Methods and products for expressing proteins in cells
Synthetic RNA molecules with non-standard nucleotides enhance protein expression and gene editing efficiency, addressing inefficiencies and toxicity issues in existing methods, enabling therapeutic applications for disease treatment.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- FACTOR BIOSCIENCE INC
- Filing Date
- 2024-02-08
- Publication Date
- 2026-06-19
AI Technical Summary
Existing RNA-based reprogramming and gene editing methods are inefficient, unreliable, and carry risks of mutation and uncontrolled mutagenesis, particularly when used in mature cells, and lack methods for simultaneous or sequential gene editing and reprogramming in somatic cells, especially in vivo.
Development of synthetic RNA molecules with low toxicity and high translation efficiency, incorporating non-standard nucleotides like 5-methylcytidine and 7-deazaguanosine, for efficient gene transfer, reprogramming, and gene editing, including methods for altering DNA sequences in vitro and in vivo, using modified nuclease and DNA-binding domains.
The synthetic RNA molecules achieve highly efficient and reliable protein expression and gene editing with reduced toxicity, enabling therapeutic applications such as cancer treatment and editing of genes related to diseases like diabetes, heart diseases, and cancer.
Smart Images

Figure 0007876562000029 
Figure 0007876562000030 
Figure 0007876562000031
Abstract
Description
[Technical Field]
[0001] Priority This application claims priority to U.S. Provisional Application No. 61 / 721,302 filed November 1, 2012, U.S. Provisional Application No. 61 / 785,404 filed March 14, 2013, and U.S. Provisional Application No. 61 / 842,874 filed July 3, 2013, the contents of which are incorporated herein by reference in their entirety. This application relates to U.S. Application No. 13 / 465,490 filed May 7, 2012, International Application No. PCT / US2012 / 067966 filed December 5, 2012, and U.S. Application No. 13 / 931,251 filed June 28, 2013, the contents of which are incorporated herein by reference in their entirety. The present invention relates, in part, to protein-coding nucleic acids, therapeutic agents comprising protein-coding nucleic acids, methods for using nucleic acids to induce cells to express proteins, methods, kits, and devices for gene transfer, gene editing, and reprogramming of cells, and cells, organisms, and therapeutic agents produced using these methods, kits, and devices.
[0002] Description of the electronically submitted text file The contents of the text file submitted electronically with this specification are incorporated in their entirety by reference: A computer-readable format copy of the Sequence Listing (filename: FABI_005_02WO_SeqList_ST25.txt, date recorded: October 30, 2013, file size: 255KB). [Background technology]
[0003] Synthetic RNA and RNA therapeutics Ribonucleic acid (RNA) is ubiquitous in both prokaryotic and eukaryotic cells, where it encodes genetic information in the form of messenger RNA, binds and transports amino acids in the form of transfer RNA, constructs amino acids into proteins in the form of ribosomal RNA, and performs numerous other functions, including regulating gene expression in the form of microRNA and long non-coding RNA. RNA can be produced synthetically by methods including direct chemosynthesis and in vitro transcription, and can be administered to patients for therapeutic purposes.
[0004] Cell reprogramming and cell therapy Cells can be reprogrammed by exposure to specific extracellular signals and / or by ectopic expression of specific proteins, microRNAs, etc. While several reprogramming methods have been previously described, most rely on ectopic expression and require the introduction of foreign DNA, which carries the risk of mutation. DNA-free reprogramming methods based on direct delivery of reprogramming proteins have been reported. However, these methods are too inefficient and unreliable for commercial use. Furthermore, RNA-based reprogramming methods have been described (see, for example, Angel. MIT Thesis. 2008. 1-56, Angel et al. PLoS ONE. 2010. 5, 107, Warren et al. Cell Stem Cell. 2010. 7, 618-630, Angel. MIT Thesis. 2011. 1-89, and Lee et al. Cell. 2012. 151, 547-558 (all of which are incorporated herein by reference)). However, existing RNA-based reprogramming methods are slow, unreliable, and inefficient when performed on mature cells; they require numerous gene transfers (resulting in significant expense and opportunities for error); they can only reprogram a limited number of cell types; they can only reprogram cells into a limited number of cell types; they require the use of immunosuppressants; and they require the use of multiple human-derived components, including blood-derived HSA and human fibroblast feeders. Many of the shortcomings of previously disclosed RNA-based reprogramming methods make them undesirable for both research and therapeutic applications.
[0005] gene editing Some spontaneously occurring proteins contain DNA-binding domains, such as zinc fingers (ZFs) and transcription activator-like effectors (TALEs), that can recognize specific DNA sequences. A fusion protein containing one or more of these DNA-binding and cleavage domains of a FokI endonuclease can be used to create double-strand breaks in desired regions of DNA in cells (see, for example, U.S. Patent Application Publications US2012 / 0064620, U.S. Patent Application Publications US2011 / 0239315, U.S. Patent No. 8,470,973, U.S. Patent Application Publications US2013 / 0217119, U.S. Patent No. 8,420,782, U.S. Patent Application Publications US2011 / 0301073, U.S. Patent Application Publications US2011 / 0145940, U.S. Patent No. 8,450,471, U.S. Patent No. 8,440,431, U.S. Patent No. 8,440,432, and U.S. Patent Application Publication 2013 / 0122581 (all of which are incorporated herein by reference)). However, current methods for gene editing cells are inefficient and carry the risk of uncontrolled mutagenesis, which makes them undesirable for both research and therapeutic applications. Methods for gene editing without DNA in somatic cells, nor methods for simultaneous or sequential gene editing and reprogramming of somatic cells, have not been previously investigated. Furthermore, methods for directly gene editing cells within a patient (i.e., in vivo) have not been previously investigated, and the development of such methods has been limited by undirected dimerization of the FokI cleavage domain, poor specificity of the DNA-binding domain, poor binding of the DNA-binding domain (partly due to other factors), lack of acceptable targets (partly due to excessive off-target effects), inefficient delivery, inefficient expression of gene-editing proteins / proteins, and inefficient gene editing by the expressed gene-editing proteins / proteins. Finally, the use of gene editing in antibacterial, antiviral, and anticancer therapies has not been previously investigated.
[0006] Therefore, the need for improved compositions and methods for protein expression in cells remains. [Overview of the project]
[0007] The present invention provides, in part, compositions, methods, articles, and devices for inducing cells to express proteins; methods, articles, and devices for producing these compositions, methods, articles, and devices; and compositions and articles comprising cells, organisms, and therapeutic agents produced using these compositions, methods, articles, and devices. Unlike previously reported methods, certain embodiments of the present invention do not involve exposing cells to foreign DNA or materials of the same species or animal origin, which makes the products produced according to the methods of the present invention useful for therapeutic applications.
[0008] In some embodiments, synthetic RNA molecules having low toxicity and high translation efficiency are provided. In one embodiment, a cell culture medium for highly efficient gene transfer, reprogramming, and gene editing of cells is provided. Other embodiments relate to a method for generating synthetic RNA molecules encoding reprogramming proteins. Further embodiments relate to a method for generating synthetic RNA molecules encoding gene editing proteins.
[0009] In one embodiment, the present invention provides a highly efficient gene-editing protein comprising a modified nuclease cleavage domain. In another embodiment, the present invention provides a high fidelity gene-editing protein comprising a modified nuclease cleavage domain. Another embodiment relates to a highly efficient gene-editing protein comprising a modified DNA-binding domain. A further embodiment relates to a high fidelity gene-editing protein comprising a modified DNA-binding domain. A further embodiment relates to a gene-editing protein comprising a modified repeat sequence. Some embodiments relate to methods for altering the DNA sequence of cells by introducing a gene-editing protein into cells or by inducing cells to express a gene-editing protein. Other embodiments relate to methods for altering the DNA sequence of cells present in an in vitro culture medium. A further embodiment relates to methods for altering the DNA sequence of cells present in vivo.
[0010] In some embodiments, the present invention provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of a gene-editing protein or a nucleic acid encoding a gene-editing protein. In one embodiment, the gene-editing protein can alter the DNA sequence of a cancer-related gene. In another embodiment, the cancer-related gene is the BIRC5 gene. Further embodiments relate to therapeutic agents comprising nucleic acids and / or cells, and methods for using therapeutic agents comprising nucleic acids and / or cells for the treatment of, for example, type 1 diabetes, heart diseases including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, tetracholastic anemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV / AIDS. In some embodiments, the nucleic acid comprises synthetic RNA. In other embodiments, the nucleic acid is delivered to cells using a virus. In some embodiments, the virus is a replicable virus. In another embodiment, the virus is a non-replicating virus.
[0011] Details of the present invention are described in the following accompanying description. Methods and materials similar to or equivalent to those described herein may be used in the practice or testing of the present invention, but exemplary methods and materials are described below. Other features, purposes, and advantages of the present invention will become apparent from this description and the claims. In this specification and the accompanying claims, singular nouns also include plural nouns unless the context specifies otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention pertains. [Brief explanation of the drawing]
[0012] [Figure 1A]This figure shows RNA encoding the indicated protein, isolated on a denatured formaldehyde-agarose gel, containing adenosine, 50% guanosine, 50% 7-deazaguanosine, 70% uridine, 30% 5-methyluridine, and 5-methylcytidine. [Figure 1B] This figure shows RNA encoding the indicated protein, isolated on a denatured formaldehyde-agarose gel, containing adenosine, 50% guanosine, 50% 7-deazaguanosine, 50% uridine, 50% 5-methyluridine, and 5-methylcytidine. [Figure 2] This figure shows primary human neonatal fibroblasts reprogrammed by five gene transfers of RNA encoding reprogramming proteins. The cells were fixed and stained for Oct4 protein. The nuclei were counterstained with Hoechst 33342. [Figure 3A] This is a diagram representing a primary human mature fibroblast. [Figure 3B] Figure 3A shows primary human mature fibroblasts that have been reprogrammed through seven gene transfers of RNA encoding reprogramming proteins. The arrows indicate colonies of the reprogrammed cells. [Figure 3C] This diagram shows a large colony of reprogrammed primary human mature fibroblasts. [Figure 4A] This diagram shows the locations of TALEN pairs that target the human CCR5 gene. Single lines indicate TALEN binding sites. Double lines indicate the locations of Δ32 mutations. [Figure 4B] This figure shows synthetic RNA encoding the TALEN pair shown in Figure 4A, separated on a denatured formaldehyde-agarose gel. [Figure 4C] This figure shows the results of a SURVEYOR assay testing the functionality of RNA in Figure 4B against human dermal fibroblasts (GM00609). The appearance of 760 bp and 200 bp bands in the sample produced from cells into which the RNA was transfected indicates successful gene editing. The percentages below each lane indicate the efficiency of gene editing (percentage of edited alleles). [Figure 4D] This figure shows the linear graphs of the "negative" and "TALEN" lanes in Figure 4C. The numbers indicate the combined intensity of the three bands compared to the total combined intensity. [Figure 4E] This figure shows the results of the SURVEYOR assay performed as shown in Figure 4C, including samples produced from cells that had undergone RNA gene transfer twice (lanes labeled "2×"). [Figure 4F] This figure illustrates simultaneous gene editing and reprogramming of primary human cells (GM00609) using synthetic RNA. The image shows a representative colony of the reprogrammed cells. [Figure 4G] Figure 4F shows the results of direct sequencing of the CCR5 gene in gene-edited and reprogrammed cells produced. Four of the nine lines tested contained deletions between TALEN binding sites, indicating efficient gene editing. [Figure 5] This figure shows the results of a SURVEYOR assay performed as shown in Figure 4C, except that RNA targeting the human MYC gene was used, containing either standard nucleotides ("A, G, U, C") or non-standard nucleotides ("A, 7dG, 5mU, 5mC"). The dark bands at 470 bp and 500 bp indicate highly efficient gene editing. [Figure 6] This figure shows the results of a SURVEYOR assay performed as shown in Figure 4C, except that RNA targeting the human BIRC5 gene was used, containing either standard nucleotides ("A, G, U, C") or non-standard nucleotides ("A, 7dG, 5mU, 5mC"). The dark band at 710 bp indicates highly efficient gene editing. [Figure 7A]Figure depicting HeLa cells (cervical cancer) transfected with RNA (RiboSlice) targeting the human BIRC5 gene. The cells were transfected with either a single RNA ("2x Survivin L") or each member of an equimolar RNA pair ("Survivin L + R"), and in each case the same total amount of RNA was delivered. As shown in the right panel, cells transfected with the RNA pair were enlarged and showed fragmented nuclei and markedly reduced proliferation, demonstrating the potent anti-cancer activity of RiboSlice. [Figure 7B] Figure depicting HeLa cells transfected with RNA targeting the human BIRC5 gene as shown in Figure 7A. The cells were then fixed and stained for survivin protein. Nuclei were counterstained with Hoechst 33342. Large fragmented cell nuclei transfected with RiboSlice are indicated by arrows. [Figure 8] Figure depicting primary human mature fibroblasts reprogrammed using synthetic RNA. Arrows indicate dense colonies of cells showing a morphology suggestive of reprogramming. [Figure 9] Figure depicting synthetic RNA encoding the indicated gene editing proteins separated on a denaturing formaldehyde-agarose gel. [Figure 10A] Figure showing the results of a SURVEYOR assay testing the efficacy of the RNA of Figure 9 on human skin fibroblasts. The cells were lysed approximately 48 hours after transfection. Bands corresponding to digestion products resulting from successful gene editing are indicated by asterisks. Lane designations are in the form "X.Y", where X means the exon from which the DNA was amplified and Y means the gene editing protein pair. For example, "1.1" means the gene editing protein pair targeting the region of exon 1 closest to the start codon. "X.N" means non-transfected cells. [Figure 10B]This figure shows the results of a SURVEYOR assay testing the toxicity of RNA in Figure 9 to human dermal fibroblasts. The cells were lysed 11 days after gene transfer. The lanes and bands are shown as in Figure 10A. The appearance of bands, indicated by asterisks, indicates that the transfected cells maintained a high viability. [Figure 11] This figure represents the results of a study designed to test the safety of RNA encoding gene-editing proteins in vivo. The graph shows the average body weight of four groups of mice (10 animals per group): one untreated group, one receiving only the medium, one treated with RiboSlice via intratumoral injection, and one treated with RiboSlice via intravenous injection. For all treated groups, animals received five doses every other day from day 1 to day 9. Animals were observed until day 17. The absence of statistically significant differences in average body weight among the four groups demonstrates the in vivo safety of RiboSlice. [Figure 12A] This figure shows the results of a SURVEYOR assay testing the effectiveness of gene-editing proteins containing various 36-amino acid repeat sequences. Human dermal fibroblasts were lysed approximately 48 hours after gene transfer of RNA encoding the gene-editing protein containing the indicated repeat sequence. Bands corresponding to digestion products resulting from successful gene editing are indicated by asterisks. Lane indications represent amino acids at the C-terminus of the repeat sequence. "Negative" indicates non-genetically modified cells. [Figure 12B] This figure shows the results of a SURVEYOR assay, which tests the effectiveness of gene-editing proteins with alternating repeat sequences of 36 amino acids in length. Human dermal fibroblasts were lysed approximately 48 hours after gene transfer of RNA encoding the gene-editing protein containing the indicated repeat sequence. Bands corresponding to digestion products resulting from successful gene editing are indicated by asterisks. Lane indications represent amino acids at the C-terminus of the repeat sequence. "Negative" indicates non-genetically modified cells. [Figure 13A]This figure represents the results of a study designed to test the safety and efficacy of RiboSlice AAV replication-deficient virus, which contains nucleic acids encoding gene-editing proteins in vivo. The graph shows the mean body weight of three groups of mice with subcutaneous tumors containing human glioma cells, including one untreated group (untreated control, "NTC", n=6), one group treated with AAV encoding GFP via intratumoral injection ("GFP", n=2), and one group treated with RiboSlice AAV encoding a gene-editing protein targeting the BIRC5 gene via intratumoral injection ("RiboSlice", n=2). Animals were administered on day 1 for the GFP group and on days 1 and 15 for the RiboSlice group. Animals were observed until day 25. The absence of statistically significant differences in mean body weight between the three groups demonstrates the safety of RiboSlice AAV in vivo. [Figure 13B] Figure 13A shows the normalized tumor volume of animals in the study. The slower increase in normalized tumor volume in the group treated with RiboSlice AAV compared to both the NTC and GFP groups demonstrates the in vivo efficacy of RiboSlice AAV. [Figure 14] Figure 12B shows the results of the SURVEYOR assay, which tests the effectiveness of gene-editing proteins. "RiboSlice" refers to gene-editing proteins in which every other repeat sequence is 36 amino acids long. "Wild-type" refers to non-genetically modified cells. [Figure 15] This figure shows RNA encoding the indicated protein, isolated on a denatured formaldehyde-agarose gel, containing adenosine, 50% guanosine, 50% 7-deazaguanosine, 60% uridine, 40% 5-methyluridine, and 5-methylcytidine. [Figure 16]This figure shows the results of an assay testing the integration of the repair template into the APP gene. The appearance of 562 bp and 385 bp bands in samples produced from cells transfected with RNA and the repair template indicates successful integration of the PstI restriction site. "-" indicates an undigested sample, and "+" indicates a sample treated with PstI restriction nuclease.
[0013] definition "Molecule" refers to molecular entities (molecules, ions, complexes, etc.).
[0014] The term "RNA molecule" refers to a molecule that contains RNA.
[0015] "Synthetic RNA molecules" refer to RNA molecules that are produced outside or inside cells using biotechnology, and include, but are not limited to, RNA molecules produced in extra vivo transcription reactions, RNA molecules produced by direct chemosynthesis, or RNA molecules produced in genetically modified E. coli (E. coli) cells.
[0016] "Genetic transfer" means bringing cells into contact with molecules, which are then moved internally by the cells.
[0017] "When genes are introduced" means during or after gene introduction.
[0018] "Genetic transfer reagents" mean substances or mixtures of substances that associate with molecules and facilitate the delivery of molecules to cells and / or the internal movement of molecules by cells, and include, but are not limited to, cationic lipids, charged polymers, or cell-permeable peptides.
[0019] "Reagent-based gene transfer" refers to gene transfer that uses gene transfer reagents.
[0020] "Cell culture medium" refers to a medium that can be used for cell culture, and non-limiting examples include Dulbecco's modified Eagle agar (DMEM) or DMEM + 10% fetal bovine serum (FBS).
[0021] A "complex-forming medium" refers to a medium to which a gene transfer reagent and the molecule to be gene-transferred are added, and to which the gene transfer reagent associates with the molecule to be gene-transferred.
