the sequencing data processing method, resulting in faster sequencing data processing than the prior art.

[0034] First, multiple sequencing reads are read from one or more sequencing data files ("SDFs"), which may be, for example, fastq files. A fastq file contains a text-based format for storing both biological sequences (e.g., nucleotide sequences) and their corresponding quality scores. Thus, sequence characters and associated quality scores are each encoded using a single ASCII character. Fastq files are a format commonly used to store the output of high-throughput sequencing instruments. Examples of such sequencing instruments include Illumina Corporation's (San Diego, California) MiSeq®, NovaSeq®, NextSeq® 550, and NexSeq® 2K instruments.

[0035] Multiple sequencing reads comprise at least one, preferably both, of multiple single-ended reads and multiple paired-ended reads. Each single-ended read comprises a single SDF (referred to herein as "R1"), and each paired-ended read comprises two SDFs (referred to herein as "R1" and "R2", respectively). Thus, for a paired-ended read, the first R1 of the two SDFs (R1 and R2) comprises the forward-direction read of the paired-ended read, and R2 of the two SDFs comprises the reverse-direction read of the paired-ended read. Figure 1 shows an example of such sequencing reads (e.g., 10 paired-ended sequencing reads).

[0036] In some embodiments, each SDF consists of four (4) rows of information, where one row of the SDF (e.g., the second row) contains sequencing data, and another row of the SDF (e.g., the fourth row) contains the associated quality score for the sequencing data. The sequencing data / rows for each read also include insert data related to the base pairs ("bp") of the insert (e.g., DNA fragment) and adapter data related to the bp of the associated adapter at the end of the insert. For paired ends, the R1 sequence row may be from base pair ("bp") 1 to the last bp, and the R2 sequence row may be from the last bp to bp1.

[0037] In some embodiments, the method further includes performing at least one processing step, and in some embodiments multiple processing steps, on at least one sequencing read, preferably on multiple sequencing reads. Such processing steps include, for example, trimming, stitching, extraction, first matching, deduplication, and second matching.

[0038] In some embodiments, trimming may be used, for example, to remove adapter information from insert information from one or more sequencing reads. In some embodiments, such trimming includes performing multiple adapter trimming passes. For example, in some embodiments, the first trimming pass may be performed starting at a bp that may be one bp longer than the known insert length (in some embodiments, the first trimming pass may start at a different bp position that is, for example, two, three, or four bp longer or shorter than the known insert length). In some embodiments, the first trimming pass may start at bp27. Furthermore, in some embodiments, the first trimming pass is performed only if the read is at least a predetermined number of bp long, for example, at least 36 bp long.

[0039] In some embodiments, a first trimming pass removes adapter bp from a sequence read using a first predetermined number of bp of the adapter to find a match in the sequence, taking into account a limited number of possible overlaps. In some embodiments, the first predetermined number of bp comprises 10 bp. In some embodiments, if the resulting read is longer than the predetermined number of bp after the first trimming pass, a limited number of second trimming passes may be made at any point along the read. In each second trimming pass, one or more adapters may match the first predetermined number of bp of the adapter plus or minus a predetermined number of additional bp from the previous trimming pass. In some embodiments, the predetermined number of additional bp comprises 1 to 2 bp. Figures 2A and 2B illustrate the results of trimming the read of Figure 1 according to such embodiments of the present disclosure.

[0040] In some embodiments, a limited number of trimming passes result in each single-ended read being ultimately trimmed to a specific number of single-ended bp, and each paired-ended read being ultimately trimmed to a specific number of paired-ended bp. Optionally, the insert bp may be relabeled using information from one or more trimming passes.

[0041] Therefore, in some embodiments, after trimming the adapter, the sequencing data processing method may also include stitching the sequencing reads. In some embodiments, stitching includes overlapping R1 of a paired-end read with R2 of a paired-end read, and then comparing the overlapping portions. If the reads do not match, the stitching process includes selecting the read (R1 and R2) that has the higher quality score.

[0042] However, if the quality scores are equal, in some embodiments, the stitching process includes progressively calculating at least one region score for R1 and R2 until one of the reads (R1 and R2) has a higher quality score than the other. In some embodiments, such calculation includes adding the quality score values ​​of the mismatched bp, a predetermined number of bp (e.g., 1 bp) to the left and right of the mismatched bp for each of R1 and R2, and then selecting the read that results in a higher total quality score. The selected read can then be trimmed to 26 bp using numbering from R1. Figure 3 is an example of the results of the stitching process for the reads in Figure 1.

[0043] For example, as shown below, for two (2) reads, namely R1 and R2, R1 is used as is, while R2 is used as the inverse complement (because it is the other strand). The letters above and below the sequence are the corresponding quality scores for each read. Thus, here F is greater than (37 vs 25). FFFFFFFFFFFFF:FFFFFFFFFF:F R1 ATTTGTAACCGACTTATGGAGCGAAG (Sequence ID 1) R2 ATTTGTAACCGACTAATGGAGCGAAG (Sequence ID 2) readFFFFFFFFFFFFFFFFFFFFFFFFFFFF

[0044] At position 15, R1 contains bp T, and at the same location, R2 contains A, and both bases have the same quality score (37). To determine which read to use, the region score of each read is calculated by adding the quality score values ​​of the bp 1 bp to the left of the bp in question (i.e., bp 15) and the bp 1 bp to the right of that bp. R1=:FF=25+37+37=99 R2 = FFF = 37 + 37 + 37 = 111

[0045] In this example, R2 wins because the calculated region score is larger (111 vs. 99). Therefore, the resulting final sequence is ATTTGTAACCGACTAATGGAGCGAAG (sequence number 2).

