Compositions and methods for genome editing of B cells
Genome editing of B cells to replace their receptor with therapeutic antibodies enhances viability and functionality, offering a continuous and immune-compatible antibody secretion solution.
Patent Information
- Application Number
- JP2024052302
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-05-21
- Filing Date
- 2024-03-27
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2037-04-04
AI Technical Summary
Current monoclonal antibody therapies require frequent injections and can induce immune responses due to non-human glycosylation patterns, and B cells have limited functionality beyond antibody production.
Genome editing is used to replace the endogenous B cell receptor with a therapeutic monoclonal antibody sequence, enabling B cells to secrete antibodies continuously and potentially permanently, with methods to enhance viability and functionality using apoptosis inhibitors and nucleases like CRISPR.
Provides continuous antibody secretion and improved B cell viability, addressing the limitations of traditional therapies and immune responses.
Smart Images

Figure 0007896010000005 
Figure 0007896010000006 
Figure 0007896010000007
Abstract
Description
[Technical Field]
[0001] Related applications This application is a continuation-in-part of U.S. Patent Application No. 15 / 161,213 filed on 14 June 2016, which is a continuation-in-part of PCT Patent Application PCT / US2016 / 025920 filed on 4 April 2016, which claims priority and interest to U.S. Provisional Application No. 62 / 142,882 filed on 3 April 2015, the contents of which are incorporated herein by reference in their entirety.
[0002] Incorporating sequence lists by reference This application includes a sequence listing submitted in ASCII format via EFS-Web, which is incorporated herein by reference in its entirety. The above ASCII copy, created on June 13, 2016, is named DFCI-106 / 002WO_ST25.txt and is 9,514 bytes in size.
[0003] The present invention relates to a method for developing engineered B cells for immunotherapy, and more specifically, to a method for modifying B cells by genome editing to produce B cells having modified specificity and / or function, and in particular secretion of therapeutic antibodies, by inserting, deleting, or modifying a gene of interest. [Background technology]
[0004] Monoclonal antibody therapy is widely used to treat a variety of diseases, from cancer to autoimmune diseases. While they offer significant medical benefits, antibodies need to be administered repeatedly by injection (often intravenously). For many antibodies, this administration requires travel, time, expense, and trained medical professionals in clinical settings. Furthermore, antibodies produced in bioreactors (e.g., using CHO cells) may have different glycosylation patterns than those of human origin and therefore may generate adverse immune responses. In addition to antibody production, B cells can function as antigen-presenting cells and cytokine sources. [Prior art documents] [Patent Documents]
[0005] [Patent Document 1] U.S. Patent No. 6,453,242 [Patent Document 2] U.S. Patent No. 6,534,261 [Patent Document 3] U.S. Patent No. 6,599,692 [Patent Document 4] U.S. Patent No. 6,503,717 [Patent Document 5] U.S. Patent No. 6,689,558 [Patent Document 6] U.S. Patent No. 7,030,215 [Patent Document 7] U.S. Patent No. 6,794,136 [Patent Document 8] U.S. Patent No. 7,067,317 [Patent Document 9] U.S. Patent No. 7,262,054 [Patent Document 10] U.S. Patent No. 7,070,934 [Patent Document 11] U.S. Patent No. 7,361,635 [Patent Document 12] U.S. Patent No. 7,253,273 [Patent Document 13] U.S. Patent Application Publication No. 2005 / 0064474 [Patent Document 14] U.S. Patent Application Publication No. 2007 / 0218528 [Patent Document 15] U.S. Patent Application Publication No. 2005 / 0267061 [Patent Document 16] U.S. Patent No. 5,789,538 [Patent Document 17] U.S. Patent No. 5,925,523 [Patent Document 18] U.S. Patent No. 6,007,988 [Patent Document 19] U.S. Patent No. 6,013,453 [Patent Document 20] U.S. Patent No. 6,410,248 [Patent Document 21] U.S. Patent No. 6,140,466 [Patent Document 22] U.S. Patent No. 6,200,759 [Patent Document 23] U.S. Patent No. 6,242,568 [Patent Document 24] WO98 / 37186 [Patent Document 25] WO98 / 53057 [Patent Document 26] WO00 / 27878 [Patent Document 27] [[ID=’59]]WO01 / 88197 [Patent Document 28] GB 2,338,237 [Patent Document 29] U.S. Patent No. 6,479,626 [Patent Document 30] U.S. Patent No. 6,903,185 [Patent Document 31] U.S. Patent No. 7,153,949 [Patent Document 32] U.S. Patent No. 6,140,0815 [Patent Document 33] U.S. Patent No. 789,538 [Patent Document 34] WO95 / 19431 [Patent Document 35] WO96 / 06166 [Patent Document 36] WO98 / 54311 [Patent Document 37] WO01 / 60970 [Patent Document 38] WO98 / 53058 [Patent Document 39] WO98 / 53059 [Patent Document 40] WO98 / 53060 [Patent Document 41] WO02 / 016536 [Patent Document 42] WO03 / 016496 [Patent Document 43] U.S. Patent No. 5,420,032 [Patent Document 44] U.S. No. 6,833,252 [Patent Document 45] U.S. Patent Application Publication 20070117128 [Patent Document 46] U.S. Patent Application No. 20110301073 [Patent Document 47] U.S. Patent Application No. 20110145940 [Patent Document 48] WO2010079430 [Patent Document 49] U.S. Patent No. 6,607,882 [Patent Document 50] U.S. Patent No. 6,824,978 [Patent Document 51] U.S. Patent No. 6,979,539 [Patent Document 52] U.S. Patent No. 6,933,113 [Patent Document 53] U.S. Patent No. 7,163,824 [Patent Document 54] U.S. Patent No. 7,013,219 [Patent Document 55] U.S. Patent Application Publication No. 20030232410 [Patent Document 56] U.S. Patent Application Publication No. 20050208489 [Patent Document 57] U.S. Patent Application Publication No. 20050026157 [Patent Document 58] U.S. Patent Application Publication No. 20050064474 [Patent Document 59] U.S. Patent Application Publication No. 20060188987 [Patent Document 60] U.S. Patent Application Publication No. 20060063231 [Patent Document 61] International Patent Application Publication WO07 / 014,275 [Patent Document 62] U.S. Patent No. 8,586,526 [Patent Document 63] U.S. Patent Application Publication No. 20060206949 [Patent Document 64] U.S. Patent Application Publication No. 20060153826 [Patent Document 65] U.S. Patent Application Publication No. 20060078552 [Patent 66] U.S. Patent Application Publication No. 20040002092 [Patent Document 67] U.S. Patent No. 7,888,121 [Patent Document 68] U.S. Patent No. 8,409,861 [Patent Document 69] U.S. Provisional Application No. 61 / 343,729 [Patent Document 70] U.S. Patent No. 5,356,802 [Patent Document 71] U.S. Patent No. 5,436,150 [Patent Document 72] U.S. Patent No. 5,487,994 [Patent Document 73] U.S. Patent No. 7,914,796 [Patent Document 74] U.S. Patent No. 8,034,598 [Patent Document 75] U.S. Patent No. 8,623,618 [Patent Document 76] U.S. Patent Application Publication No. 20110201055 [Patent Document 77] U.S. Patent Application Publication No. 20090068164 [Patent Document 78] WO2009 / 042163 [Patent Document 79] U.S. Patent No. 7,074,596 [Patent Document 80] U.S. Patent No. 8,153,773 [Patent Document 81] U.S. Patent No. 6,008,336 [Patent Document 82] U.S. Patent No. 5,049,386 [Patent Document 83] U.S. Patent No. 4,946,787 [Patent Document 84] U.S. Patent No. 4,897,355 [Patent Document 85] WO91 / 17424 [Patent Document 86] WO91 / 16024 [Patent Document 87] U.S. Patent No. 4,186,183 [Patent Document 88] U.S. Patent No. 4,217,344 [Patent Document 89] U.S. Patent No. 4,235,871 [Patent Document 90] U.S. Patent No. 4,261,975 [Patent Document 91] U.S. Patent No. 4,485,054 [Patent Document 92] U.S. Patent No. 4,501,728 [Patent Document 93] U.S. Patent No. 4,774,085
Patent document 94
Patent document 95
Patent document 96
Patent document 97
Patent document 98
Non-licensed literature
[0006] [Non-licensed document 1] Beerii et al., (2002) Nature Biotechnol. 20: 135-141 [Non-licensed document 2] Pabo et al., (2001) Ann. Rev. Biochem. 70: 313-340. [Non-licensed document 3] Isalan et al., (2001) Nature Biotechnol. 19: 656-660
Non-licensed Document 4
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed Document 8
Non-licensed literature 9
[0007] There is a need for compositions and methods for manipulating patient B cells to produce cells with modified specificity and / or function. [Means for solving the problem]
[0008] This invention employs the use of genome editing to replace the sequence encoding the endogenous B cell receptor (BCR) of B cells with a sequence encoding a defined therapeutic monoclonal antibody. Thus, B cells produced by this invention will secrete a therapeutic monoclonal antibody. Such B cells are transplanted into human patients, where they provide continuous, and possibly permanent, secretion of the therapeutic antibody.
[0009] In various embodiments, the present invention provides a method for increasing the viability of a population of primary human B cells in culture by culturing the population in a medium containing an apoptosis inhibitor. The viability of the population is increased by at least 10% compared to a B cell population cultured in the absence of the apoptosis inhibitor.
[0010] In a further embodiment, the present invention provides a method for editing the genome of a population of primary human B cells, comprising obtaining a population of primary human B cells, culturing the population of primary human B cells in a medium containing one or more activators and one or more apoptosis inhibitors, and genomically modifying the population of primary human B cells by inserting or deleting a target gene to produce a genome-edited population of B cells. Optionally, the method further comprises culturing the B cells with a CD40 agonist, for example, CD40L.
[0011] Apoptosis inhibitors are caspase inhibitors. For example, a caspase inhibitor is Q-VD-OPH.
[0012] The present invention provides isolated human B cells containing one or more genome modifications. The lymphocytes either (i) express a specified target protein or (ii) do not express one or more endogenous proteins. The lymphocytes may (i) not express their endogenous B cell receptor and (ii) may secrete a specified therapeutic monoclonal antibody.
[0013] Genome modification can be achieved using nucleases, such as engineered nucleases, CRISPR nucleases (e.g., Cas nuclease, Cpf1 nuclease, Cmr nuclease, Csf nuclease, Csm nuclease, Csn nuclease, Csy nuclease, C2c1 nuclease, C2c3 nuclease, or C2c3 nuclease), zinc finger nucleases, or transcription activator-like effector nucleases, which may be transfected into B cells by nucleofection.
[0014] Therapeutic monoclonal antibodies include TNF-α, IGHE, IL-1, IL-Iβ, IL-2, IL-4, IL-5, IL-6, IL-6R, IL-9, IL-12, IL-13, IL-17A, IL-20, IL-22, IL- 23, IL-25, BAFT, RANKL, integrin-α4, IL-6R, VEGF-A, VEGFR1, VEGFR2, EGFR, HER2, HER3, CA125, integrin α4β7, integrin α7β7, Interferon α / β receptor, CXCR4, CD2, CD3, CD4, CD5, CD6, CD19, CD20, CD22, CD23, CD25, CD27, CD28, CD30, CD33, CD37, CD38, CD40, C D41, CD44, CD51, CD52, CD56, CD70, CD74, CD79B, CD80, CD125, CD137, CD140a, CD147, CD152, CD154, CD200, CD221, CCR4, CC R5, gpl20, angiopoietin 3, PCSK9, HNGF, HGF, GD2, GD3, C5, FAP, ICAM-1, LFA-1, interferon-α, interferon-γ, interferon-γ-inducing protein, SLAMF7, HHGFR, TWEAK receptor, NRP1, EpCAM, CEA, CEA-related antigen, mesothelin, MUC1, IGF-1R, TRAIL-R2, DR5, DLL4, VWF, MCP- 1. β-amyloid, phosphatidylserine, rhesus factor, CCL11, NARP-1, RTN4, ACVR2B, SOST, NOGO-A, sclerostin, Bacillus anthrax, avian influenza, influenza A hemagglutinin, hepatitis A virus, hepatitis B virus, hepatitis C virus, polynuclear respiratory virus, rabies virus glycoprotein, cytomegalovirus glycoprotein B, tuberculosis, Ebola, Staphylococcus aureus It may be specific to aureus, SARS, MERS, malaria, RSV, HPV, HSV, TGF-β, TGF-βRl, NGF, LTA, AOC3, ITGA2, GM-CSF, GM-CSF receptor, oxLDL, LOXL2, RON, KIR2D, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, BTLA, epicyalin, myostatin, or HTV-l.
[0015] Embodiments include lymphocytes derived from isolated human B cells produced by the present invention, and a population of lymphocytes derived from isolated human B cells.
[0016] The embodiments include a pharmaceutical composition comprising an isolated human B cell population according to a first embodiment, and a method of immunotherapy comprising administering the pharmaceutical composition to a target.
[0017] Another aspect of the present invention includes a method for preparing B cells for immunotherapy against a target. The method comprises (a) genomically modifying a population of B cells by deleting a gene encoding an endogenous B cell receptor, and optionally (b) inserting a gene encoding a therapeutic monoclonal antibody. The population of B cells can be proliferated and / or activated (e.g., by IL-4) before genetic modification. The population is at least 1 × 10⁻⁶ 6 The population may contain a number of B cells. Genomic modification can be achieved using nucleases, e.g., engineered nucleases, CRISPR nucleases (e.g., Cas nuclease, Cpf1 nuclease, Cmr nuclease, Csf nuclease, Csm nuclease, Csn nuclease, Csy nuclease, C2c1 nuclease, C2c3 nuclease, or C2c3 nuclease), zinc finger nucleases, or transcription activator-like effector nucleases, the nucleases may be transfected into B cells by nucleofection. Genomic modification can be achieved using the Cas9-gRNA ribonucleoprotein complex. The gRNA may be specific to an immunoglobulin locus. The population of B cells can be activated after genetic modification (e.g., by IL-4).
[0018] The embodiment includes an isolated population of genomically modified B cells expressing a therapeutic monoclonal antibody, and thus the population of genomically modified B cells expressing a therapeutic monoclonal antibody is isolated.
[0019] The embodiment further includes administering to a subject a population of genomically modified B cells expressing a therapeutic monoclonal antibody, either as an autologous or allogeneic product.
[0020] Embodiments include methods for treating subjects, comprising administering a population of genomically modified B cells prepared by the method described above, and a population of genomically modified B cells expressing a therapeutic monoclonal antibody.
[0021] A further aspect of the present invention provides a method for editing the genome of a population of primary human B cells. The method comprises (a) obtaining a population of primary human B cells, and (b) genomically modifying the population of activated B cells by inserting and / or deleting genes of interest. The method may further comprise transfecting the cells with a homologous recombination repair (HDR) template. The method may further comprise, prior to step (b), activating the population of primary human B cells with a cytokine (e.g., IL-4) (e.g., for at least 3 days) to produce a population of activated B cells. Genome modification can be achieved using nucleases, such as engineered nucleases, CRISPR nucleases (e.g., Cas nuclease, Cpfl nuclease, Cmr nuclease, Csf nuclease, Csm nuclease, Csn nuclease, Csy nuclease, C2c1 nuclease, C2c3 nuclease, or C2c3 nuclease), zinc finger nucleases, or transcription activator-like effector nucleases, which may be transfected into B cells by nucleofection. Genome modification can be achieved by transfecting a population of activated B cells with the Cas9 protein and an sgRNA having a sequence specific to the gene of interest to create a genome-modified population of B cells. The method may further include reactivating the genome-edited population of B cells with a cytokine (e.g., IL-4). The population is at least 1 × 10⁶ 6 It may contain individual B cells.
[0022] Embodiments include a population of genome-edited B cells produced by the method described above, and a method of treating a subject that includes administering the population of genome-edited B cells (e.g., autologous or allogeneic).
[0023] In any of the above-described embodiments or models, the target gene may be an immunoglobulin locus, a gene encoding a protein that enhances antigen presentation, a gene encoding a protein that suppresses antigen presentation, a sequence related to antibody retention or secretion, a gene encoding a cytokine, a gene that promotes differentiation into memory B cells, a gene that promotes differentiation into plasma cells, a gene that promotes the transport of B cells to lymphoid organs, or a gene encoding an enzyme that can post-translationally modify antibodies.
[0024] Unless otherwise defined, technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in which the present invention pertains. Similar or equivalent methods and substances may be used in the practice of the present invention, but preferred methods and substances are listed below. All publications, patent applications, patents, and other references mentioned herein are expressly incorporated in their entirety by reference. In case of any conflict, this specification, including definitions, shall prevail. Furthermore, the substances, methods, and examples described herein are illustrative and not intended to be limiting.
[0025] Any of the above-described aspects or embodiments can be combined with any other aspects or embodiments.
[0026] Other features and advantages of the present invention will become apparent from and be included in the detailed description, drawings, and claims.