[0022] "Genetic transfer medium" refers to a medium that can be used for gene transfer, and non-specific examples include Dulbecco's modified Eagle medium (DMEM) or DMEM / F12.
[0023] "Recombinant proteins" refer to proteins or peptides that are not produced in animals or humans. Non-restrictive examples include human transferrin produced in bacteria, human fibronectin produced in the in vitro culture of mouse cells, and human serum albumin produced in rice.
[0024] A "lipid carrier" refers to a substance that can increase the solubility of lipids or lipid-soluble molecules in an aqueous solution. Non-limiting examples include human serum albumin or methyl-beta-cyclodextrin.
[0025] "Oct4 protein" means the protein encoded by the POU5F1 gene, or its natural or modified variants, family members, homologous species, fragments, or fusion constructs, non-limiting examples including human Oct4 protein (SEQ ID NO: 8), mouse Oct4 protein, Oct1 protein, protein encoded by POU5F1 pseudogene 2, the DNA-binding domain of Oct4 protein, or Oct4-GFP fusion protein. In some embodiments, the Oct4 protein comprises an amino acid sequence having at least 70% identity with SEQ ID NO: 8, or in other embodiments, at least 75%, 80%, 85%, 90%, or 95% identity with SEQ ID NO: 8. In some embodiments, the Oct4 protein comprises an amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 8. Or, in other embodiments, the Oct4 protein comprises an amino acid sequence having 1 to 15 or 1 to 10 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 8.
[0026] "Sox2 protein" means the protein encoded by the SOX2 gene, or its natural or modified variants, family members, homologous species, fragments, or fusion constructs, including, but not limited to, the human Sox2 protein (SEQ ID NO: 9), the mouse Sox2 protein, the DNA-binding domain of the Sox2 protein, or the Sox2-GFP fusion protein. In some embodiments, the Sox2 protein contains an amino acid sequence having at least 70% identity with SEQ ID NO: 9, or in other embodiments, at least 75%, 80%, 85%, 90%, or 95% identity with SEQ ID NO: 9. In some embodiments, the Sox2 protein contains an amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 9. In another embodiment, the Sox2 protein comprises an amino acid sequence having 1 to 15 or 1 to 10 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 9.
[0027] "Klf4 protein" means the protein encoded by the KLF4 gene, or its natural or modified variants, family members, homologous species, fragments, or fusion constructs, including, but not limited to, human Klf4 protein (SEQ ID NO: 10), mouse Klf4 protein, the DNA-binding domain of the Klf4 protein, or Klf4-GFP fusion protein. In some embodiments, the Klf4 protein comprises an amino acid sequence having at least 70% identity with SEQ ID NO: 10, or in other embodiments, at least 75%, 80%, 85%, 90%, or 95% identity with SEQ ID NO: 10. In some embodiments, the Klf4 protein comprises an amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 10. Or, in other embodiments, the Klf4 protein comprises an amino acid sequence having 1 to 15 or 1 to 10 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 10.
[0028] "c-Myc protein" means a protein encoded by the MYC gene, or its natural or modified variants, family members, homologous species, fragments, or fusion constructs, including, but not limited to, human c-Myc protein (SEQ ID NO: 11), mouse c-Myc protein, l-Myc protein, c-Myc(T58A) protein, the DNA-binding domain of the c-Myc protein, or the c-Myc-GFP fusion protein. In some embodiments, the c-Myc protein contains an amino acid sequence having at least 70% identity with SEQ ID NO: 11, or in other embodiments, at least 75%, 80%, 85%, 90%, or 95% identity with SEQ ID NO: 11. In some embodiments, the c-Myc protein contains an amino acid sequence having 1 to 20 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 11. Or, in other embodiments, the c-Myc protein contains an amino acid sequence having 1 to 15 or 1 to 10 amino acid insertions, deletions, or substitutions (collectively) relative to SEQ ID NO: 11.
[0029] "Reprogramming" refers to causing changes in the phenotype of a cell, and non-limiting examples include differentiating β-cell precursors into mature β-cells, dedifferentiating fibroblasts into pluripotent stem cells, transforming keratinocytes into cardiomyocytes, or growing neuronal axons.
[0030] A "reprogramming factor" refers to a molecule that can trigger reprogramming, either alone or in combination with other molecules, when a cell comes into contact with it and / or when a cell expresses it. An example of this is the Oct4 protein.
[0031] A "feeder" refers to a cell that can condition the culture medium or support the growth of other cells in the culture medium.
[0032] "Conditioning" means bringing one or more feeders into contact with the culture medium.
[0033] "Fatty acid" means a molecule containing an aliphatic chain of at least two carbon atoms, and non-limiting examples include linoleic acid, alpha-linolenic acid, octanoic acid, leukotrienes, prostaglandins, cholesterol, glucocorticoids, resolvins, protectins, thromboxanes, lipoxins, malecins, sphingolipids, tryptophan, N-acetyltryptophan, or their salts, methyl esters, or derivatives.
[0034] "Short-chain fatty acids" refer to fatty acids that contain an aliphatic chain of 2 to 30 carbon atoms.
[0035] "Albumin" refers to a protein that is highly soluble in water, and a non-specific example is human serum albumin.
[0036] An "associated molecule" refers to a molecule that is non-covalently bonded to another molecule.
[0037] "Associated molecular components of albumin" refers to one or more molecules that bind to the albumin polypeptide. Non-limiting examples include lipids, hormones, cholesterol, and calcium ions that bind to the albumin polypeptide.
[0038] "Treated albumin" refers to albumin that has been treated to reduce, remove, replace, or inactivate its associated molecular components, and non-limiting examples include human serum albumin incubated with elevated temperature, human serum albumin in contact with sodium octanoate, or human serum albumin in contact with porous material.
[0039] An "ion exchange resin" refers to a material that, when in contact with a solution containing ions, can replace one or more of those ions with one or more different ions. A non-limiting example would be a material that can replace one or more calcium ions with one or more sodium ions. "Reproductive cells" refers to sperm cells or egg cells.
[0040] "Pluripotent stem cells" refer to cells that can differentiate into all three germ layers (endoderm, mesoderm, and ectoderm) within the body.
[0041] "Somatic cells" refer to cells that are neither pluripotent stem cells nor germ cells; a non-specific example is skin cells.
[0042] "Glucose-responsive insulin-producing cells" refer to cells that, when exposed to a specific concentration of glucose, are capable of producing and / or secreting an amount of insulin that is different (less than or greater than) the amount of insulin they could produce and / or secrete when exposed to different concentrations of glucose, and a non-limiting example is a beta cell.
[0043] "Hematopoietic cells" refer to blood cells or cells that can differentiate into blood cells, and non-limiting examples include hematopoietic stem cells or leukocytes.
[0044] "Cardiac cells" refer to cells of the heart or cells that can differentiate into cardiac cells, and non-limiting examples include cardiomyocyte stem cells or cardiomyocytes.
[0045] "Retinal cells" refer to cells of the retina or cells that can differentiate into retinal cells, and a non-specific example is retinal pigment epithelial cells.
[0046] "Skin cells" refers to cells commonly found in the skin, and non-limiting examples include fibroblasts, keratinocytes, melanocytes, adipocytes, mesenchymal stem cells, adipose stem cells, or hematopoietic cells.
[0047] A "Wnt signaling stimulant" refers to a molecule that can perform one or more of the biological functions of one or more members of the Wnt family of proteins, including, but not limited to, Wnt1, Wnt2, Wnt3, Wnt3a, or 2-amino-4-[3,4 It is -(methylenedioxy)benzylamino]-6-(3-methoxyphenyl)pyrimidine.
[0048] An "IL-6 signaling stimulant" refers to a molecule that can perform one or more of the biological functions of the IL-6 protein. Non-limiting examples include the IL-6 protein or the IL-6 receptor (also known as soluble IL-6 receptor, IL-6R, IL-6R alpha, etc.).
[0049] A "TGF-β signaling stimulant" refers to a molecule that can perform one or more of the biological functions of one or more members of the TGF-β superfamily of proteins, non-limiting examples of which are TGF-β1, TGF-β3, activin A, BMP-4, or Nodal.
[0050] An "immunosuppressant" is a substance that can suppress one or more aspects of the immune system and is not normally present in mammals. Non-limiting examples include B18R or dexamethasone.
[0051] A "single-strand break" refers to a region of single-stranded or double-stranded DNA in which one or more covalent bonds connecting nucleotides are broken in one of the single-stranded or double-stranded DNA molecules.
[0052] A "double-strand break" refers to a region of double-stranded DNA where one or more of the covalent bonds connecting nucleotides are broken on each strand of the double-stranded DNA.
[0053] "Nucleotide" refers to a nucleotide or a fragment or derivative thereof, and non-limiting examples include nucleic acid bases, nucleosides, and nucleotide triphosphates.
[0054] "Nucleoside" refers to a nucleotide or a fragment or derivative thereof, and non-limiting examples include nucleic acid bases, nucleosides, and nucleotide triphosphates.
[0055] "Gene editing" refers to altering the DNA sequence of a cell, and, to give a non-limiting example, it involves introducing a protein gene into a cell that causes a mutation in that cell's DNA.
[0056] "Gene-editing proteins" refer to proteins that can alter the DNA sequence of a cell, either alone or in combination with one or more other molecules, and include, but are not limited to, nucleases, activator-like effector nucleases (TALENs), zinc finger nucleases, meganucleases, nickases, clustered regularly interspaced short palindromic repeat (CRISPR)-related proteins, or their native or modified variants, family members, homologous species, fragments, or fusion constructs.
[0057] A "repair template" refers to a nucleic acid that contains a region having at least approximately 70% homology to a sequence within 10kb of the target site of a gene-editing protein.
[0058] A "repetitive sequence" refers to an amino acid sequence that exists within one or more copies of a protein with at least approximately 10% homology. A non-limiting example is the monomeric repeats of transcription activator-like effectors.
[0059] A "DNA-binding domain" refers to a region of a molecule that can bind to a DNA molecule. Non-limiting examples include protein domains containing one or more zinc fingers, protein domains containing one or more activator-like (TAL) effector repeat sequences, or small molecule binding pockets that can bind to a DNA molecule.
[0060] A "binding site" refers to a nucleic acid sequence that can be recognized by a gene-editing protein, a DNA-binding protein, a DNA-binding domain, or a bioactive fragment or variant thereof, or a nucleic acid sequence to which a gene-editing protein, a DNA-binding protein, a DNA-binding domain, or a bioactive fragment or variant thereof has high affinity. A non-limiting example is the sequence of approximately 20 base pairs of DNA in exon 1 of the human BIRC5 gene.
[0061] "Target" refers to nucleic acids that contain a binding site.
[0062] Other definitions are found in U.S. applications No. 13 / 465,490, No. 61 / 664,494, No. 61 / 721,302, International application PCT / US12 / 67966, No. 61 / 785,404, and No. 61 / 842,874, the contents of which are incorporated herein by reference in their entirety.
[0063] It has now been discovered that non-standard nucleotide members of the 5-methylcytidine demethylation pathway, when incorporated into synthetic RNA, can increase the efficiency with which the synthetic RNA can be translated into protein and reduce the toxicity of the synthetic RNA. Examples of these non-standard nucleotides include 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine (also known as "cytidine-5-carboxylic acid"). Therefore, certain embodiments involve nucleic acids. In one embodiment, the nucleic acid is a synthetic RNA molecule. In another embodiment, the nucleic acid comprises one or more non-standard nucleotides. In one embodiment, the nucleic acid comprises one or more non-standard nucleotide members of the 5-methylcytidine demethylation pathway. In another embodiment, the nucleic acid comprises at least one of 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine or derivatives thereof. In further embodiments, the nucleic acid comprises at least one of pseudouridine, 5-methylpsoiduridine, 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N-acetylcytidine, and 7-deazaguanosine or derivatives thereof.
[0064] 5-methylcytidine demethylation pathway [ka] Certain embodiments target proteins. Other embodiments target nucleic acids that encode proteins. In one embodiment, the protein is the protein of interest. In another embodiment, the protein is selected from reprogramming proteins and gene-editing proteins. In one embodiment, the nucleic acid is a plasmid. In another embodiment, the nucleic acid is present in a virus or viral vector. In a further embodiment, the virus or viral vector is non-replicating. In a further embodiment, the virus or viral vector is replicable. In one embodiment, the virus or viral vector comprises at least one of adenoviruses, retroviruses, lentiviruses, herpesviruses, adeno-associated viruses, or natural or modified variants thereof, and modified viruses.
[0065] It has also been found that certain combinations of non-standard nucleotides can be particularly effective in increasing the efficiency with which synthetic RNA can be translated into proteins and reducing the toxicity of synthetic RNA. Examples of such combinations include 5-methyluridine and 5-methylcytidine, 5-methyluridine and 7-deazaguanosine, 5-methylcytidine and 7-deazaguanosine, 5-methyluridine, 5-methylcytidine, and 7-deazaguanosine, as well as 5-methyluridine, 5-hydroxymethylcytidine, and 7-deazaguanosine. Therefore, certain embodiments target nucleic acids comprising at least two of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. Other embodiments target nucleic acids comprising at least three of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. Other embodiments relate to nucleic acids comprising all of 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine, or one or more derivatives thereof. In one embodiment, the nucleic acid comprises one or more 5-methyluridine residues, one or more 5-methylcytidine residues, and one or more 7-deazaguanosine residues, or one or more 5-methyluridine residues, one or more 5-hydroxymethylcytidine residues, and one or more 7-deazaguanosine residues.
[0066] It has been further discovered that synthetic RNA molecules containing specific fractions of certain non-standard nucleotides and combinations thereof may exhibit particularly high translation efficiency and low toxicity. Therefore, certain embodiments focus on nucleic acids containing one or more non-standard nucleotides, comprising at least one of one or more uridine residues, one or more cytidine residues, and one or more guanosine residues. In one embodiment, about 20% to about 80% of the uridine residues are 5-methyluridine residues. In another embodiment, about 30% to about 50% of the uridine residues are 5-methyluridine residues. In a further embodiment, about 40% of the uridine residues are 5-methyluridine residues. In one embodiment, about 60% to about 80% of the cytidine residues are 5-methylcytidine residues. In another embodiment, about 80% to about 100% of the cytidine residues are 5-methylcytidine residues. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues. In further embodiments, about 20% to about 100% of the cytidine residues are 5-hydroxymethylcytidine residues. In one embodiment, about 20% to about 80% of the guanosine residues are 7-deazaguanosine residues. In another embodiment, about 40% to about 60% of the guanosine residues are 7-deazaguanosine residues. In further embodiments, about 50% of the guanosine residues are 7-deazaguanosine residues. In one embodiment, about 20% to about 80%, or about 30% to about 60%, or about 40% of the cytidine residues are N4-methylcytidine and / or N4-acetylcytidine residues. In another embodiment, each cytidine residue is a 5-methylcytidine residue. In further embodiments, about 100% of the cytidine residues are 5-methylcytidine residues and / or 5-hydroxymethylcytidine residues and / or N4-methylcytidine residues. These are thidine residues and / or N4-acetylcytidine residues and / or one or more derivatives thereof. In a further embodiment, about 40% of the uridine residues are 5-methyluridine residues, about 20% to about 100% of the cytidine residues are N4-methylcytidine and / or N4-acetylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. In one embodiment, about 40% of the uridine residues are 5-methyluridine residues, and about 100% of the cytidine residues are 5-methylcytidine residues. In another embodiment, about 40% of the uridine residues are 5-methyluridine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. In one embodiment, approximately 40% of the uridine residues are 5-methyluridine residues, approximately 100% of the cytidine residues are 5-methylcytidine residues, and approximately 50% of the guanosine residues are 7-deazaguanosine residues. In another embodiment, approximately 40% of the uridine residues are 5-methyluridine residues, approximately 20% to approximately 100% of the cytidine residues are 5-hydroxymethylcytidine residues, and approximately 50% of the guanosine residues are 7-deazaguanosine residues. In some embodiments, less than 100% of the cytidine residues are 5-methylcytidine residues. In other embodiments, less than 100% of the cytidine residues are 5-hydroxymethylcytidine residues. In one embodiment, each uridine residue in the synthetic RNA molecule is a pseudouridine residue or a 5-methylpsoiduridine residue. In another embodiment, approximately 100% of the uridine residues are pseudouridine residues and / or 5-methylpsoiduridine residues. In further embodiments, approximately 100% of the uridine residues are pseudouridine residues and / or 5-methylpsoiduridine residues, approximately 100% of the cytidine residues are 5-methylcytidine residues, and approximately 50% of the guanosine residues are 7-deazaguanosine residues.
[0067] Other non-standard nucleotides that can be used instead of or in combination with 5-methyluridine include, but are not limited to, pseudouridine and 5-methylpsoiduridine (also known as "1-methylpsoiduridine" or "N1-methylpsoiduridine") or one or more derivatives thereof. Other non-standard nucleotides that can be used instead of or in combination with 5-methylcytidine and / or 5-hydroxymethylcytidine include, but are not limited to, pseudoisocytidine, 5-methylpsoidisocytidine, 5-hydroxymethylcytidine, 5-formylcytidine, 5-carboxycytidine, N4-methylcytidine, N4-acetylcytidine, or one or more derivatives thereof. In certain embodiments, for example, when only a single gene transfer is performed, or when the transfected cells are particularly susceptible to gene transfer-related toxicity or innate immune signaling, the fraction of non-standard nucleotides may be reduced. Reducing the fraction of non-standard nucleotides may be beneficial to some extent because it can reduce the cost of nucleic acids. In certain situations, for example, when minimal immunogenicity of nucleic acids is desired, the fraction of non-standard nucleotides may be increased.
[0068] Enzymes such as T7 RNA polymerase can preferentially incorporate standard nucleotides in in vitro transcription reactions containing both standard and non-standard nucleotides. As a result, in vitro transcription reactions containing a specific fraction of non-standard nucleotides may yield RNA containing a non-standard nucleotide fraction that differs from, and often lower than, the fraction in which the non-standard nucleotides were present during the reaction. Therefore, in certain embodiments, a reference to a nucleotide-incorporated fraction (e.g., "50% 5-methyluridine") may refer to both a nucleic acid containing a specified fraction of nucleotides and a nucleic acid synthesized in a reactant containing a specified fraction of nucleotides (or nucleotide derivatives, e.g., nucleotide-triphosphates) (however, such a reaction may yield nucleic acids containing a fraction of nucleotides different from the fraction in which the non-standard nucleotides were present in the reactant). Furthermore, Different nucleotide sequences can encode the same protein by utilizing alternative codons. Therefore, in certain embodiments, a reference to a nucleotide integration fraction may mean both a nucleic acid containing a specific fraction of nucleotides and a nucleic acid encoding the same protein as a different nucleic acid, the different nucleic acid containing a specific fraction of nucleotides.