[0046] If adding the quality scores of adjacent bp (e.g., -1 and +1) still results in the same score, in some embodiments, the quality scores of other more distant bp (e.g., -2 and +2) are added until a different result is obtained between the reads. Thus, as stated above, the region scoring process described above may be further modified with respect to other respective scoring and other "calculations" of the same kind to select sequencing reads.

[0047] In some embodiments, the sequencing data processing method may further include an extraction process, which includes separating each read into a unique molecular identifier ("UMI") and a barcode.

[0048] In some embodiments, the method may further include a first matching step. The first matching step includes matching each read against a library of expected barcodes (e.g., hash tables and / or similar) with a given error rate. Thus, in this process, if the barcode from the read is "shortened", the last bp is given as "N", which can be any base. In some embodiments, the matching may be allowed to occur with one (1) error (i.e., a mismatch). Thus, if the last base is missing (due to a shorter sequence), "N" may be added. "N" is not a match because it is not A, C, G, or T. Then, an exact match may be required from the remaining 11 bp. Thus, a predetermined number of remaining bp exactly matches an identifier in the library. In some embodiments, if an exact match for the barcode is specified, a predetermined number of bp of the read is not matched, and / or if no match is found, the read may be stored in memory. In some embodiments, during the first matching, the remaining number of bp comprises, for example, 11 bp. Figure 4 is an example of such a matching process for the reads in Figure 1 after trimming (Figures 2A-2B).

[0049] In some embodiments, the method also includes deduplication of multiple reads (see, for example, Smith, TS et al., UMI tool: Modeling sequencing errors of unique molecular identifiers to improve accuracy of quantification, Cold Spring Harbor Laboratory Press (January 18, 2017), which is hereafter incorporated by reference).

[0050] In some embodiments, the method also includes a second matching. In some embodiments, the second matching is a process in which, for each barcode that does not match via the first matching (unmatched barcode "NMBC"), the second matching matches the UMI of the NMBC among the UMIs of previously matched barcodes (matched via the first matching). Thus, if a UMI is found, the NMBC can be compared to the barcode of the found UMI, and a match can be confirmed by allowing multiple mismatched bp. In some embodiments, during the second matching, the multiple allowed mismatched bp may consist of (e.g.) 1 bp or 2 bp. For this purpose, at least some embodiments of the methods and systems disclosed herein can be used in conjunction with the embodiments described in U.S. Patent Application Publication 2019 / 0249248 to assemble a sequence of amplified products from the probe described therein, thereby verifying the identifier oligonucleotide and spatially detecting the target sample.

[0051] Sequence determination data processing system and software One and / or other embodiments of the process (and / or steps thereof) described above may be performed in one or more computing devices / systems (and / or components thereof), an example of which can be found in Figure 5. As shown, system 500 may include, for example, an access device 510, a platform 550, and a network 520. Such systems, devices, and platforms may include one or more processors 511, 552 (e.g., microprocessors, CPUs, GPUs, etc.), one or more computer-readable RAMs, one or more computer-readable ROMs, and one or more computer-readable storage media (all of which may be referred to as memories 515, 560, but may be separate structures, e.g., remote data storage devices that communicate with system 500 and / or components of system 500). Other components / functionalities include device drivers, read / write drives, interfaces (e.g., 512, 556), and network adapters or interfaces, all of which may be interconnected on a communication network 520 (e.g., via 514, 558, which may be referred to as network adapters). The network adapters communicate with the network 520, and the communication network may be implemented using any architecture designed to pass data and / or control information between processors (such as microprocessors, communications, and network processors), system memory, peripheral devices, and any other hardware components in the system.

[0052] One or more operating systems and one or more application programs (e.g., 554), such as sequencing data processing applications according to embodiments of this disclosure, which may reside on the sequencing data platform 550, may be stored in one or more computer-readable storage media for execution by one or more processors via one or more of their respective RAMs (typically including cache memory). In some embodiments, each of the computer-readable storage media may be a magnetic disk storage device of an internal hard drive, a CD-ROM, DVD, memory stick, magnetic tape, magnetic disk, optical disk, semiconductor storage device such as RAM, ROM, EPROM, flash memory, or any other computer-readable medium (e.g., tangible storage device) capable of storing computer programs and digital information.