[0027] A patent or application file must include at least one drawing, which must be in color. A copy of this patent or patent application publication, including the color drawing, will be provided by the Office upon request and payment of the required fees. [Brief explanation of the drawing]
[0028] [Figure 1A] This is a schematic diagram illustrating the rearrangement at the immunoglobulin heavy chain locus. The variable region of the immunoglobulin heavy chain is assembled by V(D)J recombination from the components of the variable (VH), diversity (DH), and binding (JH) gene segments. The rearrangement process involves cleavage of the recombination signal sequence in the DNA adjacent to the rearranged gene segment, carried out by the recombination activator gene 1 (RAG1)-RAG2 complex. DNA end joining requires non-homologous end joining (NHEJ) proteins, including Ku70, Ku80, ARTEMIS, X-ray repair cross-complementation protein 4 (XRCC4), DNA ligase IV, and the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs). Transcription across the locus is driven by a promoter upstream of the rearranged VDJ segment (blue arrow), which promotes the synthesis of the μ heavy chain. This then associates with the light chain resulting from the VJ rearrangement, thereby forming IgM molecules presented on the cell surface of B cells. Next, a second isotype is created by class switch recombination (CSR), a process in which the constant region (CH) of the heavy chain is exchanged with a series of downstream constant region genes (CSR for IgE is shown). The deletion recombination reaction, which requires the enzyme activation-inducible cytidine deaminase (AID), involves the occurrence of DNA breaks in the switch (S) region preceding the constant region gene, followed by DNA repair. This results in the reconfiguration of the CH locus and the deletion of the intervening sequence as an episomal ring. Cytokines stimulate transcription via the CH gene (red arrow) to determine the immunoglobulin isotype to which B cells switch. The reconfigured variable regions of the heavy and light chains also undergo high-frequency point mutations via the process of somatic hypermutation (SHM) (not shown). Eμ and 3' regulatory region (3'RR) enhancers affect V(D)J recombination and CSR, respectively. [Figure 1B] This is a schematic diagram illustrating the bacterial immune defense mechanism of the CRISPR / Cas system. [Figure 1C]This is a schematic diagram illustrating genome editing of human B cell receptors using the CRISPR / Cas system. [Figure 2] This is a schematic diagram illustrating the Cas9-gRNA delivery method. [Figure 3] This is a schematic diagram of various Cas9 vectors containing a GFP-Cas9 bicistronic construct with a T2A site. The selected vectors have different promoters. [Figure 4A] This is a series of graphs illustrating the efficacy of nucleofection of peripheral blood mononuclear cells (PBMCs) with the eGFP construct or the GFP-Cas9 construct. [Figure 4B] The continuation of Figure 4A is shown. [Figure 4C] Figure 4B continues. [Figure 4D] Figure 4C continues below. [Figure 5A] Figures 5A and 5B are a series of graphs illustrating the effectiveness of nucleofection of PBMCs under conditions of eGFP construct, GFP-Cas9 construct, or DNA-free conditions, and the resulting cell viability following the nucleofection process. [Figure 5B] Figure 5B illustrates the cell viability following nucleofection of PBMCs and the percentage of PBMCs expressing GFP. [Figure 6] This is a series of graphs demonstrating the survival rate of isolated B cells following marker expression (CD19) isolation, transfection under conditions lacking eGFP DNA, eGFP mRNA, and DNA, and conditions without transfection, as well as the percentage of transfected cells expressing DNA based on the transfection conditions. [Figure 7A]This is a series of graphs showing the survival rate and percentage of eGFP-positive B cells following the eGFP construct, GFP-Cas9 construct, nucleofection under DNA-free conditions, and untransfected conditions of B cells. Various nucleofection programs, U-015, U-017, and V-015 [Lonza], were evaluated as variations for these experiments (Figures 7A and 7B). [Figure 7B] The continuation of Figure 7A is shown. [Figure 7C] To evaluate the effect of nucleofection of specific DNA constructs on the viability of B cells at selected concentrations, various types of DNA constructs at specific concentrations were nucleofected into isolated B cells (Figure 7C). [Figure 7D] Similar experiments were performed using the cell lines Ramos and U266 (Figure 7D). [Figure 8A] This is a series of graphs illustrating the cell viability and percentage of GFP-expressing cells in cultured isolated B cells in the presence of IL-4 or IL4 / IL21 / CD40L, either before or after nucleofection. [Figure 8B] The continuation of Figure 8A is shown. [Figure 9A] Figure 9A is a series of graphs illustrating the effects of various conditions on the viability and / or eGFP expression of nucleofected cells. Figure 9A is a series of graphs illustrating the optimization of primary B cell transfection. The graphs in Figure 9A illustrate GFP expression or cell viability following transfection with the cited vector construct. [Figure 9B] Figure 9B is a series of graphs illustrating the viability and eGFP expression of nucleofected B cells with DNA at various concentrations. [Figure 9C]Figure 9C is a series of graphs illustrating the effects of cytokine addition (i.e., IL4 or IL4 / IL21 / αCD40) on cell viability as indicated by 7-AAD staining and the amount of GFP-positive B cells, either before or after transfection. [Figure 10] This is a series of graphs illustrating the survival rates following nucleofection by various DNA constructs and the percentage of cells expressing GFP or Cas9 in the presence of IL4 or IL4 / IL21 / αCD40. [Figure 11A] This is a series of graphs illustrating the effects of various cell isolation methods on cell viability and the percentage of GFP-expressing cells following nucleofection by DNA constructs. The isolation methods tested were Magnetic Cell Isolation and Separation (MACS®) and RosetteSep®. [Figure 11B] The continuation of Figure 11A is shown. [Figure 12A] This is a series of graphs illustrating the cell viability of B cells and the percentage of cells expressing GFP under various transfection conditions using the Neon® transfection apparatus. [Figure 12B] The continuation of Figure 12A is shown. [Figure 13A] This is a series of graphs illustrating B cell viability and the percentage of GFP-expressing B cells following nucleofection using various Amaxa® programs (V-015, V-016, V-017). [Figure 13B] This is a series of graphs illustrating the survival rate of PMBCs following nucleofection using various Amaxa® programs (V-015, V-016, V-017) and the percentage of PMBCs expressing GFP. [Figure 14A] This is a series of graphs illustrating cell viability and the percentage of cells expressing GFP or GFP-Cas9 in B cells co-cultured with irradiated CD40L-expressing 3T3 cells. [Figure 14B]The continuation of Figure 14A is shown. [Figure 15A] This is a series of graphs illustrating cell viability and the percentage of cells expressing GFP or GFP-Cas9 in B cells co-cultured with irradiated CD40L-expressing 3T3 cells. [Figure 15B] The continuation of Figure 15A is shown. [Figure 15C] This is a series of graphs illustrating cell viability and the percentage of cells expressing GFP or GFP-Cas9 in B cell line U266 co-cultured with irradiated CD40L-expressing 3T3 cells. [Figure 16-1] This is a series of graphs presenting a summary of the B-cell nucleofection assay performed. [Figure 16-2] The continuation of Figure 16-1 is shown below. [Figure 17] This is a series of gels demonstrating Cas9 / gRNA delivery and comparison with Cas9 DNA, mRNA, or protein. [Figure 18A-1] This is a series of graphs illustrating the TIDE analysis of primary B cells transfected with a DNA construct encoding Cas9. [Figure 18A-2] The continuation of Figure 18A-1 is shown below. [Figure 18B-1] The continuation of Figure 18A-2 is shown below. [Figure 18B-2] The continuation of Figure 18B-1 is shown below. [Figure 18C-1] This is a series of graphs illustrating the TIDE analysis of primary B cells transfected with a Cas9-coding RNA construct. [Figure 18C-2] The continuation of Figure 18C-1 is shown below. [Figure 18D-1] The continuation of Figure 18C-2 is shown below. [Figure 18D-2] The continuation of Figure 18D-1 is shown below. [Figure 18E-1] This is a series of graphs illustrating the TIDE analysis of primary B cells transfected with the Cas9 protein. [Figure 18E-2] The continuation of Figure 18E-1 is shown below. [Figure 18F-1]The continuation of Figure 18E-2 is shown below. [Figure 18F-2] The continuation of Figure 18F-1 is shown. [Figure 19] This is a schematic diagram illustrating the generation of primary human B cells using the Cas9 ribonucleoprotein knock-in method. [Figure 20A-1] This diagram and a series of graphs illustrate the targeting of CXCR4 by Cas9 RNP in human B cells. The data show that CXCR4 expression in B cells is reduced by up to 70% after targeting by Cas9 RNP complexed with gCXCR4. [Figure 20A-2] The continuation of Figure 20A-1 is shown below. [Figure 20B] The continuation of Figure 20A-2 is shown below. [Figure 20C] The continuation of Figure 20B is shown. [Figure 21A] This is a series of gels depicting the insertion of an HDR template into a CXCR4 seated position using Cas9 RNP. [Figure 21B] This is a series of gels illustrating the enhancement of HDR efficiency by adding the NHEJ inhibitor Scr7. [Figure 21C] This is a series of gels depicting CXCR4 cleavage and HDR in human B cell lines. [Figure 21D] Figure 21C continues. [Figure 21E] Figure 21D continues. [Figure 21F] This is a series of graphs illustrating the confirmation of genome editing in activated human primary B cells (by the T7E1 assay). Figures 21F-H are a series of graphs illustrating the ability of various combinations of cytokines and agonists to activate primary human B cells. [Figure 21G] The continuation of Figure 21F is shown. [Figure 21H-1] Figure 21G continues. [Figure 21H-2] The continuation of Figure 21H-1 is shown. [Figure 21I] This is a series of gels depicting the confirmation of genome editing in activated human primary B cells (by the T7E1 assay). RNP is a ribonucleoprotein. [Figure 21J] The continuation of Figure 21I-2 is shown below. [Figure 21K] Figure 21J continues. [Figure 21L] The continuation of Figure 21K is shown. [Figure 22A] This is a series of gels demonstrating the targeting of human B cell receptor loci by Cas9 RNP. Figure 22A depicts a series of gels illustrating an assay to determine primer sequences for amplifying four specific cleavage loci. [Figure 22B] Figures 22B and 22C are a series of gels illustrating the identification of gRNAs that target human B cell receptor (BCR) loci. [Figure 22C] Figure 22B continues. [Figure 22D] Figure 22D shows a series of gels depicting selected gRNA (IGH) combinations that target human BCR loci. [Figure 22E] Figure 22E shows a series of gels depicting selected gRNA (IGK) combinations that target human BCR loci. [Figure 23A] A list of HR templates is shown. HR templates 1) to 8) correspond to sequence numbers 17 to 24, respectively. [Figure 23B] The continuation of Figure 23A is shown. [Figure 23C] Figure 23B continues. [Figure 24A] A series of gels depicting the introduction of HR-mediated restriction sites or epitope tags into the BCR locus of human B cell lines or primary human B cells. [Figure 24B] The continuation of Figure 24A is shown. [Figure 24C] The continuation of Figure 24B is shown. [Figure 24D] Figure 24C continues. [Figure 24E] Figure 24D continues. [Figure 24F] Figure 24E continues below. [Figure 24G] The continuation of Figure 24F is shown. [Figure 24H] Figure 24G continues. [Figure 24I] Figure 24H continues. [Figure 25A-1] Figure 25A is a series of flow cytometry graphs illustrating the introduction of FLAG and HA tags to the BCR locus in primary human B cells, with 5 days of activation before transfection and 6 days of activation after transfection. [Figure 25A-2] The continuation of Figure 25A-1 is shown below. [Figure 25B] Figure 25B is a bar graph showing that FLAG expression increased by more than 5-6 times after insertion of the FLAG / HA construct into IGHV and IGHV / J, and HA expression increased by more than 2-7 times after insertion of the FLAG / HA construct into IGKV and IGKV / J. Figure 25B also shows the presence of FLAG / HA double-positive cells, whose presence increased by more than 1-2 times after insertion into IGHV and IGKV, as well as into IGHV / J and IGKV / J. All stains used for quantification were normalized against an untransfected control (ctrl). [Figure 26A] This is a series of graphs illustrating MiSeq data that confirm homologous recombination (HR) at the CXCR4 locus within B cell lines. NHEJ represents non-homologous end joining. [Figure 26B] This is a series of graphs illustrating MiSeq data that demonstrate homologous recombination (HR) at the CXCR4 locus within primary human B cells. [Figure 26C] This table summarizes the MiSeq results for heart rate (HR) in the CXCR4 sitting position. [Figure 27A] This is a series of graphs depicting MiSeq data showing confirmation of homologous recombination (HR) at the BCR locus within the B cell line-Ramos. NHEJ stands for non-homologous end joining. [Figure 27B] This is a series of graphs illustrating MiSeq data that confirm homologous recombination (HR) at the BCR locus within the B cell line-Raji. [Figure 27C] The continuation of Figure 27B is shown. [Figure 27D] This is a series of graphs illustrating MiSeq data that demonstrate homologous recombination (HR) at the BCR locus within primary human B cells. [Figure 27E] This table summarizes the MiSeq results for HR in the BCR position (and also serves as a guide for sample IDs RI-20 and BI-20). [Figure 28] This bar graph shows the survival rate of primary human B cells activated before transfection, which is shown to be necessary to achieve HR. [Figure 29] This graph illustrates the results of an assay to determine the survival rate of primary B cells after RNP transfection. [Figure 30] Figures 30A and 30B are a series of bar graphs illustrating the detection of model epitope tag expression following homologous recombination in primary B cells. Figure 30A is a bar graph illustrating the expression of the FLAG tag after insertion into the CXCR4 model locus. The inserted epitope tag can be spontaneously expressed from the CXCR4 locus in primary human B cells when regulated by an endogenous promoter. Figure 30B illustrates cell viability following transfection with the indicated components. Cas9 / gRNA RNPs are co-transfected with HDR templates encoding one or three repeats of the FLAG epitope. The first two samples (untransfected or without HDR template) serve as negative controls. [Figure 31]Figures 31A–C illustrate that sequences encoding nanobodies can be inserted into the heavy chain of primary B cells, and that insertion efficiency increases with increasing DNA template volume. The pancaspase inhibitor Q-VD-OPH ("OPH") is included to increase cell viability. Figure 31A is a series of gels illustrating the insertion of nanobody sequences into IGHV of BCRs. Figure 31B is a series of bar graphs illustrating cell viability following the insertion of nanobody sequences into IGHV of BCRs. Figure 31C is a schematic diagram illustrating the insertion of nanobody sequences into IGHV of BCRs and showing the positions of the primers used in PCR run on the gel in Figure 31A, where one primer is specific to the genome and the other is specific to the insert, so that the amplicon can only be detected if the nanobody construct is inserted. [Figure 32] Figures 32A and 32B illustrate how sequences encoding the heavy and light chains of monoclonal antibodies can be inserted into the heavy and light chain loci of primary human B cells. Figure 32A shows a series of gels and schematics illustrating the insertion of the heavy chain sequence into IGHV of BCR. Figure 32B shows a series of gels and schematics illustrating the insertion of the light chain sequence into IGKV of BCR. A 10 μM OPH concentration increases insertion efficiency compared to 2 μM. [Figure 33] Figures 33A–33B illustrate that linearized plasmid HDR templates ("template lin") are inserted more efficiently than circular plasmid HDR templates ("template"). Figure 33A is a series of gels illustrating the insertion of linearized plasmid HDR templates encoding nanobodies, heavy chains ("HC"), or light chains ("LC") into the IGHV and IGKV of BCR. The heavy and light chain constructs used in the experiments described herein also encode the IgG constant region ("IgG-Fc"). Figure 33B is a series of bar graphs illustrating cell viability following the insertion of linearized plasmid HDR templates into the IGHV and IGKV of BCR. [Figure 34]Figure 34A is a series of bar graphs illustrating the insertion of the antibody sequence's BCR into IGHV and IGKV. Figure 34B is a series of graphs illustrating the expression of nanobodies. The FLAG epitope is fused to the nanobodies and heavy chain (HC), and the HA epitope is fused to the light chain (LC). Figure 34C is a series of graphs illustrating the cell viability following the insertion of nanobodies or antibodies. [Figure 35] This is a series of flow cytometry graphs depicting protein expression following insertion of nanobody or antibody sequences into the IGHV and / or IGKV of the BCR. Antibodies specific to FLAG or HA are used to detect cells expressing constructs containing these epitopes. While the editing efficiency is moderate, a clear shift is observed. [Figure 36A] Figure 36A is a series of graphs following a second flow cytometry experiment depicting the insertion of the nanobody or antibody sequence into the BCR of the IGHV and / or IGKV. [Figure 36B] Figure 36B is a series of bar graphs illustrating antibody expression following insertion into IGHV and IGKV. [Figure 36C] Figure 36C is a series of bar graphs depicting cell viability and purity following insertion of nanobody and antibody sequences into the IGHV and IGKV of the BCR. UT represents untransfected cells. [Figure 37-1] This is a series of flow cytometry graphs illustrating the insertion of the antibody sequence's BCR into IGHV and IGKV in the second experiment. [Figure 37-2] The continuation of Figure 37-1 is shown below. [Figure 38A] Figure 38A is a series of graphs following a third flow cytometry experiment depicting the insertion of nanobody or antibody sequences into the BCR of IGHV and / or IGKV. [Figure 38B] Figure 38B is a series of bar graphs illustrating antibody expression following insertion into IGHV and IGKV. [Figure 38C] Figure 38C is a series of bar graphs depicting cell viability and purity following insertion of nanobody and antibody sequences into the IGHV and IGKV of the BCR. UT represents untransfected cells. [Figure 39-1] This is a series of flow cytometry graphs illustrating the insertion of the antibody sequence's BCR into IGHV and IGKV in the third experiment. [Figure 39-2] The continuation of Figure 39-1 is shown below. [Figure 40-1] Figure 40A is a series of graphs depicting flow cytometry data following the insertion of the antibody sequence's BCR into IGHV and IGKV. [Figure 40-2] Figure 40B shows flow cytometry plots of HV(FLAG) following insertion into IGHV and IGKV. Figure 40C shows flow cytometry plots of KV(HA) following insertion into IGHV and IGKV. [Figure 40-3] Figure 40D is a series of bar graphs depicting cell viability and purity following the insertion of the antibody sequence into the BCR of IGHV and IGKV. UT represents untransfected cells. These are identical to the samples from which mRNA was collected for subsequent analysis of expression at the mRNA level. [Figure 41] This is a series of graphs illustrating the insertion of nanobody sequences into the IGHV and IGKV of the BCR, as well as the statistical expression of nanobody flow. [Figure 42] This is a series of graphs depicting the insertion of antibody sequences into IGHV and IGKV in the BCR, based on the quantification of FLAG / HA double-positive cells detected by flow cytometry. [Figure 43] This is a series of graphs depicting the insertion of antibody sequences into the BCR of IGHV and IGKV, based on the quantification of single FLAG or HA-positive cells detected by flow cytometry. [Figure 44]This is a series of graphs depicting the insertion of the antibody sequence into the IGHV and IGKV of the BCR, based on the quantification of FLAG or HA, when the heavy and light chains are targeted individually in separate samples. [Figure 45] This is a series of graphs illustrating the insertion of sequences encoding the heavy and light chains of monoclonal antibodies into the heavy and light chain loci of primary human B cells, leading to the secretion of antibodies with desired specificity. B cells were electroporated with a plasmid HDR template encoding the heavy or light chain of adalimumab (anti-TNFα) along with Cas9 / gRNA RNPs and a constant region. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting IGHV and IGKV loci. ELISA was performed by coating plates with recombinant TNFα before incubation with supernatant from B cell cultures. Secondary antibodies against europium-labeled human IgG were then added to the plates and analyzed using a fluorescence plate reader. UTs are untransfected (negative control). Samples from three independent donors are shown. [Figure 46] This is a series of gels illustrating how insertion of monoclonal antibodies encoding heavy and light chains into the heavy and light chain loci of primary human B cells leads to mRNA expression. B cells were electroporated with a plasmid HDR template encoding the heavy or light chain of adalimumab (anti-TNFα) along with Cas9 / gRNA RNPs and a constant region. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting the IGHV and IGKV loci. mRNA was collected and reverse transcribed using reverse primers specific to the insert. RT-PCR was performed on this cDNA, and amplicons of expected size were detected by gel electrophoresis using two different primer pairs. In both cases, one primer was germline specific and the other was insert specific. UT represents untransfected cells (negative control). [Figure 47]This is a series of graphs illustrating the effect of adding the pancaspase inhibitor Q-VD-OPH ("OPH") to the culture conditions of IL-4 activated cells to increase their viability. Several concentrations of OPH were tested. Flow cytometry was performed 5 days after electroporation. [Figure 48] This is a series of graphs depicting the increased viability of IL-4 activated cells in a second experiment testing several concentrations of OPH. This experiment further included electroporation of Cas9 RNP and HDR templates. [Figure 49] This is a series of graphs illustrating the first experiment, which tested the effect of OPH concentration on the viability of kit-activated cells. The kit contains a CD40 agonist in addition to IL-4. Cells were activated for 4 days before electroporation with Cas9 RNP, and flow cytometry was performed 5 days after electroporation. [Figure 50] This is a series of graphs illustrating the second experiment, which tested the effect of OPH concentration on the viability of kit-activated cells. The kit contains a CD40 agonist in addition to IL-4. Cells were activated 4 days before electroporation of Cas9 RNP and HDR templates, and flow cytometry was performed 5 days after electroporation. [Figure 51] This is a series of graphs illustrating the third experiment, which tested the effect of OPH concentration on the viability of kit-activated cells. The kit contains a CD40 agonist in addition to IL-4. Cells were activated for 4 days before electroporation with Cas9 RNP and HDR templates, and flow cytometry was performed 4 days after electroporation. [Figure 52-1] This is a series of graphs illustrating how an apoptosis inhibitor increases B cell viability after electroporation. UT represents untransfected cells. EPC represents the electroporation control (no RNP or HDR template added). [Figure 52-2] The continuation of Figure 52-1 is shown below. [Modes for carrying out the invention]
[0029] The present invention provides methods or compositions for genome editing of B cells. B cells can be edited to delete and / or insert one or more genes of interest. Deletion means deleting at least a portion of a gene so that the gene is functionally inactive. Furthermore, the present invention provides compositions and methods for transcriptionally repressing or activating genes of interest.
[0030] Surprisingly, it was discovered that the addition of caspase inhibitors increased both the transfection efficiency and viability of genome-edited B cells.
[0031] Genes that may be deleted, inserted, or modified include immunoglobulin genes, genes encoding proteins that enhance antigen presentation, genes encoding proteins that suppress antigen presentation, gene loci containing sequences related to antibody retention or secretion, genes encoding cytokines, genes that promote differentiation into memory B cells, genes that promote differentiation into plasma cells, genes that promote the transport of B cells to lymphoid organs (e.g., lymph nodes, spleen, bone marrow), and genes encoding enzymes that can post-translationally modify antibodies.
[0032] B cells can be edited to modify their specificity or function.
[0033] In some embodiments, the compositions and methods of the present invention are used to produce B cells that do not express endogenous B cell receptors (BCRs). The B cells can further be modified by inserting exogenous BCRs to produce antibodies and / or B cells specific to a target of interest. Current treatments with exogenously produced monoclonal antibodies require regular injections, which typically require patients to travel to medical facilities and / or result in recurrent illness. Furthermore, such exogenously produced monoclonal antibodies are highly effective. In contrast, the present invention provides a method for preparing target-specific B cells that stably produce target-specific therapeutic antibodies after transplantation into a patient. Stable production of exogenously produced antibodies may also result in better clinical outcomes, as serum antibody concentrations remain relatively constant (against a certain level of the target antigen) and do not fluctuate between injections. Furthermore, some commercially available therapeutic antibodies contain non-human portions and may therefore cause an immune response that is neutralizing or even harmful. Since therapeutic antibodies are intrinsically produced by human cells by the method of the present invention, the post-translational modifications of the antibodies are entirely human, and therefore, no harmful immune effects are expected.
[0034] In another embodiment, the compositions and methods of the present invention are used to produce B cells that express proteins not normally expressed by B cells.
[0035] Alternatively, the compositions and methods of the present invention can be used to produce B cells that do not express proteins normally expressed by B cells.
[0036] In further embodiments, compositions and methods of the present invention are used to produce B cells having modified functions. Modified functions include, but are not limited to, improving or hindering the function of B cells as antigen-presenting cells (i.e., for vaccines or tolerance), modifying the inflammatory phenotype of B cells (i.e., pro-inflammatory or anti-inflammatory), restricting the differentiation pathway of B cells, or restricting the localization of B cells. Furthermore, the transmembrane domain of the B cell receptor can be disrupted to convert non-plasma B cells into plasma-like antibody-secreting cells.
[0037] The function of B cells can be modified, or not modified, by altering the repertoire of innate B cell receptors. Modifying function rather than specificity may be useful in ways that induce tolerance in subjects with autoimmune diseases. Manipulating post-translational modifications, such as glycosylation, may be particularly useful for such applications.
[0038] This invention represents the first successful demonstration of genome editing of primary human B cells. To obtain the successful therapeutic application of genome-modified B cells, it was crucial to establish transfection conditions that preserve the viability of primary B cells. In particular, optimal transfection conditions that maintain both viability and function needed to be established. The use of B cells presented several unique challenges compared to other cell types, and therefore, many optimizations were necessary.
[0039] For example, culture conditions were optimized with respect to culture vessel, cell concentration, medium (including supplemental components), and cytokines. These culture conditions, optimized to maintain primary B cell viability, should be modified when cells were activated and / or transfected. Transfection was optimized with respect to cell number, Cas9:gRNA ratio, electroporation device, nucleofection program, and recovery step. Rapid and extremely gentle handling was crucial for viability. Viability was further enhanced by including apoptosis inhibitors (e.g., caspase inhibitors) in the medium.
[0040] In certain embodiments, the method of the present invention employs the use of genome editing to replace the sequence encoding the endogenous B cell receptor (BCR) of patient-derived B cells with a sequence encoding a specified therapeutic monoclonal antibody. The variable regions of the light and heavy chains of the BCR are edited, and the resulting genome-modified B cells are isolated. The resulting genome-modified B cells are administered to the target. Since the B cells can differentiate into memory cells and long-lived plasma cells, a population of antigen-presenting cells persists for a long period, potentially throughout the patient's lifespan.
[0041] Accordingly, the present invention provides a method relating to the use of exogenous DNA, a nuclease enzyme such as a DNA-binding protein, and a guide RNA for localizing the nuclease enzyme to a specific DNA sequence within a B cell. Following the cleavage of endogenous DNA, the exogenous DNA is incorporated into its site via homologous recombination.
[0042] Preferably, the DNA will be cleaved at and near IGHV3-23 and IGHJ6, and IGKV3-20 and IGKJ5. Further target loci include IGHV1-69, IGHV3-30, IGHJ4, IGKV1-39, and IGKJ4. More specifically, the DNA will be cleaved between chr2pl2:88,856,000 and chr2pl2:90,236,000 (including the IGKC and IGKV loci, NC 000002.12 chromosome 2, reference GRCh38.p2, primary assembly, gene ID: 50802), and between chrl4q32.33:105,565,000 and chrl4q32.33:106,881,000 (including the IHG4 and IGHV loci, NC_000014.9 chromosome 14, reference GRCh38.p2, primary assembly, gene ID: 3492). At random selection, the DNA will be cleaved between chr22ql1.222,025,000 and chr22ql1.222,925,000 (including the IGLC and IGLV loci, gene ID: 3535).
[0043] In various embodiments, the invention includes inducible safety switches that can turn on or off the production of therapeutic antibodies, including through inducible expression or repression of the transcription of a target gene, or through permanent induction of cell death. Preferred safety switches are known in the art and include, for example, inducible caspase 9.