[0069] The DNA sequence of a cell can be altered by contacting the cell with a gene-editing protein or by inducing the cell to express a gene-editing protein. However, previously disclosed gene-editing proteins have weaknesses such as low binding efficiency and excessive off-target activity, which can significantly limit their use in therapeutic applications where introducing undesirable mutations into the cell's DNA could lead to cancer development in a patient's cells. It has now been discovered that a gene-editing protein containing the StsI endonuclease cleavage domain (SEQ ID NO: 1) can exhibit substantially lower off-target activity than previously disclosed gene-editing proteins while maintaining high levels of on-target activity. Other novel modified proteins have also been discovered that, when used as the nuclease domain of gene-editing proteins: StsI-HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-UHA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6), and StsI-UHF (SEQ ID NO: 7), can exhibit high on-target activity, low off-target activity, small size, solubility, and other desirable properties. StsI-HF (high fidelity) and StsI-UHF (ultra-high fidelity) may exhibit lower off-target activity than both wild-type StsI and wild-type FokI, partly due to specific amino acid substitutions in the C-terminal region at positions 141 and 152, while StsI-HA, StsI-HA2 (high activity), StsI-UHA, and StsI-UHA2 (ultra-high activity) may exhibit higher on-target activity than both wild-type StsI and wild-type FokI, partly due to specific amino acid substitutions in the N-terminal region at positions 34 and 61. Therefore, certain embodiments target proteins containing a nuclease domain.In one embodiment, the nuclease domain includes one or more of the cleavage domains of FokI endonuclease (SEQ ID NO: 53), StsI endonuclease (SEQ ID NO: 1), StsI-HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-UHA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6), and StsI-UHF (SEQ ID NO: 7), or bioactive fragments or variants thereof.
[0070] It was also discovered that modified gene-editing proteins containing DNA-binding domains with specific novel repeat sequences may exhibit lower off-target activity than previously disclosed gene-editing proteins while maintaining high levels of on-target activity. Certain of these modified gene-editing proteins may offer several advantages over previously disclosed gene-editing proteins, including, for example, improved mobility of the linker region connecting the repeat sequences, which may result in improved binding efficiency. Therefore, certain embodiments concern proteins containing multiple repeat sequences. In one embodiment, at least one of the repeat sequences contains the amino acid sequence:GabG, where "a" and "b" each represent arbitrary amino acids. In one embodiment, the protein is a gene-editing protein. In another embodiment, one or more of the repeat sequences reside within a DNA-binding domain. In a further embodiment, "a" and "b" are each independently selected from the H and G groups. In a further embodiment, "a" and "b" are H and G, respectively. In one embodiment, the amino acid sequence resides within approximately five amino acids at the C-terminus of the repeat sequence. In another embodiment, the amino acid sequence resides at the C-terminus of the repeat sequence. In some embodiments, one or more Gs in the amino acid sequence GabG are replaced with one or more amino acids other than G, such as A, H, or GG. In one embodiment, the repeat sequence consists of about 32 to about 40 amino acids, or about 33 to about 39 amino acids, and The repeat sequences have a length of approximately 34–38 amino acids, or approximately 35–37 amino acids, or approximately 36 amino acids, or more than approximately 32 amino acids, or more than approximately 33 amino acids, or more than approximately 34 amino acids, or more than approximately 35 amino acids. Other embodiments relate to proteins comprising one or more activator-like effector domains. In one embodiment, at least one of the activator-like effector domains comprises a repeat sequence. Other embodiments relate to proteins comprising multiple repeat sequences, produced by inserting one or more amino acids between at least two of the repeat sequences of a activator-like effector domain. In one embodiment, one or more amino acids are inserted approximately 1, 2, 3, 4, or 5 amino acids from the C-terminus of at least one repeat sequence. Yet another embodiment relates to proteins comprising multiple repeat sequences, where approximately every other repeat sequence has a different length from the repeat sequence immediately preceding or following it. In one embodiment, every other repeat sequence is approximately 36 amino acids long. In another embodiment, every other repeat sequence is 36 amino acids long. Further embodiments relate to a protein comprising multiple repeat sequences, each comprising at least two repeat sequences, each having a length of at least 36 amino acids, and at least two of these 36-amino acid repeat sequences being separated by at least one repeat sequence having a length of less than 36 amino acids. Some embodiments relate to a protein comprising, for example, one or more sequences selected from SEQ ID NOs. 54, 55, 56, 57, 58, 59, and 60.
[0071] Other embodiments relate to proteins containing a DNA-binding domain. In some embodiments, the DNA-binding domain comprises a plurality of repeat sequences. In one embodiment, the plurality of repeat sequences enable highly specific recognition of a binding site within a target DNA molecule. In another embodiment, at least two of the repeat sequences have at least about 50%, about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homology with respect to each other. In a further embodiment, at least one of the repeat sequences comprises one or more regions that can bind to a binding site within a target DNA molecule. In a further embodiment, the binding site comprises a defined sequence about 1 to about 5 nucleotides in length. In one embodiment, the DNA-binding domain comprises a zinc finger. In another embodiment, the DNA-binding domain comprises a transcription activator-like effector (TALE). In further embodiments, the plurality of repeat sequences include at least one repeat sequence having at least about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homology to TALE. In further embodiments, the gene-editing protein includes clustered, equally spaced single-chain palindromic repeat (CRISPR)-associated proteins. In one embodiment, the gene-editing protein includes a nuclear localization sequence. In another embodiment, the nuclear localization sequence includes the amino acid sequence:PKKKRKV. In one embodiment, the gene-editing protein includes a mitochondrial localization sequence. In another embodiment, the mitochondrial localization sequence includes the amino acid sequence:LGRVIPRKIASRASLM. In one embodiment, the gene-editing protein includes a linker. In another embodiment, the linker annexes the DNA-binding domain to the nuclease domain. In further embodiments, the linker is about 1 to about 10 amino acids long. In some embodiments, the linker is about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids long. In one embodiment, the gene editing protein can create a nick or double-strand break within the target DNA molecule.
[0072] A particular embodiment is a method for denaturing the genome of a cell, comprising introducing a nucleic acid molecule into the cell, the nucleic acid molecule encoding a non-spontaneous fusion protein comprising an artificial transcription activator-like (TAL) effector repeat domain comprising one or more repeat units of 36 amino acid length and an endonuclease domain, the repeat domain The present invention relates to a method in which a fusion protein is modified to recognize a predetermined nucleotide sequence, and the fusion protein recognizes the predetermined nucleotide sequence. In one embodiment, the cell is a eukaryotic cell. In another embodiment, the cell is an animal cell. In a further embodiment, the cell is a mammalian cell. In a further embodiment, the cell is a human cell. In one embodiment, the cell is a plant cell. In another embodiment, the cell is a prokaryotic cell. In some embodiments, the fusion protein introduces endonuclease-like cleavage into the nucleic acid of the cell, thereby denaturing the cell's genome.
[0073] Other embodiments relate to nucleic acid molecules encoding a non-spontaneous fusion protein, comprising an artificial transcription activator-like (TAL) effector repeat domain containing one or more repeat units of 36 amino acid length and restriction endonuclease activity, wherein the repeat domain is modified for the recognition of a predetermined nucleotide sequence, and the fusion protein recognizes the predetermined nucleotide sequence. In one embodiment, the repeat unit varies by about seven or fewer amino acids. In another embodiment, each repeat unit contains the amino acid sequence:LTPXQVVAIAS, where X can be either E or Q, and the amino acid sequence:LTPXQVVAIAS is followed by a carboxyl terminus by one or two amino acids that determine the recognition of one of adenine, cytosine, guanine, or thymine. In one embodiment, the nucleic acid encodes repeat units of about 1.5 to about 28.5. In another embodiment, the nucleic acid encodes repeat units of about 11.5, about 14.5, about 17.5, or about 18.5. In a further embodiment, the predetermined nucleotide sequence is a promoter region. Some embodiments relate to vectors comprising nucleic acid molecules or sequences. In one embodiment, the vector is a viral vector. In another embodiment, the viral vector comprises one or more of the following: adenoviruses, retroviruses, lentiviruses, herpesviruses, adeno-associated viruses, or natural or modified variants thereof, and modified viruses.
[0074] Specific embodiments relate to nucleic acid molecules encoding a non-spontaneous fusion protein, comprising a first region that recognizes a given nucleotide sequence and a second region having endonuclease activity, wherein the first region contains an artificial TAL effector repeat domain comprising one or more repeat units of about 36 amino acids in length, each differing from the others by seven or fewer amino acids, and the repeat domain is modified for the recognition of the given nucleotide sequence. In one embodiment, the first region comprises the amino acid sequence:LTPXQVVAIAS, where X may be either E or Q. In another embodiment, the amino acid sequence LTPXQVVAIAS of the encoded non-spontaneous fusion protein is followed immediately by an amino acid sequence selected from HD, NG, NS, NI, NN, and N. In a further embodiment, the fusion protein contains restriction endonuclease activity. Some embodiments relate to nucleic acid molecules encoding proteins that include one or more sequences selected from SEQ ID NOs: 2, 3, 4, 5, 6, 7, 54, 55, 56, 57, 58, 59, and 60.
[0075] In one embodiment, the repeat sequence comprises LTPvQVVAIAwxyzHG, where "v" is D or E, "w" is S or N, "x" is N, H, or I, "y" is any amino acid or the absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In another embodiment, the repeat sequence comprises LTPvQVVAIAwxyzHG, where "v" is D or E, "w" is S or N, "x" is N, H, or I, "y" is selected from D, A, I, N, H, K, S, and G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVL CQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwxyzHG, where "v" is D or E, "w" is S or N, "x" is any amino acid other than N, H, and I, "y" is any amino acid or the absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwIyzHG, where "v" is D or E, "w" is S or N, "y" is any amino acid other than G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwIAzHG, where "v" is D or E, "w" is S or N, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwxyzHG, where "v" is D or E, "w" is S or N, "x" is S, T, or Q, "y" is any amino acid or absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG.In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwxyzHG, where "v" is D or E, "w" is S or N, "x" is S, T, or Q, "y" is selected from D, A, I, N, H, K, S, and G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG, or GKQALETVQRLLPVLCQAHG. In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwx, where "v" is D or E, "w" is S or N, and "x" is S, T, or Q. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwxy, where "v" is D or E, "w" is S or N, "x" is S, T, or Q, and "y" is selected from D, A, I, N, H, K, S, and G. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwxyzGHGG, where "v" is Q, D, or E, "w" is S or N, "x" is N, H, or I, "y" is any amino acid or the absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwxyzGHGG, where "v" is Q, D, or E, "w" is S or N, "x" is N, H, or I, "y" is selected from D, A, I, N, H, K, S, and G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA.In yet another embodiment, the repeat sequence is LTPvQVVAIAwxyzGHGG, where "v" is Q, D, or E, "w" is S or N, "x" is any amino acid other than N, H, and I, "y" is any amino acid or the absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeat sequence is LTPvQVVAI. AwIyzGHGG, where "v" is Q, D, or E, "w" is S or N, "y" is any amino acid other than G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwIAzGHGG, where "v" is Q, D, or E, "w" is S or N, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeat sequence comprises LTPvQVVAIAwxyzGHGG, where "v" is Q, D, or E, "w" is S or N, "x" is S, T, or Q, "y" is any amino acid or absence of an amino acid, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwxyzGHGG, where "v" is Q, D, or E, "w" is S or N, "x" is S, T, or Q, "y" is selected from D, A, I, N, H, K, S, and G, and "z" is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD, or GKQALETVQRLLPVLCQA. In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwx, where "v" is Q, D, or E, "w" is S or N, and "x" is S, T, or Q. In yet another embodiment, the repeating sequence comprises LTPvQVVAIAwxy, where "v" is Q, D, or E, "w" is S or N, "x" is S, T, or Q, and "y" is selected from D, A, I, N, H, K, S, and G.
[0076] Certain fragments of the endonuclease cleavage domain, including fragments shortened at the N-terminus, fragments shortened at the C-terminus, fragments with internal deletions, and fragments combining N-terminus, C-terminus, and / or internal deletions, can maintain some or all of the catalytic activity of the complete endonuclease cleavage domain. Determining whether a fragment can maintain some or all of the catalytic activity of the complete domain can be achieved, for example, by synthesizing a gene-edited protein containing the fragment according to the method of the present invention, inducing cells to express the gene-edited protein according to the method of the present invention, and measuring the efficiency of gene editing. Thus, using the measurement of gene editing efficiency, it is possible to confirm whether any specific fragment can maintain some or all of the catalytic activity of the complete endonuclease cleavage domain. Therefore, certain embodiments focus on bioactive fragments of the endonuclease cleavage domain. In one embodiment, the endonuclease cleavage domain is selected from FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, and StsI-UHF, or their natural or modified variants or bioactive fragments.
[0077] Certain fragments of a DNA-binding domain or repeat sequence, including fragments shortened at the N-terminus, fragments shortened at the C-terminus, fragments with internal deletions, and fragments combining N-terminus, C-terminus, and / or internal deletions, can maintain some or all of the binding activity of the complete DNA-binding domain or repeat sequence. An example of a DNA-binding domain or repeat sequence fragment that can maintain some or all of the binding activity of the complete repeat sequence is the Ralstonia solanacearum TALE-like protein (RTL). Determining whether a fragment can maintain some or all of the binding activity of the complete DNA-binding domain or repeat sequence can be done, for example, by synthesizing a gene-edited protein containing the fragment according to the method of the present invention, or by inducing cells to undergo gene editing according to the method of the present invention. This can be achieved by expressing gene editing proteins and measuring the efficiency of gene editing. Thus, by measuring gene editing efficiency, it is possible to determine whether any specific fragment can maintain some or all of the binding activity of the complete DNA-binding domain or repeat sequence. Accordingly, certain embodiments target bioactive fragments of DNA-binding domains or repeat sequences. In one embodiment, the fragment enables highly specific recognition of a binding site within a target DNA molecule. In another embodiment, the fragment comprises a sequence encoding a bacterial wilt TALE-like protein or a bioactive fragment thereof.
[0078] Certain embodiments relate to compositions for modifying the DNA sequence of cells, comprising nucleic acids, wherein the nucleic acids encode gene-editing proteins. Other embodiments relate to compositions for modifying the DNA sequence of cells, comprising a nucleic acid mixture, wherein the nucleic acid mixture comprises a first nucleic acid encoding a first gene-editing protein and a second nucleic acid encoding a second gene-editing protein. In one embodiment, the binding sites of the first gene-editing protein and the binding sites of the second gene-editing protein are located within the same target DNA molecule. In another embodiment, the binding sites of the first gene-editing protein and the binding sites of the second gene-editing protein are separated by fewer than 50 bases, fewer than 40 bases, fewer than 30 bases or fewer than 20 bases, fewer than 10 bases, or about 10 to 25 bases, or about 15 bases. In one embodiment, the nuclease domains of the first gene-editing protein and the nuclease domains of the second gene-editing protein can form a dimer. In another embodiment, the dimer can produce a nick or double-strand break within the target DNA molecule. In one embodiment, the composition is a therapeutic composition. In another embodiment, the composition comprises a repair template. In a further embodiment, the repair template is a single-stranded DNA molecule or a double-stranded DNA molecule.
[0079] Other embodiments relate to a manufacturing article for synthesizing a protein or a nucleic acid encoding a protein. In one embodiment, the article is a nucleic acid. In another embodiment, the protein includes a DNA-binding domain. In a further embodiment, the nucleic acid includes a nucleotide sequence encoding a DNA-binding domain. In one embodiment, the protein includes a nuclease domain. In another embodiment, the nucleic acid includes a nucleotide sequence encoding a nuclease domain. In one embodiment, the protein includes a plurality of repeat sequences. In another embodiment, the nucleic acid encodes a plurality of repeat sequences. In a further embodiment, the nuclease domain is selected from FokI, StsImStsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, and StsI-UHF, or their natural or modified variants or bioactive fragments. In one embodiment, the nucleic acid includes an RNA polymerase promoter. In another embodiment, the RNA polymerase promoter is a T7 promoter or an SP6 promoter. In a further embodiment, the nucleic acid includes a viral promoter. In one embodiment, the nucleic acid includes an untranslated region. In another embodiment, the nucleic acid is an in vitro transcription template.
[0080] Certain embodiments relate to methods for inducing cells to express a protein. Other embodiments relate to methods for altering the DNA sequence of a cell, comprising introducing a gene-editing protein into the cell or inducing the cell to express the gene-editing protein. Still other embodiments relate to methods for reducing the expression of a target protein in a cell. In one embodiment, the cell is induced to express a gene-editing protein, which can create nicks or double-strand breaks within a target DNA molecule. In another embodiment, the nicks or double-strand breaks result in gene inactivation. Still other embodiments relate to methods for producing an inactive, reduced-activity, or dominant-negative form of a protein. In one embodiment... In this embodiment, the protein is a survivor. Further embodiments relate to a method for repairing one or more mutations in a cell. In one embodiment, the cell is brought into contact with a repair template. In another embodiment, the repair template is a DNA molecule. In a further embodiment, the repair template does not contain a binding site for a gene-editing protein. In a further embodiment, the repair template encodes an amino acid sequence encoded by a DNA sequence containing a binding site for a gene-editing protein.
[0081] Other embodiments relate to methods for treating a patient, comprising administering to the patient a therapeutically effective amount of a protein or a protein-encoding nucleic acid. In one embodiment, the treatment results in remission of symptoms in one or more patients. Specific embodiments relate to methods for treating a patient, comprising a. removing cells from the patient; b. inducing the cells to express a gene-editing protein by introducing nucleic acids encoding gene-editing proteins into the cells; c. reprogramming the cells; and e. introducing the cells into the patient. In one embodiment, the cells are reprogrammed into a less differentiated state. In another embodiment, the cells are reprogrammed by introducing one or more synthetic RNA molecules encoding one or more reprogramming proteins into the cells. In a further embodiment, the cells are differentiated. In a further embodiment, the cells are differentiated into one of the following: skin cells, glucose-responsive insulin-producing cells, hematopoietic cells, cardiac cells, retinal cells, renal cells, nervous system cells, stromal cells, adipocytes, osteocytes, muscle cells, oocytes, and spermatocytes. Other embodiments relate to methods for treating a patient, comprising: a) removing hematopoietic cells or stem cells from the patient; b) inducing the cells to express the gene-editing protein by introducing nucleic acids encoding the gene-editing protein into the cells; and c) introducing the cells into the patient.