[0053] The user device and / or sequencing data processing system / platform may also include a read / write (R / W) drive or interface for reading from and writing to one or more portable computer-readable storage media (or cloud-based data storage devices). Application programs on the viewing device and / or user device (e.g., 510) may be stored on one or more of the portable computer-readable storage media, read via their respective R / W drives or interfaces, and loaded onto their respective computer-readable storage media. The user device and / or sequencing data processing system / platform may also include a network adapter or interface, such as a Transmission Control Protocol (TCP) / Internet Protocol (IP) adapter card or a wireless communication adapter (such as a 4G or 5G wireless communication adapter using Orthogonal Frequency Division Multiple Access (OFDMA) technology). For example, an application program may be downloaded from an external computer or external storage device to the computing device via a network (e.g., 520, the Internet, a local area network or other wide area network, or a wireless network) and a network adapter or interface. The program may be loaded onto computer-readable storage media from the network adapter or interface. The network may include copper wires / cables, fiber optic cables / cables, wireless transmission, routers, firewalls, switches, gateway computers, and / or edge servers. User devices and / or sequencing data processing systems / platforms may also include one or more output devices or interfaces (e.g., display screens) and one or more input devices or interfaces (e.g., keyboards, keypads, mice, or pointing devices, touchpads). For example, a device driver may interface to an output device or interface for imaging, and to an input device or interface for user input or user selection (e.g., via pressure or capacitive sensing).Device drivers, R / W drives or interfaces, and network adapters or interfaces may include hardware and software (stored on computer-readable storage media and / or ROM).

[0054] In some embodiments, the sequencing data processing system / platform (and its methods) may be a standalone network server or represent functionality integrated into one or more network systems. The user device 510 and / or the sequencing data processing system / platform 550 may be a laptop computer, a desktop computer, a dedicated computer server, or any other computer system known in the art. In some embodiments, the sequencing data processing system may represent a computer system using clustered computers and components to function as a seamless single resource pool when accessed over a network (e.g., 520) such as a LAN, WAN, or a combination thereof. This embodiment may be particularly desired in data center and cloud computing applications. In general, the user device and / or the sequencing data processing system may be any programmable electronic device according to embodiments of the present disclosure, or any combination of such devices.

[0055] The programs described herein are identified based on the application in which such programs are implemented in a particular embodiment or embodiment of the disclosure. However, any specific program naming conventions used herein are for convenience only, and therefore the embodiments and embodiments of the disclosure should not be limited to use only in any particular application identified and / or suggested by such naming conventions.

[0056] Embodiments of the present disclosure may be, or may use, one or more devices, systems, methods (see, for example, above), and / or computer-readable media, integrated at any possible level of technical detail. Computer-readable media may include computer-readable storage media (or media(s)) having computer-readable program instructions for causing a processor to perform one or more embodiments of the present disclosure. Computer-readable (storage) media may be tangible devices capable of holding and storing instructions used by instruction execution devices. Computer-readable media may be, but are not limited to, non-temporary storage media including, for example, electronic storage devices, magnetic storage devices, optical storage devices, electromagnetic storage devices, semiconductor storage devices, or any preferred combination thereof. A non-exhaustive list of more specific examples of computer-readable storage media includes, namely, portable computer diskettes, hard disks, random access memory (RAM), read-only memory (ROM), erasable and programmable read-only memory (EPROM or flash memory), static random access memory (SRAM), portable compact disk read-only memory (CD-ROM), digital versatile disks (DVDs), memory sticks, floppy disks, mechanically encoded devices such as punch cards or grooved raised structures on which instructions are recorded, and any preferred combination of the above. Computer-readable storage media as used herein should not be construed as transient signals themselves, such as radio waves or other freely propagating electromagnetic waves, electromagnetic waves propagating through waveguides or other transmission media (e.g., light pulses passing through optical fiber cables), or electrical signals transmitted through wires, as described in embodiments of the present disclosure.

[0057] As described above, the computer-readable program instructions described herein may be downloaded from a computer-readable storage medium to each computing / processing device, or to an external computer or external storage device via a network, such as the Internet, a local area network, a wide area network, and / or a wireless network. The network may include copper wires / cables, fiber optic cables, wireless transmissions, routers, firewalls, switches, gateway computers, and / or edge servers. A network adapter card or network interface within each computing / processing device receives computer-readable program instructions from the network and transfers the computer-readable program instructions for storage in a computer-readable storage medium within each computing / processing device.

[0058] The computer-readable program instructions for performing the operations of the Disclosure may be assembler instructions, instruction set architecture (ISA) instructions, machine instructions, machine-dependent instructions, microcode, firmware instructions, state setting data, configuration data for integrated circuits, or source code or object code written in any combination of one or more programming languages, including object-oriented programming languages ​​such as Smalltalk, C++, or similar, and procedural programming languages ​​such as the C programming language or similar programming languages. The computer-readable program instructions may be fully executed on the user's computer, partially executed on the user's computer, executed as a standalone software package, partially executed on the user's computer and partially executed on a remote computer, or fully executed on a remote computer or server. In the latter deployment, the remote computer may be connected to the user's computer through any type of network (e.g., 520), including a local area network (LAN) or a wide area network (WAN), or a connection to an external computer may be made (e.g., via the Internet using an Internet service provider). In some embodiments, for example, an electronic circuit including a programmable logic circuit, a field-programmable gate array (FPGA), or a programmable logic array (PLA) can perform various aspects of the present disclosure by executing computer-readable program instructions by personalizing the electronic circuit using state information of computer-readable program instructions.

[0059] These computer-readable program instructions may be provided to a processor of a general-purpose computer, a special-purpose computer, or other programmable data processing device to produce a machine or system (see, for example, above) such that instructions executed via the processor of the computer or other programmable data processing device create means for implementing the functions / actions / steps / processes defined herein (for any embodiment of the disclosed method). These computer-readable program instructions may also be stored in a computer-readable storage medium that can be instructed to function in a manner specific to the computer, programmable data processing device, and / or other device, and the computer-readable storage medium storing the instructions may include a manufactured article containing instructions that implement the modes of functions / actions defined herein according to embodiments of the disclosure.