[0044] Therapeutic monoclonal antibodies The B cells produced by the method of the present invention are engineered to secrete therapeutic monoclonal antibodies. Therapeutic monoclonal antibodies are well known in the art, for example, 3F8, 8H9, avagovomab, abciximab, abrilumab, actoxumab, adalimumab, adecatumumab, aducanumab, afelimomab, afutuzumab, alacizumab pegol, ALD518, alemtuzumab, alirocumab, altumomab pentetate, amatuximab, and anatumomab mafenatox. mafenatox), anifrolumab, anrukinzumab (=IMA-638), apolizumab, arcitumomab, aselizumab, atinumab, atlizumab (=tocilizumab), atorolimumab, bapineuzumab, basiliximab ab) Bavituximab, Bectumomab, Belimumab, Benralizumab, Bertilimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Biciromab, Bimagrumab, Bivatuzumab mertansine, Blinatumomab, Blosozumab, Brentuximab vedotinVedotin), Briakinumab, Brodalumab, Canakinumab, Cantuzumab mertansine, Cantuzumab ravtansine, Caplacizumab, Capromab pendetide, Carlumab, Catumakisomab, CC49, cBR96-doxorubicin immunoconjugate, Cedelizumab, Certolizumab pegol, Cetuximab, Ch.14.18, Citatuzumab vogatox bogatox), cixutumumab, clazakizumab, clenoliximab, clivatuzumab tetraxetan tetraxetan), conatumumab, concizumab, crenezumab, CR6261, dasetuzumab, daclizumab, dalotuzumab, daratumumab, demcizumab, denosumab, detumomab, dinutuximab, diridavumab, dorlimomab aritoxaritox), Drozitumab, Duligotumab, Dupilumab, Dusigitumab, Ecromeximab, Eculizumab, Edobacomab, Edrecolomab, Efalizumab, Efungumab, Eldelumab, Elotuzumab, Elsilimomab, Emibetuzumab, Enavatuzumab, Enfortumab vedotin, Enlimomab pegol pegol), enokizumab, enoticumab, ensituximab, epitumomabcituxetan), epratuzumab, erlizumab, ertumaxomab, etaracizumab, etrolizumab, evinacumab, evolocumab, exbivirumab, fanolesomab, faralimomab, farletuzumab, fasinumab, FBTA05, felvizumab, fezakinumab, Ficlatuzumab, Figitumumab, Flambotumab, Fletikumab, Fontolizumab, Foralumab, Foravirumab, Fresolimumab, Fulranumab, Futuximab, Galiximab, Ganitumab, Gantenerumab, Gavilimomab, Gemtuzumab ozogamicin ozogamicin), Gevokizumab, Girentuximab, Glembatumumab vedotin, Golimumab, Gomiliximab, Guselkumab, Ibalizumab, Ibritumomab tiuxetan, Icrucumab, Igovomab, IMAB362, Imciromab, Imgatuzumab, Inclacumab, Indatuximabravtansine, infliximab, intetumumab, inolimomab, inotuzumab ozogamicin ozogamicin), ipilimumab, iratumumab, itolizumab, ixekizumab, keriximab, labetuzumab, lambrolizumab, lampalizumab, lebrikizumab, lemalesomab, lerdelimumab, lexatumumab, livivirumab, lifastuzumab vetotin Vedotin, Ligelizumab, Lintuzumab, Lirilumab, Lodelcizumab, Lorvotuzumab mertansine, Lucatumumab, Lulizumab pegol pegol), Lumiliximab, Mapatumumab, Margetuximab, Maslimomab, Mavrilimumab, Matuzumab, Mepolizumab, Metelimumab, Miratuzumab, Minretumomab, Mitumomab, Mogamulizumab, Morolimmumab, Motavizumab, Moxetumomab Pasdotox Pasudotox), Muromonab-CD3, Nacolomab tafenatox, Namilumab, Naptumomab estafenatoxestafenatox), narnatumab, natalizumab, nevacumab, necitumumab, nererimomab, nesvacumab, nimotuzumab, nivolumab, nofetumomab merpentan Merpentan, Obiltoxaximab, Ocaratuzumab, Ocrelizumab, Odulimomab, Ofatumumab, Olaratumab, Olokizumab, Omalizumab, Onartuzumab, Ontuxizumab, Oportuzumab monatox Monatox), Oregovomab, Orticumab, Otelixizumab, Otlertuzumab, Oxelumab, Ozanezumab, Ozoralizumab, Pagibaximab, Palivizumab, Panitumumab, Pankomab, Panobacumab bacumab), Parsatuzumab, Pascolizumab, Pateclizumab, Patritumab, Pmbrolizumab, Pemtumomab, Perakizumab, Pertuzumab, Pexelizumab, Pidilizumab, Pinatuzumab vedotin, Pintumomab, Placulumab, Polatuzumab vedotinVedotin, Ponezumab, Priliximab, Pritoxaximab, Pritumumab, PRO140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ramucirumab, Ranibizumab, Raxibacumab, Regavirumab (R egavirumab, reslizumab, rilotumumab, rituximab, lobatumumab, rolledumab, romosozumab, rontalizumab, roofelizumab, ruplizumab, samalizumab, sarilumab, satumomab pendetide pendetide), Secukinumab, Seribantumab, Setoxaximab, Sevirumab, Sibrotuzumab, SGN-CD19A, SGN-CD33A, Sifalimumab, Siltuximab, Simtuzumab, Siplizumab, Sirukumab, Sofituzumab vedotin Vedotin, solanezumab, solitomab, sonepcizumab, sontuzumab, stamulumab, sulesomab, suvizumab, tabalumab, tacutuzumab tetraxetantetraxetan), tadocizumab, talizumab, tanezumab, taplitumomab paptox, tarexizumab, tefibazumab, telimomab aritox), tenatumomab, teneliximab, teplizumab, teprotumumab, TGN1412, ticilimumab (=tremelimumab), tildrakizumab, tigatuzumab, TNX-650, tocilizumab (Toc ilizumab (=atlizumab), toralizumab, tositumomab, tovetumab, tralokinumab, trastuzumab, TRBS07, tregalizumab, tremelimumab, tucotuzumab (cermoloukin) celmoleukin), tuvirumab, ublituximab, urelumab, urtoxazumab, ustekinumab, vantictumab, vapaliximab, varlilumab, batelizumab, vedolizumab, veltuzumab, bepalimomab, besencumab, visilizumab, volociximab, borsetuzumab mafodotinThis includes mafodotin, botumumab, zalutumumab, zanolimmab, zatuximab, ziralimumab, and zolimomab.
[0045] Therapeutic antibodies include TNF-α, IGHE, IL-1, IL-Iβ, IL-2, IL-4, IL-5, IL-6, IL-6R, IL-9, IL-12, IL-13, IL-17A, IL-20, IL-22, IL-23, IL-25, BAFF, RANKL, Integri -α4, IL-6R, VEGF-A, VEGFR1, VEGFR2, EGFR, HER2, HER3, CA125, integrin α4β7, integrin α7β7, interferon α / β receptor, CXCR4, CD2, CD3, CD4, CD5, CD6, CD19 CD20, CD22, CD23, CD25, CD27, CD28, CD30, CD33, CD37, CD38, CD40, CD41, CD44, CD51, CD52, CD56, CD70, CD74, CD79B, CD80, CD125, CD137, CD140a, CD147, CD152, CD154, CD200, CD221, CCR4, CCR5, gpl20, angiopoietin 3, PCSK9, HNGF, HGF, GD2, GD3, C5, FAP, ICAM-1, LFA-1, interferon-α, interferon- γ, interferon-γ-inducible protein, SLAMF7, HHGFR, TWEAK receptor, NRP1, EpCAM, CEA, CEA-related antigen mesomelin, MUC1, IGF-1R, TRAIL-R2, DR5, DLL4, VWF, MCP-1, β-amyloid, phosphatidylserine, rhesus factor, CCL11, CXCR4NARP-1, RTN4, ACVR2B, SOST, NOGO-A, sclerostin, Bacillus anthrax, avian influenza, influenza A hemagglutinin, hepatitis A virus, hepatitis B It may be specific to viruses, hepatitis C virus, polynuclear respiratory virus, rabies virus glycoprotein, cytomegalovirus glycoprotein B, tuberculosis, Ebola, Staphylococcus aureus, SARS, MERS, RSV, malaria, HPV, HSV, TGF-β, TGF-βRl, NGF, LTA, AOC3, ITGA2, GM-CSF, GM-CSF receptor, oxLDL, LOXL2, RON, KIR2D, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, BTLA, epicyalin, myostatin, or HIV-1.
[0046] gene editing Genome editing, or genome editing, is a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using nucleases. Nucleases may be artificially engineered. Alternatively, nucleases may be naturally occurring. Nucleases generate specific double-strand breaks (DSBs) at desired locations in the genome. Subsequently, the cell's endogenous repair mechanisms repair the induced breaks through natural processes such as homologous recombination (HR) and non-homologous end joining (NHEJ). Nucleases include, for example, zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), CRISPR (e.g., the CRISPR / Cas system), and homing endonucleases that have been reengineered into engineered meganucleases. CRISPR nucleases include, for example, Cas nuclease, Cpfl nuclease, Cmr nuclease, Csf nuclease, Csm nuclease, Csn nuclease, Csy nuclease, C2c1 nuclease, C2c3 nuclease, and C2c3 nuclease.
[0047] DNA binding domain Described herein are compositions comprising a DNA-binding domain that specifically binds to any target site of a gene on a B cell. In preferred embodiments, the gene is an immunoglobulin gene, a gene encoding a protein that enhances antigen presentation, a gene encoding a protein that suppresses antigen presentation, a gene locus containing a sequence related to antibody retention or secretion, a gene encoding a cytokine, a gene that promotes differentiation into memory B cells, a gene that promotes differentiation into plasma cells, or a gene that promotes the transport of B cells to lymphoid organs (e.g., lymph nodes, spleen, bone marrow).
[0048] Any DNA-binding domain can be used in the compositions and methods disclosed herein.
[0049] In one embodiment, the DNA-binding domain includes a zinc finger protein. Preferably, the zinc finger protein is a non-natural protein that has been engineered to bind to a selected target site. For example, Beerii et al., (2002) Nature Biotechnol. 20: pp. 135-141; Pabo et al., (2001) Ann. Rev. Biochem. 70: pp. 313-340; Isalan et al., (2001) Nature Biotechnol. 19: pp. 656-660; Segal et al., (2001) Curr. Opin. Biotechnol. 12: pp. 632-637; Choo et al., (2000) Curr. Opin. Struct See Biol.10:411-416, U.S. Patent Nos. 6,453,242, 6,534,261, 6,599,692, 6,503,717, 6,689,558, 7,030,215, 6,794,136, 7,067,317, 7,262,054, 7,070,934, 7,361,635, 7,253,273, and U.S. Patent Application Publication Nos. 2005 / 0064474, 2007 / 0218528, and 2005 / 0267061, all of which are incorporated herein by reference.
[0050] The manipulated zinc finger-binding domains may possess novel binding specificity compared to natural zinc finger proteins (ZFPs). Methods of manipulation include, but are not limited to, rational design and the selection of various types. Rational design includes, for example, using a database comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. For example, U.S. Patents 6,453,242 and 6,534,261, both of which are incorporated herein by reference, can be seen.
[0051] Exemplary selection methods, including phage displays and two-hybrid systems, are disclosed in U.S. Patents 5,789,538, 5,925,523, 6,007,988, 6,013,453, 6,410,248, 6,140,466, 6,200,759, and 6,242,568, as well as WO98 / 37186, WO98 / 53057, WO00 / 27878, WO01 / 88197 and GB 2,338,237. Furthermore, enhancing the binding specificity of zinc finger binding domains is described, for example, in U.S. Patent 6,794,136.
[0052] Furthermore, as disclosed in these and other references, zinc finger domains and / or polyfingered zinc finger proteins may be linked together using any suitable linker sequence, for example, one containing a linker of 5 or more amino acids in length. For example, see U.S. Patents 6,479,626, 6,903,185, and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. Furthermore, enhancing the binding specificity of the zinc finger binding domain is described, for example, in U.S. Patent 6,794,136.
[0053] Selection of target site Methods for designing and constructing ZFPs and fusion proteins (and polynucleotides encoding them) are known to those skilled in the art, as shown in U.S. Patents 6,140,0815, 789,538, 6,453,242, 6,534,261, 5,925,523, 6,007,988, and 6,013,453. This is described in detail in Japanese Patent Nos. 6,200,759, WO95 / 19431, WO96 / 06166, WO98 / 53057, WO98 / 54311, WO00 / 27878, WO01 / 60970, WO01 / 88197, WO02 / 099084, WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536, and WO03 / 016496.
[0054] In one embodiment, the DNA-binding domain is a modified zinc finger protein that binds (in a sequence-specific manner) to a target site in an HLA gene or HLA regulatory gene, thereby modulating HLA expression. The ZFP can selectively bind to a specific halotype of interest. For a discussion of HLA halos identified in the U.S. population and their frequencies across different races, see Maiers et al., (2007) Human Immunology 68:779–788, incorporated herein by reference.
[0055] In some embodiments, the DNA-binding domain may be derived from a nuclease. For example, recognition sequences of homing endonucleases and meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-Csml, I-PanI, I-Scell, I-PpoI, I-SceIII, I-CieI, I-TevI, I-TevII, and I-TevIII are known. See also U.S. Patent Nos. 5,420,032 and 6,833,252, Belfort et al., (1997) Nucleic Acids Res. 25: pp. 3379-3388, Dujon et al., (1989) Gene 82: pp. 115-118, Perler et al., (1994) Nucleic Acids Res. 22, pp. 1125-1127, Jasin (1996) Trends Genet 12: pp. 224-228, Gimble et al., (1996) J. Mol. Biol. 263: pp. 163-180, Argast et al., (1998) J. Mol. Biol. 280: pp. 345-353, and the New England Biolabs catalog. Furthermore, the DNA binding specificity of homing endonucleases and meganucleases can be manipulated to bind to non-natural target sites. For example, see Chevalier et al., (2002) Molec. Cell 10: pp. 895-905; Epinat et al., (2003) Nucleic Acids Res. 31: pp. 2952-2962; Ashworth et al., (2006) Nature 441: pp. 656-659; Paques et al., (2007) Current Gene Therapy 7: pp. 49-66; and U.S. Patent Application Publication 20070117128.
[0056] In other embodiments, the DNA-binding domain includes an engineered domain from a TAL effector similar to those derived from the plant pathogens Xanthomonas (see Boch et al., (2009) Science 326: pp. 1509-1512, and Moscow and Bogdanove, (2009) Science 326: pp. 1501) and Ralstonia (see Heuer et al., (2007) Applied and Environmental Microbiology 73(13): pp. 4379-4384, U.S. Patent Application No. 20110301073 and U.S. Patent Application No. 20110145940). Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system that can inject more than 25 different effector proteins into plant cells. Among these injected proteins, transcription activator-like effectors (TALEs) mimic plant transcription activators and manipulate the plant transcriptope (Kay et al., (2007) Science 318: pp. 648-651). These proteins contain a DNA-binding domain and a transcription-activating domain. One of the best-characterized TALEs is AvrBS3 from Xanthomonas campestris pv. Vesicatoria (see Bonas et al., (1989) Mol Gen Genet 218: pp. 127-136 and WO2010079430). TALEs contain a domain clustered at one site in a tandem repeat, each repeat containing approximately 34 amino acids, which is important for the DNA-binding specificity of these proteins. Furthermore, they include nuclear localization sequences and acidic transcription activation domains (see Schomack S et al., (2006) J Plant Physiol 163(3):256-272 for a review).Furthermore, in the plant pathogenic bacterium Ralstonia solanacearum, two genes designed for R. solanacearum biovar 1 strain GMI1000 and biovar 4 strain RS1000, brg11 and hpx17, were found to be homologous to the AvrBs3 family of Xanthomonas (see Heuer et al., (2007) Appl and Envir Micro 73(13): pp. 4379-4384). These genes are 98.9% identical in their nucleotide sequences, but differ in a 1,575 bp deletion in the repeat domain of hpx17. However, both gene products have less than 40% sequence identity with Xanthomonas AvrBs3 family proteins.
[0057] Furthermore, as disclosed in these and other references, zinc finger domains and / or polyfingered zinc finger proteins or TALEs may be linked together using any suitable linker sequence, for example, one containing a linker of 5 or more amino acids. For example linker sequences of 6 or more amino acids, see also U.S. Patents 6,479,626, 6,903,185, and 7,153,949. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. Furthermore, enhancing the binding specificity of the zinc finger binding domain is described, for example, in U.S. Patent 6,794,136.
[0058] Fusion protein In one embodiment, the fusion protein includes a DNA-binding domain and a cleavage (nuclease) domain. Genetic modification can be achieved using a nuclease, such as an engineered nuclease. The technique of engineered nucleases is based on the manipulation of native DNA-binding proteins. For example, the manipulation of homing endonucleases with modified DNA-binding specificity is described. See Chames et al., (2005) Nucleic Acids Res 33(20):el78, Arnould et al., (2006) J. Mol. Biol. 355:443-458. Furthermore, the manipulation of ZFPs is also described. See, for example, U.S. Patents 6,534,261, 6,607,882, 6,824,978, 6,979,539, 6,933,113, 7,163,824, and 7,013,219.
[0059] In a preferred embodiment, the nuclease comprises a CRISPR / Cas system. The CRISPR (clustered equispaced short repeat) locus encoding the RNA components of the system, and the Cas (CRISPR-related) locus encoding the protein (Jansen et al., 2002. Mol. Microbiol. 43: pp. 1565-1575; Makarova et al., 2002. Nucleic Acids Res. 30: pp. 482-496; Makarova et al., 2006. Biol. Direct 1: 7; Haft et al., 2005. PLoS Comput Biol. 1: e60) form the gene sequence of the CRISPR / Cas nuclease system. The CRISPR locus within the microbial host comprises a combination of the CRISPR-related (Cas) gene and non-coding RNA elements that can program the specificity of CRISPR-mediated nucleic acid cleavage.
[0060] Type II CRISPR is one of the most well-characterized systems, performing targeted DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, a pre-crRNA array and a tracrRNA, are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes to the repeat region of the pre-crRNA, mediating the processing of the pre-crRNA into a mature crRNA containing a separate spacer sequence. Third, the mature crRNA:tracrRNA complex guides Cas9 to the target DNA via Watson-Crick base pairing between the spacer on the cRNA and the protospacer on the target DNA, following an additional protospacer-adjacent motif (PAM) required for target recognition. Finally, Cas9 generates a double-strand break within the protospacer by mediating the cleavage of the target DNA. The activity of the CRISPR / Cas system involves three steps: (i) insertion of a foreign DNA sequence into the CRISPR array to prevent future attacks in a process called "adaptation," (ii) expression of related proteins and expression and processing of the array, followed by (iii) RNA-mediated interference with foreign nucleic acids. Thus, within bacterial cells, several so-called "Cas" proteins are involved in the natural functioning of the CRISPR / Cas system and play a role in functions such as the insertion of foreign DNA.
[0061] In some embodiments, the Cas protein may be a “functional derivative” of a native Cas protein. A “functional derivative” of a native sequence polypeptide is a compound that has qualitative biological properties in common with the native sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of the native sequence and derivatives of the native sequence polypeptide and its fragments, provided that they have biological activity in common with the corresponding native sequence polypeptide. The biological activity expected herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term “derivative” includes both polypeptide amino acid sequence variants and covalent modifications, as well as fusions thereof. Preferred derivatives of Cas polypeptides or their fragments include, but are not limited to, mutations, fusions, and covalent modifications of Cas proteins or their fragments. Cas proteins, including Cas proteins or their fragments, and derivatives of Cas proteins or their fragments, can be obtained from cells, or can be produced in vitro, or can be obtained by a combination of these two procedures. Cells may be cells that naturally produce Cas protein, or cells that naturally produce Cas protein and produce endogenous Cas protein at high expression levels, or cells that have been genetically engineered to produce Cas protein from exogenously introduced nucleic acids that are identical to or different from endogenous Cas. In some cases, cells do not naturally produce Cas protein and are genetically engineered to produce it.
[0062] The method also involves introducing a single guide RNA (sgRNA) into a cell or organism. The guide RNA (sgRNA) contains a nucleic acid sequence complementary to the target chromosomal DNA. The sgRNA may be an engineered single-stranded guide RNA containing, for example, a crRNA sequence (complementary to the target DNA sequence) and a common tracrRNA sequence, or a crRNA-tracrRNA hybrid. The sgRNA can be introduced into a cell or organism as DNA (with an appropriate promoter), as in vitro transcribed RNA, or as synthetic RNA.
[0063] Furthermore, ZFPs and / or TALEs have been fused to nuclease domains to create functional entities called ZFNs and TALENs, which can recognize target nucleic acid targets via the manipulated (ZFP or TALE) DNA-binding domain and induce DNA cleavage near the DNA binding site through nuclease activity. See, for example, Kim et al., (1996) Proc Natl Acad Sci USA 93(3): pp. 1156-1160. Recently, such nucleases have been used for genome modification in various organisms. For example, one can refer to U.S. Patent Publication No. 20030232410, U.S. Patent Publication No. 20050208489, U.S. Patent Publication No. 20050026157, U.S. Patent Publication No. 20050064474, U.S. Patent Publication No. 20060188987, U.S. Patent Publication No. 20060063231, and International Patent Publication WO07 / 014,275.
[0064] Therefore, the methods and compositions described herein are broadly applicable and may include any target nuclease. Non-limiting examples of nucleases include meganucleases, TALENs, and zinc finger nucleases. Nucleases may include heterogeneous DNA binding and cleavage domains (e.g., zinc finger nucleases, meganucleases with heterogeneous cleavage domains and DNA binding domains), or alternatively, the DNA binding domain of a natural nuclease may be modified to bind to a selected target site (e.g., meganucleases engineered to bind to a site different from that of their congener).
[0065] In any of the nucleases described herein, the nuclease may comprise an engineered TALE DNA-binding domain and a nuclease domain (e.g., an endonuclease and / or meganuclease domain), and is also called a TALEN. Methods and compositions for engineering these TALEN proteins for robust site-directed interactions with user-selected target sequences are publicly available (see, for example, U.S. Patent No. 8,586,526). In some embodiments, the TALEN comprises an endonuclease (e.g., Fold) cleavage domain or a cleavage half-domain. In other embodiments, the TALE nuclease is a megaTAL. These megaTAL nucleases are fusion proteins comprising a TALE DNA-binding domain and a meganuclease cleavage domain. The meganuclease cleavage domain is monomerically active and does not require dimerization for activity. (See Boissel et al., (2013) Nuclease Acid Res: pp. 1-13, doi: 10.1093 / nar / gktl224) Furthermore, the nuclease domain may also exhibit DNA binding function.