[0082] It has now been discovered that a cell culture medium essentially consisting of, or containing, DMEM / F12, ascorbic acid, insulin, transferrin, sodium selenite, ethanolamine, basic fibroblast growth factor, and transforming growth factor beta is sufficient to maintain pluripotent stem cells, including in vitro human pluripotent stem cells. Therefore, specific embodiments focus on a cell culture medium essentially consisting of, or containing, DMEM / F12, ascorbic acid, insulin, transferrin, sodium selenite, ethanolamine, basic fibroblast growth factor, and transforming growth factor beta. In one embodiment, ascorbic acid is present at approximately 50 μg / mL. In another embodiment, insulin is present at approximately 10 μg / mL. In a further embodiment, transferrin is present at approximately 5.5 μg / mL. In a further embodiment, sodium selenite is present at approximately 6.7 ng / mL. In a further embodiment, ethanolamine is present at approximately 2 μg / mL. In a further embodiment, basic fibroblast growth factor is present at approximately 20 ng / mL. In a further embodiment, transforming growth factor beta is present at approximately 2 ng / mL. In one embodiment, ascorbic acid is ascorbic acid-2-phosphate. In another embodiment, transforming growth factor beta is transforming growth factor beta 1 or transforming growth factor beta 3. In one embodiment, the cell culture medium is used for culturing pluripotent stem cells. In another embodiment, the pluripotent stem cells are human pluripotent stem cells. In a further embodiment, the cell culture medium is used for culturing cells during or after reprogramming. In one embodiment, the cell culture medium does not contain animal-derived components. In another embodiment, the cell culture medium is manufactured according to a manufacturing standard. In a further embodiment, the manufacturing standard is GMP. In one embodiment, the cells are contacted with cell adhesion molecules. In another embodiment, the cell adhesion molecules are selected from fibronectin and vitronectin or their bioactive fragments. In a further embodiment, the cells are contacted with fibronectin and vitronectin. In further embodiments, the cell adhesion molecule is recombinant.
[0083] In certain situations, for example, when producing therapeutic drugs, it may be beneficial to replace animal-derived components with non-animal-derived components to reduce the risk of contamination by viruses and / or other animal-derived pathogens. It has now been discovered that synthetic cholesterol, including semi-synthetic plant-derived cholesterol, can be used to replace animal-derived cholesterol in gene transfer media without reducing gene transfer efficiency or increasing gene transfer-related toxicity. Therefore, certain embodiments relate to gene transfer media containing synthetic or semi-synthetic cholesterol. In one embodiment, the semi-synthetic cholesterol is plant-derived. In another embodiment, the gene transfer medium does not contain animal-derived cholesterol. In a further embodiment, the gene transfer medium is a reprogramming medium. Other embodiments relate to complex-forming media. In one embodiment, the complex-forming medium has a pH greater than about 7, or greater than about 7.2, or greater than about 7.4, or greater than about 7.6, or greater than about 7.8, or greater than about 8.0, or greater than about 8.2, or greater than about 8.4, or greater than about 8.6, or greater than about 8.8, or greater than about 9.0. In another embodiment, the complex-forming medium comprises transferrin. In yet another embodiment, the complex-forming medium comprises DMEM. In yet another embodiment, the complex-forming medium comprises DMEM / F12. Still other embodiments relate to a method for forming complexes of nucleic acid gene transfer reagents. In one embodiment, the gene transfer reagent is incubated in the complex-forming medium. In another embodiment, incubation occurs before the mixing step. In yet another embodiment, the incubation step is about 5 seconds to about 5 minutes, or about 10 seconds to about 2 minutes, or about 15 seconds to about 1 minute, or about 30 seconds to about 45 seconds. In one embodiment, the gene transfer reagent is selected from Table 1. In another embodiment, the gene transfer reagent is a lipid or lipidoid. In yet another embodiment, the gene transfer reagent comprises a cation. In yet another embodiment, the cation is a polyvalent cation.In a further embodiment, the gene transfer reagent is N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamide)ethyl]-3,4-di[oleyloxy]-benzamide (also known as MVL5) or a derivative thereof.
[0084] Certain embodiments relate to methods for inducing cells to express proteins by contacting them with nucleic acids. In one embodiment, the cells are mammalian cells. In another embodiment, the cells are human cells or rodent cells. Other embodiments relate to cells produced using one or more of the methods of the present invention. In one embodiment, the cells are present in a patient. In another embodiment, the cells are isolated from a patient. Other embodiments relate to a screening library containing cells produced using one or more of the methods of the present invention. In one embodiment, the screening library is used for at least one of the following screenings: toxicity screening, including cardiotoxicity screening, neurotoxicity screening, and hepatotoxicity screening; efficacy screening, high-processing screening, high-content screening; and other screenings.
[0085] Other embodiments relate to kits containing nucleic acids. In one embodiment, the kit contains a delivery reagent (also known as a "gene transfer reagent"). In another embodiment, the kit is a reprogramming kit. In a further embodiment, the kit is a gene editing kit. Other embodiments relate to kits for generating nucleic acids. In one embodiment, the kit contains at least two of pseudouridine triphosphate, 5-methyluridine triphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine triphosphate, N4-methylcytidine triphosphate, N4-acetylcytidine triphosphate, and 7-deazaguanosine triphosphate, or one or more derivatives thereof. Other embodiments relate to therapeutic agents containing nucleic acids. In one embodiment, the therapeutic agent is a pharmaceutical composition. In the application form, the pharmaceutical composition is formulated. In a further embodiment, the formulation comprises an aqueous suspension of liposomes. Examples of liposome components are listed in Table 1 and are presented as examples, not limitations. In one embodiment, the liposome comprises one or more polyethylene glycol (PEG) chains. In another embodiment, the PEG is PEG2000. In a further embodiment, the liposome comprises 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) or a derivative thereof. In one embodiment, the therapeutic agent comprises one or more ligands. In another embodiment, the therapeutic agent comprises at least one of the following: androgens, CD30 (TNFRSF8), cell-permeable peptides, CXCR, estrogen, epidermal growth factor, EGFR, HER2, folic acid, insulin, insulin-like growth factor I, interleukin-13, integrins, progesterone, interstitial-derived factor 1, thrombin, vitamin D, and transferrin, or bioactive fragments or variants thereof. Further embodiments relate to therapeutic agents comprising cells produced using one or more of the methods of the present invention. In one embodiment, the therapeutic agent is administered to a patient for the treatment of at least one of the following: type 1 diabetes, heart diseases including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thrombocytopenia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV / AIDS. [Table 1]
[0086] Certain embodiments relate to nucleic acids comprising a 5′ cap structure selected from cap 0, cap 1, cap 2, and cap 3, or derivatives thereof. In one embodiment, the nucleic acid comprises one or more UTRs. In another embodiment, the one or more UTRs enhance the stability of the nucleic acid. In a further embodiment, the one or more UTRs comprise an alphaglobin or betaglobin 5′-UTR. In a further embodiment, the one or more UTRs comprise an alphaglobin or betaglobin 3′-UTR. In a further embodiment, the synthetic RNA molecule comprises an alphaglobin or betaglobin 5′-UTR and an alphaglobin or betaglobin 3′-UTR. In one embodiment, the 5′-UTR comprises a Kozak sequence that is substantially similar to the Kozak common sequence. In another embodiment, the nucleic acid comprises a 3′ poly(A) tail. In a further embodiment, the 3′ poly(A) tail is about 20 nt to about 250 nt, or about 120 nt to about 150 nt in length. In a further embodiment, the 3′ poly(A) tail is about 20 nt, or about 30 nt, or about 40 nt, or about 50 nt, or about 60 nt, or about 70 nt, or about 80 nt, or about 90 nt, or about 100 nt, or about 110 nt, or about 120 nt, or about 130 nt, or about 140 nt, or about 150 nt, or about 160 nt, or about 170 nt, or about 180 nt, or about 190 nt, or about 200 nt, or about 210 nt, or about 220 nt, or about 230 nt, or about 240 nt, or about 250 nt in length.
[0087] Other embodiments relate to methods for reprogramming cells. In one embodiment, the cells are reprogrammed by contacting them with one or more nucleic acids. In one embodiment, the cells are contacted with a plurality of nucleic acids encoding at least one of the following: Oct4 protein, Sox2 protein, Klf4 protein, c-Myc protein, Lin28 protein, or bioactive fragments, variants, or derivatives thereof. In another embodiment, the cells are contacted with a plurality of nucleic acids encoding a plurality of proteins, including Oct4 protein, Sox2 protein, Klf4 protein, and c-Myc protein, or one or more bioactive fragments, variants, or derivatives thereof. Yet another embodiment relates to methods for gene editing cells. In one embodiment, the cells are gene edited by contacting them with one or more nucleic acids.
[0088] Animal models are routinely used to study the effects of biological processes. In certain situations, for example, when studying human diseases, animal models containing mutated genomes may be beneficial, for one reason being that such animal models can more closely mimic the phenotype of human diseases. Therefore, certain embodiments relate to methods for producing organisms containing one or more gene mutations (also known as "mutations," or "gene edits"). In one embodiment, the one or more gene mutations are produced by introducing one or more nucleic acids encoding one or more gene-editing proteins into cells. In another embodiment, the one or more nucleic acids include synthetic RNA molecules. In one embodiment, the one or more gene-editing proteins include at least one of zinc finger nucleases, TALENs, clustered, equally spaced single-chain palindromic repeat (CRISPR)-related proteins, nucleases, meganucleases, and nickases, or bioactive fragments or variants thereof. In one embodiment, the cells are pluripotent cells. In another embodiment, the cells are embryonic stem cells. In a further embodiment, the cells are embryos. In further embodiments, the cells are members of animal cells, plant cells, yeast cells, and bacterial cells. In one embodiment, the cells are rodent cells. In another embodiment, the cells are human cells. In a particular embodiment, the cells are genetically modified with one or more nucleic acids encoding one or more gene-editing proteins and one or more nucleic acids encoding one or more repair templates. In one embodiment, the cells are introduced into a blastocyst. In another embodiment, the cells are introduced into a female of pseudopregnancy. In further embodiments, the presence or absence of gene mutations in the offspring is determined. In further embodiments, the determination is made by direct sequencing. In one embodiment, the organism is livestock, such as a pig or a cow. In another embodiment, the organism is a pet, such as a dog, a cat or a fish.
[0089] In certain situations, for example, when modifying the genome of a target cell by adding a nucleic acid sequence, it may be advantageous to insert the nucleic acid sequence within a safe-harbor location to reduce the risks associated with random insertion. Therefore, certain embodiments relate to methods for inserting nucleic acid sequences within safe-harbor locations. Morphologically, the cell is a human cell, and the safe port location is the AAVS1 locus. In another embodiment, the cell is a rodent cell, and the safe port location is the Rosa26 locus. In one embodiment, the cell is further contacted with one or more nucleic acids encoding one or more repair templates. Other embodiments relate to a kit for altering the DNA sequence of a cell. In one embodiment, the cell is a human cell, and the target DNA molecule contains a nucleotide sequence encoding the AAVS1 locus. In another embodiment, the cell is a rodent cell, and the target DNA molecule contains a nucleotide sequence encoding the Rosa26 locus. Other embodiments relate to a method for producing a reporter cell, by contacting the cell with one or more nucleic acids encoding one or more gene-editing proteins and one or more nucleic acids encoding one or more repair templates. In one embodiment, the one or more repair templates include DNA. In another embodiment, the one or more repair templates encode one or more fluorescent proteins. In a further embodiment, the one or more repair templates encode at least a portion of the promoter region of a gene.
[0090] In certain situations, for example, when producing a library of gene-edited cells, it may be beneficial to increase the efficiency of gene editing to reduce the cost of characterizing the cells. It has now been discovered that the efficiency of gene editing can be increased by repeatedly exposing cells to synthetic RNA encoding one or more gene-editing proteins. Therefore, a particular embodiment relates to a method for gene editing cells, wherein the cells are repeatedly exposed to one or more nucleic acids encoding one or more gene-editing proteins. In one embodiment, the cells are exposed at least twice over a continuous period of 5 days. In another embodiment, the cells are exposed twice at intervals of approximately 24 hours to approximately 48 hours.
[0091] In cancer, the survival and proliferation of malignant cells may, to some extent, be attributable to the presence of specific genetic abnormalities that are not generally present in the patient. It has now been discovered that gene-editing proteins can be used to target survival and proliferation-related pathways, and that, when used in this manner, gene-editing proteins and the nucleic acids encoding them can constitute potent anticancer therapeutics. Therefore, certain embodiments focus on anticancer therapeutics. In one embodiment, the therapeutic is a therapeutic composition that inhibits cell survival and / or prevents, slows, or limits cell proliferation. In another embodiment, the cells are cancer cells. In a further embodiment, the therapeutic comprises one or more gene-editing proteins or nucleic acids encoding one or more gene-editing proteins. In a further embodiment, the one or more gene-editing proteins target one or more sequences that promote cell survival and / or proliferation. Such sequences include, but are not limited to, apoptosis-related genes, including genes for inhibitors of the apoptosis (IAP) family, such as BIRC5 (see, for example, Table 2 and Table 2 of U.S. Provisional Application No. 61 / 721,302, the contents of which are incorporated herein by reference); sequences related to telomere maintenance, such as the genes telomerase reverse transcriptase (TERT) and telomerase RNA component (TERC); sequences affecting angiogenesis, such as the gene VEGF; and other cancer-related genes, including genes for BRAF, BRCA1, BRCA2, CDKN2A, CTNNB1, EGFR, the MYC family, the RAS family, PIK3CA, PIK3R1, PKN3, TP53, PTEN, RET, SMAD4, KIT, MET, APC, RB1, the VEGF family, TNF, and the ribonucleotide reductase family. Examples of gene-editing protein target sequences for BIRC5 are listed in Table 3 and in Table 3 of U.S. Provisional Application No. 61 / 721,302 (the contents of which are incorporated herein by reference), and are presented as examples, not limitations. In one embodiment, at least one of the one or more sequences is present in both malignant and non-malignant cells. In another embodiment, at least one of the one or more sequences is enriched in malignant cells.In a further embodiment, at least one of the one or more sequences is a non-malignant cell. It is concentrated in the cell. In one embodiment, the therapeutic composition further comprises nucleic acids encoding one or more repair templates. In another embodiment, the one or more gene-editing proteins induce the cell to express an inactive or dominant-negative form of the protein. In a further embodiment, the protein is a member of the IAP family. In a further embodiment, the protein is Survivin. [Table 2] [Table 3]
[0092] Other embodiments relate to methods for treating cancer, comprising administering to a patient a therapeutically effective amount of a gene-editing protein or nucleic acid encoding one or more gene-editing proteins. In one embodiment, the treatment results in a reduction or cessation of cancer cell growth in the patient. In another embodiment, the treatment results in a delay or remission of cancer progression. In one embodiment, the target DNA molecule comprises the BIRC5 gene. In another embodiment, the target DNA molecule comprises a sequence selected from SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15. In further embodiments, multiple adjacent binding sites are homologous to at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 98%, or at least about 99%, with respect to one or more sequences listed in Table 3, Table 4, Table 3 of U.S. Provisional Application No. 61 / 721,302 (the contents of which are incorporated herein by reference), Table 1 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 1 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference). In certain circumstances, a gene-editing protein having a shortened N-terminal domain can be used to eliminate the first base T restriction on the binding site sequence. In some embodiments, the cancer is a glioma. In one embodiment, the patient has previously undergone surgery and / or radiotherapy, and / or undergoes surgery and / or radiotherapy simultaneously. In another embodiment, the administration is performed by one or more of the following methods: subarachnoid injection, intracranial injection, intravenous injection, perfusion, subcutaneous injection, intraperitoneal injection, portal vein injection, and local delivery. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]
[0093] A particular embodiment relates to a method for treating cancer, comprising: a) removing a biopsy sample containing one or more cancerous cells from a patient; b) determining the sequence of a cancer-related gene marker in the one or more cancerous cells; and c) administering to the patient a therapeutically effective amount of a gene-editing protein or nucleic acid encoding a gene-editing protein, wherein the sequence of the target DNA molecule is at least about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homologous to the sequence of the cancer-related gene marker. In one embodiment, the method further comprises comparing the sequences of one or more cancer-related gene markers in one or more cancerous cells with the sequences of the same cancer-related gene markers in one or more non-cancerous cells, and selecting cancer-related gene markers having different sequences in the one or more cancerous cells and the one or more non-cancerous cells, wherein the sequence of the target DNA molecule or binding site is at least about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 98%, or about 99% homology to the sequence of the selected cancer-related gene marker.