[0060] Computer-readable program instructions are also loaded onto a computer, other programmable data processing device, or other device to cause a series of operational steps to be performed on the computer, other programmable device, or other device, resulting in a computer implementation process, and instructions executed on a computer, other programmable device, or other device implement the functions / actions defined herein.

[0061] The various concepts of the inventions disclosed herein may be embodied in one or more methods (as described above), and at least one example thereof is provided. The actions performed as part of such methods may be ordered in any preferred manner. Thus, embodiments may be constructed in which the actions are performed in a different order than those shown, and may include some actions being performed simultaneously, even if they are shown as consecutive actions in the exemplary embodiments.

[0062] All references to any and all other publications and documents, including but not limited to patents, patent applications, articles, web pages, books, etc., presented anywhere in this application are incorporated herein by reference.

[0063] As stated elsewhere, the embodiments of the disclosed invention are described for illustrative purposes only and are not limiting. Other embodiments are possible and encompassed by this disclosure, as is evident from the teachings contained herein. For this reason, the breadth and scope of this disclosure should not be limited to any of the embodiments described above, but should be determined solely by the claims supported by this disclosure and its equivalents. Furthermore, embodiments of the subject matter disclosure may include methods, systems, and apparatus / devices that further include any all elements from any other disclosed methods, systems, and devices, including any all elements corresponding to the combination of systems, devices, and methods of event determination. In other words, elements from one or more disclosed embodiments may be interchangeable with elements from other disclosed embodiments. In addition, one or more features / elements of a disclosed embodiment may be removed, and still patentable subject matter may result (thus resulting in further embodiments of the subject matter disclosure). Furthermore, some embodiments correspond to systems, devices, and methods that specifically lack one and / or another (applicable) element, structure, and / or step compared to the teachings of the prior art, and as a result represent patentable subject matter and are distinguishable from the prior art (i.e., claims covering such embodiments may include negative limitations indicating the absence of one or more features of the teachings of the prior art).

[0064] All definitions set forth herein and used herein should be understood to take precedence over dictionary definitions, definitions in documents referenced by reference, and / or the ordinary meanings of the terms set forth herein.

[0065] As used herein and in the claims, the indefinite articles "a" and "an" should be understood to mean "at least one" unless explicitly indicated otherwise.

[0066] The terms "can" and "may" are used interchangeably in this disclosure to indicate that any element, component, structure, function, functionality, purpose, benefit, operation, step, process, apparatus, system, device, result, or elucidation referenced is possible to be used, included, occur, or otherwise represented in relation to the proposal shown in the description in which the terms are used (or referenced) for a specific embodiment.

[0067] As used herein and in the claims, the expression “and / or” should be understood to mean “either or both” of the elements thus combined, that is, elements that exist constitutively in some cases and disjunctively in others. Multiple elements enumerated by “and / or” should be interpreted in the same manner, that is, “one or more” of the elements are thus combined. Other elements other than those specifically identified by the “and / or” matters may exist, whether related to those specifically identified elements or not. For this reason, as a non-restrictive example, a reference to “A and / or B” when used with open-ended language such as “equipped with,” may refer to A only in one embodiment (optionally including elements other than B), B only in another embodiment (optionally including elements other than A), and both A and B (optionally including other elements), and so on.

[0068] When used herein and in the claims, “or” should be understood to have the same meaning as “and / or” as set forth above. For example, when separating items in a list, “or” or “and / or” should be understood to be inclusive, that is, to include not just at least one of many elements or a list of elements, but two or more, optionally, additional items not listed. Only terms that are clearly indicated as the opposite, such as “one of” or “exactly one of” or, when used in the claims, “consisting of,” refer to including exactly one element of many elements or a list of elements. In general, the term “or” as used herein should be understood to indicate an exclusive choice (i.e., “one or the other, but not both”) only when preceded by an exclusive term such as “either,” “one of,” “one of,” or “exactly one of.” When used in the claims, “essentially consisting of” should have the usual meaning as used in the field of patent law.

[0069] When used herein and in the claims, the expression “at least one” in a reference to a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element and all of the elements specifically enumerated in the list of elements, nor excluding any combination of elements in the list of elements. This definition also allows for the existence of elements other than those specifically identified in the list of elements to which the expression “at least one” refers, whether related to those specifically identified elements or not. Therefore, as a non-restrictive example, "at least one of A and B" (in other words, "at least one of A or B," or in other words, "at least one of A and / or B") may, in one embodiment, mean that there is at least one element that includes any two or more A's and no B (and optionally includes elements other than B); in another embodiment, mean that there is at least one element that includes any two or more B's and no A (and optionally includes elements other than A); and in yet another embodiment, mean that there is at least one element that includes any two or more A's and at least one element that includes any two or more B's (and optionally includes other elements).