[0066] In further embodiments, the nuclease includes a compact TALEN (cTALEN). These are single-stranded fusion proteins in which a TALE DNA-binding domain is linked to a TevI nuclease domain. Depending on the location where the TALE DNA-binding domain is localized relative to the TevI nuclease domain, the fusion protein can function either as a nickase localized by the TALE region or by causing double-strand breaks (see Beurdeley et al., (2013) Nat Comm: pp. 1-8, DOI: 10.1038 / ncomms2782). Additional TALENs (e.g., one or more TALENs (cTALEN or FokI-TALEN) and one or more mega-TALENs) or any TALEN can be used in combination with other DNA-cutting enzymes.
[0067] In certain embodiments, the nuclease comprises a meganuclease (homing endonuclease) or portions thereof that exhibit cleavage activity. Natural meganucleases recognize cleavage sites of 15 to 40 base pairs and are typically classified into four families: the LAGLIDADG (SEQ ID NO: 1) family, the GIY-YIG family, the His-Cyst box family, and the HNH family. Exemplary homing endonucleases include I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII. Their recognition sequences are known. See also U.S. Patent No. 5,420,032, U.S. Patent No. 6,833,252, Belfort et al., (1997) Nucleic Acids Res. 25:3379-3388, Dujon et al., (1989) Gene 82:115-118, Perler et al., (1994) Nucleic Acids Res. 22,1125-1127, Jasin (1996) Trends Genet 12:224-228, Gimble et al., (1996) J. Mol. Biol. 263:163-180, Argast et al., (1998) J. Mol. Biol. 280:345-353, and the catalog of New England Biolabs.
[0068] Initially, DNA-binding domains derived from the LAGLIDADG (SEQ ID NO: 1) family of natural meganucleases have been used to promote site-directed genome modification in plants, yeast, Drosophila, mammalian cells, and mice. However, this approach has evolved to include modifications of homologous genes that preserve the meganuclease recognition sequence (Monet et al., (1999) Biochem Biophysics. Res. Common. 255:88-93), or pre-modified genomes into which the recognition sequence has been introduced (Route et al., (1994) Mol. Cell. Biol. 14:8096-106, Chilton et al., (2003) Plant Physiology. 133:956-65, Puchta et al., (1996) Proc. Natl. Acad. Sci. USA 93:5055-60, Rong et al., (2002) Genes Dev. It is limited to either 16:1568-81, Gouble et al., (2006) J. Gene Med. 8(5):616-622. Therefore, efforts have been made to manipulate meganucleases to exhibit novel binding specificity at medically or biologically relevant sites (Porteus et al., (2005) Nat Biotechnol. 23: pp. 967-973; Sussman et al., (2004) J. Mol. Biol. 342: pp. 31-41; Epinat et al., (2003) Nucleic Acids Res. 31: pp. 2952-62; Chevalier et al., (2002) Molec. Cell 10: pp. 895-905; Epinat et al., (2003) Nucleic Acids Res. 31: pp. 2952-2962; Ashworth et al., (2006) Nature 441: pp. 656-659; Paques et al., (2007) Current Gene Therapy pp. 7:49-66, U.S. Patent Application Publication Nos. 20070117128, 20060206949, 20060153826, 20060078552, and 20040002092).Furthermore, native or engineered DNA-binding domains derived from meganucleases can be operably ligated to cleavage domains derived from heterologous nucleases (e.g., FokI), and / or cleavage domains derived from meganucleases can be operably ligated to heterologous DNA-binding domains (e.g., ZFP or TALE).
[0069] In other embodiments, the nuclease is a zinc finger nuclease (ZFN) or a TALE DNA-binding domain-nuclease fusion (TALEN). ZFNs and TALENs include a DNA-binding domain (zinc finger protein or TALE DNA-binding domain) engineered to bind to a selected target site, and a cleavage domain or cleavage half-domain (e.g., derived from restriction and / or meganucleases as described herein).
[0070] As described in detail above, zinc finger binding domains and TALE DNA binding domains can be engineered to bind to a selected sequence. See, for example, Beerli et al., (2002) Nature Biotechnol. 20:135-141; Pabo et al., (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al., (2001) Nature Biotechnol. 19:656-660; Segal et al., (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al., (2000) Curr. Opin. Struct Biol. 10:411-416. Engineered zinc finger binding domains or TALE proteins can have novel binding specificities compared to the native proteins. Methods of engineering include, but are not limited to, rational design and various types of selections. Rational design includes, for example, using a database that associates triplet (or quadruplet) nucleotide sequences with the amino acid sequences of individual zinc fingers or TALEs, where each triplet or quadruplet nucleotide sequence is associated with the amino acid sequence of one or more zinc finger or TALE repeat units that bind to a specific triplet or quadruplet sequence. See, for example, U.S. Patent No. 6,453,242 and U.S. Patent No. 6,534,261, which are hereby incorporated by reference in their entirety.
[0071] Methods for the selection of target sites and the design and construction of fusion proteins (and polynucleotides encoding the same) are known to those of skill in the art and are described in detail in U.S. Patent No. 7,888,121 and U.S. Patent No. 8,409,861, which are hereby incorporated by reference in their entirety.
[0072] Furthermore, as disclosed in these and other references, zinc finger domains, TALEs, and / or polyfingered zinc finger proteins may be linked together using any suitable linker sequence, for example, one containing a linker of 5 or more amino acids in length (e.g., TGEKP (SEQ ID NO: 3), TGGQRP (SEQ ID NO: 4), TGQKP (SEQ ID NO: 5), and / or TGSQKP (SEQ ID NO: 6)). For example, for exemplary linker sequences of 6 or more amino acids in length, see U.S. Patents 6,479,626, 6,903,185, and 7,153,949. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. See also U.S. Provisional Application No. 61 / 343,729.
[0073] Therefore, nucleases such as ZFNs, TALENs, and / or meganucleases may contain any DNA-binding domain and any nuclease (cleavage) domain (cleavage domain, cleavage half-domain). As mentioned above, the cleavage domain may be heterologous to the DNA-binding domain; for example, the DNA-binding and cleavage domains of a zinc finger or TAL effector may be derived from a nuclease, or the DNA-binding and cleavage domains of a meganuclease may be derived from a different nuclease. Heterologous cleavage domains can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which cleavage sites may originate include, but are not limited to, restriction endonucleases and homing endonucleases. For example, see the 2002-2003 catalog, New England Biolabs, Beverly, Mass, and Belfort et al., (1997) Nucleic Acids Res. 25: pp. 3379-3388. Further enzymes that cleave DNA are known (see, for example, S1 nuclease, manguine nuclease, pancreatic DNase I, micrococcal nuclease, yeast HO endonuclease, Linn et al., (ed.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or their functional fragments) can be used as sources for cleavage domains and cleavage half-domains.
[0074] Similarly, the cleavage half-domains may originate from any nuclease or a portion thereof and require dimerization for cleavage activity, as described above. Generally, if a fusion protein contains cleavage half-domains, two fusion proteins are required for cleavage. Alternatively, a single protein containing two cleavage half-domains can be used. The two cleavage half-domains may originate from the same endonuclease (or its functional fragment), or each cleavage half-domain may originate from a different endonuclease (or its functional fragment). Furthermore, for two fusion proteins, the target sites relative to each other are in a preferred configuration, and as a result, the binding of the two fusion proteins to their respective target sites positions the cleavage half-domains in a spatial orientation relative to each other, such as by dimerization, to form functional cleavage domains. Thus, in some embodiments, the near ends of the target sites are separated by 5-8 nucleotides or 15-18 nucleotides. However, any integer number of nucleotides or nucleotide pairs can be interposed between the two target sites (e.g., 2-50 or more nucleotide pairs). Generally, the cleavage site is located between the target sites.
[0075] Restriction endonucleases (restriction enzymes) are present in many species and are capable of sequence-specific binding to DNA (at the recognition site) and cleavage of DNA at or near the binding site. Some restriction enzymes (e.g., IIS type) cleave DNA at a site distant from the recognition site and have separable binding and cleavage domains. For example, the IIS type enzyme Fok I catalyzes double-strand breaks of DNA at a position 9 nucleotides from the recognition site on one strand and at a position 13 nucleotides from the recognition site on the other strand. For example, see U.S. Patents 5,356,802, 5,436,150, and 5,487,994, as well as Li et al., (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279, Li et al., (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768, Kim et al., (1994a) Proc. Natl. Acad. Sci. USA 91:883-887, Kim et al., (1994b) J. Biol. Chem 269:31,978-31,982. Thus, in one embodiment, the fusion protein comprises at least one cleavage domain (or cleavage half-domain) derived from an IIS-type restriction enzyme and one or more zinc finger-binding domains, which may or may not be manipulated.
[0076] An exemplary IIS-type restriction enzyme in which the cleavage domain is separable from the binding domain is Fok I. This particular enzyme is active as a dimer, as described by Bitinaite et al., (1998) Proc. Natl. Acad. Sci. USA 95:10,570-10,575. Therefore, for the purposes of this disclosure, the portion of the Fok I enzyme used in the disclosed fusion proteins is considered to be the cleavage half-domain. Thus, for targeted double-strand cleavage and / or targeted replacement of cellular sequences using zinc finger-Fok I fusion, two fusion proteins, each containing a Fok I cleavage half-domain, can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage half-domains can also be used. The parameters for targeted cleavage and targeted sequence variation using zinc finger-Fok I fusion are presented somewhere in this disclosure.
[0077] A cleavage domain or cleavage half-domain can be any part of a protein that retains cleavage activity or the ability to polymerize (e.g., dimerize) to produce a functional cleavage domain.
[0078] Exemplary IIS-type restriction enzymes are described in International Patent Application Publication WO07 / 014,275, all of which are incorporated herein by reference. Further restriction enzymes also include separable binding and cleavage domains, which are contemplated in this disclosure. See, for example, Roberts et al., (2003) Nucleic Acids Res. 31:418–420.
[0079] In one embodiment, the cleavage domain includes one or more manipulated cleavage half-domains (also called dimerization domain mutations) that minimize or prevent homodimerization, such as those described in U.S. Patents 7,914,796, 8,034,598, and 8,623,618, and U.S. Patent Application Publication 20110201055, all of which are incorporated herein by reference. The amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of Fok I are all targets that affect the dimerization of the Fok I cleavage half-domain.
[0080] The manipulated cleaved half-domains described herein can be prepared, for example, by site-directed mutagenesis of a wild-type cleaved half-domain (Fok I) using any preferred method, such as those described in U.S. Patent Nos. 7,914,796, 8,034,598, and 8,623,618, and U.S. Patent Application Publication No. 20110201055.
[0081] Alternatively, nucleases can be assembled in vivo at nucleic acid target sites using so-called “replication enzyme” technology (see, for example, U.S. Patent Application Publication No. 20090068164). The components of such a resolution enzyme can either be expressed on separate expression constructs, or the individual components can be linked in a single open reading frame separated, for example, by a self-cleaving 2A peptide or IRES sequence. The components may be individual zinc finger-binding domains or meganuclease nucleic acid-binding domains.
[0082] Nucleases can be screened for activity in a yeast-based chromosome system before use, for example, as described in WO2009 / 042163 and 20090068164. Nuclease expression constructs can be readily designed using methods known in the art. For example, see U.S. Patent Publication Nos. 20030232410, 20050208489, 20050026157, 20050064474, 20060188987, 20060063231, and International Patent Publication WO07 / 014,275. Nuclease expression may be regulated by a constitutive or inducible promoter, such as a galactokinase promoter that is activated (derepressed) in the presence of raffinose and / or galactose and repressed in the presence of glucose.
[0083] delivery Methods for delivering proteins containing DNA-binding domains as described herein are described, for example, in U.S. Patents 6,453,242, 6,503,717, 6,534,261, 6,599,692, 6,607,882, 6,689,558, 6,824,978, 6,933,113, 6,979,539, 7,013,219, and 7,163,824, all of which are incorporated herein by reference.
[0084] DNA-binding domains as described herein and fusion proteins containing such DNA-binding domains can be delivered using vectors containing sequences encoding one or more DNA-binding proteins. Furthermore, additional nucleic acids (e.g., sequences encoding donor and / or non-classical HLA proteins) can also be delivered via these vectors. Any vector system can be used, including but not limited to plasmid vectors, linear constructs, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors, herpesvirus vectors, and adeno-associated virus vectors. U.S. Patents 6,534,261, 6,607,882, 6,824,978, 6,933,113, 6,979,539, 7,013,219, and 7,163,824 can also be referenced, all of which are incorporated herein by reference. Furthermore, it will be apparent that any of these vectors may contain one or more DNA-binding protein-coding sequences and / or appropriate additional nucleic acids. Therefore, when one or more DNA-binding proteins as described herein are introduced into a cell, and additional DNA is appropriate, they may be carried on the same vector or on separate vectors. When multiple constructs are used, each vector may contain a sequence encoding one or more DNA-binding proteins, and, if desired, additional nucleic acids.
[0085] Conventional viral and nonviral gene transfer methods can be used to introduce nucleic acids encoding engineered DNA-binding proteins into cells (e.g., mammalian cells) and target tissues, with the co-introduction of additional nucleic acid sequences if desired. Such methods can also be used to administer nucleic acids (encoding, for example, DNA-binding proteins, donor proteins, and / or non-classical HLA proteins) to cells in vitro. In some embodiments, nucleic acids are administered for use in vivo or ex vivo gene therapy.
[0086] Nonviral vector delivery systems include DNA plasmids, naked nucleic acids, nucleic acids complexed with delivery vehicles such as liposomes or polymers, or ribonucleoproteins.
[0087] Viral vector delivery systems include DNA and RNA viruses, which, after delivery to cells, become episomes or are integrated into the genome. For a review of gene therapy procedures, see Anderson, Science 256: pp. 808-813 (1992), Nabel and Feigner, TIBTECH 11: pp. 211-217 (1993), Mitani and Caskey, T1BTECH 11: pp. 162-166 (1993), Dillon, TIBTECH 11: pp. 167-175 (1993), Miller, Nature 357: pp. 455-460 (1992), Van Brunt, Biotechnology 6(10): pp. 1149-1154 (1988), Vigne, Restorative Neurology and Neuroscience 8: pp. 35-36 (1995), and Kremer and Perricaudet, British Medical Bulletin. See 51(l):pp. 31-44 (1995), Haddada et al., in Current Topics in Microbiology and Immunology, Doerfler and Bohm (eds.) (1995), and Yu et al., Gene Therapy 1:pp. 13-26 (1994).
[0088] Nonviral delivery methods include electroporation, nucleofection, lipofection, microinjection, gene guns, viromosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid complexes, naked DNA, mRNA, ribonucleoproteins, artificial vilorones, and drug-enhanced uptake of DNA. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for delivery. In a preferred embodiment, one or more nucleic acids are delivered as mRNA. The use of capped mRNA to increase translation efficiency and / or mRNA stability is also preferred. ARCA (anti-reverse cap analog) caps or variants thereof are particularly preferred. See U.S. Patents 7,074,596 and 8,153,773 incorporated herein by reference.
[0089] More preferably, the protein containing the DNA-binding domain is delivered as a ribonucleoprotein (RNP). The RNP contains a nuclease and a DNA-binding domain such as gRNA. Preferably, the RNP is Cas9-gRNA.
[0090] Additional exemplary nucleic acid delivery systems include those provided by Lonza (Cologne, Germany), Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc (see, for example, U.S. Patent No. 6,008,336). Lipofection is described, for example, in U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787, and U.S. Patent No. 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam™, Lipofectin™, and Lipofectamine™ RNAiMAX). Cationic and neutral lipids suitable for receptor recognition lipofection of effective polynucleotides include those of Feigner, WO91 / 17424, WO91 / 16024. Delivery can be done to cells (ex vivo administration) or can target tissues (in vivo administration).
[0091] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those of skill in the art (see, for example, Crystal, Science 270:404-410 (1995), Blaese et al., Cancer Gene Ther 2:291-297 (1995), Behr et al., Bioconjugate Chem 5:382-389 (1994), Remy et al., Bioconjugate Chem 5:647-654 (1994), Gao et al., Gene Therapy 2:710-722 (1995), Ahmad et al., Cancer Res. 52:4817-4820 (1992), U.S. Patent No. 4,186,183, U.S. Patent No. 4,217,344, U.S. Patent No. 4,235,871, U.S. Patent No. 4,261,975, U.S. Patent No. 4,485,054, U.S. Patent No. 4,501,728, U.S. Patent No. 4,774,085, U.S. Patent No. 4,837,028, and U.S. Patent No. 4,946,787).
[0092] The use of RNA or DNA virus-based systems for the delivery of nucleic acids encoding engineered DNA-binding proteins and / or other donors, if desired, leverages highly advanced processes for targeting viruses to specific cells and transporting the viral payload to nucleic acids. Viral vectors can be administered directly to patients (in vivo), or they can be used to directly treat cells in vitro, allowing the modified cells to be administered to patients (ex vivo). Conventional virus-based systems for nucleic acid delivery include, but are not limited to, retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia vectors, and herpes simplex virus vectors for gene transfer. Integration into the host genome is possible in retroviral, lentiviral, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues.
[0093] The targeting of retroviruses can be modified by incorporating exogenous envelope proteins, expanding the target population of potentially infectable target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transduction system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats (LTRs) capable of packaging exogenous sequences up to 6–10 kb. A minimum number of cis-acting LTRs are sufficient for vector replication and packaging, which can then be used to incorporate therapeutic genes into target cells to provide persistent transgene expression. Widely used retroviral vectors include those based on mouse leukemia virus (MuLV), gibbon leukemia virus (GaLV), Simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchscher et al., J. Virol. 66: pp. 2731-2739 (1992), Johann et al., J. Virol. 66: pp. 1635-1640 (1992), Sommerfelt et al., Virol. 176: pp. 58-59 (1990), Wilson et al., J. Virol. 63: pp. 2374-2378 (1989), Miller et al., J. Virol. 65: pp. 2220-2224 (1991), and PCT / US94 / 05700).
[0094] Adenovirus-based systems can be used in applications where transient expression is preferred. Adenovirus-based vectors enable very high transduction efficiency in many cell types and do not require cell division. High titers and high levels of expression have been obtained with such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used, for example, in the in vitro production of nucleic acids and peptides, and for transduction of target nucleic acids into cells for in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160: pp. 38-47 (1987), U.S. Patent No. 4,797,368, WO93 / 24641, Kotin, Human Gene Therapy 5: pp. 793-801 (1994), Muzyczka, J. Clin. Invest. 94:1351 (1994)). The construction of recombinant AAV vectors has been described in numerous publications, including U.S. Patent No. 5,173,414, Tratschin et al., Mol. Cell. Biol. 5: pp. 3251-3260 (1985), Tratschin et al., Mol. Cell. Biol. 4: pp. 2072-2081 (1984), Hermonat and Muzyczka, PNAS 81: pp. 6466-6470 (1984), and Samulski et al., J. Virol. 63: pp. 03822-3828 (1989).
[0095] In clinical trials, at least six viral vector approaches are currently available for gene transfer, and these approaches utilize methods that involve supplementing the deletion vector with a gene that is inserted into a helper cell line to produce a transduction factor.
[0096] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood 85: pp. 3048-305 (1995), Kohn et al., Nat. Med. 1: pp. 1017-102 (1995), Malech et al., PNAS 94: 22 pp. 12133-12138 (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., Science 270: pp. 475-480 (1995)). Transduction efficiencies of over 50% have been observed in MFG-S packaged vectors (Ellem et al., Immunol Immunother. 44(1): pp. 10-20 (1997), Dranoff et al., Hum. Gene Ther. 1: pp. 111-112 (1997)).
[0097] Recombinant adeno-associated virus vectors (rAAVs) are a promising alternative gene delivery system based on deficient and non-pathogenic parvovirus adeno-associated virus type 2. All vectors are derived from plasmids containing only AAV 145 via a terminal inversion sequence adjacent to the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of transduced cells are key features of this vector system. (Wagner et al., Lancet 351:9117 pp. 1702-1703 (1998), Keams et al., Gene Ther. 9:748-755 (1996)). Other AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV8.2, AAV9, and AAVrh10, as well as pseudotype AAVs such as AAV2 / 8, AAV2 / 5, and AAV2 / 6, can also be used in conjunction with the present invention.
[0098] Replication-deficient recombinant adenovirus vectors (Ad) can be produced with high titers and readily infect many different cell types. Many adenovirus vectors are engineered so that the transgene replaces the Ad E1a, E1b, and / or E3 genes, and then the replication-deficient vector proliferates in human cells, trans-replenishing the function of the deficient gene. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing differentiated cells, such as those found in the liver, kidney, and muscle. Conventional Ad vectors have large carrying capacity. Examples of Ad vector use in clinical trials include polynucleotide therapy for antitumor immunization via intramuscular injection (Sterman et al., Hum. Gene Ther. 7: pp. 1083-1089 (1998)). Further examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24:1 pp. 5-10 (1996), Sterman et al., Hum. Gene Ther. 9:7 pp. 1083-1089 (1998), Welsh et al., Hum Gene Ther. 2:205-2018 (1995), Alvarez et al., Hum. Gene Ther. 5:597-613 (1997), Topf et al., Gene Ther. 5:507-513 (1998), and Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).
[0099] Packaging cells are used to form viral particles that can infect host cells. Such cells include 293 cells for packaging adenoviruses, and psi.2 or PA317 cells for packaging retroviruses. Viral vectors used in gene therapy are typically produced by a production cell line that packages nucleic acid vectors into viral particles. The vector typically contains the minimum viral sequence necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding proteins to be expressed. The lost viral function is supplied trans by the packaging cell line. For example, an AAV vector used in gene therapy has only the terminal inversion (ITR) sequence derived from the AAV genome required for packaging and integration into the host genome. The viral DNA is packaged into a cell line containing helper plasmids that encode other AAV genes, namely rep and cap, but lack the ITR sequence. The cell line is also infected with adenovirus as a helper. The helper virus promotes the replication of the AAV vector and the expression of AAV genes from the helper plasmid. Helper plasmids are not packaged in large quantities because they lack an ITR sequence. Adenovirus contamination can be reduced, for example, by heat treatment where adenovirus is more susceptible than AAV.
[0100] B cell gene editing This invention provides a method for gene editing of B cells.