[0094] Many cancer cells express survivin, a member of the apoptosis (IAP) protein family of inhibitors, encoded in humans by the BIRC5 gene. RNA interference can be used to reduce the expression of specific mRNA molecules, including survivin mRNA, thereby transiently inhibiting the growth of certain cancer cells. However, previous methods of reducing survivin mRNA expression using RNA interference have yielded only transient effects, resulting in only a short increase in the mean time to death (TTD) in animal models. It has now been discovered that inducing cells to express one or more gene-editing proteins that target the BIRC5 gene can lead to disruption of the BIRC5 gene, induce cells to express and / or secrete non-functional mutants of the survivin protein, induce cells to express and / or secrete dominant-negative mutants of the survivin protein, trigger activation of one or more apoptotic pathways in the cells and surrounding cells, slow or halt the growth of the cells and surrounding cells, lead to the death of the cells and surrounding cells, inhibit cancer progression, and potentially lead to remission in cancer patients. Therefore, certain embodiments relate to gene-editing proteins that target the BIRC5 gene. In one embodiment, the gene-editing protein binds to one or more regions within the BIRC5 gene. In another embodiment, the gene-editing protein binds to one or more regions of sequences selected from SEQ ID NOs: 12, 13, 14, and 15. In a further embodiment, the gene-editing protein binds to one or more sequences selected from SEQ ID NOs: 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In a further embodiment, the gene-editing protein binds to one or more nucleic acid sequences encoding SEQ ID NO: 34, or a bioactive fragment, variant, or analog thereof.In further embodiments, the gene-editing protein is one or more sequences selected from Table 3, Table 4, Table 3 of U.S. Provisional Application No. 61 / 721,302 (the contents of which are incorporated herein by reference), Table 1 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 1 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference). The gene-editing protein binds to one or more sequences that are at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or about 99% homology to one or more sequences selected from Table 3 of ( ), Table 1 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 1 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference). In one embodiment, the gene-editing protein creates one or more nics or double-strand breaks in the DNA of the cell. In another embodiment, the one or more nics or double-strand breaks are created within the BIRC5 gene. In a further embodiment, the one or more nics or double-strand breaks are created within one or more exons of the BIRC5 gene. In a further embodiment, the one or more nics or double-strand breaks are created within sequences selected from SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15. In a further embodiment, the one or more nicks or double-strand breaks are made within a sequence encoding an inhibitor of an apoptotic domain (also known as "IAP," "IAP domain," "IAP repeat," "baculovirus inhibitor of apoptotic protein repeat," "BIR," etc.).In further embodiments, the gene-editing protein binds to one or more sequences selected from Table 5, Table 2 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 2 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference), or to one or more sequences that are at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 98% homology to one or more sequences selected from Table 5, Table 2 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 2 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference). In yet another embodiment, the gene-editing protein binds to a sequence encoding one or more genes selected from Table 2, Table 5, Table 6, Table 7, Table 4 of U.S. Provisional Application No. 61 / 721,302 (the contents of which are incorporated herein by reference), Table 2 of U.S. Provisional Application No. 61 / 785,404 (the contents of which are incorporated herein by reference), or Table 2 of U.S. Provisional Application No. 61 / 842,874 (the contents of which are incorporated herein by reference). [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] Table 5-6 Table 5-7
[0095] In some embodiments, the target DNA molecule includes genes that are overexpressed in cancer. Examples of genes overexpressed in cancer include, but are not limited to, ABL1, BIRC5, BLK, BTK, CDK family members, EGFR, ERBB2, FAS, FGR, FLT4, FRK, FYN, HCK, HIF1A, HRAS, HSP90AA1, HSP90AA1, HSPA4, KDR, KIF11, KIF11, KIF20A, KIF21A, KIF25, KIT, KRAS, LCK, LYN, MAPK1, MET, MYC, MYH1, MYO1G, NRAS, NTRK1, PDGFB, PDGFRA, PDGFRB, PKN3, PLK1, RAF1, RB1, RET, RRM1, RRM2, SRC, TNF, TPM2, TYRO3, VEGFA, VEGFB, VEGFC, YES1, and ZAP70. In some embodiments, the target DNA molecule includes genes selected from ABL1, BIRC5, BLK, BTK, CDK family members, EGFR, ERBB2, FAS, FGR, FLT4, FRK, FYN, HCK, HIF1A, HRAS, HSP90AA1, HSP90AA1, HSPA4, KDR, KIF11, KIF11, KIF20A, KIF21A, KIF25, KIT, KRAS, LCK, LYN, MAPK1, MET, MYC, MYH1, MYO1G, NRAS, NTRK1, PDGFB, PDGFRA, PDGFRB, PKN3, PLK1, RAF1, RB1, RET, RRM1, RRM2, SRC, TNF, TPM2, TYRO3, VEGFA, VEGFB, VEGFC, YES1, and ZAP70, or fragments or variants thereof. In other embodiments, the target DNA molecule includes genes that are mutated in cancer. Examples of genes that mutate in cancer include, but are not limited to, AIM1, APC, BRCA1, BRCA2, CDKN1B, CDKN2A, FAS, FZD family members, HNF1A, HOPX, KLF6, MEN1, MLH1, NTRK1, PTEN, RARRES1, RB1, SDHB, SDHD, SFRP1, ST family members, TNF, TP53, TP63, TP73, VBP1, VHL, Wnt family members, BRAF, CTNNB1, PIK3CA, PIK3R1, SMAD4, and YPEL3.In some embodiments, the target DNA molecule includes genes selected from AIM1, APC, BRCA1, BRCA2, CDKN1B, CDKN2A, FAS, FZD family members, HNF1A, HOPX, KLF6, MEN1, MLH1, NTRK1, PTEN, RARRES1, RB1, SDHB, SDHD, SFRP1, ST family members, TNF, TP53, TP63, TP73, VBP1, VHL, Wnt family members, BRAF, CTNNB1, PIK3CA, PIK3R1, SMAD4, and YPEL3, or fragments or variants thereof. In one embodiment, the method further includes administering a therapeutically effective dose of the repair template to the patient.
[0096] Mutations within specific genes can increase the likelihood of cells becoming cancerous. However, in certain situations, for example, when the non-mutant form of a cancer-related gene is beneficial, inactivating cancer-related genes in non-cancerous cells can be detrimental. It has now been discovered that partial or complete mutations in genes can be specifically inactivated using gene-editing proteins. Examples of cancer-related mutations include ALK (F1174, R1275), APC (R876, Q1378, R1450), and BRAF. (V600), CDKN2A (R58, R80, H83, D84, E88, D108G, W110, P114), CTNNB1 (D32, S33, G34, S37, T41, or S45), E GFR (G719, T790, L858), EZH2 (Y646), FGFR3 (S249, Y373), FLT3 (D835), GNAS (R201), HRAS (G12, G13, Q61) Examples include, but are not limited to, IDH1 (R132), JAK2 (V617), KIT (D816), KRAS (G12, G13), NRAS (G12, G13, Q61), PDGFRA (D842), PIK3CA (E542, E545, H1047), PTEN (R130), and TP53 (R175, H179, G245, R248, R249, R273, W282). Therefore, certain embodiments focus on gene-editing proteins that bind to disease-related mutations. In one embodiment, the gene-editing protein binds to DNA containing a specific mutation, which has a higher affinity than DNA without the mutation. In another embodiment, the disease is cancer.
[0097] Neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and dementia with Lewy bodies, are characterized by the progressive loss of function and / or death of cells in the central and / or peripheral nervous systems. Disease progression may be accompanied by the accumulation of protein-rich plaques, which may contain the protein α-synuclein (encoded by the SNCA gene in humans). As a result, researchers have sought to develop therapeutics that can dismantle these plaques, for example, by means of antibodies that bind to the plaques and tag them for destruction by the immune system. However, in many cases, dismantling the plaques has little to no effect on the patient's symptoms or progression of the disease. It has now been found that the failure of existing therapies targeting neurodegenerative disease-related plaques is partly due to the nervous system's lack of ability to repair cellular damage that occurs during the early stages of plaque formation. Inducing cells to express one or more gene-editing proteins that target the SNCA gene may result in the disruption of the SNCA gene, induce cells to express plaque-resistant variants of the α-synuclein protein, slow or halt the growth of neurodegenerative disease-related plaques, protect the cells and nearby cells from the damaging effects of neurodegenerative disease-related plaques, slow and / or halt the progression of neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and dementia with Lewy bodies, and reduce symptoms and / or increase function in patients with neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and dementia with Lewy bodies. Other neurodegenerative diseases include, for example, visual impairment including blindness, hearing loss including deafness, balance disorders, loss of taste and / or smell, and other sensory impairments. Therefore, certain embodiments focus on gene-editing proteins that target the SNCA gene. In one embodiment, the gene-editing protein binds to one or more regions within the SNCA gene. In another embodiment, the gene-editing protein binds to one or more nucleic acid sequences encoding SEQ ID NO: 51, or to a bioactive fragment, variant, or analog thereof.Other embodiments relate to methods for treating neurodegenerative diseases, comprising administering to a patient a therapeutically effective amount of a gene-editing protein or a nucleic acid encoding a gene-editing protein, wherein the gene-editing protein can bind to a nucleotide sequence encoding a protein that forms disease-related plaques, resulting in a reduction of disease-related plaques in the patient and / or a delay or cessation of disease progression. In one embodiment, the nucleotide sequence comprises an SNCA gene. In another embodiment, the nucleotide sequence encodes α-synuclein. In further embodiments, the neurodegenerative disease is selected from Parkinson's disease, Alzheimer's disease, and dementia.
[0098] Specific embodiments relate to a method for identifying a pathogenic toxin, comprising: introducing a gene-editing protein or nucleic acid encoding a gene-editing protein into a cell to alter the DNA sequence of the cell, such that the altered DNA sequence confers susceptibility to a disease; exposing the cell to a suspected pathogenic toxin; and assessing the extent to which the cell exhibits a phenotype associated with the disease. In one embodiment, the disease is a neurodegenerative disease, an autoimmune disease, a respiratory disease, a reproductive disease, or cancer. Other embodiments relate to a method for assessing the safety of a therapeutic substance, comprising: introducing a gene-editing protein or nucleic acid encoding a gene-editing protein into a cell to alter the DNA sequence of the cell, such that the altered DNA sequence confers susceptibility to one or more toxic effects of the therapeutic substance; and measuring one or more toxic effects of the therapeutic substance on the cell. Further embodiments include a method for assessing the effectiveness of a therapeutic substance, comprising: altering the DNA sequence of a cell by introducing a gene-editing protein or nucleic acid encoding a gene-editing protein, such that the altered DNA sequence causes the cell to exhibit one or more disease-related phenotypes; contacting the cell with the therapeutic substance; and measuring the degree to which the one or more disease-related phenotypes are reduced.
[0099] In some embodiments, the patient is diagnosed with proteopathy. Examples of proteopathy and proteopathy-related genes are presented in Table 6 and are included as examples, not as limitations. In one embodiment, proteopathy includes AA (secondary) amyloidosis, Alexander disease, Alzheimer's disease, amyotrophic lateral sclerosis, intra-aortic amyloidosis, ApoAI amyloidosis, ApoAII amyloidosis, ApoAIV amyloidosis, vibrinogen amyloidosis, cardiac atrial amyloidosis, autosomal dominant cerebral arteriovenous disease with subcortical infarction and leukoencephalopathy, cerebral β-amyloid angiopathy, dialysis amyloidosis, familial amyloid cardiomyopathy, familial polyamyloid neuropathy, familial amyloidosis (Finnish type), familial British type dementia, familial Danish dementia, frontotemporal lobar degeneration, hereditary cerebral amyloid angiopathy, hereditary lattice keratitis dystrophy, Huntington's disease, inclusion body myositis / myopathy, lysozyme amyloidosis, medullary thyroid carcinoma, odontogenic (Pindborg) tumor amyloid, Parkinson's disease, pituitary prolactinoma, prion disease, alveolar proteinosis, retinal ganglion cell degeneration in glaucoma, retinitis pigmentosa with rhodopsin mutations, senile systemic amyloidosis, serpinopathy, synuclein disease, tauopathy, type II diabetes, punch-drunk syndrome (dementia) The target DNA molecule is selected from pugilistica (chronic traumatic encephalopathy), frontotemporal dementia, frontotemporal lobar degeneration, gangliocytoma, ganglioglioma, Haller-Holden-Spats syndrome, lead encephalopathy, lipofuscinosis, Lytico-Bodig disease, meningeal hemangioma, progressive supranuclear palsy, subacute sclerosing panencephalitis, tangle-dominant dementia, and tuberous sclerosis. In another embodiment, the target DNA molecule includes genes selected from APOA1, APOA2, APOA4, APP, B2M, CALCA, CST3, FGA, FGB, FGG, FUS, GFAP, GSN, HTT, IAPP, ITM2B, LYZ, MAPT, MFGE8, NOTCH3, NPPA, ODAM, PRL, PRNP, RHO, SAA family members, SERPIN family members, SFTPC, SNCA, SOD family members, TARDBP, TGFBI, and TRR, or fragments or variants thereof.In a further embodiment, the target DNA molecule encodes a gene or fragment selected from Table 6, and the patient is diagnosed with the corresponding disease listed in Table 6. [Table 6]
[0100] Examples of tauopathies include, but are not limited to, Alzheimer's disease, Parkinson's disease, and Huntington's disease. Other examples of tauopathies include punch-drunk syndrome (chronic traumatic encephalopathy), frontotemporal dementia, frontotemporal lobar degeneration, gangliocytoma, ganglioglioma, Haller-Holden-Spats syndrome, lead encephalopathy, lipofuscinosis, Lytico-Bodig disease, meningeal hemangioma, progressive supranuclear palsy, subacute sclerosing panencephalitis, tangle-dominant dementia, and tuberous sclerosis. In some embodiments, the patient is diagnosed with tauopathy. In one embodiment, tauopathy is selected from Alzheimer's disease, Parkinson's disease, and Huntington's disease. In another embodiment, tauopathy is selected from punch-drunk syndrome (chronic traumatic encephalopathy), frontotemporal dementia, frontotemporal lobar degeneration, gangliocytoma, ganglioglioma, Haller-Holden-Spats syndrome, lead encephalopathy, lipofuscinosis, Lytico-Bodig disease, meningeal hemangioma, progressive supranuclear palsy, subacute sclerosing panencephalitis, tangle-dominant dementia, and tuberous sclerosis.
[0101] Autoimmune diseases, including but not limited to lupus, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), and graft rejection, are characterized by symptoms caused to some extent by one or more elements of the immune system attacking non-infectious and non-cancerous isogeneic cells and / or tissues. Therefore, certain embodiments focus on methods for treating autoimmune diseases. In one embodiment, the autoimmune disease is selected from lupus, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), and graft rejection. In another embodiment, the target DNA molecule encodes a polypeptide sequence that can be recognized by the host immune system.
[0102] Infectious pathogens may contain nucleic acid sequences not present in the host organism. It has now been discovered that gene-editing proteins can be used to eliminate, reduce, or modify all or part of the effects of infectious pathogens and / or infectious diseases, and that, when used in this manner, gene-editing proteins and the nucleic acids encoding them can constitute potent anti-infective therapeutic agents. Infectious pathogens that can be treated in this manner include, but are not limited to, viruses, bacteria, fungi, yeasts, and parasites. Therefore, certain embodiments relate to methods for inducing cells to express gene-editing proteins that target one or more infectious pathogen-associated sequences. In one embodiment, the cells are one of bacterial cells, fungal cells, yeast cells, and parasitic cells. In another embodiment, the cells are mammalian cells. In a further embodiment, the cells are human cells. Other embodiments relate to therapeutic compositions comprising nucleic acids encoding one or more gene-editing proteins that target one or more infectious pathogen-associated sequences. Certain embodiments relate to methods for inducing cells to express gene-editing proteins that target one or more sequences related to susceptibility to or resistance to infectious diseases. Other embodiments relate to therapeutic compositions comprising nucleic acids encoding one or more gene-editing proteins that target one or more sequences related to susceptibility to or resistance to infectious diseases. In one embodiment, the cells are transfected with nucleic acids encoding one or more gene-editing proteins and nucleic acids encoding one or more repair templates. In another embodiment, the repair template contains a resistance gene or a bioactive fragment or variant thereof. In a further embodiment, the repair template contains an RNAi sequence. In a further embodiment, the RNAi sequence is shRNA. Other embodiments relate to methods for treating infectious diseases, comprising administering to a patient a therapeutically effective amount of a gene-editing protein or nucleic acid encoding a gene-editing protein, wherein the gene-editing protein can bind to one or more nucleotide sequences present in the infectious pathogen.
[0103] It has now been discovered that the ratio of non-homologous end joining to homologous recombination can be altered by changing the expression and / or function of one or more components of the DNA repair pathway. Non-limited examples of genes encoding components of the DNA repair pathway include, but are not limited to, Artemis, BLM, CtIP, DNA-PK, DNA-PKcs, EXOl, FEN1, Ku70, Ku86, LIGIII, LIGIV, MRE11, NBS1, PARP1, RAD50, RAD54B, XLF, XRCC1, XRCC3, and XRCC4. Therefore, specific embodiments relate to methods for altering the expression and / or function of one or more components of the DNA repair pathway. In specific embodiments, such expression and / or function are increased. In other embodiments, such expression and / or function are decreased. DNA-dependent protein kinases (DNA-PKs) are components of the non-homologous end joining DNA repair pathway. It has now been discovered that altering the expression of DNA-PKs can increase repair via homologous recombination. In one embodiment, cells are contacted with a DNA-PK inhibitor. Examples of DNA-PK inhibitors include, but are not limited to, compound 401 (2-(4-morpholinyl)-4H-pyrimido[2,1-a]isoquinoline-4-one), DMNB, IC87361, LY294002, NU7026, NU7441, OK-1035, PI 103 hydrochloride, vanillin, and wartmannin.
[0104] Genetic mutations can affect the length of protein products, for example, by introducing stop codons and / or disrupting the read frame. Certain diseases, including Duchenne muscular dystrophy, can be caused by the production of truncated and / or frameshifted proteins. It has now been discovered that diseases associated with the production of one or more truncated and / or frameshifted proteins can be treated using gene-editing proteins. In one embodiment, the gene-editing protein creates a double-strand break within approximately 1 kb, 0.5 kb, or 0.1 kb of the exon containing the disease-causing mutation. In another embodiment, the gene-editing protein is co-expressed with a DNA sequence containing one or more wild-type sequences. In certain embodiments, the DNA is single-stranded. In other embodiments, the DNA is double-stranded. Diseases caused by the expression of truncated proteins can be treated by exon skipping. It has now been discovered that exon skipping can be induced using gene-editing proteins. In one embodiment, the gene-editing protein creates a double-strand break within approximately 1 kb, 0.5 kb, or 0.1 kb of the exon to be skipped. In another embodiment, the gene-editing protein creates a double-strand break within approximately 1 kb, 0.5 kb, or 0.1 kb upstream of the intron of the exon to be skipped. In yet another embodiment, the gene-editing protein creates a double-strand break within approximately 1 kb, 0.5 kb, or 0.1 kb of the splice-receptor site upstream of the intron of the exon to be skipped.
[0105] Nucleic acids, including those contained in liposome formulations, can accumulate in the liver and / or spleen upon delivery to the body. It has now been discovered that nucleic acids encoding gene-editing proteins can regulate gene expression in the liver and spleen, and that nucleic acids used in this manner can constitute potent therapeutic agents for the treatment of liver and spleen diseases. Therefore, certain embodiments relate to methods for treating liver and / or spleen diseases by delivering nucleic acids encoding one or more gene-editing proteins to a patient. Other embodiments relate to therapeutic compositions comprising nucleic acids encoding one or more gene-editing proteins for the treatment of liver and / or spleen diseases. Liver and / or spleen diseases and conditions that can be treated include, but are not limited to, hepatitis, alcohol-induced liver disease, drug-induced liver disease, Epstein-Barr virus infection, adenovirus infection, cytomegalovirus infection, toxoplasmosis, Rocky Mountain spotted fever, non-alcoholic fatty liver disease, hemochromatosis, Wilson's disease, Gilbert's disease, and cancers of the liver and / or spleen. Other examples of sequences (including genes, gene families, and loci) that can be targeted by gene-editing proteins using the method of the present invention are listed in Table 7 and are presented as examples, not limitations. [Table 7]
[0106] Certain embodiments relate to combination therapies comprising one or more therapeutic compositions of the present invention and one or more adjuvant therapies. Examples of adjuvant therapies are provided in Table 8 and in Table 5 of U.S. Provisional Application No. 61 / 721,302 (the contents of which are incorporated herein by reference), and are presented as examples, not limitations. [Table 8-1] [Table 8-2]
[0107] The pharmaceutical product may further include a delivery reagent (also known as a “gene transfer reagent”) and / or an excipient. Pharmaceutically acceptable delivery reagents, excipients, and methods for preparing and using them (including methods for preparing pharmaceutical products and administering them to a patient (also known as a “subject”)) are well known in the art and are described in numerous publications, for example, U.S. Patent Application Publication US2008 / 0213377 (which is incorporated herein by reference in its entirety).