[0070] In the claims and the above specification, all transitional phrases such as “equipment,” “include,” “possess,” “have,” “contain,” “involve,” “hold,” “compose of,” and similar phrases should be understood to be open-ended, that is, to mean including but not being limited to something. As described in Chapter 2111.03 of the U.S. Patent and Trademark Office Manual of Patent Examination Procedure, only the transitional phrases “compose of” and “essentially consist of” should be closed or semi-closed transitional phrases, respectively. Some aspects of the present invention are described below. 1. A sequencing data processing method for assisting in determining the identity of DNA fragments from multiple reads contained in a sequencing data file, the method comprising performing a plurality of adapter trimming passes, the adapter trimming passes comprising at least: For each sequencing read, a first trimming pass is provided, which includes removing adapter bp from the sequence, the first trimming pass beginning with a bp one nucleotide longer than the known insert length, and using a predetermined number of bp of the adapter to find a match in the sequence considering a limited number of possible overlaps. If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed at any point along the lead, each including matching one or more adapters with a first predetermined number of bp of the adapter obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass, As a result of the limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bp. Optionally, you can relabel the insert bp using information from one or more trimming passes, Methods that include... 2. The first trimming pass described above is the method described in item 1, starting at bp27. 3. The method according to any one of items 1 to 2, wherein the first trimming pass is performed only if the read / a read is at least 36 bp in length. 4. The method according to any one of items 1 to 3, wherein the first predetermined number of bp of the adapter is 10 bp. 5. The method according to any one of items 1 to 4, wherein the predetermined number of additional bp comprises 1 to 2 bp. 6. The method described in any of items 1-5, further comprising reading multiple sequencing reads from one or more sequencing data files ("SDF"). 7. The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four rows of information, the second row of which contains sequencing data, and the fourth row of which contains a quality score for the sequencing data. The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. The method according to item 6, wherein, for paired ends, the R1 sequence line is from base pair ("bp") 1 to the last bp, and the R2 sequence line is from the last bp to bp1. 8. The method according to any one of items 1 to 7, further comprising performing at least one additional processing step on the plurality of sequencing reads. 9. The method according to item 8, wherein the at least one additional processing step is selected from the group consisting of stitching, extraction, first matching, deduplication, and second matching. 10. Stitching is, For each paired-end read, the first sequencing read (R1) of the paired-end read is overlapped with the second sequencing read (R2) of the paired-end read, and the overlapping portion is compared. If the aforementioned reads do not match, select one of R1 and R2 which has the higher quality score, or if the aforementioned quality scores are equal, The process involves progressively calculating at least one region score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​for mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using numbering from R1, the selected reads are trimmed to a predetermined number of bp (e.g., 26 bp), The method described in item 9, including the method described in item 9. 11. Extraction as described in item 9, comprising separating each read into a unique molecular identifier ("UMI") and a barcode. 12. The method according to item 9, wherein the first matching involves matching each read against a library of expected barcodes (e.g., a hash table) with a given error rate. 13. Regarding the first matching, If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If an exact match for the barcode is specified, the verification of the predetermined number of base pairs (bp) of the lead is not performed. If no match is found, the read is stored in memory, as described in item 12. 14. The method of item 9, wherein for each barcode ("NMBC") that has not been matched via alignment matching, the UMI of the NMBC is matched with the UMIs of barcodes that have been previously matched via alignment matching, and if a UMI is found, the NMBC is compared with the barcode of the found UMI, and a match is confirmed, allowing for multiple mismatched bp. 15. A sequencing data processing method for assisting in determining the identity of DNA fragments from multiple reads contained in a sequencing data file, wherein the method includes a stitching process, and the stitching process is For each paired-end read, the first sequencing read (R1) of the paired-end read is overlapped with the second sequencing read (R2) of the paired-end read, and the overlapping portion is compared. If the aforementioned reads do not match, select one of R1 and R2 which has the higher quality score, or if the aforementioned quality scores are equal, The process involves progressively calculating at least one region score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​for mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using numbering from R1, the selected reads are trimmed to a predetermined number of bp (e.g., 26 bp), Methods that include... 16. The method according to item 15, further comprising performing at least one additional processing step on the plurality of sequencing reads. 17. The method according to item 16, wherein the plurality of processing steps are selected from the group consisting of adapter trimming, extraction, first matching, deduplication, and second matching. 18. Adapter trimming is at least, For each sequencing read, a first trimming pass is provided, which includes removing adapter bp from the sequence, the first trimming pass beginning with a bp one nucleotide longer than the known insert length, and using a predetermined number of bp of the adapter to find a match in the sequence considering a limited number of possible overlaps. If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed at any point along the lead, each including matching one or more adapters with a first predetermined number of bp of the adapter obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass, As a result of the limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bp. Optionally, the insert bp / a certain insert bp may be relabeled using information from one or more trimming passes. The method described in item 16, including the method described in item 16. 