[0101] In some embodiments, B cells are edited so that they do not express their endogenous (i.e., naturally reconstituted) B cell receptor (BCR).
[0102] In some embodiments, B cells are edited to replace the endogenous B cell receptor (BCR) of the B cell with a sequence of a defined therapeutic monoclonal antibody. The variable regions of the light and heavy chains of the BCR will be edited. For example, IGHV, IGHD, IGHJ, IGHC, IGKV, IGKJ, IGKC, IGLV, IGLJ, IGLC, or any combination thereof may be edited. In some preferred embodiments, the B cell receptor is edited in IGHV, IGKV, and across the IGHV / J region. In some embodiments, multiple B cell receptor regions are co-targeted for modification. For example, IgHV and IgHJ, or IgHV and IgKV, or any combination thereof may be co-targeted. In some embodiments, modification or editing is possible at multiple B cell receptor loci. In some embodiments, the B cell receptor can be targeted for genomic insertion across the V / J fragment.
[0103] In another embodiment, B cells are edited to either express or not express the gene of interest. In a further embodiment, B cells are modified to be transcriptionally repressive or to activate the gene of interest.
[0104] For example, B cells are edited or modified to alter their function. Modified function includes, but is not limited to, improving or hindering the function of B cells as antigen-presenting cells (i.e., for vaccines or tolerance), altering the inflammatory phenotype of B cells (i.e., pro-inflammatory or anti-inflammatory), restricting the differentiation pathway of B cells, or restricting the localization of B cells. Furthermore, the transmembrane domains of B cells can be disrupted to convert non-plasmid B cells into plasma-like antibody-secreting cells.
[0105] The function of B cells can be modified, or not modified, by altering the repertoire of innate B cell receptors. Modifying function rather than specificity is useful in methods of inducing tolerance in subjects with autoimmune diseases.
[0106] B cells are first edited by isolating them from a sample of interest. The sample may be, for example, blood, bone marrow, or tissue. For instance, B cells can be isolated from peripheral blood mononuclear cells (PBMCs), bone marrow, or spleen.
[0107] B cells are isolated by any method known in the art. For example, B cells are isolated by flow cytometry, magnetic cell isolation and cell separation (MACS), RosetteSep, or antibody panning. One or more isolation techniques can be used to obtain a population of B cells isolated with sufficient purity, viability, and yield.
[0108] Preferably, B cells are isolated by MACS. More preferably, B cells are isolated by RosetteSep.
[0109] The purity of the isolated B cells is at least approximately 80%, 85%, 90%, 91%, 92%, 93%, 94%, and 95%. The viability of the isolated B cells is at least approximately 70%, 75%, 80%, 85%, 90%, and 95%.
[0110] Optionally, after isolation, B cells are grown in culture to obtain a sufficient number of cells for gene editing. In some embodiments, B cells are cultured in RPMI + 10% FBS, 1% P / S, 1% HEPES, and 1% L-glutamine. The B cells are approximately 0.5 and 10 × 10⁶ 6 They are cultured at a density of cells / mL or between those densities. Preferably, B cells are cultured at approximately 2 and 4 × 10⁶ cells / mL. 6 Cells are cultured at or between cells / mL.
[0111] In some embodiments, B cells are cultured in a cell medium containing cytokines. Cytokines include, for example, IL-1-like, IL-1α, IL-1β, IL-1RA, IL-18, common γ chain (CD132), IL-2, IL-4, IL-7, IL-9, IL-13, IL-15, common β chain (CD131), IL-3, IL-5, GM-CSF, IL-6-like, IL-6, IL-11, G-CSF, IL-12, LIF, OSM, IL-10-like, IL-10, IL-20, IL-21, IL-14, and IL-16. These include IL-17, IFN-α, IFN-β, IFN-γ, CD154, LT-β, TNF-α, TNF-β, 4-1BBL, APRIL, CD70, CD153, CD178, GITRL, LIGHT, OX40L, TALL-1, TRAIL, TWEAK, TRANCE, TGF-β1, TGF-β2, TGF-β3, Epo, Tpo, Flt-3L, SCF, M-CSF, αCD40, or any combination thereof. Toll-like receptor agonists can also be used. Preferably, the cytokines are IL-4, IL-2, CD40L, or any combination thereof.
[0112] B cells can be activated before and / or after transfection. Unexpectedly, it was discovered that homologous recombination (i.e., when a gene is inserted) in primary human B cells requires activation before transfection. Furthermore, reactivation after transfection can also improve homologous recombination. Surprisingly, if the cells were not activated before transfection, activation immediately after transfection (and even for five consecutive days) did not result in homologous recombination. Activation was not an absolute requirement for non-homologous end joining (NHEJ) (i.e., when a gene is deleted).
[0113] Preferably, B cells are activated before transfection. More preferably, B cells are activated both before and after transfection.
[0114] B cells can be activated by culturing them in a cytokine-containing cell medium for approximately 1 to 10 days, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. Preferably, B cells are cultured in a cytokine-containing cell medium for approximately 3 to 5 days.
[0115] Cytokines include, for example, IL-1-like, IL-1α, IL-1β, IL-1RA, IL-18, common γ chain (CD132), IL-2, IL-4, IL-7, IL-9, IL-13, IL-15, common β chain (CD 131), IL-3, IL-5, GM-CSF, IL-6-like, IL-6, IL-11, G-CSF, IL-12, LIF, OSM, IL-10-like, IL-10, IL-20, IL-21, IL-14, IL-16 These include IL-17, IFN-α, IFN-β, IFN-γ, CD154, LT-β, TNF-α, TNF-β, 4-1BBL, APRIL, CD70, CD153, CD178, GITRL, LIGHT, OX40L, TALL-1, TRAIL, TWEAK, TRANCE, TGF-β1, TGF-β2, TGF-β3, Epo, Tpo, Flt-3L, SCF, M-CSF, αCD40, or any combination thereof. Toll-like receptor agonists can also be used. Preferably, the cytokines are IL-4, IL-2, CD40L, or any combination thereof.
[0116] Preferably, B cells are activated for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to transfection. Most preferably, B cells are activated for at least 3 days. For example, B cells are activated for at least 3, 4, or 5 days prior to transfection. Preferably, B cells are reactivated for at least 1, 2, 3, 4, or 5 days after transfection. Most preferably, B cells are activated with IL-4 prior to transfection. Furthermore, B cells may be further treated with IL-4 after transfection. Preferably, B cells are activated by a B cell proliferation kit.
[0117] Cytokines are present at concentrations of approximately 1 ng / ml and 20 ng / ml, or concentrations between these. The cytokine concentrations for B cell activation are approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ng / ml. In a preferred embodiment, the cytokine concentration is approximately 5 ng / ml.
[0118] In some embodiments, B cells are treated with CD40L before transfection. + The cells (e.g., 3T3 cells) are co-cultured. The B cells are co-cultured for at least 12, 24, 36, 48, or 72 hours prior to transfection.
[0119] The preferred culture conditions for inactivated primary B cells are 1-2 × 10⁶ cells in RPMI supplemented with penicillin, streptomycin, L-glutamine, and HEPES, as well as 5 ng / ml of IL-4 (without β-ME), in 15 ml bioreactor tubes (before transfection) and FACS tubes (after transfection). 6 This includes culturing cells at a concentration of cells / ml.
[0120] Preferred culture of activated primary B cells involves culturing them in a standing T25 flask (in a standard incubator) or a 100 ml Erlenmeyer (a shaking incubator that prevents aggregation and thereby avoids the need to roughly resuspend cells) in medium supplemented with 5 μl of each Expander / ml (CellXVivo Human B Cell Growth Kit, R&D Systems).
[0121] B cells are edited by the use of exogenous DNA, nuclease enzymes such as DNA-binding proteins, and guide RNAs (gRNAs) that localize the nuclease enzyme to specific DNA sequences within the B cell. The nuclease and gRNA are delivered (i.e., transfected) into the B cell by methods known in the art as described above. Preferably, the B cells are transfected by nucleofection. Most preferably, the B cells are transfected with an endonuclease protein such as Cas9, or a ribonucleoprotein complex in which Cas9 is pre-complexed with the gRNA.
[0122] The viability and transfection efficiency of B cells increase depending on the number of cells transfected. For example, for optimal viability and efficiency, at least 1×10 4 ~1×10 8 cells are transfected. Preferably, 1×10 6 ~1×10 7 B cells are transfected. Most preferably, at least about 1×10 6 to 5×10 6 ~1×10 7 B cells are transfected.
[0123] B cells are transfected by nucleofection using a nucleofection device. Any nucleofection device can be used, for example, MaxCyte, Neon®, or Amaxa®, preferably Amaxa® Nucleofector is used. Any Amaxa® Nucleofector program can be used. Preferably, program V-015, U-015, or V-015 is used. Most preferably, program V-015 is used.
[0124] Preferred nucleofection conditions include transfection with Cas9 RNP (10 μg Cas9 + 20 μg gRNA pre-complexed at room temperature for 20 minutes) using the human B cell nucleofector kit (Lonza) with the Amaxa Nucleofector instrument under program V-015, followed by adding medium to the cuvette and allowing the cells to remain in the cuvette in the incubator for at least 30 minutes before transferring them to culture tubes.
[0125] B cells are transfected with nucleases and guide RNA as DNA, mRNA, and / or protein, i.e., ribonucleoproteins. Preferably, B cells are transfected with Cas9-gRNA ribonucleoprotein.
[0126] Surprisingly and unexpectedly, gene editing (insertion or deletion) using ribonucleoproteins was found to be the most efficient method.
[0127] The viability and transfection efficiency of B cells are increased by culturing B cells in a medium containing an apoptosis inhibitor.
[0128] Surprisingly and unexpectedly, it was discovered that gene editing (insertion or deletion) was more efficient when apoptosis inhibitors were added to the culture medium during and / or after transfection. The apoptosis inhibitors increased the efficiency of homologous recombination (i.e., when genes were inserted) in primary human B cells. Furthermore, the apoptosis inhibitors also increased the viability of transfected primary B cells. In some embodiments, B cell viability was significantly increased and apoptosis was reduced.
[0129] Inhibitors of apoptosis include caspase inhibitors. Other inhibitors of apoptosis include, for example, apoptosis protein inhibitors (IAPs), cellular inhibitor of apoptosis protein-1 (cIAP), protein 3 containing a repeat structure of baculovirus IAP (cIAP2), protein 6 containing a repeat structure of baculovirus IAP, and protein 1 containing a repeat structure of baculovirus IAP (NAIP).
[0130] In some embodiments, the caspase inhibitor inhibits both the inducible and / or effective forms of caspases. In some embodiments, the caspase inhibitor inhibits caspase 2, caspase 8 and caspase 9, caspase 3, caspase 6 and caspase 7. In some embodiments, the caspase inhibitor includes the pancaspase inhibitor Z-VD-OPH. In some embodiments, the reduction of apoptosis increases the viability of B cells.
[0131] Apoptosis inhibitors are present at concentrations of approximately 1 μM and 50 μM, or concentrations in between. The concentrations of apoptosis inhibitors are approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μM.
[0132] In some embodiments, reduction of apoptosis by an apoptosis inhibitor increases B cell viability by at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, and 95% or more, including all endpoints. In some embodiments, caspase inhibitors, including the pancaspase inhibitor Z-VD-OPH, increase B cell viability by at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, and 95% or more, including all endpoints. The increase in viability is determined by comparing it to the viability of B cells cultured in the absence of the apoptosis inhibitor.
[0133] Optionally, the DNA plasmid may have a promoter. Exemplary promoters include the EF-1a (EFS) promoter or the Cbh promoter. Preferably, the promoter is the EF-1a promoter.
[0134] Optionally, a plasmid may contain one or more different regulatory sequences. These regulatory sequences may include, for example, initiators, promoter factors, signal peptides, and polyadenylation signals.
[0135] DNA is prepared and isolated by any method known in the art. For example, DNA is prepared using Maxiprep, Midiprep, or Miniprep. Preferably, the DNA construct is isolated using Maxiprep, such as non-endofree Maxiprep.
[0136] The DNA is transfected at concentrations of approximately 1 μg and 10 μg, or concentrations in between. The DNA concentrations are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μg. Preferably, the DNA concentration is 5 μg.
[0137] More preferably, B cells are transfected with ribonucleoprotein (RNP), which is a complex of a nuclease protein and a guide RNA, such as a single guide RNA (sgRNA). Most preferably, B cells are transfected with Cas9 RNP. The sgRNA can be engineered to target any gene locus. In another embodiment, the sgRNA targets any immunoglobulin gene locus.
[0138] For example, sgRNA may include gRNA from IGHV3-23 (immediately upstream): GAAAACACCTGAAAATCCCA (SEQ ID NO: 7), gRNA from IGHJ6 (immediately downstream): GTCCTCGGGGCATGTTCCGA (SEQ ID NO: 8), gRNA from IGKV3-20 (immediately upstream): TTAGGACCCAGAGGGAACCA (SEQ ID NO: 9), or gRNA from IGKJ4 (within): CTGTGGCTCACTTTCGGCGG (SEQ ID NO: 10), or any combination thereof.
[0139] Other exemplary sgRNA sequences include the following:
[0140] gIGHV:(IGHV3-23)TGAACAGAGAGAACTCACCA(Sequence ID 11)
[0141] gIGHJ:(IGHJ6)GGTCCTCGGGGCATGTTCCG(Sequence ID 12)
[0142] gIGKV:(IGKV3-20)GCTGCTCAGTTAGGACCCAG(Sequence ID 13)
[0143] gIGKJ:(IGKJ5)GGGCATTTAAGATTTGCCAT(Sequence ID 14)
[0144] In some embodiments, B cells are transfected with a homologous recombination repair (HDR) template in addition to Cas9 and sgRNA. An exemplary HDR template is shown, for example, in Figure 23.
[0145] Optionally, before administration to the subject, the genome-edited B cell population is free from components used during production, such as cell culture components, DNA, RNA, and ribonucleoproteins, and is substantially free from mycoplasma, endotoxins, and microbial contamination. Preferably, the genome-edited B cell population has less than 10, 5, 3, 2, or 1 CFU / swab. Most preferably, the genome-edited B cell population has 0 CFU / swab. The endotoxin level of the genome-edited B cell population is less than 20 EU / mL, less than 10 EU / mL, or less than 5 EU / mL. The viability of the genome-edited B cell population is at least 70%, at least 75%, or at least 80%.
[0146] Genome-edited B cells are used immediately after the genome editing process (for example, in antigen detection screening or therapeutic methods) or after a short culture period.
[0147] Genome-edited B cells can be irradiated before clinical use. Irradiation induces the expression of cytokines that promote the activity of immune effector cells.
[0148] Applicable The disclosed compositions and methods can be used in any application where modulation of B cell receptor expression, specificity, and / or functionality is desired. Preferably, the compositions and methods of the present invention are used in immunotherapy.
[0149] B cells can be autologous or allogeneic.
[0150] Specifically, monoclonal antibody therapy is used to treat conditions such as cancer, autoimmune diseases, transplant rejection, osteoporosis, macular degeneration, multiple sclerosis, pathogens, or cardiovascular diseases.
[0151] In some embodiments, the present invention provides homologous recombination in primary human B cells. In some embodiments, homologous recombination in primary human B cells results in the insertion of a specific sequence at a defined genomic locus. In one embodiment, the sequence encodes a model epitope tag. In some embodiments, the model epitope tag may be inserted into and / or expressed from a model locus containing a CXC chemokine receptor type. In some embodiments, the CXC chemokine receptor type is selected from CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, and CXCR7. In some embodiments, the model epitope tag may be inserted into and / or expressed from a model locus containing a B cell receptor (BCR). In some embodiments, the sequence encoding an antibody is inserted into a genomic locus of the endogenous heavy chain and / or endogenous light chain. For example, IGHV, IGHD, IGHJ, IGHC, IGKV, IGKJ, IGKC, IGLV, IGLJ, IGLC, or any combination thereof. In some embodiments, the sequence encoding the antibody is the nanobody of the monoclonal antibody and / or the heavy and light chains of the monoclonal antibody.
[0152] definition It should also be understood that the terms used herein are intended to describe only specific embodiments and are not intended to limit them. When used herein and in the appended claims, the singular forms “a,” “an,” and “the” include multiple subjects unless the context clearly indicates otherwise. For example, a reference to “a cell” includes a combination of two or more cells or an entire cell culture, and a reference to “a polynucleotide” includes, in practice, numerous copies of that polynucleotide. Unless otherwise stated or made clear from the context, the term “or” should be understood to be compatible when used herein. Unless defined herein and in the remainder of this specification, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the invention pertains.
[0153] Unless otherwise stated or evident from the context, the term “about” as used herein should be understood to mean within the normal range of acceptance in the art, for example, within two standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise evident from the context, numerical values presented herein are modified by the term “about.”
[0154] As used herein, “DNA-binding protein moiety” is a segment or polypeptide of a DNA-binding protein that can specifically bind to a particular DNA sequence. The binding is specific to a particular DNA sequence site. A DNA-binding protein moiety may include a shortened segment or fragment of a DNA-binding protein.
[0155] As used herein, the terms “polynucleotide,” “nucleotide,” “oligonucleotide,” “oligomer,” “oligo,” or equivalent terms refer to molecules comprising a polymer sequence of nucleotide base monomers, where the monomer sequence defines a polynucleotide. Polynucleotides may include polymers of deoxyribonucleotides that make up deoxyribonucleic acid (DNA) and polymers of ribonucleotides that make up ribonucleic acid (RNA). Polynucleotides may be single-stranded or double-stranded. When single-stranded, a polynucleotide may correspond to the sense strand or antisense strand of a gene. A single-stranded polynucleotide can hybridize with a complementary portion of a target polynucleotide to form a double-stranded molecule that may be homo-double-stranded or hetero-double-stranded.
[0156] The length of a polynucleotide is not limited in any respect. Bonds between nucleotides can be internucleotide phosphodiester bonds or any other type of bond. Polynucleotides can be produced by biological means (e.g., enzymatically) either in vivo (intracellularly) or in vitro (in a cell-free system). Polynucleotides can be chemically synthesized using an enzyme-free system. Polynucleotides may or may not be enzymatically elongable.
[0157] Typically, nucleotide monomers incorporated into polymers are linked in a manner in which the 5' phosphate of the pentose ring of a single mononucleotide is unidirectionally linked to its neighboring 3' oxygen (hydroxyl) via a phosphodiester bond. Therefore, polynucleotides formed by 3'-5' phosphodiester bonds (including natural polynucleotides) are said to have a 5' end and a 3' end. Thus, the 5' end of a polynucleotide molecule generally has a free phosphate group at the 5' position of the nucleotide's pentose ring, while the 3' end of a polynucleotide molecule has a free hydroxyl group at the 3' position of the pentose ring. Within a polynucleotide molecule, the position located at 5' relative to other positions is said to be "upstream," and the position at 3' relative to other positions is said to be "downstream." This terminology reflects the fact that polymerase proceeds along the template chain in a 5'-to-3' manner, extending the polynucleotide chain. Unless otherwise indicated, whenever a polynucleotide sequence is represented, the nucleotides will be understood to be oriented from left to right, 5' to 3'.
[0158] As used herein, the term “polynucleotide” is not intended to be limited to natural polynucleotide structures, natural nucleotide sequences, natural skeletons, or natural nucleotide bonds. Those skilled in the art are familiar with a wide variety of polynucleotide analogs, non-natural nucleotides, non-natural phosphodiester bonds, and nucleotide analogs that may be used in the present invention.
[0159] As used herein, the terms “nucleotide sequence,” “polynucleotide sequence,” “nucleic acid sequence,” “polynucleotide sequence,” and equivalent or similar phrases refer to the order of nucleotide monomers in a nucleotide polymer. Typically, nucleotide sequences are written in the 5' or 3' direction. Unless otherwise indicated, the particular polynucleotide sequences of the present invention optionally include complementary sequences in addition to the explicitly indicated sequences.
[0160] As used herein, the term “gene” generally refers to a combination of polynucleotide elements that, when operably linked in a natural or recombinant manner, provide some product or function. The term “gene” should be interpreted broadly and may encompass the mRNA, cDNA, genomic DNA forms of genes. In some uses, the term “gene” encompasses the transcribed sequence, including the 5' and 3' untranslated regions (5'-UTR and 3'UTR), exons, and introns. In some genes, the transcribed region will include an “open reading frame” that codes for a polypeptide. In some uses of the term, “gene” includes only the coding sequence (e.g., “open reading frame” or “coding sequence”) necessary to code for a polypeptide. In some embodiments, a gene does not code for a polypeptide and is, for example, a ribosomal RNA gene (rRNA) and a transfer RNA (tRNA) gene. In some embodiments, the term “gene” further includes not only the transcribed sequence but also untranscribed regions, including upstream and downstream regulatory regions, enhancers, and promoters. The term "gene" encompasses the mRNA, cDNA, and genome morphology of a gene.
[0161] In some embodiments, the genomic morphology or genomic clone of a gene includes the sequence of transcribed mRNA and other non-transcribed sequences outside the transcript. Regulatory regions outside the mRNA transcription unit are called 5' or 3' flanking sequences. The functional genomic morphology of a gene typically includes regulatory factors that are necessary, and often sufficient, for the regulation of transcription. The term “promoter” is generally used to describe a DNA region that is typically 5'-side, but not exclusive, of the transcription start site, which is sufficient to bring about correct transcription initiation. In some embodiments, the “promoter” also includes other cis-acting regulatory factors that are necessary for or bring about inducible transcription at a strong or elevated level. In some embodiments, the promoter is constitutively active, and in alternative embodiments, the promoter is conditionally active (e.g., transcription is initiated only under specific physiological conditions).
[0162] Generally, the term “regulator” refers to any cis-acting genetic element that controls a particular aspect of nucleic acid sequence expression. In some usage, the term “promoter” essentially includes the minimum sequence required to initiate transcription. In some usage, the term “promoter” includes the transcription-initiating sequence and also includes sequences that can upregulate or downregulate transcription, commonly referred to as “enhancers” and “repressors,” respectively.
[0163] Certain DNA regulatory factors, including promoters and enhancers, generally function only within a specific class of organisms. For example, regulatory factors derived from bacterial genomes generally do not function in eukaryotes. However, regulatory factors from more closely related organisms often exhibit cross-functionality. For instance, DNA regulatory factors derived from certain mammalian organisms, such as humans, will often function in other mammalian species, such as mice. Furthermore, in the design of recombinant genes intended to function across many species, there are consensus sequences for many types of regulatory factors known to function across species, such as in all mammalian cells, including mouse and human host cells.