[0108] For example, the composition may be a morphologically pharmaceutically acceptable salt. Such salts include, for example, those described in J. Pharma. Sci. 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. PHStahl and CG Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, which are incorporated herein by reference in their entirety. Examples of pharmaceutically acceptable salts that are not limited include sulfates, citrates, acetates, oxalates, chlorides, bromides, iodides, nitrates, bisulfates, phosphates, acid phosphates, isonicotinates, lactates, salicylates, citric acid, tartrates, oleates, tannic acid, pantothenates, vitartrates, ascorbates, succinates, malates, gentisinates, fumarates, gluconates, glucaronates, saccharates, formic acid, benzoates, glutamates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, camphorsulfonates, pamoates, phenylacetates, trifluoroacetates, acrylates, chlorobenzoates, dinitrobenzoates, hydroxybenzoates, and methoxybenzoates. Cibenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, isobutyrate, phenylbutyrate, α-hydroxybutyrate, butyne-1,4-dicarboxylate, hexyn-1,4-dicarboxylate, caprate, caprylate, cinamate, glycolate, heptanoate, hippurate, malic acid, hydroxymalate, malonate, mandelate, mesylate, nicotinate, phthalate, teraphthalate, propiolate, propionate, phenylpropionate, sebacate, subelate, p-bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-hydroxyethylsulfonate, methylsulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, naphthalene-1,5-sulfonates, xylene sulfonates, tartarate salts, hydroxides of alkali metals such as sodium, potassium, and lithium, hydroxides of alkaline earth metals such as calcium and magnesium, hydroxides of other metals such as aluminum and zinc, ammonia, and organic amines such as unsubstituted or hydroxysubstituted mono-, di-, or tri-alkylamines and dicyclohexylamines, tributylamine, pyridine, N-methyl, N-ethylamine, diethylamine, and triethylamine. Examples include mono-, bis-, or tris-(2-OH-lower alkylamines) such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine; N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)-amines such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine, and similar compounds.
[0109] This pharmaceutical composition may contain excipients, including water and liquids such as oil (including petroleum, animal, plant-derived, or synthetic sources such as peanut oil, soybean oil, mineral oil, sesame oil, and the like). Pharmaceutical excipients may include, for example, physiological saline, acacia gum, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. Further, auxiliary agents, stabilizers, thickeners, lubricants, and colorants may be used. In one embodiment, pharmaceutically acceptable excipients are sterile when administered to the subject. Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. If desired, any of the agents described herein may contain small amounts of wetting agents or emulsifiers, or pH buffers.
[0110] In various embodiments, the compositions described herein may be administered in effective doses of, for example, about 1 mg / kg to about 100 mg / kg, about 2.5 mg / kg to about 50 mg / kg, or about 5 mg / kg to about 25 mg / kg. The precise determination of what constitutes an effective dose may be based on individual patient factors, including size, age, and type of disease. Dosage can be readily determined by those skilled in the art from the present disclosure and knowledge in the art. For example, dosage may be determined by referring to Physicians' Desk Reference, 66th Edition, PDR Network; 2012 Edition (December 27, 2011), the contents of which are incorporated herein by reference in their entirety.
[0111] The active compositions of the present invention may include traditional pharmaceuticals. Administration of these compositions according to the present invention may be via any common route, provided that the target tissue is accessible through that route. This includes oral, nasal, or buccal administration. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal, or intravenous injection, or by direct injection into cancerous tissue. The agents disclosed herein may also be administered by catheter systems. Such compositions are typically administered as pharmaceutically acceptable compositions, as described herein.
[0112] After formulation, the solution can be administered in an amount that is compatible with the drug formulation and therapeutically effective. The formulation can be easily administered in a variety of drug formulations, such as injectable solutions, drug-release capsules, and the like. For parenteral administration in aqueous solutions, for example, the solution is generally adequately buffered, and the diluent is first made isotonic, for example, with sufficient saline or glucose. Such aqueous solutions can be used for intravenous, intramuscular, subcutaneous, and intraperitoneal administration, for example. Preferably, as is well known to those skilled in the art, particularly in light of this disclosure, a sterile aqueous medium is employed.
[0113] The exemplary subjects or patients mean any vertebrate, without limitation, including humans and other primates (e.g., chimpanzees and other apes and monkey species), livestock (e.g., cattle, sheep, pigs, goats, and horses), domestic mammals (e.g., dogs and cats), laboratory animals (e.g., rodents such as mice, rats, and guinea pigs), and birds (e.g., chickens, turkeys, and other poultry birds, domestic, wild, and game birds such as ducks and geese, and similar species). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
[0114] The present invention will be further illustrated by the following non-limiting embodiments. [Examples]
[0115] Example 1: RNA Synthesis RNA encoding human proteins Oct4, Sox2, Klf4, c-Myc-2(T58A), and Lin28, or human genes XPA, CCR5, TERT, MYC, and BIRC5, and containing various combinations of standard and non-standard nucleotides, along with mRNA cap 2′-O-methyltransferase, is used with the T7 High Yield RNA Synthesis Kit and Vaccina Capping System Kit (all from New England). RNA was synthesized from a DNA template using Biolabs, Inc., according to the manufacturer's instructions and the inventors' previously disclosed inventions (U.S. Patent No. 13 / 465,490 (now U.S. Patent No. 8,497,124), U.S. Provisional Application No. 61 / 637,570, U.S. Provisional Application No. 61 / 664,494, International Application No. PCT / US12 / 67966, U.S. Provisional Application No. 61 / 785,404, U.S. Patent No. 13 / 931,251, and U.S. Provisional Application No. 61 / 842,874, all of which are incorporated herein by reference in their entirety) (Table 9, Figure 1A, Figure 1B, and Figure 15). This RNA was then diluted with nuclease-free water to 100 ng / μL to 200 ng / μL. For specific experiments, a ribonuclease inhibitor (Superase·In, Life Technologies Corporation) was added at a concentration of 1 μL / 100 μg of RNA. The RNA solution was stored at 4°C. For reprogramming experiments, RNAs encoding Oct4, Sox2, Klf4, c-Myc-2 (T58A), and Lin28 were mixed in a molar ratio of 3:1:1:1:1. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]
[0116] Example 2: Gene transfer of cells using synthetic RNA For gene transfer in a 6-well plate, 2 μg of RNA and 6 μL of gene transfer reagent (Lipofectamine RNAiMAX, Life Technologies Corporation) were first diluted separately in complex-forming medium (Opti-MEM, Life Technologies Corporation, or DMEM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 2 μg / mL ethanolamine) to a total volume of 60 μL each. Following the gene transfer reagent manufacturer's instructions, the diluted RNA and gene transfer reagent were then mixed and incubated at room temperature for 15 minutes. Next, the complex was added to cells in the culture medium. 30 μL to 240 μL of the complex was added to each well of a 6-well plate already containing 2 mL of gene transfer medium per well. The plate was gently shaken to distribute the complex throughout the wells. Cells were incubated with the complex for 4 hours to overnight, and the medium was replaced with fresh gene transfer medium (2 mL / well). For gene transfer in 24-well and 96-well plates, the volume was measured. Alternatively, 0.5 μg to 5 μg of RNA and 2 to 3 μL of gene transfer reagent (Lipofectamine 2000, Life Technologies Corporation) per 1 μg of RNA were first diluted separately in complex-forming medium (Opti-MEM, Life Technologies Corporation, or DMEM / F12 + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 2 μg / mL ethanolamine) to a total volume of 5 μL to 100 μL each. The diluted RNA and gene transfer reagent were then mixed and incubated at room temperature for 10 minutes. Next, the complex was added to cells in the culture medium. 10 μL to 200 μL of the complex was added to each well of a 6-well plate that already contained 2 mL of gene transfer medium per well. In specific experiments, DMEM + 10% FBS or DMEM + 50% FBS was used as a substitute for gene transfer medium. The plates were gently shaken to distribute the complex throughout the wells.The cells were incubated with the complex for 4 hours to overnight. In specific experiments, the culture medium was replaced with fresh transgenic medium (2 mL / well) 4 hours or 24 hours after gene transfer.
[0117] Example 3 Toxicity of synthetic RNA containing non-standard nucleotides and its protein translation Primary human fibroblasts were genetically modified according to Example 2 using RNA synthesized according to Example 1. The cells were fixed and stained with an antibody against Oct4 20–24 hours after genetic modification. The relative toxicity of the RNA was determined by assessing the cell density at the time of fixation.
[0118] Example 4 Formulation of gene transfer medium We developed cell culture media that support efficient gene transfer and reprogramming of cells using nucleic acids ("gene transfer media"): DMEM / F12 + 15 mM HEPES + 2 mM L-alanyl-L-glutamine + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 2 μg / mL ethanolamine + 50 μg / mL L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate + 4 μg / mL cholesterol + 1 μM hydrocortisone + 25 μg / mL polyoxyethylene sorbitan monooleate + 2 μg / mL D-alpha-tocopherol acetate + 20 ng / mL bFGF + 5 mg / mL treated human serum albumin.
[0119] We developed variants of this medium that supported robust, long-term culture of diverse cell types, including pluripotent stem cells ("maintenance medium"): DMEM / F12 + 2 mM L-alanyl-L-glutamine + 10 μg / mL insulin + 5.5 μg / mL transferrin + 6.7 ng / mL sodium selenite + 2 μg / mL ethanolamine + 50 μg / mL L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate + 20 ng / mL bFGF + 2 ng / mL TGF-β1.
[0120] In the gene transfer medium, treated human serum albumin was treated with 32 mM sodium octanoate, followed by heating at 60°C for 4 hours, then treatment with ion exchange resin (AG501-X8(D), Bio-Rad Laboratories, Inc.) for 6 hours at room temperature, followed by treatment with dextran-coated activated carbon (C6241, Sigma-Aldrich Co. LLC.) overnight at room temperature, followed by centrifugation, filtration, and adjustment to a 10% solution with nuclease-free water, which was then added to the other components of the medium. This was used as the gene transfer medium in all examples described herein unless otherwise specified. For reprogramming experiments, cells were plated on either uncoated plates in DMEM + 10%-20% serum, or on plates coated with fibronectin and vitronectin in the gene transfer medium, unless otherwise specified. This gene transfer medium was unconditioned unless otherwise specified. It is recognized that the formulation of gene transfer media can be adjusted to meet the needs of the specific cell type being cultured. It is also recognized that treated human serum albumin can be substituted with other treated albumins, such as treated bovine serum albumin, without adversely affecting the performance of the medium.In lieu of or in addition to L-alanyl-L-glutamine, other glutamine sources, e.g., L-glutamine, may be used; in lieu of or in addition to HEPES, other buffer systems, e.g., phosphates, bicarbonates, etc., may be used; in lieu of or in addition to sodium selenite, other forms of selenium, e.g., selenite, may be provided; in lieu of or in addition to L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate and / or D-alpha-tocopherol acetate, other antioxidants, e.g., L-ascorbic acid, may be used; in lieu of or in addition to polyoxyethylene sorbitan monooleate, other surfactants, e.g., Pluronic F-68 and / or Pluronic It is further recognized that F-127 may be used, that other basic media such as MEM and DMEM may be used instead of or in addition to DMEM / F12, and that the components of the culture medium can be changed over time without adversely affecting the performance of the medium, for example, by using a medium without TGF-β from day 0 to day 5, and then using a medium containing 2 ng / mL of TGF-β from day 5 onwards. It is further recognized that other components, such as fatty acids, lysophosphatidic acid, lysosphingomyelin, sphingosine-1-phosphate, other sphingolipids, ROCK inhibitors including Y-27632 and thiazovibin, members of the TGF-β / NODAL family of proteins, IL-6, and members of the Wnt family of proteins, can be added to the medium at appropriate concentrations without adversely affecting its performance. Furthermore, it is recognized that components known to promote or inhibit the growth of specific cell types, and / or protein stimulants and / or antagonists, or other molecules known to promote or inhibit the growth of specific cell types, such as sphingosine-1-phosphate and pluripotent stem cells, can be added to the medium at appropriate concentrations without adversely affecting its performance when used with these cell types.This invention relates equally to components added as purified compounds, components added as parts of mixtures described in detail, complexes or undetermined mixtures, such as components added as parts of animal or vegetable oils, and components added by biological processes, such as conditioning. The concentrations of components may vary from the stated values within a range that will be obvious to those skilled in the art, without adversely affecting the performance of the culture medium. Animal-free versions of the culture medium were prepared using recombinant versions of all protein components and non-animal versions of all other components, including semi-synthetic plant-derived cholesterol (Avanti Polar Lipids, Inc.).
[0121] Example 5: Reprogramming of human fibroblasts using synthetic RNA containing non-standard nucleotides Primary human neonatal fibroblasts were plated at a density of 10,000 cells / well in transgenic medium in 6-well plates coated with recombinant human fibronectin and recombinant human vivoronectin (diluted to concentrations of 1 μg / mL and 1 mL / well, respectively, in DMEM / F12 and incubated at room temperature for 1 hour). The following day, these cells were transfected using RNA containing A, 0.5 dG, 0.5 mU, and 5 mC, as shown in Example 2, with RNA doses of 0.5 μg / well on day 1, 0.5 μg / well on day 2, 2 μg / well on day 3, 2 μg / well on day 4, and 4 μg / well on day 5. Small colonies of cells showing morphology consistent with reprogramming became visible as early as day 5. This medium was replaced with maintenance medium on day 6. The cells were stained with an antibody against Oct4. Oct4-positive colonies of cells showing morphology consistent with reprogramming were visible throughout the wells (Figure 2).
[0122] Example 6: Reprogramming of primary mature human fibroblasts using synthetic RNA, without feeders, passaging, immunosuppressants, or conditioning. The wells of a 6-well plate were coated with a mixture of recombinant human fibronectin and recombinant human vivoronectin (DMEM / F12, 1 μg / mL per 1 mL / well) over 1 hour at room temperature. Primary mature human fibroblasts were plated into these coated wells in transgenic medium at a density of 10,000 cells / well. The cells were maintained at 37°C, 5% CO2, and 5% O2. Starting the following day, RNA synthesized according to Example 1 was transfected into the cells over 5 days according to Example 2. The total amount of RNA transfected each day during these 5 days was 0.5 μg, 0.5 μg, 2 μg, 2 μg, and 4 μg, respectively. From the fourth transfection onward, the medium was changed twice a day. On the day after the final transfection, this medium was replaced with transgenic medium supplemented with 10 μM Y-27632. Dense colonies of cells with reprogrammed morphologies were visible within each gene-transferred well by day 4 (Figure 8).
[0123] Example 7: Efficient and rapid induction and reprogramming of cells derived from mature human skin biopsy tissue. Full-thickness skin punch biopsies were performed on healthy 31-year-old volunteers according to an approved protocol. A portion of the skin on the left upper arm was temporarily anesthetized by topical application of 2.5% lidocaine. This area was disinfected with 70% isopropanol, and a full-thickness skin biopsy was performed using a 1.5 mm diameter punch. The tissue was rinsed in phosphate-buffered saline (PBS), placed in a 1.5 mL tube containing 250 μL of TrypLE Select CTS (Life Technologies Corporation), and incubated at 37°C for 30 minutes. The tissue was then transferred to a 1.5 mL tube containing 250 μL of DMEM / F12-CTS (Life Technologies Corporation) + 5 mg / mL of collagenase and incubated at 37°C for 2 hours. The epidermis was removed using forceps, and the tissue was mechanically dissociated. The cells were rinsed twice in DMEM / F12-CTS. Venotomy was also performed on the same volunteers, and venous blood was collected in Vacutainer SST tubes (Becton, Dickinson and Company). Serum was isolated according to the manufacturer's instructions. Isogenic plating medium was prepared by mixing DMEM / F12-CTS + 2 mM L-alanyl-L-glutamine (Sigma-Aldrich Co. LLC.) + 20% human serum. Cells derived from skin tissue samples were plated into fibronectin-coated wells of a 6-well plate in the isogenic plating medium. Many cells with fibroblast morphology began to adhere and diffuse by day 2 (Figure 3A). The cells were inflated and frozen in Synth-a-Freeze (Life Technologies Corporation).
[0124] Cells were passaged in 6-well plates at a density of 5,000 cells / well. The following day, this medium was replaced with transgenic medium, and these cells were transfected using RNA containing A, 0.5 dG, 0.4 mU, and 5 mC, as shown in Example 2, with RNA doses of 0.5 μg / well on day 1, 0.5 μg / well on day 2, 2 μg / well on day 3, 2 μg / well on day 4, and 2 μg / well on day 5. On days 6 and 7, specific cells were given an additional 2 μg / well of transgenicity. Furthermore, from day 4 onward, specific wells were given 2 ng / mL of TGF-β1. This medium was replaced with maintenance medium on day 6. Colonies of cells showing morphology consistent with reprogramming became visible between days 5 and 10 (Figure 3B). The colonies grew rapidly, and many showed morphology similar to that of embryonic stem cell colonies (Figure 3C). Colonies were collected and plated into wells coated with recombinant human fibronectin and recombinant human vivoronectin (diluted to concentrations of 1 μg / mL and 1 mL / well, respectively, in DMEM / F12 and incubated at room temperature for 1 hour). The cells grew rapidly and were subculturised to establish a cell line.
[0125] Example 8: Synthesis of RiboSlice targeting CCR5 RiboSlice pairs targeting the following sequences, L1:TCATTTTCCATACAGTCAGT, L2:TTTTCCATACAGTCAGTATC, R1:TGACTATCTTTAATGTCTGG, and R2:TATCTTTAATGTCTGGAAAT, were synthesized according to Example 1 (Figures 4A and 4B). These pairs target 20-bp sites within the human CCR5 gene on the sense (L1 and L2) or antisense strands (R1 and R2). The following pairs were prepared: L1&R1, L1&R2, L2&R1, and L2&R2.