19. The first trimming pass described above is the method described in item 18, starting at bp27. 20. The method according to any one of items 18-19, wherein the first trimming pass is performed only if the read / a read is at least 36 bp in length. 21. The method according to any one of items 18 to 20, wherein the first predetermined number of bp of the adapter comprises 10 bp for the first trimming pass. 22. The method according to any one of items 18 to 21, wherein the predetermined number of additional bp comprises 1 to 2 bp. 23. The method described in any of items 18-22, further comprising reading multiple sequencing reads from one or more sequencing data files ("SDF"). 24. The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four rows of information, the second row of which contains sequencing data, and the fourth row of which contains a quality score for the sequencing data. The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. The method according to item 23, wherein, for paired ends, the R1 sequence line is from base pair ("bp") 1 to the last bp, and the R2 sequence line is from the last bp to bp1. 25. Extraction as described in item 17, comprising separating each read into a unique molecular identifier ("UMI") and a barcode. 26. The method of item 17, wherein the first matching involves matching each read against a library of expected barcodes (e.g., a hash table) with a given error rate. 27. Regarding the first matching, If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If an exact match for the barcode is specified, the verification of the predetermined number of base pairs (bp) of the lead is not performed. If no match is found, the read is stored in memory, as described in item 26. 28. The method of item 17, wherein for each barcode ("NMBC") that has not been matched via alignment matching, the UMI of the NMBC is matched with the UMIs of barcodes that have been previously matched via alignment matching, and if a UMI is found, the NMBC is compared with the barcode of the found UMI, and a match is confirmed, allowing for multiple mismatched bp. 29. A sequencing data processing method for determining the identity of DNA fragments from multiple reads contained in a sequencing data file, wherein the method is: Reading multiple sequencing reads from one or more sequencing data files ("SDF"), The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four rows of information, the second row of which contains sequencing data, and the fourth row of which contains a quality score for the sequencing data. The sequencing data for each read includes insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. Regarding paired ends, the R1 sequence line is from base pair ("bp") 1 to the last bp, and the R2 sequence line is from the last bp to bp1. Performing multiple processing steps on the aforementioned multiple sequence determination reads, The plurality of processing steps are selected from the group consisting of trimming, stitching, extraction, first matching, deduplication, and second matching. Trimming is, The method involves performing multiple adapter trimming passes, wherein the adapter trimming passes are: A first trimming pass comprising removing adapter bp from a sequence, the first trimming pass beginning with a bp one nucleotide longer than the known insert length, and including using a predetermined number of bp of the adapter to find a sequence match considering a limited number of possible overlaps, If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed at any point along the lead, each of which involves matching one or more adapters with a first predetermined number of bp of the adapter, obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass. As a result of the limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bp. Optionally, you can relabel the insert bp using information from one or more trimming passes, Includes, Stitching is, The process involves overlapping R1 of a paired lead with R2 of the same paired lead, and comparing the overlapping portion. If the aforementioned leads do not match, Choose either R1 or R2, which has a higher quality score, or If the aforementioned quality scores are equal, The process involves progressively calculating at least one region score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​for mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using the numbering from R1, the selected reads are trimmed to 26 bp, Includes, Extraction involves separating each read into a unique molecular identifier ("UMI") and a barcode. The first matching involves matching each read against a library of expected barcodes (e.g., a hash table) with a given error rate. If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If an exact match for the barcode is specified, the verification of the predetermined number of base pairs (bp) of the lead is not performed. If no match is found, the read is stored in memory. The aforementioned multiple reads are duplicated, The second matching involves matching the UMI of each unmatched barcode (unmatched barcode or "NMBC") with the UMI of previously matched barcodes via alignment matching, A method for confirming a match by comparing the NMBC with the barcode of the found UMI, allowing for multiple mismatched bps, if a UMI is found. 30. The first trimming pass described above is the method described in item 29, starting at bp27. 31. The method described in either item 29 or 30, wherein the first trimming pass is performed only if the read is at least 36 bp long. 32. The method according to any one of items 29 to 31, wherein the first predetermined number of bp of the adapter is 10 bp. 33. The method according to any one of items 29 to 32, wherein the predetermined number of additional bp comprises 1 to 2 bp. 34. During the first matching, the remaining number of bp is as described in any of items 29-33, comprising 11 bp. 35. The method according to any one of items 29 to 34, wherein, during the second matching, the plurality of allowed mismatch bps consist of 1 bp or 2 bps. 36. A system or device that performs any of the methods described in items 1 to 35. 37. At least one computer processor that has access to computer instructions configured to cause a server to perform one of the actions described in any of items 1 through 35. 38. A data storage device or system for storing data and / or computer instructions to operate on one or more processors, for causing one or more processors to perform any of the methods described in items 1 to 35, wherein the computer instructions are operablely included in an application program.