[0164] As used herein, the expressions “operable combination,” “operable sequence,” “operable link,” “operable binding,” and similar phrases, when used in relation to nucleic acids, refer to the operable linking of nucleic acid sequences arranged in a functional relationship with one another. For example, operable linking of promoters, enhancer factors, open reading frames, 5' and 3' UTRs, and stop sequences results in the precise production of an RNA molecule. In some embodiments, operable linking of nucleic acid factors results in the transcription of an open reading frame and ultimately the production of a polypeptide (i.e., expression of the open reading frame).
[0165] As used herein, the term “genome” refers to the entire genetic information or genetic material possessed by an organism (including viruses), i.e., the entire genetic component of an organism or virus. Generally, the genome refers to all the genetic material within an organism’s chromosomes, and also to extrachromosomal genetic information that is stably transmitted to daughter cells (e.g., the mitochondrial genome). The genome may contain RNA or DNA. The genome may be linear (mammalian) or circular (bacterial). Genomic material typically exists in separate units, such as chromosomes.
[0166] As used herein, “polypeptide” is any polymer of amino acids (natural, non-natural, or combinations thereof) of any length, typically linked by covalent peptide bonds, but not exclusively. Polypeptides may originate from any source, such as natural polypeptides, polypeptides produced by recombinant molecular genetics techniques, cell-derived polypeptides, or polypeptides enzymatically produced in cell-free systems. Polypeptides can also be produced using chemical (non-enzymatic) synthesis methods. Polypeptides are characterized by the amino acid sequence in the polymer. As used herein, the term “protein” is synonymous with polypeptide. The term “peptide” typically refers to a small polypeptide, which is typically smaller than a protein. Unless otherwise stated, polypeptides are not limited to those having or not having any particular biological activity.
[0167] As used herein, the expressions “codon use,” “codon bias,” “preferred codon use,” or similar terms refer, in one aspect, to differences in the frequency of occurrence of any one codon among synonymous codons that code for a single amino acid in protein-coding DNA or RNA (where many amino acids have the ability to be coded by one or more codons). In another aspect, “codon use bias” may also refer to differences in codon bias between two species, each exhibiting a different codon bias. Different organisms often exhibit different codon biases, which are preferences for preferred codons among synonymous codons in their coding sequences.
[0168] As used herein, the terms “vector,” “vehicle,” “construct,” “template,” and “plasmid” are used in relation to any recombinant polynucleotide molecule that can be amplified and used to transfer a nucleic acid segment from one organism to another. A vector generally contains a portion that mediates vector amplification and manipulation (e.g., one or more origins of replication, genes conferring drug or antibiotic resistance, multiple cloning sites, activatably linked promoter / enhancer factors enabling the expression of the cloned gene, etc.). A vector is generally, often, a recombinant nucleic acid molecule derived from a bacteriophage or a plant or animal virus. Plasmid and cosmid refer to two such recombinant vectors. A “cloning vector,” “shuttle vector,” or “subcloning vector” contains an activatably linked portion that facilitates the subcloning process (e.g., multiple cloning sites containing multiple restriction endonuclease target sequences). Nucleic acid vectors may be linear or cyclic in form, depending on the type of vector or the type of application. Some cyclic nucleic acid vectors may be intentionally linearized before delivery to cells. The vector can also serve as a polymerase chain reaction (PCR) template for generating a linear construct that may contain additional sequences encoded by the primers used at its ends. Such a construct can also be delivered to cells.
[0169] As used herein, the term “expression vector” refers to a recombinant vector containing operablely linked polynucleotide factors that promote and optimize the expression of a desired gene (e.g., a protein-coding gene) in a particular host organism (e.g., a bacterial expression vector or a mammalian expression vector). The polynucleotide sequence that promotes gene expression may include, for example, a promoter, an enhancer, a transcription termination sequence, and a ribosome-binding site.
[0170] As used herein, the term “host cell” refers to any cell containing heterologous nucleic acids. Heterologous nucleic acids may be vectors such as shuttle vectors or expression vectors, or linear DNA templates, or in vitro transcribed RNA. In some embodiments, the host cell can drive the expression of genes encoded on the vector. In some embodiments, the host cell assists in the replication and proliferation of the vector. The host cell may be a bacterial cell such as E. coli, or a mammalian cell (e.g., a human cell or a mouse cell). A suitable host cell (such as a suitable mouse cell) can be used to create a stably incorporated cell line, which can then be used to create a complete transgenic organism.
[0171] Methods (i.e., means) for delivering vectors / constructs or other nucleic acids (such as in vitro transcribed RNA) to host cells such as bacterial and mammalian cells are well known to those skilled in the art and are not provided in detail herein. Any method of nucleic acid delivery to host cells may find use with the present invention.
[0172] For example, methods for delivering vectors or other nucleic acid molecules to bacterial cells such as Escherichia coli (called transformation) are commonplace and include electroporation and transformation of E. coli cells that have been made competent by pretreatment with divalent cations such as CaCl2.
[0173] The delivery of vectors or other nucleic acids (such as RNA) to cultured mammalian cells (known as transfection) is a routine practice, and many transfection methods find use with the present invention. These include, but are not limited to, calcium phosphate precipitation, electroporation, lipid-based methods such as Transfectamine® (Life Technologies®) and TransFectin® (Bio-Rad Laboratories) (liposomes or lipoplexes), cationic polymer transfection using DEAE-dextran, direct nucleic acid injection, gene gun particle injection, viral transduction using engineered viral carriers (known as transduction, using engineered herpes simplex virus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, Sindbisvirus, etc.), and sonoporation. Any of these methods find use with the present invention. The terms transfection and nucleofection are used interchangeably herein.
[0174] As used herein, the term “recombinant” in relation to nucleic acids or polynucleotides indicates that a substance (e.g., recombinant nucleic acid, gene, polynucleotide, polypeptide, etc.) has been modified by human intervention. Generally, some components of a recombinant molecule are not naturally occurring, or the primary sequence of a recombinant polynucleotide or polypeptide has been manipulated in some way. Natural nucleotide sequences become recombinant polynucleotides when they are taken from their natural location of origin (e.g., chromosomes) or when they are transcribed from a recombinant DNA construct. An open reading frame of a gene is a recombinant molecule if its nucleotide sequence is taken from its natural environment and cloned into any type of nucleic acid vector (even if the ORF has the same nucleotide sequence as the natural gene) or becomes a PCR template. Protocols and reagents for producing recombinant molecules, and especially recombinant nucleic acids, are well known to those skilled in the art. In some embodiments, the term “recombinant cell line” refers to any cell line containing recombinant nucleic acid, i.e., nucleic acid that is not natural to the host cell.
[0175] As used herein, the terms “exotic” or “non-natural,” as applied to polynucleotides or polypeptides, refer to molecules that are reconstituted or artificially supplied to a biological system and that cannot be found in the natural composition (e.g., in relation to sequence, genomic location, or arrangement of any part) or are not natural to a particular biological system. These terms refer to related substances originating from sources other than natural sources, or molecules having a non-natural or non-native composition, genetic location, or arrangement of any part. The terms “exotic” and “non-natural” are often used interchangeably with “recombinant.”
[0176] As used herein, the terms “natural” or “endogenous” refer to molecules found in natural biological systems, cells, tissues, species, or chromosomes during investigation, and to sequences found in specific biological systems, cells, tissues, species, or chromosomes being manipulated. A “natural” or “endogenous” gene is generally a gene that does not contain any nucleotide sequences other than those normally associated in nature (e.g., nuclear chromosomes, mitochondrial chromosomes, or chloroplast chromosomes). Endogenous genes, transcripts, or polypeptides are encoded by their natural loci and are not artificially supplied to cells.
[0177] As used herein, the term “marker” most commonly refers to a biological characteristic or trait that, when present in a cell (e.g., when expressed), results in a characteristic or phenotype that makes the cell visible or identifiable as containing that marker. Various types of markers are commonly used and may include, for example, visible markers such as chromogenic phenomena like lacZ supplementation (β-galactosidase) or fluorescence such as the expression of green fluorescent protein (GFP) or GFP fusion protein, RFP, BFP; selectable markers; phenotypic markers (proliferation efficiency, cell morphology, colony color or colony morphology, temperature sensitivity); molecular markers such as biomolecules distinguishable by antibiotic sensitivity and resistance, antigen sensitivity (e.g., blood group antigens and tissue suitability markers); cell surface markers (e.g., H2KK); enzyme markers; and nucleic acid markers such as restriction fragment length polymorphisms (RFLPs), single nucleotide polymorphisms (SNPs), and other amplified genetic polymorphisms.
[0178] As used herein, the terms “selectable marker,” “screening marker,” or “positive selection marker” refer to a marker that, when present in cells, gives rise to a trait or phenotype that enables the selection or isolation of those cells from other cells that do not express the selectable marker trait. A variety of genes can be used as selectable markers; for example, genes encoding drug resistance or nutritional requirements are widely known. For example, kanamycin (neomycin) resistance can be used as a trait to select bacteria that have taken up a plasmid carrying a gene encoding bacterial kanamycin resistance (e.g., the enzyme neomycin phosphotransferase II). Untransfected cells will eventually die when the culture is treated with neomycin or a similar antibiotic.
[0179] A similar mechanism can be used to sort transfected mammalian cells containing a vector carrying a gene encoding neomycin resistance (one of two aminoglycoside phosphotransferase genes, which are neo-sortable markers). The sorting process can be used to establish stably transfected mammalian cell lines. Genethecin (G418) is commonly used to sort mammalian cells containing stably incorporated copies of transfected genetic material.
[0180] As used herein, the terms “negative screening” or “negative screening marker” refer to a marker that, when present (e.g., expressed, activated, or otherwise), enables the identification of cells that do not possess the characteristic or trait being screened (e.g., compared to cells possessing the characteristic or trait).
[0181] A wide variety of positive and negative selectable markers are known for use in prokaryotes and eukaryotes, and selectable marker tools for plasmid selection in bacterial and mammalian cells are widely available. Bacterial selection systems include, but are not limited to, ampicillin resistance (β-lactamase), chloramphenicol resistance, kanamycin resistance (aminoglycoside phosphotransferase), and tetracycline resistance. Mammalian selection marker systems include, but are not limited to, neomycin / G418 (neomycin phosphotransferase II), methotrexate resistance (dihydrofolate reductase, DHFR), hygromycin-B resistance (hygromycin-B phosphotransferase), and blastocydin resistance (blastocydin S deaminase).
[0182] As used herein, the term “reporter” generally refers to a portion, compound, or other component that can be used to visualize, quantify, or identify a desired component of a system under consideration. A reporter is generally, but non-exclusively, a gene that codes for a reporter protein. For example, a “reporter gene” is a gene that, when expressed in a cell, enables the visualization or identification of a cell or enables the quantification of recombinant gene expression. For example, a reporter gene may code for an enzyme whose activity can be quantified, such as a protein like chloramphenicol acetyltransferase (CAT) or firefly luciferase protein. Reporters also include fluorescent proteins such as green fluorescent protein (GFP), or any recombinant variant of GFP, including enhanced GFP (EGFP), blue fluorescent protein (BFP and derivatives), cyan fluorescent protein (CFP and other derivatives), yellow fluorescent protein (YFP and other derivatives), and red fluorescent protein (RFP and other derivatives).
[0183] As used herein, the term “tag,” when used as a protein tag, generally refers to a peptide sequence that is genetically fused to the open reading frame of another protein, thereby creating a recombinant fusion protein. Ideally, the fused tag does not interfere with the innate bioactivity or function of the larger protein to which it is fused. Protein tags are used for a variety of purposes, including, but not limited to, tags for facilitating the purification, detection, or visualization of fusion proteins. Some peptide tags can be removed by chemical or enzymatic means, such as by target-specific proteolysis (e.g., by TEV).
[0184] Depending on their usage, the terms “marker,” “reporter,” and “tag” may overlap in their definitions, and the same protein or polypeptide may be used as a marker, reporter, or tag in different applications. In some scenarios, polypeptides can function simultaneously as both reporter and / or tag and / or marker within the same recombinant gene or protein.
[0185] As used herein, the term “prokaryotes” refers to organisms belonging to the kingdom Monera (also called prokaryotes), which can generally be distinguished from eukaryotes by their single-celled tissue, asexual reproduction by budding or fission, absence of membrane-bound nuclei or other membrane-bound organelles, ring chromosomes, presence of operons, introns, message capping, and absence of poly(A) mRNA, characteristic ribosome structure, and other biochemical features. Prokaryotes include the subkingdoms of bacteria ("fungi") and archaea (often called "archaea").
[0186] As used herein, the terms “bacteria” or “bacterial” refer to prokaryotes, which are distinguishable from archaea based on many well-defined morphological and biochemical criteria.
[0187] As used herein, the term “eukaryote” refers to organisms belonging to the kingdom Eukaryotes (typically multicellular tissues) that can generally be distinguished from prokaryotes by the presence of a membrane-bound nucleus and other membrane-bound organelles, linear genetic material (i.e., linear chromosomes), absence of operons, introns, message capping, and the presence of poly(A) mRNA, characteristic ribosome structure, and other biochemical features.
[0188] As used herein, the term “mammal” or “mammalian” refers to the group of eukaryotic organisms that are endothermic amniotes, distinguishable from reptiles and birds by the possession of hair, three middle ear bones, mammary glands in females, a neocortex in the brain, and many giving birth to living young individuals. The largest group of mammals, placental mammals (Eutheria), have a placenta that feeds offspring during pregnancy. Placental mammals include rodents (including mice and rats) and primates (including humans).
[0189] In the context of this invention, “subject” is preferably a mammal. Mammals may be, but are not limited to, humans, non-human primates, mice, rats, dogs, cats, horses, or cattle.
[0190] As used herein, the term “encode” broadly refers to any process in which information within a polymer macromolecule is used to direct the production of a second molecule distinct from a first molecule. The second molecule may have a chemical structure different from the chemical properties of the first molecule.
[0191] For example, in some embodiments, the term “coding” describes a semi-conservative DNA replication process in which one strand of a double-stranded DNA molecule is used as a template to encode a complementary sister strand newly synthesized by DNA-dependent DNA polymerase. In other embodiments, a DNA molecule can encode an RNA molecule (e.g., by a transcription process using the DNA-dependent RNA polymerase enzyme). Similarly, an RNA molecule can encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term “coding” also extends to triplet codons encoding amino acids. In other embodiments, an RNA molecule can encode a DNA molecule, for example, by a reverse transcription process incorporating the RNA-dependent DNA polymerase enzyme. In yet another embodiment, a DNA molecule can encode a polypeptide, and when used in that case, “coding” is understood to encompass both transcription and translation processes.
[0192] As used herein, the term “derived from” refers to a first component (e.g., a first molecule), or a process used to isolate, induce, or produce a different second component (e.g., a second molecule different from the first molecule). For example, the mammalian codon-optimized Cas9 polynucleotides of the present invention are derived from the amino acid sequence of the wild-type Cas9 protein. Similarly, the mammalian codon-optimized Cas9 polynucleotides of the present invention, including single-mutant nickase and double-mutant null-nuclease, are derived from the polynucleotide encoding the wild-type mammalian codon-optimized Cas9 protein.
[0193] As used herein, the expression “variant” refers to a first composition (e.g., the first molecule) in relation to a second composition (e.g., the second molecule, also called the “parent” molecule). A variant molecule may be derived from, isolated from, based on, or homologous to the parent molecule. For example, variant forms of mammalian codon-optimized Cas9 (hspCas9), including single-mutant nickase and double-mutant null-nuclease of Cas9, are variants of mammalian codon-optimized wild-type Cas9 (hspCas9). The term “variant” may be used to describe either a polynucleotide or a polypeptide.
[0194] When applied to polynucleotides, the variant molecule may have complete nucleotide sequence identity with the original parent molecule, or alternatively, less than 100% nucleotide sequence identity with the parent molecule. For example, a variant of a gene nucleotide sequence may be a second nucleotide sequence that is identical to the original nucleotide sequence by at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% or more in terms of nucleotide sequence. A polynucleotide variant also includes a polynucleotide containing the entire parent polynucleotide, and further includes additional fusion nucleotide sequences. A polynucleotide variant also includes a polynucleotide that is a portion or subsequence of the parent polynucleotide, and for example, unique subsequences of polynucleotides disclosed herein (determined, for example, by standard sequence comparison and alignment techniques) are also encompassed by the present invention.
[0195] In another embodiment, a polynucleotide variant includes a nucleotide sequence that involves minor, trivial, or insignificant changes to the parent nucleotide sequence. For example, minor, trivial, or insignificant changes include changes to the nucleotide sequence that (i) do not alter the amino acid sequence of the corresponding polypeptide, (ii) occur outside the open reading frame of the polynucleotide that codes for the protein, (iii) result in a deletion or insertion that may affect the corresponding amino acid sequence but only slightly or not at all affects the biological activity of the polypeptide, and / or (iv) result in an amino acid substitution with a chemically similar amino acid. When the polynucleotide does not code for a protein (e.g., tRNA, or crRNA, or tracrRNA, or sgRNA), a variant of that polynucleotide may include nucleotide changes that do not result in a loss of function of the polynucleotide. In another embodiment, conserved variants of the disclosed nucleotide sequence that result in a functionally identical nucleotide sequence are included in the present invention. Those skilled in the art will understand that many variants of the disclosed nucleotide sequence are included in the present invention.
[0196] Variant polypeptides are also disclosed. When applied to a protein, a variant polypeptide may have complete amino acid sequence identity with the original parent polypeptide, or alternatively, may have less than 100% amino acid sequence identity with the parent protein. For example, an amino acid sequence variant may be a second amino acid sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical in amino acid sequence to the original amino acid sequence.
[0197] A polypeptide variant includes a polypeptide comprising the entire parent polypeptide and further comprising an additional fusion amino acid sequence. A polypeptide variant also includes a polypeptide that is a portion or subsequence of the parent polypeptide, and for example, a unique subsequence of the polypeptide disclosed herein (determined, for example, by standard sequence comparison and alignment techniques) is also encompassed by the present invention.
[0198] In another embodiment, polypeptide variants include polypeptides that have minor, trivial, or insignificant changes to the amino acid sequence of the parent. For example, minor, trivial, or insignificant changes include amino acid changes (including substitutions, deletions, and insertions) that have little to no effect on the biological activity of the polypeptide and result in a functionally identical polypeptide, including the addition of non-functional peptide sequences. In yet another embodiment, variant polypeptides of the present invention alter the biological activity of the parent molecule; for example, mutant variants of the Cas9 polypeptide have altered nuclease activity or lose nuclease activity. Those skilled in the art will understand that many variants of the disclosed polypeptides are encompassed within the present invention.
[0199] In some embodiments, variants of the polynucleotide or polypeptide of the present invention may include variant molecules that modify, add, or delete a small percentage of nucleotide or amino acid positions, for example, typically less than about 10%, less than 5%, less than 4%, less than 2%, or less than 1%.
[0200] As used herein, the term “conservative substitution” in nucleotide or amino acid sequences refers to a change in a nucleotide sequence that either (i) results in no corresponding change to the amino acid sequence due to the redundancy of the triplet codon code, or (ii) results in a substitution by an amino acid having a chemically similar structure to the original parent amino acid. Tables of conservative substitutions presenting functionally similar amino acids are well known in the art, where one amino acid residue is substituted by another amino acid residue having similar chemical properties (e.g., aromatic side chain or positively charged side chain) and thus does not substantially alter the functional properties of the resulting polypeptide molecule.
[0201] The following is a classification of natural amino acids containing similar chemical properties, where substitutions within a group are "conservative" amino acid substitutions. This classification is not strict, as these natural amino acids may be placed in different classifications when different functional properties are considered. Amino acids with nonpolar and / or aliphatic side chains include glycine, alanine, valine, leucine, isoleucine, and proline. Amino acids with polar uncharged side chains include serine, threonine, cysteine, methionine, asparagine, and glutamine. Amino acids with aromatic side chains include phenylalanine, tyrosine, and tryptophan. Amino acids with positively charged side chains include lysine, arginine, and histidine. Amino acids with negatively charged side chains include aspartic acid and glutamic acid.
[0202] As used herein, the terms “identical” or “% identical” in the context of two or more nucleic acids or polypeptides mean two or more sequences or subsequences that are the same ("identical") or have a specific percentage ("% identical") of amino acid residues or nucleotides that are identical when compared and aligned for the greatest match with a second molecule, when measured by a sequence comparison algorithm (e.g., BLAST alignment, or any other algorithm known to those skilled in the art), or alternatively by visual inspection.
[0203] In the context of two nucleic acids or polypeptides, the phrase “substantially identical” refers to two or more sequences or subsequences that, when compared and aligned for maximum match using a sequence comparison algorithm or visual inspection, have at least about 60%, about 70%, about 80%, about 90%, about 90-95%, about 95%, about 98%, or about 99% or more nucleotide or amino acid residue identity. Such “substantially identical” sequences are typically considered “homologous” without reference to actual ancestry. Preferably, “substantially identical” between nucleotides exists over a region of polynucleotides of at least about 50 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, or at least about 500 nucleotides, and most preferably over the full length of the polynucleotide. Preferably, “substantially identical” between polypeptides exists over a region of at least about 50 amino acid residues, more preferably over a region of at least about 100 amino acid residues, and most preferably the sequences are identical over their full length.
[0204] In the context of two polypeptides, the term "sequence similarity" refers to the degree of relationship between two or more sequences or subsequences. Such sequences typically exhibit some degree of amino acid sequence identity, as well as amino acid non-identity, meaning there are some percentage substitutions within a group of functionally related amino acids. For example, a serine substitution (misalignment) by threonine in a polypeptide is sequence similarity (but not identity).
[0205] As used herein, the term “homologous” refers to two or more amino acid sequences that originate naturally or artificially from a common ancestral protein or amino acid sequence. Similarly, nucleotide sequences are homologous when they originate naturally or artificially from a common ancestral nucleic acid. Homologousity in proteins is generally inferred from the amino acid sequence identity and sequence similarity between two or more proteins. The exact percentage of sequence identity and / or similarity useful for establishing homology varies depending on the nucleic acid and protein in question, but as low as 25% sequence similarity is routinely used to establish homology. For example, higher levels of sequence similarity, such as 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or higher, can also be used to establish homology. Methods for determining the percentage of sequence similarity (e.g., BLASTP and BLASTN, which utilize default parameters) are generally available.