[0126] Example 9 Measurement of CCR5 gene editing efficiency using mismatch detection nuclease Primary human fibroblasts were plated at a density of 10,000 cells / well in transgenic medium in 6-well plates coated with recombinant human fibronectin and recombinant human vivoronectin (diluted to concentrations of 1 μg / mL and 1 mL / well, respectively, in DMEM / F12 and incubated at room temperature for 1 hour). The following day, RNA synthesized according to Example 8 was transfected into these cells as shown in Example 2. Two days after transfection, genomic DNA was isolated and purified. A region within the CCR5 gene was amplified by PCR using primers F:AGCTAGCAGCAAACCTTCCCTTCA and R:AAGGACAATGTTGTAGGGAGCCCA. 150 ng of the amplified PCR product was crossed with 150 ng of reference DNA in 10 mM Tris-Cl + 50 mM KCl + 1.5 mM MgCl2. The cross-pollinated DNA was treated with a mismatch detection endonuclease (SURVEYOR nuclease, Transgenomic, Inc.), and the resulting product was analyzed by agarose gel electrophoresis (Figures 4C and 4D).
[0127] Example 10: High-efficiency gene editing by repeated gene transfer using RiboSlice Primary human fibroblasts were plated as shown in Example 9. The following day, RNA synthesized according to Example 8 was introduced into these cells as shown in Example 2. The next day, a second gene introduction was performed on cells in one of the wells. Two days after the second gene introduction, the efficiency of gene editing was measured as shown in Example 9 (Figure 4E).
[0128] Example 11: Gene editing of CCR5 using RiboSlice, and reprogramming of human fibroblasts that is DNA-free, feeder-free, immunosuppressant-free, and conditioning-free. Primary human fibroblasts were plated as shown in Example 9. The following day, RNA synthesized according to Example 8 was introduced into these cells as shown in Example 2. Approximately 48 hours later, these cells were reprogrammed according to Example 5 using RNA synthesized according to Example 1. Large colonies of cells exhibiting morphology characteristic of reprogramming became visible as shown in Example 5 (Figure 4F). The colonies were collected and a cell line was established. The cell line was directly sequenced to confirm successful gene editing (Figure 4G).
[0129] Example 12: Personalized cell replacement therapy for HIV / AIDS, including gene-edited and reprogrammed cells. In accordance with the inventors' previously disclosed inventions (US Patent Application No. 13 / 465,490, US Provisional Application No. 61 / 637,570, and US Provisional Application No. 61 / 664,494), and / or Example 11, patient skin cells are gene-edited and reprogrammed into hematopoietic cells. The cells are then enzymatically dissociated from the culture vessel to isolate CD34+ / CD90+ / Lin or CD34+ / CD49f+ / Lin cells. Approximately 1 × 10⁻⁶ 3 ~Approx. 1×10 5 The cells are infused into the patient's vena cava. The hematopoietic cells return to the spinal cavity and engraft.
[0130] Example 13: Generation of APP-inactivated rat embryonic stem cells Rat embryonic stem cells were plated in a 6-well plate with rat stem cell medium at a density of 10,000 cells / well. The following day, these cells were genetically modified as shown in Example 2, using 0.5 μg / well of RiboSlice, which targets the following sequences, L:TTCTGTGGTAAACTCAACAT and R:TCTGACTCCCATTTTCCATT (0.25 μg of L and 0.25 μg of R), synthesized according to Example 1.
[0131] Example 14: Generation of APP gene-deficient rats using APP-inactivated rat embryonic stem cells Rat embryonic stem cells are gene-edited according to Example 13 and microinjected into rat blastocysts. These microinjected blastocysts are then transplanted into female rats in a pseudopregnancy.
[0132] Example 15: Generation of APP-inactivated embryos for the production of gene-deficient rats A RiboSlice pair targeting the following sequences, L:TTCTGTGGTAAACTCAACAT and R:TCTGACTCCCATTTTCCATT, is synthesized according to Example 1. RiboSlice at a concentration of 5 μg / μL is injected into the pronucleus or cytoplasm of a one-cell stage rat embryo. This embryo is then transplanted into a pseudopregnant female rat.
[0133] Example 16 Gene transfer into cells of synthetic RNA containing non-standard nucleotides and DNA encoding repair templates For gene transfer in a 6-well plate, 1 μg of RNA encoding a gene-editing protein targeting exon 16 of the human APP gene, 1 μg of single-strand repair template DNA containing a PstI restriction site not present in the target cells, and 6 μL of gene transfer reagent (Lipofectamine RNAiMAX, Life Technologies Corporation) were first diluted separately in complex-forming medium (Opti-MEM, Life Technologies Corporation) to a total volume of 120 μL. Following the manufacturer's instructions for the gene transfer reagent, the diluted RNA, repair template, and gene transfer reagent were then mixed and incubated at room temperature for 15 minutes. The complex was added to cells in culture medium. Approximately 120 μL of the complex was added to each well of a 6-well plate already containing 2 mL of gene transfer medium per well. The plate was gently shaken to distribute the complex throughout the wells. Cells were incubated with the complex for 4 hours to overnight, and the medium was replaced with fresh gene transfer medium (2 mL / well). The following day, this culture medium was changed to DMEM + 10% FBS. Two days after gene transfer, genomic DNA was isolated and purified. A region within the APP gene was amplified by PCR, and the amplified product was digested with PstI and analyzed by gel electrophoresis (Figure 16).
[0134] Example 17: Insertion of a transgene into rat embryonic stem cells at a safe port location. Rat embryonic stem cells were plated in a 6-well plate with rat stem cell medium at a density of 10,000 cells / well. The following day, these cells were genetically modified as in Example 13, using a repair template containing a RiboSlice synthesized according to Example 1, targeting the following sequences: L:TATCTTCCAGAAAGACTCCA and R:TTCCCTTCCCCCTTCTTCCC, and the transgene adjacent to two regions containing approximately 400 bases each, homologous to the region surrounding the rat Rosa26 locus.
[0135] Example 18: Humanized LRRK2 rat Rat embryonic stem cells are plated as shown in Example 13, and RiboSlice targeting the following sequences, L:TTGAAGGCAAAAATGTCCAC and R:TCTCATGTAGGAGTCCAGGA, synthesized according to Example 1, is introduced into them. Two days after gene introduction, these cells are introduced according to Example 17, and the introduced gene contains the human LRRK2 gene and optionally part or all of the human LRRK2 promoter region.
[0136] Example 19: Insertion of a transgene into human fibroblasts at a safe port location. Primary human fibroblasts were plated as shown in Example 9. The following day, these cells were genetically modified as shown in Example 2, using a repair template containing a RiboSlice synthesized according to Example 1, targeting the following sequences: L:TTATCTGTCCCCTCCACCCC and R:TTTTCTGTCACCAATCCTGT, and the transgene adjacent to two regions containing approximately 400 bases each, homologous to the region surrounding the human AAVS1 gene locus.
[0137] Example 20: Insertion of RNAi sequence into a safe port location Primary human fibroblasts were plated and transfected according to Example 19, and the transgene contained a sequence encoding shRNA preceded by a PolIII promoter.
[0138] Example 21: Gene editing of Myc using RiboSlice Primary human fibroblasts were plated in 6-well plates at a density of 50,000 cells / well in DMEM + 10% FBS. After 2 days, this medium was replaced with gene transfection medium. After 4 hours, these cells were transfected with 1 μg / well of RiboSlice, which targeted the following sequences, L:TCGGCCGCCGCCAAGCTCGT and R:TGCGCGCAGCCTGGTAGGAG, synthesized according to Example 1, as shown in Example 2. The following day, gene editing efficiency was measured as shown in Example 9 using the following primers, F:TAACTCAAGACTGCCTCCCGCTTT and R:AGCCCAAGGTTTCAGAGGTGATGA (Figure 5).
[0139] Example 22: Cancer therapy including RiboSlice targeting Myc HeLa cervical cancer cells were plated in 6-well plates at a density of 50,000 cells / well in folate-free DMEM + 2 mM L-alanyl-L-glutamine + 10% FBS. The following day, this medium was replaced with a gene transduction medium. The following day, these cells were transduced as shown in Example 21.
[0140] Example 23 Gene editing of BIRC5 using RiboSlice Primary human fibroblasts were plated in 6-well plates at a density of 50,000 cells / well in DMEM + 10% FBS. After 2 days, this medium was replaced with gene transfection medium. After 4 hours, these cells were transfected with 1 μg / well of RiboSlice, which targeted the following sequences, L:TTGCCCCCTGCCTGGCAGCC and R:TTCTTGAATGTAGAGATGCG, synthesized according to Example 1, as shown in Example 2. The following day, gene editing efficiency was measured as shown in Example 9 using the following primers, F:GCGCCATTAACCGCCAGATTTGAA and R:TGGGAGTTCACAACAACAGGGTCT (Figure 6).
[0141] Example 24: Cancer therapy including RiboSlice targeting BIRC5 HeLa cervical cancer cells were plated in 6-well plates at a density of 50,000 cells / well in folate-free DMEM + 2 mM L-alanyl-L-glutamine + 10% FBS. The following day, this medium was replaced with a gene transduction medium. The following day, these cells were transduced as shown in Example 23 (Figures 7A and 7B).
[0142] Example 25: Culture of cancer cell lines Cancer cell lines HeLa (cervical cancer), MDA-MB-231 (breast cancer), HCT 116 (colon cancer), U87 MG (glioma), and U-251 (glioma) were propagated in culture medium. Cells were cultured in DMEM + 10% FBS or DMEM + 50% FBS and maintained at 37°C, 5% CO2, and either ambient O2 or 5% O2. Cells grew rapidly under all conditions and were regularly passaged every 2–5 days using trypsin solution in HBSS.
[0143] Example 26: RiboSlice gene-editing RNA design process and algorithm Annotated DNA sequences of the BIRC5 gene were retrieved from NCBI using the eFetch utility and a Python script. The same Python script was used to identify the protein-coding DNA sequences within each of the four exons of the BIRC5 gene. This script then searched for sequence elements that met the following conditions, along with 40 adjacent bases: (i) one element resides on the main strand and the others on the complementary strand, (ii) each element begins with T, and (iii) elements are separated by 12 or more bases and 20 or fewer bases. Each element was then assigned a score representing its likelihood of binding to other elements in the human genome using Qblast (NCBI). This score was calculated as the sum of the reciprocals of the nine lowest E values, excluding matches to the target sequence. The score for a pair was calculated by adding the scores of the individual elements.
[0144] Example 27 Synthesis of RNA encoding gene-editing protein (RiboSlice) RNA encoding gene-editing proteins was designed according to Example 26 and synthesized according to Example 1 (Table 10, Figure 9). This RNA was diluted with nuclease-free water to 200 ng / μL to 500 ng / μL and stored at 4°C. [Table 10]
[0145] Example 28 Activity analysis of RiboSlice targeting BIRC5 Six BIRC5-targeting RiboSlice pairs, designed according to Example 26 and synthesized according to Example 27, were introduced into primary mature human fibroblasts according to Example 2. Two days after gene introduction, genomic DNA was isolated and purified. To measure gene editing efficiency, 150 ng of amplified PCR product was crossed with 150 ng of reference DNA in 10 mM Tris-Cl + 50 mM KCl + 1.5 mM MgCl2. The crossed DNA was treated with SURVEYOR mismatch-specific endonuclease (Transgenomic, Inc.), and the resulting product was analyzed by agarose gel electrophoresis (Figure 10A). As demonstrated by the appearance of bands of the expected size (asterisks in Figure 10A), all six tested RiboSlice pairs efficiently edited the BIRC5 gene.
[0146] Example 29 Analysis of mitotic inhibition by RiboSlice targeting BIRC5 Primary mature human fibroblasts were gene-edited according to Example 28 and then propagated in culture medium. After 11 days, genomic DNA was isolated and purified, and the gene editing efficiency was measured as shown in Example 28 (Figure 10B). As indicated by the appearance of bands of the expected size (asterisks in Figure 10B) in the genomic DNA isolated from the proliferating cells, all of the RiboSlice pairs tested did not inhibit fibroblast proliferation, demonstrating the low toxicity of these RiboSlice pairs to normal fibroblasts.
[0147] Example 30 Analysis of the anticancer activity of RiboSlice targeting BIRC5 Primary mature human fibroblasts and HeLa cervical cancer cells cultured according to Example 25 were transfected with RiboSlice pairs according to Example 28. Fibroblast proliferation was temporarily slowed due to toxicity related to the transfection reagent, but recovered within 2 days of transfection. In contrast, HeLa cell proliferation was remarkably slowed, and many giant cells with fragmented nuclei were observed in the transfected wells. After 2-3 days, many cells showed morphology suggestive of apoptosis, demonstrating the potent anticancer activity of RiboSlice targeting BIRC5.
[0148] Example 31: Study on the safety of RiboSlice in vivo 40 female NCr nu / nu mice were given 5 × 10 in 50% Matrigel (BD Biosciences). 6 MDA-MB-231 tumor cells were subcutaneously injected. The cell injection volume was 0.2 mL / mouse. The age of the mice at the start of the study was 8-12 weeks. Pair matching was performed, and the tumor size was 100-150 mm. 3When the animals reached their average size, they were divided into four groups of 10 each, and treatment was initiated. Body weight was measured daily for the first five days, and then every other week until the end of the study. The treatment consisted of RiboSlice BIRC5-1.2 compounded with a medium (Lipofectamine 2000, Life Technologies Corporation). To prepare the solution to be administered to each group, 308 μL of complex-forming buffer (Opti-MEM, Life Technologies Corporation) was pipetted into each of two sterile, ribonuclease-free 1.5 mL tubes. 22 μL of RiboSlice BIRC5-1.2 (500 ng / μL) was added to one of the two tubes, and the contents of the tube were mixed by pipetting. 22 μL of the medium was added to the second tube. The contents of the second tube were mixed, then transferred to the first tube, and mixed with the contents of the first tube by pipetting to form a complex. The complex was incubated at room temperature for 10 minutes. The syringe was loaded during incubation. Animals were injected intravenously or intratumorally at a total dose of 1 μg RNA per animal, per 60 μL total volume. Infusions were performed every other day, for a total of 5 treatments. The dose was not adjusted for body weight. Animals were observed for 17 days. No significant reduction in mean body weight was observed (Figure 11, RiboSlice BIRC5-1.2 is labeled "ZK1"), demonstrating the in vivo safety of RiboSlice gene-edited RNA.
[0149] Example 32: Analysis of the anticancer activity of RiboSlice targeting BIRC5 in a glioma model. RiboSlice pairs were introduced into U-251 glioma cell lines cultured according to Example 25, as described in Example 28. The glioma cells responded to the treatment similarly to HeLa cells: proliferation slowed significantly, and many giant cells with fragmented nuclei were observed in the transfected wells. After 2-3 days, many cells exhibited morphology suggestive of apoptosis, demonstrating the potent anticancer activity of RiboSlice targeting BIRC5 in a glioma model.
[0150] Example 33 Screening of reagents for nucleic acid delivery to cells Delivery reagents, including polyethyleneimine (PEI), various commercial lipid-based gene transfer reagents, peptide-based gene transfer reagents (N-TER, Sigma-Aldrich Co., LLC.), and several lipid-based and sterol-based delivery reagents, were screened for in vitro gene transfer efficiency and toxicity. The delivery reagents were conjugated with RiboSlice BIRC5-1.2, and the conjugates were delivered to HeLa cells cultured according to Example 25. Toxicity was assessed by analyzing cell density 24 hours after gene transfer. Gene transfer efficiency was assessed by analyzing morphological changes as described in Example 30. The tested reagents showed a wide range of toxicity and gene transfer efficiency. Reagents containing a higher percentage of ester bonds showed lower toxicity than reagents containing a lower percentage of ester bonds or reagents without ester bonds.
[0151] Example 34: High-concentration liposome RiboSlice High-concentration liposome RiboSlices were prepared by mixing 1 μg of RNA with 3 μL of complex-forming medium (Opti-MEM, Life Technologies Corporation) at a concentration of 500 ng / μL, and 2.5 μL of gene transfer reagent (Lipofectamine 2000, Life Technologies Corporation) per 1 μg of RNA with 2.5 μL of complex-forming medium. The diluted RNA and gene transfer reagent were then mixed and incubated at room temperature for 10 minutes to form high-concentration liposome RiboSlices. Alternatively, gene transfer reagents containing DOSPA or DOSPER can be used.
[0152] Example 35: In vivo RiboSlice efficacy study - subcutaneous glioma model 40 female NCr nu / nu mice were given 1 × 10⁶ doses. 7U-251 tumor cells were subcutaneously injected. The cell injection volume was 0.2 mL / mouse. The age of the mice at the start of the study was 8-12 weeks. Pair matching was performed, and tumors measuring 35-50 mm were observed. 3 When the average size was reached, the animals were divided into four groups of 10 each, and treatment was initiated. Body weight was measured daily for the first five days, and then every other week until the end of the study. Caliper measurements were performed every other week to calculate tumor size. The treatment consisted of RiboSlice BIRC5-2.1 compounded with a medium (Lipofectamine 2000, Life Technologies Corporation). To prepare the solution to be administered, 294 μL of complex-forming buffer (Opti-MEM, Life Technologies Corporation) was pipetteed into a tube containing 196 μL of RiboSlice BIRC5-1.2 (500 ng / μL), and the contents of the tubes were mixed by pipetting. 245 μL of complex-forming buffer was pipetteed into a tube containing 245 μL of medium. The contents of the second tube were mixed, then transferred to the first tube, and mixed with the contents of the first tube by pipetting to form a complex. The complex was incubated at room temperature for 10 minutes. The syringe was loaded during incubation. Animals were injected intratumorally with either 20 μL or 50 μL of RNA per animal, or a total volume of either 2 μg or 5 μg of RNA per animal. Injections were performed every other day, for a total of 5 treatments. The dose was not adjusted for body weight. Animals were observed for 25 days.
[0153] Example 36 Synthesis of a highly active / high-fidelity RiboSlice in vitro transfer template An in vitro transcription template encoding a nuclease domain containing a T7 bacteriophage RNA polymerase promoter, a 5′ untranslated region, a strong Kosack sequence, a TALE N-terminal domain, 18 repeat sequences designed according to Example 26, a TALE C-terminal domain, and a StsI sequence (SEQ ID NO: 1), StsI-HA sequence (SEQ ID NO: 2), StsI-HA2 sequence (SEQ ID NO: 3), StsI-UHA sequence (SEQ ID NO: 4), StsI-UHA2 sequence (SEQ ID NO: 5), StsI-HF sequence (SEQ ID NO: 6), or StsI-HF2 sequence (SEQ ID NO: 7) is synthesized using standard cloning and molecular biology techniques, or by direct chemical synthesis using, for example, gene fragment construction techniques (e.g., gBlocks, Integrated DNA Technologies, Inc.).