Claims

1. A sequencing data processing method for assisting in determining the identity of DNA fragments from multiple reads contained in a sequencing data file, the method comprising performing a plurality of adapter trimming passes, the adapter trimming passes comprising at least For each sequencing read, a first trimming pass includes removing adapter bp from the sequence, which begins with a first trimming pass that is one nucleotide longer than the known insert length, and includes using a predetermined number of adapter bp to find a match in the sequence considering a limited number of possible overlaps. If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed along the lead at any location, each including matching one or more adapters with a first predetermined number of bp of the adapter obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass, Includes, The method is such that, for single-ended reads, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and for paired-ended reads, each paired-ended read is ultimately trimmed to a specific number of paired-ended bp.

2. The method according to claim 1, wherein the first trimming pass is started at bp27.

3. The method according to any one of claims 1 to 2, wherein the first trimming pass is performed only when the lead / a certain lead is at least 36 bp in length.

4. The method according to any one of claims 1 to 3, wherein, with respect to the first trimming pass, the first predetermined number of bp of the adapter is 10 bp.

5. The method according to any one of claims 1 to 4, wherein the predetermined number of additional bp comprises 1 to 2 bp.

6. The method according to any one of claims 1 to 5, further comprising reading multiple sequencing reads from one or more sequencing data files ("SDFs").

7. The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four lines of information, the second line of which contains sequencing data, and the fourth line of which contains a quality score for the sequencing data. The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. The method according to claim 6, wherein, for paired ends, the sequence line of R1 is from base pair ("bp") 1 to the last bp, and the sequence line of R2 is from the last bp to bp1.

8. The method according to any one of claims 1 to 7, further comprising performing at least one additional processing step on the plurality of sequencing reads.

9. The method according to claim 8, wherein the at least one additional processing step is selected from the group consisting of stitching, extraction, first matching, deduplication, and second matching.

10. Stitching is, For each paired-end read, the first sequence determination read (R1) of the paired-end read is overlapped with the second sequence determination read (R2) of the paired-end read, and the overlapping portion is compared. If the aforementioned reads do not match, select one of R1 and R2 which has a higher quality score, or if the quality scores are equal, The process involves progressively calculating at least one domain score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​of the mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using numbering from R1, the selected leads are trimmed to a predetermined number of bp, The method according to claim 9, including the method described in claim 9.

11. The method according to claim 9, wherein the extraction comprises separating each read into a unique molecular identifier ("UMI") and a barcode.

12. The method according to claim 9, wherein the first matching comprises matching each read against a library of expected barcodes with a given error rate.

13. Regarding the first matching, If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If precise matching of the barcode is specified, the predetermined number of bp of the lead will not be matched. The method according to claim 12, wherein if no match is found, the read is stored in memory.

14. The method according to claim 9, wherein the second matching includes, for each barcode ("NMBC") that does not match via alignment matching, matching the UMI of the NMBC with the UMIs of barcodes that have previously matched via alignment matching, and if a UMI is found, comparing the NMBC with the barcode of the found UMI, and confirming a match, allowing for a number of mismatched bp.

15. A sequencing data processing method for assisting in determining the identity of DNA fragments from multiple reads contained in a sequencing data file, wherein the method includes a stitching process, and the stitching process is For each paired-end read, the first sequencing read (R1) of the paired-end read is overlapped with the second sequencing read (R2) of the paired-end read, and the overlapping portion is compared. If the aforementioned reads do not match, select one of R1 and R2 which has a higher quality score, or if the quality scores are equal, The process involves progressively calculating at least one domain score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​of the mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using numbering from R1, the selected leads are trimmed to a predetermined number of bp, Methods that include...

16. The method according to claim 15, further comprising performing at least one additional processing step on the plurality of sequencing reads.

17. The method according to claim 16, wherein the plurality of processing steps are selected from the group consisting of adapter trimming, extraction, first matching, deduplication, and second matching.

18. Adapter trimming is at least, For each sequencing read, a first trimming pass includes removing adapter bp from the sequence, which begins with a first trimming pass that is one nucleotide longer than the known insert length, and includes using a predetermined number of adapter bp to find a match in the sequence considering a limited number of possible overlaps. If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed along the lead at any location, each including matching one or more adapters with a first predetermined number of bp of the adapter obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass, Includes, The method according to claim 16, wherein, as a result of the limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bp.

19. The method according to claim 18, wherein the first trimming pass is started at bp27.

20. The method according to any one of claims 18 to 19, wherein the first trimming pass is performed only when the lead / a certain lead is at least 36 bp in length.

21. The method according to any one of claims 18 to 20, wherein, with respect to the first trimming pass, the first predetermined number of bp of the adapter is 10 bp.

22. The method according to any one of claims 18 to 21, wherein the predetermined number of additional bp comprises 1 to 2 bp.

23. The method according to any one of claims 18 to 22, further comprising reading multiple sequencing reads from one or more sequencing data files ("SDFs").

24. The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four lines of information, the second line of which contains sequencing data, and the fourth line of which contains a quality score for the sequencing data. The sequencing data for each read includes, and / or, insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. The method according to claim 23, wherein, for paired ends, the sequence line of R1 is from base pair ("bp") 1 to the last bp, and the sequence line of R2 is from the last bp to bp1.

25. The method according to claim 17, wherein the extraction comprises separating each read into a unique molecular identifier ("UMI") and a barcode.

26. The method according to claim 17, wherein the first matching includes matching each read against a library of expected barcodes with a given error rate.

27. Regarding the first matching, If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If precise matching of the barcode is specified, the predetermined number of bp of the lead will not be matched. The method according to claim 26, wherein if no match is found, the read is stored in memory.

28. The method according to claim 17, wherein the second matching comprises, for each barcode ("NMBC") that does not match via alignment matching, matching the UMI of the NMBC with the UMIs of barcodes that have previously matched via alignment matching, and if a UMI is found, comparing the NMBC with the barcode of the found UMI, and confirming a match, allowing for a number of mismatched bp.