[0206] As used herein, the terms “part,” “subsequence,” “segment,” or “fragment,” or similar terms, refer to any portion of a larger sequence (e.g., a nucleotide subsequence or an amino acid subsequence) smaller than the complete sequence from which it is derived. The minimum length of a subsequence is not limited, except that the minimum length may be useful in terms of its intended function. A subsequence may originate from any portion of the parent molecule. In some embodiments, a part or subsequence may retain an important feature or biological activity of the larger molecule, or correspond to a specific functional domain of the parent molecule, such as a DNA-binding domain or a transcriptional activity domain. A polynucleotide part may be of any length, for example, at least 5, 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, 200, 300, or 500 or more nucleotides.
[0207] As used herein, the term “kit” is used to refer to a combination of articles that facilitate a process, method, assay, analysis, or handling of a sample. A kit may include a written instruction manual describing how to use the kit (for example, an instruction manual describing the method of the present invention), chemical reagents or enzymes, primers and probes required for the method, and any other components.
[0208] The “isolated” cell population is “substantially free” of cells and substances that are naturally occurring and / or related during production. “Substantially free” or “substantially pure” means that at least 50%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90% of the population are of the desired cell type. [Examples]
[0209] (Example 1) Experimental approach Cas9 is listed for illustrative purposes, but the same objective can be achieved using other CRISPR systems (e.g., Cpf1 or Cas9 of Staphylococcus aureus). Such systems may have different substrate specificities, and therefore, while the approach remains the same, the gRNA sequence and genomic target site may differ.
[0210] 1) Isolation of human B cells (e.g., Miltenyi, B Cell Isolation Kit II, 130-091-151)
[0211] 2) Nucleofection procedure (Lonza, Human B Cell Nucleofector Kit), a. Optimize hAAVS1 or CXCR4 cleavage by varying the cell number and mRNA / plasmid / sgRNA concentration. i. Cas9-2A-GFP or Cas9+GFP modified mRNA and effective hAAVS1-targeted gRNA → GFP-positive cells can be sorted by FACS and enriched with nucleofected cells. ii. Analyze DNA (MiSeq or Surveyor / T7E1 assay) iii. Examination of surface CXCR4 loss by flow cytometry b. Screen sgRNAs to identify sgRNAs that cleave target loci in the heavy and light chains: Test expected sequences using publicly available software. i. Each nucleofection experiment (e.g., 2 × 10⁻⁶) 6 In individual B cells, one predicted sgRNA is transfected to each of the four target sites (upstream and downstream of the heavy and light chains = 4). PCR amplification of each locus is followed by T7E1 and / or MiSeq to verify the optimal cleavage factor among the predicted sgRNAs for each site. c. Optimize homologous recombination (HR) donor template insertion. i. Vary the amounts of Cas9 mRNA / plasmid / protein, sgRNA, and donor template (encoding an epitope tag adjacent to the homologous arm or recombinant heavy and light chains of a known therapeutic monoclonal antibody). 1. Donor templates should prevent template cleavage by replacing NGG in PAM with NNG or NGN (synonymous substitutions are most desirable). 2. The insert should encode a stop codon that prevents the expression of any downstream sequence spliced into a novel mRNA, following a defined immunoglobulin constant region. ii. Modified mRNA of Cas9-2A-GFP or Cas9+GFP, or recombinant Cas9(+GFP) protein or recombinant Cas9 / GFP fusion protein, and homologous recombination (HR) donor templates (which may be linear or may contain both heavy and light chains and their homologous arms in a single template, which can be ligated into a circular pseudovector by including a common restriction site at the template ends to generate overhanging ends that fit the template ends), or conventional donor vectors (e.g., CFP+both HR templates) 1. If B cells can survive without persistent signaling from the B cell receptor (BCR), optimization of functional HR can be achieved by inserting two fluorescent reporters (e.g., EGFP, mCherry) or epitope tags into the heavy and light chain loci. 2. Following Lonza (the manufacturer of Nucleofector), all four sgRNAs should be introduced into each cell (a Gibson assembly on a common vector may also be performed to ensure cotransfection), and delivery of a cocktail of RNPs containing the four relevant sgRNAs should similarly allow targeting to the four loci in most cells. iii. Nucleofect human B cells with Cas9 / GFP, four sgRNAs, and two HR inserts (heavy and light chains, each flanked by homologous arms exceeding 500 bp at both ends). → Sort GFP-positive cells, isolate genomic DNA, and perform MiSeq.
[0212] 3) Confirm the presence of a specific insertion by performing HR PCR across the boundary of the insertion site (genomic DNA from the B cell population before nucleofection will likely be used as a negative control). a. Cloning cells and performing Sanger sequencing across the junction. b. RFLP can also be performed on isolated and cloned B cells (due to the heterogeneity repertoire, RFLP will likely not work with negative controls).
[0213] 4) Confirm functional replacement of monoclonal antibodies: Perform flow cytometry using fluorescently labeled or biotinylated recombinant target proteins (or cells expressing the target antigen). a. Nucleofect human B cells with an RNP cocktail (four sgRNAs) and two HR inserts (heavy and light chains, each flanked by homologous arms exceeding 500 bp at both ends). b. CD19-positive B cells that bind to a fluorescently labeled bait are isolated by FACS (binding to the bait is limited to B cells having the desired genomic modification, i.e., an inserted BCR with defined specificity to the bait). i. Perform deep sequencing on several clones to identify cells with undesirable off-target genomic modifications that would likely be excluded from consideration. ii. Desired B cell clones can be nucleofected with mRNA encoding XBP-1, which promotes differentiation into long-lived plasma cells and stimulates the secretion of high levels of immunoglobulin. iii. (For allogeneic applications, genome editing is performed to mutate or remove the relevant HLA locus. Since this is necessary to antagonistize possible NK cell-mediated cytotoxicity, the DNA encoding CD48 can be inserted into a safe-harbor locus (e.g., Rosa26).)
[0214] (Example 2) Exemplary sgRNA IGHV3-23 (immediately upstream) gRNA: GAAAACACCTGAAAATCCCA (Sequence ID 7)
[0215] IGHJ6 (immediately downstream) gRNA: GTCCTCGGGGCATGTTCCGA (Sequence ID 8)
[0216] IGKV3-20 (immediately upstream) gRNA: TTAGGACCCAGAGGGAACCA (Sequence ID 9)
[0217] gRNA (within) IGKJ4: CTGTGGCTCACTTTCGGCGG (Sequence ID 10)
[0218] (Example 3) anti-TNFα insert sequence Adalimumab will be used as an example.
[0219] World Wide Web (www)_imgt.org / 3Dstructure-DB / cgi / details.cgi?pdbcode=7860
[0220] Heavy chain (VDJ-IGHG1) (SEQ ID NO: 15)
[0221] [ka]
[0222] [ka]
[0223] Light chain (VJ-IGKC) (Sequence ID 16)
[0224] [ka]
[0225] [ka]
[0226] Regulatory sequences such as initiators, promoter factors, signal peptides, and polyadenylation signals can be included in the insert as needed.
[0227] (Example 4) B cell editing at the CXCR4 locus The data presented in this embodiment demonstrate that CXCR4 can be a target for genetic modification in human B cells following delivery of Cas9-gRNA RNP (but not following delivery of Cas9-coding DNA or mRNA). For example, the CXCR4 locus was a target for genomic cleavage in three cell lines (Ramos, Raji, and U266) (Figures 21C and 21E) as well as in primary B cells (Figures 17, 18, and 20) (as demonstrated by the T7E1 cleavage assay).
[0228] The data demonstrate the efficiency of targeting the CXCR4 locus by significant protein reduction / loss following protein cleavage in primary B cells (Figure 20A).
[0229] Furthermore, genomic insertions were confirmed by HindIII restriction enzyme digestion assays. Samples that tested positive for HindIII digestion had HDR template insertions at the CXCR4 locus, while negative samples did not. This was demonstrated in three B cell lines: Ramos, Raji, and U266 (Figures 21D and 21E).
[0230] The gCXCR4 skeleton described by Schumann et al. ("Generation of knock-in primary human T cells using Cas9 ribonucleoproteins," Proc Natl Acad Sci US A. August 18, 2015, 112(33):10437-42) is used in a specific assay referred to as "gCXCR4 PNAS."
[0231] The assays used to determine CXCR4 targeting in isolated human B cells transfected with Cas9 RNP (often with donor HDR templates containing a HindIII restriction site) included flow cytometry, HindIII restriction digestion, TIDE analysis, and MiSEQ analysis of the CXCR4 protein. The workflows of these assays are schematically shown in Figure 19. Data from these assays show that CXCR4 expression on B cells is reduced by up to 70% after targeting with Cas9 RNP complexed with the gCXCR4 scaffold described by Schumann et al. (Figure 20A). It should be noted that gCXCR4-1 and gCXCR4-2 are different gCXCR4 preparations using different gCXCR4 scaffolds. The data further show that all three gCXCR4 constructs exhibit cleavage in the T7E1 assay, and that the gCXCR4 scaffold described by Schumann et al. is the most efficient (consistent with flow cytometry results) (Figure 20). It should be noted that the G / C control (PCR product with G7C SNP) is the positive control for the T7E1 assay. The asterisks in Figure 20B represent unspecified bands. The data from these targeting experiments show that: cleavage by Cas9 RNP at the CXCR4 locus is stably reproducible; a Cas9 / gCXCR4 ratio of 1:5 is most efficient; post-transfection medium change (MC) does not increase cleavage efficiency; different nucleofection (U-015) programs slightly decrease cleavage efficiency; and less Cas9 also works (with a slight decrease in efficiency) (Figure 20C).
[0232] Cleavage at the CXCR4 locus by Cas9 RNP is depicted on the gels shown in Figures 21A and 21B. Data from these assays indicate that gCXCR4 PNAS synthesized from another oligo (gCXCR4 PNAS2) also functions, but with slightly reduced cleavage efficiency; a 100 pmol HDR template yields the best cleavage efficiency; and Scr7 treatment appears to increase cleavage efficiency. It should be noted that the gel lacks the resolution to detect HDR-mediated HindIII restriction site introduction, as the insertion rate (determined by MiSeq, Figure 26B) is less than 1%, which is below the detection limit of this assay. It should be noted that homologous recombination (HR) in primary human B cells can increase by an order of magnitude (approximately 2%) for specific gRNAs at specific loci (e.g., the B cell receptor IGHV, Figure 27D).
[0233] The assays performed also revealed that cleavage efficiency in cell lines was significantly higher than in primary B cells (Figure 21C). Double-stranded HDR templates (HDR ds) + 1 μM Scr7 yielded better cleavage efficiency than single-stranded HDR templates (HDR ss) (Figure 21C). However, the data also showed that single-stranded HDR templates (HDR ss) + 1 μM Scr7 yielded better HR efficiency than double-stranded HDR templates (HDR ds) (Figure 21D). Higher HR efficiency was also observed in Ramos cell lines than in U266 cell lines (Figure 21D), due to the former having a higher proliferation rate. Interestingly, single-stranded HDR templates without Scr7 yielded the best HR efficiency for Raji cells (Figure 21E). Cells need to proliferate to achieve homologous recombination. Primary B cells did not proliferate robustly under conventional culture methods, which may explain the lack of observed homologous recombination.
[0234] After 48 hours, other assays were performed, including one to confirm activation by evaluating the expression of CD23, CD69, and Ki67 in particular (Figure 21F). Subsequent assays also included the use of a human B cell proliferation kit (CellXVivo®, R&D Systems). These data show that the B cell proliferation kit yielded the highest levels of CD23 and CD69 growth factors from each kit, and the highest proliferation rate, at 5 μL per mL of medium for 5 days (Figure 21G). The B cell proliferation kit was used for subsequent assays. CXCR4 HDR was evaluated in activated primary human B cells (Figures 21H-21K). For these assays, cells were activated and transfected with BX5 for 3 days and activated for a further 3 days (Figure 21I). HR was not detectable by HindIII digestion (HR was confirmed by MiSeq as described above). Prior to transfection, donor cell 1 was activated for 3 days and donor cell 2 for 2 days; both were further activated for 3 days after transfection (Figure 21J). HR could not be detected by HindIII digestion. Further experiments were conducted, including trying various activation conditions before and after transfection, in an attempt to increase HR efficiency. The conditions for these experiments were as follows:
[0235] 1) 5-day kit activation - transfection - 3-day kit activation
[0236] 2) 5-day kit activation - transfection - 3-day IL-4 (instead of the complete kit)
[0237] 3) 3-day kit activation - transfection - 5-day kit activation
[0238] 4) 3-day kit activation - transfection - 5-day IL-4 (instead of the complete kit)
[0239] 5) 3 days of IL-4 (instead of the complete kit) - transfection - 5 days of kit activation.
[0240] For this experiment using conditions 2 and 3 described above and the HDR template, two different donors were used, resulting in reduced cleavage efficiency for donor 1 (Figure 21K). HDR was not detected by HindIII digestion under any of these test conditions. The use of condition 4 described above and the HDR template resulted in reduced cleavage efficiency for donor 2 (Figure 21L). HDR was not detected by HindIII digestion under any of these test conditions. One explanation for this is that digestion does not have sufficient sensitivity to elucidate HindIII digestion of HDR. The MiSeq data presented below supports this conclusion.
[0241] A series of experiments using MiSeq were performed to confirm whether homologous recombination was achieved. All MiSeq analyses were performed according to the method described in Guell et al., "Genome Editing Assessment using CRISPR Genome Analyzer (CRISPR-GA)," Bioinformatics 30(20):2968-2970, which is incorporated herein by reference. The MiSeq data demonstrate that the Raji and Ramos cell lines were successfully processed to achieve homologous recombination (HR) at both heavy and light chain loci, even when multiple loci were targeted simultaneously, as evidenced by the insertion of sequences and encoding peptides [R10, R14] recognized by restriction enzymes (Res) [R4, R5, R13] [R5, R15, R18, B5] [R5, R15, R18, B5] [R10, R14] [R5, R15, R18, B5] [R5, R15, R18, B5] [R5, R15, R18, B5] [R10, R14] [R5, R15, R18, B5] [R15, R18, B5] [R15, R18, R18] [R19 (Figures 27A-27D) Genomic insertion into the CXCR4 locus was determined using MiSeq assays in three cell lines, Ramos, Raji, and U266, as well as in isolated primary B cells. (Figures 26A and 26B) Data from assays using these B cell lines (Figure 26A) indicate that cell activation is not necessary in spontaneously growing cell lines. For assays using primary human B cells (Figure 26B), B cells were activated for 5 days before transfection and 5 days after transfection. In one embodiment, primary B cells needed to be activated before transfection (appearing to require a minimum of 3 days). Activation for 5 days before transfection, followed by an additional 3 days of activation after transfection, appears to work best (0.33% mean between two donors, which was considerably higher than the 0.01% background in three untransfected controls). These data further suggest that the absence of observable bands on the gel, as described above, is due to the limited detection sensitivity of the gel-based assay, rather than to a true absence or non-existence of HR.
[0242] Furthermore, primary B cells achieved HR at both heavy and light chain loci, even when multiple loci were tagged simultaneously [B15], as evidenced by the insertion of a restriction enzyme (RE)-recognized sequence [B15 and B13, respectively, see Figures 27D–27E; see Figures 23A–23B for the HDR template sequences (1, 5) containing the HindIII site for introduction into these two loci]. Translation of a functional protein following the insertion of a sequence encoding a peptide epitope tag was achieved from the insertion site, as demonstrated by flow cytometry data (Figures 25A–25B).
[0243] The data show that cleavage at the CXCR locus in primary human B cells is successful only upon transfection with Cas protein (RNP), while Cas9-encoding DNA or mRNA does not result in genomic cleavage detectable by T7E1 assay (Figure 17) and TIDE analysis (Figures 18A-18F). Furthermore, the data further demonstrate increased viability for proteins (Figure 28) compared to nucleic acids (Figures 5-14).
[0244] The DNA encoding Cas9 does not induce editing beyond the background (negative control) (Figures 18A and 18B). The RNA encoding Cas9 also does not induce editing beyond the background (negative control) (Figures 18C and 18D). On the other hand, the Cas9 protein induces editing (Figures 18E and 18F). Note that the data presented in Figures 18A to 18F are graphs obtained by performing TIDE analysis. The method used to perform the TIDE analysis is presented in its entirety by reference in Brinkman et al., 2014, "Easy quantitative assessment of genome editing by sequence trace decomposition," Nucleic Acids Research, 42(22).
[0245] Furthermore, the expression of model epitope tags following homologous recombination in primary human B cells can be detected. B cells were electroporated with homologous recombination repair (HDR) templates encoding Cas9 / gRNA ribonucleoprotein (RNP) and 1× or 3× FLAG peptide (DYKDDDDK). RNPs were prepared by incubating recombinant Cas9 protein with gRNA targeting the CXCR4 locus. As negative controls, some cells were left untransfected, while others were transfected without the HDR template. Although the efficiency of genome editing was rather moderate, these data indicate that the inserted epitope tags can be spontaneously expressed by endogenous promoters, as demonstrated by flow cytometry analysis. B cell viability is presented for each treatment group (Figures 30A-30B).
[0246] (Example 5) B-cell editing at B-cell receptor loci The data presented in this example demonstrate genomic cleavage / targeting of B cell loci (Figures 22B–22E). The data show that genomic cleavage occurs at the B cell receptor loci of two B cell lines tested, Raji and Ramos (Figures 24A–24F), as well as isolated primary B cells (Figures 22B–22E), using the T7E1 cleavage assay. The primers selected for amplification of the cleavage loci are shown in Figure 22A.
[0247] The data presented in Figures 24A and 24G also demonstrate that genomic insertions at multiple receptor loci in B cells were achieved within Raji, with IGHV (including co-targeting of IGKV) and across the IGHV / J region (as assayed by Hind III restriction enzyme digestion assay), demonstrating the ability to replace entire variable fragments of the antibody (Figures 24A and 24G). Within the Ramos B cell line, the data show that IGHV can be targeted, including targeting across the IGHV / J region (Figure 24C). The data also demonstrate that selected IGHV / IGHJ or IGKV / IGKJ gRNA combinations target human B cell receptor (BCR) loci (i.e., 1-3 / 2-2 (IGHV / IGHJ) targeting is shown in Figures 22D, 24C, 24E, and 24G, and 3-1 / 4-6 (IGKV / IGKJ) targeting is shown in Figures 22E and 24E). Simultaneous transfection of two RNPs (targeting different loci) did not impair the previously observed cleavage efficiency and in some cases even improved it (Figure 24C).
[0248] Primer pairs that amplify four specific cleavage loci were identified (Figure 22A). Gluta-mediated gRNAs targeting human BCR loci were also identified (Figures 22B-22C).
[0249] The viability of primary human B cells after transfection with ribonucleoprotein (RNP) was also evaluated (Figure 29). Data from these experiments showed that B cell viability was higher when the B cell density used in the transfection procedure was 2 × 10⁶. 6 and 5 x 10 6 When it is between these two ranges, it indicates that there is no noticeable change. Furthermore, RNP transfection is 2 × 10 6 This can be performed on cells, while DNA transfection requires 1 × 10⁶ to maintain a similar survival rate. 7Cells are required. Survival rates do not decrease between 2 and 5 days after transfection, compared to DNA transfection, where survival rates typically decline significantly within just 2 days after transfection. These observations are noteworthy because it appears that time after transfection is necessary for homologous recombination to occur, and at least 3 days seems preferable.
[0250] The selected gRNA sequences for BCR editing include:
[0251] gIGHV:(IGHV3-23)GAAAACACCTGAAAATCCCA(Sequence ID 7)
[0252] gIGHJ:(IGHJ6)GTCCTCGGGGCATGTTCCGA(Sequence ID 8)
[0253] gIGKV:(IGKV3-20):TTAGGACCCAGAGGGAACCA(Sequence ID 9)
[0254] gIGKJ:(IGKJ4)CTGTGGCTCACTTTCGGCGG(Sequence ID 10)
[0255] The introduction of restriction sites and epitope tags into the BCR locus of human B cells included the following (as listed in Figure 23C):
[0256] Targeting: 1) Introduction of HindIII into IGHV: gRNA1-3, HDR template 1 2) Introduction of FLAG tags into IGHV: gRNA1-3, HDR template 2 3) Introduction of HindIII into IGHV / J: gRNA1-3 and 2-2, HDR template 3 4) Introduction of FLAG tag into IGHV / J: gRNA1-3 and 2-2, HDR template 4 5) Introduction of HindIII into IGKV: gRNA3-1, HDR template 5 6) Introduction of HA tag into IGKV: gRNA3-1, HDR template 6 7) Introduction of HindIII into IGKV / J: gRNA3-1 and 4-6, HDR template 7 8) Introduction of HA tags into IGKV / J: gRNA3-1 and 4-6, HDR template 8 9) HindIII to IGHV and IGKV: 1) + 5) 10) FLAG's IGHV and HA's IGKV: 2) + 6) 11) HindIII to IGHV / J and IGKV / J: 3) + 7) 12) FLAG's IGHV / J and HA's IGKV / J: 4) + 8)
[0257] The data further demonstrate that the B cell receptor is targeted for genomic insertions across the V / J region, which helps to demonstrate a proof of concept for its ability to replace entire antibody variable fragments. This is demonstrated in the Raji cell line by insertion of the HindIII insertion site and in primary B cells by PCR amplicons of the correct size (i.e., no amplicon is observed in the absence of an insertion that replaces a large native intervening sequence that separates the primer binding sites by a distance that cannot be amplified by the extension time used in the PCR reaction performed) (Figures 24A–24F). Figure 24 shows insertions of the HindIII site into IGHV and IGKV (Figures 24A and 24G), as well as insertions into IGHV / J (Figures 24C, 24E, and 24G), and insertions into IGKV / J (Figure 24G). Sanger sequencing confirmed that the amplicons extend to the V / J region. The data confirms insertions across the vertex / junction in primary human B cells during 5 days of activation before transfection and 5 days of activation after transfection.
[0258] The data also demonstrated that genomic insertion was achieved by independent protein expression from both heavy and light chain loci in primary human B cells at single-cell resolution flow cytometry (i.e., FLAG peptide at IgH and HA peptide at IgK) (Figures 25A and 25B).