[0154] Example 37: Synthesis of highly active / high-fidelity RiboSlice gene-editing RNA High-activity RiboSlice and high-fidelity RiboSlice are synthesized according to Example 27 using an in vitro transfer template synthesized according to Example 36.
[0155] Example 38: Production of a non-replicating virus encoding RiboSlice for the treatment of proteopathy A nucleotide sequence containing RiboSlice, which targets DNA sequences encoding plaque-forming protein sequences, is incorporated into a mammalian expression vector containing a non-replicating virus genome. This vector is then introduced into a packaging cell line to generate a non-replicating virus. The culture supernatant is collected and filtered using a 0.45 μm filter to remove debris.
[0156] Example 39: Production of a replicable tumor regression virus encoding RiboSlice for the treatment of cancer A nucleotide sequence containing RiboSlice targeting the BIRC5 gene is incorporated into a mammalian expression vector containing a replicable viral genome, and the gene is introduced into a packaging cell line to generate a replicable virus. The culture supernatant is collected and filtered according to Example 38.
[0157] Example 40: Study of the efficacy of RiboSlice in vivo - Orthotopic glioma model, administration via the subarachnoid space. 40 female NCr nu / nu mice were given 1 × 10⁶ doses. 5 U-251 tumor cells were intracranially injected. The cell injection volume was 0.02 mL / mouse. The age of the mice at the start of the study was 8-12 weeks. After 10 days, the animals were divided into four groups of 10 each, and treatment was started. Body weight was measured daily for the first 5 days, and then every other week until the end of the study. The treatment consisted of RiboSlice BIRC5-2.1 compounded with a medium (Lipofectamine 2000, Life Technologies Corporation). To prepare the solution to be administered, 294 μL of complex-forming buffer (Opti-MEM, Life Technologies Corporation) was pipetteed into a tube containing 196 μL of RiboSlice BIRC5-1.2 (500 ng / μL), and the contents of the tube were mixed by pipetting. 245 μL of complex-forming buffer was pipetteed into a tube containing 245 μL of medium. Mix the contents of the second tube, then transfer them to the first tube and mix them with the contents of the first tube by pipetting to form a complex. Incubate the complex at room temperature for 10 minutes. Load the syringe during incubation. Inject 10-20 μL of RNA per animal, or 1-2 μg of RNA per animal's total volume, into the subarachnoid space of the animal. Injections should be performed every other day for a total of 5 treatments. The dose is not adjusted for body weight. Observe the animals for 60 days.
[0158] Example 41: Treatment of glioma using RiboSlice - IV perfusion Patients diagnosed with glioma are administered 1 mg of high-concentration liposomal RiboSlice BIRC5-2.1, prepared according to Example 34, by IV infusion at 1 hour, 3 times per week, for 4 weeks. 500 mm 3For initial tumor volumes exceeding [a certain value], tumor debulking is performed surgically and optionally with radiotherapy and / or chemotherapy, and RiboSlice treatment is initiated. TNF-α and / or 5-FU are administered optionally to the patient as part of combination therapy using a standard dosing regimen.
[0159] Example 42: Treatment of glioma using RiboSlice - Replicable tumor regression virus The patient is administered 1 mL of replicated virus particles (1000 CFU / mL) prepared according to Example 39 by subarachnoid or intracranial injection.
[0160] Example 43 Treatment of Parkinson's disease using RiboSlice targeting SNCA Patients diagnosed with Parkinson's disease are administered 50 μg of RiboSlice, which targets the SNCA gene, via subarachnoid or intracranial injection.
[0161] Example 44 Treatment of Alzheimer's disease using RiboSlice targeting APP Patients diagnosed with Alzheimer's disease are administered 50 μg of RiboSlice, which targets the APP gene, via subarachnoid or intracranial injection.
[0162] Example 45 Treatment of type 2 diabetes using RiboSlice targeting IAPP Patients diagnosed with type 2 diabetes are administered 5 mg of RiboSlice, which targets the IAPP gene, via intravenous, intraperitoneal, or portal vein infusion.
[0163] Example 46: iRiboSlice Personalized Cancer Therapy A biopsy sample is taken from a patient diagnosed with cancer. Genomic DNA is isolated and purified from this biopsy sample, and the DNA sequence (either whole genome sequence, exome sequence, or sequence of one or more cancer-related genes) is determined. RiboSlice pairs (iRiboSlice) targeting the patient's individual cancer sequence are designed according to Example 26 and synthesized according to Example 27. The individualized iRiboSlice is administered to the patient using an administration route appropriate to the location and type of cancer.
[0164] Example 47: RiboSlice mixture for genetically diverse / treatment-resistant cancers Patients diagnosed with genetic diversity and / or treatment-resistant cancer are administered a mixture of RiboSlice pairs that target multiple cancer-related genes and / or multiple sequences within one or more cancer-related genes.
[0165] Example 48: Mito-RiboSlice for Mitochondrial Diseases Patients diagnosed with mitochondrial disease are administered 2 mg of RiboSlice, which targets disease-related sequences and contains mitochondrial localization sequences, via intramuscular injection.
[0166] Example 49: Treatment of eye diseases using RiboSlice eye drops Patients diagnosed with corneal or conjunctival disease should be administered RiboSlice as a 0.5% isotonic solution.
[0167] Example 50 Treatment of skin diseases using RiboSlice topical formulation Patients diagnosed with skin diseases are administered RiboSlice as a 1% topical cream / ointment containing one or more stabilizers that prevent RNA degradation.
[0168] Example 51 Treatment of lung or respiratory disease using RiboSlice aerosol formulation Patients diagnosed with lung or respiratory disease are administered RiboSlice as a 0.5% aerosol spray.
[0169] Example 52 Treatment of infectious diseases using RiboSlice that targets DNA sequences present in infectious pathogens RiboSlice, which targets sequences present in the specific infectious pathogen infecting the patient, is administered to patients diagnosed with an infectious disease using an appropriate route of administration for the location and type of infection, and a dose appropriate for the route of administration and the severity of the infection.
[0170] Example 53 Gene-edited human zygote for in vitro fertilization Human germ cells, zygotes, or early-stage blastocysts are genetically modified with RiboSlice, targeting genes encoding disease-related or undesirable traits. The genome is then characterized, and cells are prepared for in vitro fertilization.
[0171] Example 54: Cleavage domain screen for improving the activity and fidelity of gene editing proteins Panels of RiboSlice pairs, each containing a different cleavage domain, are designed according to Example 26 and synthesized according to Example 27. The activity of the RiboSlice pairs is determined as shown in Example 28.
[0172] Example 55 Gene-edited cells for screening of Parkinson's disease-causing toxins Primary human mature fibroblasts were gene-edited according to Example 28 using RiboSlice (Table 11) and repair templates targeting SNCA to produce cells with SNCA A30P, E46K, and A53T mutations. The cells were reprogrammed and differentiated into dopaminergic neurons. These neurons were used in a high-process α-synuclein agglutination toxin screening assay to identify toxins that may contribute to Parkinson's disease. [Table 11]
[0173] Example 56 Gene-edited cells for screening carcinogenic toxins Primary human mature fibroblasts were gene-edited according to Example 28 using RiboSlice (Table 12) and repair templates targeting TP53 to produce cells with TP53 P47S, R72P, and V217M mutations. The cells were reprogrammed and differentiated into hepatocytes. These hepatocytes were used in a high-processing in vitro transformation toxin screening assay to identify toxins that may contribute to cancer. [Table 12]
[0174] Example 57 Design and synthesis of RNA encoding a modified gene-editing protein (RiboSlice) RNA encoding gene-editing proteins designed according to Example 26 was synthesized according to Example 27 (Table 13). As shown in Table 13, each gene-editing protein contained a DNA-binding domain containing a transcription activator-like (TAL) effector repeat domain with a repeat sequence of 35-36 amino acids in length. The 36-amino acid repeat sequences were assigned sequence identification numbers. The template name "18" indicates that the 18th repeat sequence was 36 amino acids long. The template name "EO" indicates that every other repeat sequence was 36 amino acids long. The amino acids following "18" or "EO" indicate the amino acids at the C-terminus of the 36-amino acid repeat sequence (multiple sequences are possible). The notation "StsI" indicates that the nuclease domain contained an StsI cleavage domain. Templates without the "StsI" notation contained a FokI cleavage domain. [Table 13-1] [Table 13-2]
[0175] Example 58 Activity analysis of RiboSlice targeting BIRC5 The activity of the RiboSlice molecules synthesized according to Example 57 was analyzed according to Example 28 (Figures 12A, 12B, and 14). High-efficiency gene editing was observed in cells expressing a gene-editing protein containing one or more 36-amino acid-long repeat sequences. The gene editing efficiency was highest in cells expressing a gene-editing protein containing one or more repeat sequences containing the amino acid sequence: GHGG.
[0176] Example 59 Study on the Safety and Efficacy of RiboSlice AAV in Vivo - Subcutaneous Glioma Model, Intratumoral Route of Delivery Tumors containing U-251 human glioma cells were implanted into animals according to Example 35. AAV serotype 2 encoding GFP, BIRC5-2.1L RiboSlice, and BIRC5-2.1R RiboSlice was prepared according to standard techniques (AAV-2 Helper Free Expression System, Cell Biolabs, Inc.). The virus stock was stored at 4 °C (short term) or -80 °C (long term). Animals were given an intratumoral injection of either 160 μL of GFP AAV on day 1 or 80 μL of BIRC5-2.1L RiboSlice AAV + 80 μL of BIRC5-2.1R RiboSlice AAV on days 1 and 15. Animals were observed for 25 days. No significant reduction in average body weight was observed (Figure 13A), which demonstrates the in vivo safety of RiboSlice AAV. Tumor growth was inhibited within the RiboSlice AAV group (Figure 13B), which demonstrates the in vivo efficacy of RiboSlice AAV.
[0177] Example 60 Treatment of Cancer Using RiboSlice AAV Patients are administered 1 mL of RiboSlice AAV virus particles prepared according to Example 59 by intrathecal or intracranial injection. The administration is repeated as necessary. 500 mm 3For patients with an initial tumor volume exceeding [a certain value], tumor debulking is performed surgically and optionally by radiotherapy and / or chemotherapy, and RiboSlice AAV treatment is initiated. TNF-α and / or 5-FU are administered optionally to the patient as part of combination therapy using a standard dosing regimen.
[0178] Example 61: iRiboSlice AAV Personalized Cancer Therapy A biopsy sample is taken from a patient diagnosed with cancer. Genomic DNA is isolated and purified from this biopsy sample, and the DNA sequence (either whole genome sequence, exome sequence, or sequence of one or more cancer-related genes) is determined. RiboSlice pairs (iRiboSlice) targeting the patient's specific cancer sequence are designed according to Example 26 and synthesized according to Example 59. The personalized iRiboSlice AAV is administered to the patient using an administration route appropriate to the location and type of cancer.
[0179] Example 62: Capsule encapsulation of liposome formulations and nucleic acids Liposomes are prepared using the following formulation: 3.2 mg / mL of N-(carbonyl-ethoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine (MPEG2000-DSPE), 9.6 mg / mL of fully hydrogenated phosphatidylcholine, 3.2 mg / mL of cholesterol, 2 mg / mL of ammonium sulfate, and histidine as a buffer. Sodium hydroxide is used to control the pH, and sucrose is used to maintain isotonicity. To form liposomes, the lipids are mixed in an organic solvent, dried, hydrated with stirring, and sized by extrusion through a polycarbonate filter with an average pore size of 800 nm. Nucleic acids are encapsulated by combining 10 μg of the liposome formulation per 1 μg of nucleic acid and incubating at room temperature for 5 minutes.
[0180] Example 63 Folic acid-targeted liposome formulation Liposomes are prepared according to Example 62, except that 0.27 mg / mL of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folic acid (polyethylene glycol)-5000] (FA-MPEG5000-DSPE) is added to the lipid mixture.
[0181] Example 64: Cancer therapy including liposomal RiboSlice targeting BIRC5 Liposomes encapsulating RiboSlice pairs synthesized according to Example 23 are prepared according to Example 62 or Example 63. These liposomes are administered by injection or intravenous infusion, and tumor response and interferon plasma levels are monitored daily.
[0182] Example 65: Cancer therapy including liposomal RiboSlice targeting cancer-related genes Liposomes encapsulating RiboSlice targeting cancer-related genes, synthesized according to Example 1, are prepared according to Example 62 or Example 63. These liposomes are administered by injection or intravenous infusion, and tumor response and interferon plasma levels are monitored daily.
[0183] Example 66: Therapy containing RNA encoding liposome proteins Liposomes containing synthetic RNA encoding a therapeutic protein synthesized according to Example 1 are prepared according to Example 62 or Example 63. These liposomes are administered by injection or intravenous infusion.
[0184] Example 67 Combination cancer therapy including RiboSlice and TNF-α targeting BIRC5 The patient is administered isolated limb perfusion (ILP) using liposomes (see Example 64) encapsulating RiboSlice targeting tumor necrosis factor alpha (TNF-α) and BIRC5. Following limb warming, the liposomes are infused into the arterial line of the extracorporeal ILP circuit over approximately 5 minutes, and perfusion is continued for a further 85 minutes. One to two days later, ILP is repeated, infusing TNF-α into the arterial line of the extracorporeal ILP circuit over 3 to 5 minutes, and perfusion is continued for a further 60 minutes. Tumor response and interferon plasma levels are monitored daily.
[0185] Example 68 Combination cancer therapy including RiboSlice and fluorouracil (5-FU) targeting BIRC5 On day 1, the patient receives a 60-minute intravenous infusion of liposomes containing BIRC5-targeting RiboSlice (see Example 64), followed by a 46-hour intravenous infusion of 5-FU on days 2 and 3. Tumor response and interferon plasma levels are monitored daily.
[0186] Equal portions Those skilled in the art will be able to identify or confirm, through mere routine experimentation, numerous equivalents to the specific embodiments described herein. Such equivalents are intended to be covered by the following claims.
[0187] Embedding by reference All patents and publications referenced herein are incorporated herein in their entirety by reference.
Claims
1. An in vitro method for generating multiple gene-edited cells, (a) To provide a plurality of synthetic RNA molecules, wherein the plurality of synthetic RNA molecules are i. A first synthetic RNA molecule encoding a first fusion protein containing a DNA-binding domain and a nuclease catalytic domain; and ii. A second synthetic RNA molecule encoding a second fusion protein comprising a DNA-binding domain and a nuclease catalytic domain; wherein the first and second fusion proteins are independently transcription activator-like effector nucleases (TALENs). Including providing; and (b) Contacting a plurality of cells with the plurality of synthetic RNA molecules in vitro, wherein the plurality of cells contain a target DNA sequence, the plurality of cells are a plurality of human cells (excluding human embryos), and the plurality of synthetic RNA molecules are added to a culture medium surrounding the plurality of cells. Including, By bringing the cells into contact, the plurality of cells internally move the plurality of synthetic RNA molecules, and the first fusion protein and the second fusion protein are expressed, causing single-strand breaks or double-strand breaks to occur in the target DNA sequence. method.
2. The method according to claim 1, wherein the first synthetic RNA molecule and the second synthetic RNA molecule are independently synthesized from a DNA template by in vitro transcription.
3. The method according to claim 2, wherein the DNA template encodes a plurality of monomer repeats, each monomer repeat comprising a repeating variable domain (RVD), and each RVD is selected to target a sequence in the target DNA sequence.
4. The method according to any one of claims 1 to 3, further comprising contacting the plurality of cells with at least one of poly-L-lysine, poly-L-ornithine, RGD peptide, fibronectin, vitronectin, collagen, and laminin.
5. The method according to any one of claims 1 to 4, wherein the culture medium substantially does not contain an immunosuppressant.
6. The method according to any one of claims 1 to 5, wherein the first synthetic RNA molecule, the second synthetic RNA molecule, or both the first synthetic RNA molecule and the second synthetic RNA molecule include at least one selected from the group consisting of a 5-methyluridine residue, a pseudouridine residue, a 5-methylpsoiduridine residue, a 5-hydroxyuridine residue, a 5-hydroxypsoiduridine residue, and a 5-methylcytidine residue.
7. The method according to claim 6, wherein the first synthetic RNA molecule, the second synthetic RNA molecule, or both the first synthetic RNA molecule and the second synthetic RNA molecule contain uridine residues, and 20% to 100% of the uridine residues are 5-hydroxyuridine residues.
8. The method according to any one of claims 1 to 7, wherein the first synthetic RNA molecule, the second synthetic RNA molecule, or both the first synthetic RNA molecule and the second synthetic RNA molecule further comprises one or more of a 5'-cap, a 5'-cap 1 structure, and a 3'-poly(A) tail.
9. The method according to any one of claims 1 to 8, wherein the plurality of cells are derived from a biopsy sample and / or a plurality of human skin cells.
10. The method according to claim 9, wherein the plurality of cells are a plurality of fibroblasts.
11. The method according to any one of claims 1 to 8, wherein the plurality of cells are a plurality of human pluripotent stem cells.
12. The method according to claim 11, wherein the plurality of human pluripotent stem cells are human induced pluripotent stem cells.
13. The method according to any one of claims 1 to 8, wherein the plurality of cells are human somatic cells.
14. The method further includes introducing a DNA repair template containing an insertion sequence and one or more regions homologous to the DNA of the plurality of cells into the plurality of cells in vitro, and inserting the insertion sequence into the single-strand break or double-strand break region. The method according to any one of claims 1 to 13.
15. The method according to claim 14, wherein the DNA repair template includes one or more regions homologous to the DNA of the cell upstream of the single-strand break or double-strand break.
16. The method according to claim 14, wherein the DNA repair template includes one or more regions homologous to the DNA of the cell downstream of the single-strand break or double-strand break.
17. The method according to claim 14, wherein the DNA repair template includes one or more regions homologous to the DNA of the cell upstream of the single-strand break or double-strand break, or one or more regions homologous to the DNA of the cell downstream of the single-strand break or double-strand break.
18. The method according to any one of claims 1 to 17, wherein the culture medium is a gene transfer medium.
19. The method according to claim 18, wherein the gene transfer medium is complexed with the plurality of synthetic RNA molecules.