29. A sequencing data processing method for determining the identity of DNA fragments from multiple reads contained in a sequencing data file, wherein the method is: This involves reading multiple sequencing reads from one or more sequencing data files ("SDFs"), The plurality of sequencing reads comprises a plurality of single-ended reads and a plurality of paired-ended reads, Each single-ended lead has a single SDF ("R1"), and each paired-ended lead has two SDFs ("R1", "R2"). With respect to paired-end leads, the first R1 of the two SDFs is provided with the forward-facing lead of the paired-end lead, and the second R2 of the two SDFs is provided with the reverse-facing lead of the paired-end lead. Each SDF contains four lines of information, the second line of which contains sequencing data, and the fourth line of which contains a quality score for the sequencing data. The sequencing data for each read includes insert data relating to the base pairs ("bp") of the insert (i.e., DNA fragment) and second adapter data relating to the bp of the corresponding adapter at the end of the insert. Regarding paired ends, the R1 sequence line is from base pair ("bp") 1 to the last bp, and the R2 sequence line is from the last bp to bp1. Performing multiple processing steps on the aforementioned multiple sequence determination reads, The plurality of processing steps are selected from the group consisting of trimming, stitching, extraction, first matching, duplicate removal, and second matching. Trimming is, The method involves performing multiple adapter trimming passes, wherein the adapter trimming passes are: A first trimming pass comprising removing adapter bp from a sequence, the first trimming pass beginning with a bp one nucleotide longer than the known insert length, and including using a predetermined number of adapter bp to find a sequence match considering a limited number of possible overlaps, If, after the first trimming pass, the lead is longer than a predetermined number of bp, a limited number of second trimming passes are performed at any point along the lead, each of which involves matching one or more adapters with a first predetermined number of bp of the adapter obtained by adding or subtracting a predetermined number of additional bp from the previous trimming pass. As a result of the limited number of trimming passes, each single-ended read is ultimately trimmed to a specific number of single-ended bp, and each paired-ended read is ultimately trimmed to a specific number of paired-ended bp. Includes, Stitching is, The process involves overlapping R1 of a paired lead with R2 of the same paired lead, and comparing the overlapping portion. If the aforementioned leads do not match, Choose either R1 or R2, which has a higher quality score, or If the aforementioned quality scores are equal, The process involves progressively calculating at least one domain score for R1 and R2 until one of R1 and R2 has a higher quality score, including adding the quality score values ​​of the mismatched bp, 1 bp to the left of the mismatched bp, and 1 bp to the right for each of R1 and R2, and selecting the read with the higher total quality score. Using the numbering starting from R1, the selected lead is trimmed to 26 bp, Includes, Extraction involves separating each read into a unique molecular identifier ("UMI") and a barcode. The first matching involves matching each read against a library of expected barcodes with a given error rate. If the barcode from the read is short, the last bp is given as "N", so the remaining predetermined number of bp must exactly match an identifier in the library. If precise matching of the barcode is specified, the predetermined number of bp of the lead will not be matched. If no match is found, the read is stored in memory. The aforementioned multiple reads are duplicated, The second matching involves matching the UMI of each unmatched barcode (unmatched barcode or "NMBC") with the UMI of previously matched barcodes via alignment matching, A method for confirming a match by comparing the NMBC with the barcode of the found UMI, allowing for multiple mismatches in the barcodes.

30. The method according to claim 29, wherein the first trimming pass is started at bp27.

31. The method according to claim 29 or 30, wherein the first trimming pass is performed only when the lead is at least 36 bp long.

32. The method according to any one of claims 29 to 31, wherein, with respect to the first trimming pass, the first predetermined number of bp of the adapter is 10 bp.

33. The method according to any one of claims 29 to 32, wherein the predetermined number of additional bp comprises 1 to 2 bp.

34. The method according to any one of claims 29 to 33, wherein during the first matching, the remaining number of bp comprises 11bp.

35. The method according to any one of claims 29 to 34, wherein during the second matching, the plurality of allowed mismatches bp comprises 1 bp or 2 bp.

36. A system that performs any of the methods described in claims 1 to 35.

37. A computer instruction configured to cause a server to perform any of the methods described in any of claims 1 to 35.

38. A data storage device for storing data and / or computer instructions that operate on one or more processors, for causing one or more processors to perform any of the methods according to claims 1 to 35, wherein the computer instructions are operablely included in an application program.

39. The method according to claim 1, further comprising relabeling the insert bp using information from one or more trimming passes.

40. The method according to claim 18, further comprising relabeling the insert bp / a certain insert bp using information from one or more trimming passes.

41. The method according to claim 29, further comprising relabeling an insert bp using information from one or more trimming passes.

42. The method according to claim 10, wherein trimming the selected lead to a predetermined number of bp includes trimming to 26 bp using numbering from R1.

43. The method of claim 15, wherein trimming the selected lead to a predetermined number of bp includes trimming to 26 bp using numbering from R1.

44. The method according to claim 12, wherein matching each read against a library includes matching each read against a hash table of expected barcodes with a given error rate.

45. The method according to claim 26, wherein matching each read against a library includes matching each read against a hash table of expected barcodes with a given error rate.

46. The method according to claim 29, wherein matching each read against a library includes matching each read against a hash table of expected barcodes with a given error rate.

47. A device that performs any of the methods described in Claims 1 to 35.

48. A data storage system for storing data and / or computer instructions that operate on one or more processors in order to cause one or more processors to perform any of the methods according to Claims 1 to 35, wherein the computer instructions are operablely included in an application program.

Images