[0259] The data confirm that multiple loci (e.g., IgHV+IgHJ, IgHV+IgKV) can be targeted simultaneously without any loss of efficiency at any of the loci. [H=heavy chain, K=light chain]
[0260] MiSeq data confirm homologous recombination (HR) at the BCR locus in B cell lines, Ramos (Figure 27A), Raji (Figures 27B and 27C), and primary B cells (Figure 27D). These assays demonstrate that spontaneously growing cell lines do not require activation. HR template 1 (i.e., HR template IGH1) was successfully inserted into the IGHV locus (Figure 27A). HR templates 5 (i.e., HR template IGK1) and 1 (i.e., HR template IGH1) were successfully inserted into the IGKV and IGHV loci, respectively (Figure 27B). HR templates 2 (i.e., HR template IGH2) and 6 (i.e., HR template IGK2), which encode peptides, were successfully inserted into the IGHV and IGKV loci, respectively (Figure 27C). HR templates 1 (i.e., HR template IGH1) and 6 (i.e., HR template IGK2), each containing a restriction site and encoding a peptide, were successfully inserted even when multiple loci were targeted [R15, R18] (Figure 27C). HR templates 5 (i.e., HR template IGK1) and 1 (i.e., HR template IGH1), each containing a restriction site, were successfully inserted into the IGKV and IGHV loci, respectively (Figure 27D). This was true even when multiple loci were targeted [B15] (Figure 27D).
[0261] (Example 6) Transfection optimization Various conditions were assayed to establish optimal conditions for transfection of B cells and PBMCs (Figures 3–16). The assayed variables included the effect of cell density on transfection efficiency (Figures 3–5), the type of transfection (i.e., optimization of the nucleofection program used) (Figures 6, 7, 12, and 13), whether the DNA construct to be transfected was cleaved or intact (Figure 7C), whether the cells were cultured in the presence of IL4 or IL4 / IL21 / CD40L before or after transfection (Figures 8–10, 14), the concentration of the DNA construct used for transfection (Figures 9A, 15A, 15B), and the type of cell isolation used (i.e., MAC or RosetteSep isolation) (Figure 11). Other assays were used to determine the effect of various Cas9 vectors with different promoters on cell viability and the ability of cells to express GFP (Figure 9A). These data demonstrate that vector number 63592 (EFS promoter) results in higher GFP expression than vector number 48138 (Cbh promoter). These data further demonstrate that cell viability is higher with mRNA transfection than with plasmid transfection, and that there is no significant difference in GFP expression between day 1 and day 2 after transfection.
[0262] Cell viability The data shows that the viability and efficiency of eGFP transfection in PMBCs increase the cell number (i.e., the cell number increases by 1 × 10⁻⁶). 6 From 5 x 10 6 ~1 × 10 e 7 This demonstrates that enhancement can be achieved by increasing the number of cells (down to the individual cell level) (Figure 5A). Other observations regarding the effect of cell concentration on DNA construct transfection show that viability, rather than efficiency, can be enhanced by increasing the number of cells in PBMCs (Figure 5A), that viability is lowest after Cas9 transfection and decreases slightly over time (Figure 5B), and that GFP expression decreases after 48 hours (Figure 5B).
[0263] Assays comparing the efficiency of plasmid DNA transfection with that of mRNA show that plasmid DNA yields higher GFP expression efficiency than mRNA (Figure 6).
[0264] Nucleofection Of the various nucleofection programs tested, nucleofection program V-015 yielded the highest cell viability, the lowest background in transfection control (no DNA addition), and the highest transfection efficiency for eGFP and Cas9 (Figures 7A-7D). Other observations from these assays indicate that standard DNA prep works better than end-free ("EF") prep (i.e., comparing Cas9 with EF), linearized DNA works better than plasmid DNA (i.e., comparing cleaved Cas9 with Cas9), GFP mRNA works well in higher quantities but still has low efficiency (i.e., mGFP 10 μg, 20 μg), transfection using the MaxCyte instrument does not work, and viability is not significantly affected by different conditions (i.e., slightly higher for mRNA transfection and end-free prep) (Figures 7A-7D). Assays using cell line transfection demonstrate high transfection efficiency for U266 / eGFP, better Cas9 transfection function in U266 than in primary B cells, high viability of transfected U266 cells, insufficient efficiency in Ramos cell lines except for GFP mRNA (mGFOP), and insufficient viability in transfected Ramos cell lines (Figure 7D).
[0265] B cell culture in the presence of cytokines Various optimizations were performed on primary B cell transfection (Figures 8-10). Data from these optimization experiments showed that culturing cells with IL-4 / IL-21 / CD40L after transfection increased the efficiency of eGPF and Cas9 transfection (Figure 8B). Various Cas9 vectors with different promoters were also assayed. These results showed that vector number 63592 (EFS promoter) functioned better than number 48138 (Cbh promoter), that autosynthetic GFP and Cas9 mRNA+ / -5meC did not function as well as GFP mRNA purchased from Trilink, resulting in higher viability with mRNA transfection, and that there was no detectable difference in expression between day 1 and day 2 after transfection (Figures 9A-9B). Changes in the amount of DNA used in the assay showed that 5 μg functioned better than 2 μg, but viability decreased significantly (Figure 9B).
[0266] B cell activation one week prior to transfection results in higher transfection efficiency for IL-4 than for the IL-4 / IL-21 / anti-CD40 agonist ("aCD40"), decreased cell viability, and indicates that one week of activation is too long (i.e., cells are overstimulated and begin to die) (Figure 10).
[0267] The effect of co-culture with CD40L-expressing fibroblasts on the activation of isolated B cells was also evaluated (Figures 14A and 14B). For these assays, B cells were co-cultured with irradiated 3T3 cells for 24, 48, or 72 hours prior to transfection. Data from these assays indicate that CD40L-positive 3T3 cells suppress GFP transfection efficiency, that there is an increase in Cas9 expression efficiency, and that cell viability increases after transfection following co-culture with 3T3 cells. These same assays were repeated for all PBMCs (Figure 14B). Data from these experiments indicate that the presence of CD40L-positive cells does not increase transfection efficiency for either GFP or Cas9, and that cell viability increases after co-culture with 3T3 cells.
[0268] Cell isolation The effect of the method of cell isolation on transfection was also evaluated (Figures 11A and 11B). Two isolation methods were evaluated: MACS and RosetteSep. Data from these assays indicate that B cells isolated by RosetteSep exhibit higher transfection efficiency. For MACS-isolated cells, intersite treatment reduced transgene expression, while in RosetteSep-isolated cells, cytokines had a positive effect on transfection of cells from one donor (Donor A) but no effect on cells from the other donor (Donor B) (Figures 11A and 11B).
[0269] Effects of multiple variables on nucleic acid nucleofection Other assays performed determined the effects of B cell activation, the amount of B cells used, and the concentration of the DNA construct transfected (Figures 15A–15C). For these assays, different amounts of B cells were seeded on 3T3 cells and co-cultured for 24 and 48 hours, followed by transfection with varying concentrations of DNA construct. Data from these assays indicate that higher cell numbers, longer cell activation, and higher DNA concentrations each had a positive effect on transfection of both GFP and Cas9, but with lower transfection efficiency. Cell viability decreased slightly after nucleofection when B cells were pre-cultured with 3T3 cells. Other assays performed showed that higher B cell numbers performed best when combined with 5 μg of Cas9 plasmid (Figure 15B).
[0270] In summary, the data from these experiments can be summarized as follows:
[0271] The recovery process after nucleofection is crucial for survival rates.
[0272] Cell number: 1×10 6 From 5 x 10 6 ~1 × 10 7 It increased to [number].
[0273] DNA prep: Standard Maxiprep performs better than end-free Maxiprep.
[0274] Increase the amount of DNA from 2 μg to 5 μg.
[0275] mRNA vs. plasmid DNA: Plasmid DNA functions better than mRNA.
[0276] Circularized vs. linearized plasmid DNA: Linearized DNA appears to offer higher transfection efficiency than circularized DNA.
[0277] Linear plasmid HDR templates are inserted more efficiently than circular plasmid HDR templates. B cells were electroporated with plasmid HDR templates encoding Cas9 / gRNA RNPs and nanobodies, or the heavy or light chain of adalimumab (anti-TNFα), along with the constant region. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting the IGHV and IGKV loci. As negative controls, some cells were left untransfected, while others were transfected without HDR templates. PCR was performed on isolated genomic DNA using germline-specific forward primers and insert-specific reverse primers, and amplicons of predicted size were detected by gel electrophoresis. B cell viability is presented for each treatment group. (Figures 33A-33B)
[0278] Different promoters: The EF-1a promoter works best.
[0279] Nucleofection program: V-015 works best.
[0280] Electroporation device: Amaxa is the only device that allows for GFP expression following electroporation of the nucleic acid encoding Cas9_2A_GFP.
[0281] Activation: 5 ng / ml of Il-4 before and after transfection yields the best results.
[0282] (Example 7) B cell isolation and culture B cells were isolated from PBMCs obtained from human umbilical cord blood using the Ficoll method.
[0283] For Magnetic Cell Isolation and Separation (MACS), B cells were panned using negative screening with reagents from Miltenyi. The purity of the isolated B cells was approximately 95%, with a viability of 80% to 90%. The LS column yielded a larger quantity of cells compared to the LS column (approximately twice as many).
[0284] RosetteSep isolation (based on B-cell panning with an antibody cocktail-stem cells) yielded approximately four times more cells than via MACS, with a purity of approximately 90% and a viability of approximately 95%.
[0285] Isolated B cells were 2-4 × 10⁶ cells in RPMI + 10% FBS, 1% P / S, 1% HEPES, and 1% L-glutamine. 6 Cells were cultured at a density of cells / ml. Under certain conditions, supplementary components were also added. It was noted that cells had a higher viability in the absence of β-ME, and that in the presence of IL-4, cells could be cultured for an even longer period with a higher viability.
[0286] (Example 8) Antibody insertion, mRNA expression, antibody production, and evaluation of antibody specificity 2 x 10 6One primary human B cell was used for each experiment. Cells were isolated from fresh clavicular blood using RosetteSep B Cells Enrichment Cocktail (StemCell Technologies) and activated for 1 day with recombinant IL-4 (BioLegend) or for 3-4 days with CellXVivo Human B Cell Expansion Kit (R&D Systems) prior to electroporation. After performing electroporation as described (15 μg Cas9, 20 μg gRNA, and 100 pmol single-stranded HDR template or 3 μg double-stranded HDR template), cells were cultured for 5 or 6 days with the activating components as well as 1 μM Scr-7 and 10 μM Z-VD-OPH (quinoline-Val-Asp-difluorophenoxymethyl ketone, "OPH"). The activating components and OPH were lysed according to the manufacturer's specifications and added to the culture medium immediately before transferring the cells to flow cytometry tubes for culture. After a further 5 or 6 days of culture, cell viability was confirmed by flow cytometry using Zombie NIR (BioLegend) staining.
[0287] Insertion of sequences encoding nanobodies into the heavy chain loci of primary human B cells, or insertion of sequences encoding the heavy and light chains of monoclonal antibodies into the heavy and light chain loci of primary human B cells, leads to antibody production. B cells were electroporated with plasmid HDR templates encoding the heavy or light chain of ozoralizumab or adalimumab (anti-TNFα), along with Cas9 / gRNA RNPs and constant regions. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting IGHV and IGKV loci. The heavy chain (HC) and light chain (LC) constructs contained FLAG and HA tags, respectively, enabling tracking with established reagents for flow cytometry. The nanobodies construct also contained FLAG tags. Viability and purity are shown. UT is untransfected (negative control). Insertion of monoclonal antibody sequences encoding the heavy and light chains of primary human B cells into the heavy and light chain loci leads to the secretion of antibodies with desired specificity. B cells were electroporated with a plasmid HDR template encoding the heavy or light chain of adalimumab (anti-TNFα) along with Cas9 / gRNA RNPs and a constant region. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting the IGHV and IGKV loci. ELISA was performed by coating plates with recombinant TNFα before incubation with supernatant from B cell culture. Secondary antibodies against europium-labeled human IgG were then added to the plates and analyzed using a fluorescence plate reader. UTs are untransfected (negative control). Samples from three independent donors are shown.
[0288] Insertion of monoclonal antibody sequences encoding the heavy and light chains of primary human B cells into the heavy and light chain loci leads to mRNA expression. B cells were electroporated with a plasmid HDR template encoding the heavy or light chain of adalimumab (anti-TNFα) along with Cas9 / gRNA RNPs and a constant region. RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting the IGHV and IGKV loci. mRNA was collected and reverse transcribed using reverse primers specific to the insert. RT-PCR was performed on this cDNA, and amplicons of expected size were detected by gel electrophoresis using two different primer pairs. In both cases, one primer was germline specific and the other was insert specific. UTs were untransfected (negative control). (Figures 31-46)
[0289] (Example 9) Evaluation of the pancaspase inhibitor Q-VD-OPH (OPH) on B cell editing efficiency and viability. Increasing B cell viability after electroporation was necessary to produce the data presented in Example 8 (insertion of sequences encoding nanobodies or antibodies and confirmation of their expression). This example describes the identification of the pancaspase inhibitor Q-VD-OPH ("OPH") for significantly increasing B cell viability after electroporation and the definition of their optimal concentrations, which were performed prior to the experiments described in Example 8. For these experiments, 2 × 10⁻⁶ 6One primary human B cell was used for each experiment. Cells were isolated from fresh clavicular blood using RosetteSep B Cells Enrichment Cocktail (StemCell Technologies) and activated for 1 day with recombinant IL-4 (BioLegend) or for 3-4 days with CellXVivo Human B Cell Expansion Kit (R&D Systems) prior to electroporation. After electroporation (15 μg Cas9, 20 μg gRNA, and 100 pmol single-stranded HDR template or 3 μg double-stranded HDR template) as described, cells were cultured with the respective activators and different OPH concentrations. The activators and OPH were lysed according to the manufacturer's specifications and added to the culture medium immediately before transferring the cells to flow cytometry tubes for culture. After a further 5 or 6 days of culture, cell viability was confirmed by flow cytometry using Zombie NIR (BioLegend) staining (Figures 47-52).
[0290] In the first experiment, which tested various concentrations of OPH in IL-4 activated cells, UT, Cas9+gRNA, Cas9+gRNA OPH 2μM (DMSO=0.05%), Cas9+gRNA OPH 4μM (DMSO=0.1%), and Cas9+gRNA OPH 10μM (DMSO=0.1%) were tested. Cell counts were 2 × 10⁶ per test. 6 Cells were seeded at a specific density. 10 μg of Cas9 was transfected. B cells were isolated on day (-1), cell electroporation was performed on day (0), and flow cytometry evaluation was performed on day (5). Cell viability increased significantly with increasing OPH concentration. As shown in Figure 47B, cell viability increased by approximately 100% following treatment with 10 μM OPH.
[0291] In a second experiment testing OPH concentrations in IL-4 activated B cells, the following conditions were evaluated: UT, 1 μg Cas9+gRNA+GFP fragment, 1 μg Cas9+gRNA+GFP fragment with 2 μM OPH (DMSO=0.02%), 1 μg Cas9+gRNA+GFP fragment with 4 μM OPH (DMSO=0.04%), 1 μg Cas9+gRNA+GFP fragment with 10 μM OPH (DMSO=0.1%), and 1 μg Cas9+gRNA+GFP fragment with 20 μM OPH (DMSO=0.2%). Cells were 2 × 10⁶ per test. 6 Cells were seeded at a specific density. 10 μg of Cas9 was transfected. B cells were isolated on day (-1), cell electroporation was performed on day (0), and flow cytometry evaluation was performed on day (5). Cell viability increased significantly with increasing OPH concentration. As shown in Figure 48C, cell viability increased by approximately 100% following treatment with 10 μM OPH (compared to those without OPH).
[0292] In the first experiment testing the concentration of OPH in kit (IL-4+CD40L) activated B cells, the following conditions were evaluated:
[0293] UT, Cas9+gRNA, Cas9+gRNA OPH 2μM (DMSO=0.05%), Cas9+gRNA OPH 4μM (DMSO=0.1%), Cas9+gRNA OPH 10μM (DMSO=0.1%). Cells were 2 × 10⁶ per test. 6 Cells were seeded at a specific density. 10 μg of Cas9 was transfected. B cells were isolated on day (-1), cell electroporation was performed on day (0), and flow cytometry evaluation was performed on day (5). As shown in Figure 49C, cell viability increased by approximately 100% following treatment with 10 μM OPH (compared to those without OPH).
[0294] In a second experiment testing the electroporation of kit-activated B cells with various concentrations of OPH, the following conditions were evaluated: untransfected (UT), Cas9 10μg + gRNA + 1μg GFP fragment, Cas9 10μg + gRNA + 1μg GFP fragment OPH 2μM (DMSO=0.02%), Cas9 10μg + gRNA + 1μg GFP fragment OPH 4μM (DMSO=0.04%), Cas9 10μg + gRNA + 1μg GFP fragment OPH 10μM (DMSO=0.1%), and Cas9 10μg + gRNA + 1μg GFP fragment OPH 20μM (DMSO=0.2%). Cells were 2 × 10⁶ per test. 6 Cells were seeded at a specific density. B cells were isolated on day (-5) and activated on day (-4). Cell electroporation was performed on day (0), and flow cytometry was performed on day (5). Cell viability increased significantly with increasing OPH concentration. As shown in Figure 50C, cell viability increased significantly by approximately 200% following treatment with 10 μM OPH (compared to no OPH).
[0295] In a third experiment testing the electroporation of kit-activated B cells with various concentrations of OPH, the following conditions were evaluated: untransfected (UT), Cas9 15 μg + gRNA-CXCR4 20 μg + HR template 1 * FLAG 100pmol OPH 0μM, Cas9 15μg + gRNA-CXCR4 20μg + HR template 1 * FLAG 100pmol OPH 2μM, Cas9 15μg + gRNA-CXCR4 20μg + HR template 1 * FLAG 100pmol OPH 5μM, Cas9 15μg + gRNA-CXCR4 20μg + HR template 1 * FLAG 100pmol OPH 10μM, Cas9 15μg + gRNA-CXCR4 20μg + HR template 1 *FLAG 100pmol OPH 10μM+SCR7 1μM, Cas9 15μg+gRNA-CXCR4 20μg+HR template 1 * FLAG 100pmol OPH 20μM, Cas9 10μg + gRNA-IGHV 20μg + nanobody template 3μg OPH 2μM, Cas9 10μg + gRNA-IGHV 20μg + nanobody template 3μg OPH 10μM. Cells were 1.8 × 10⁶ per test. 6 Cells were seeded at a specific density. 15 μg of Cas9 was transfected. The DMSO concentration was 0.1%. Cell electroporation was performed on day (0), and flow cytometry evaluation was performed on day (4). As shown in Figures 51 and 52, apoptosis inhibitors significantly increased B cell viability after electroporation.
[0296] Furthermore, sequences encoding nanobodies can be inserted into the heavy chain locus of primary human B cells. B cells were electroporated with a plasmid HDR template encoding Cas9 / gRNA ribonucleoprotein (RNP) and ozoralizumab (anti-TNFα nanobodies). RNPs were prepared by incubating recombinant Cas9 protein with gRNA targeting the IGHV locus. As negative controls, some cells were left untransfected, while others were transfected without the HDR template. PCR was performed on isolated genomic DNA using germline-specific forward primers and insert-specific reverse primers, and amplicons of predicted size were detected by gel electrophoresis. Insertion efficiency increased with increasing template volume, and B cell viability increased following OPH treatment (Figures 31A-C).
[0297] Furthermore, sequences encoding the heavy and light chains of monoclonal antibodies can be inserted into the heavy and light chain loci of primary human B cells. B cells were electroporated with a plasmid HDR template encoding the heavy or light chain of adalimumab (anti-TNFα) along with Cas9 / gRNA RNPs and a constant region. The RNPs were prepared by incubating recombinant Cas9 protein with gRNAs targeting the IGHV and IGKV loci. As negative controls, some cells were left untransfected, while others were transfected without the HDR template. PCR was performed on isolated genomic DNA using germline-specific forward primers and insert-specific reverse primers, and amplicons of predicted size were detected by gel electrophoresis. Insertion efficiency increased with increasing amounts of Z-VD-OPH ("OPH"), with a 10 μM OPH concentration increasing homologous recombination compared to 2 μM (Figures 32A-C).
[0298] Other Embodiments Although the present invention has been described in detail, the above description is intended to illustrate, not limit, the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A population of B cells isolated from human patients, At least some of the B cells have one or more genomic modifications, The aforementioned modification of one or more genomes includes nuclease-assisted insertion of one or more nucleic acid sequences at one or more B cell receptor loci, The insertion of one or more nucleic acid sequences encodes an exogenous antibody, and The aforementioned modification of one or more genomes includes the deletion of one or more nucleic acid sequences of one or more B cell receptor loci encoding endogenous B cell receptors. A population of B cells, including the aforementioned population.
2. The population of B cells according to claim 1, wherein the population expresses at least 40% fewer endogenous B cell receptors than a population of B cells that do not have one or more genomic modifications.
3. The population of B cells according to claim 1 or 2, wherein at least 1% of the cells in the population have one or more genomic modifications.
4. The population of B cells according to any one of claims 1 to 3, wherein at least 0.5% of the cells in the population express exogenous antibodies.
5. The foreign antibodies include TNF-α, IGHE, IL-1, IL-Iβ, IL-2, IL-4, IL-5, IL-6, IL-6R, IL-9, IL-12, IL-13, IL-17A, IL-20, IL-22, IL-23. , IL-25, BAFT, RANKL, Integrin-α4, VEGF-A, VEGFR1, VEGFR2, EGFR, HER2, HER3, CA125, Integrin α4β7, Integrin α7β7, Interferon α / β receptor, CXCR4, CD2, CD3, CD4, CD5, CD6, CD19, CD20, CD22, CD23, CD25, CD27, CD28, CD30, CD33, CD37, CD38, CD40, CD41, CD 44, CD51, CD52, CD56, CD70, CD74, CD79B, CD80, CD125, CD137, CD140a, CD147, CD152, CD154, CD200, CD221, CCR4, CCR5, gp l20, angiopoietin 3, PCSK9, HNGF, HGF, GD2, GD3, C5, FAP, ICAM-1, LFA-1, interferon-α, interferon-γ, interferon-γ-inducing protein, SLAMF7, HHGFR, TWEAK receptor, NRP1, EpCAM, CEA, CEA-related antigen mesothelin, MUC1, IGF-1R, TRAIL-R2, DR5, DLL4, VWF, MCP-1, β-amyloid, phosphatidylserine, rhesus factor, CCL11, NARP-1, RTN4, ACVR2B, SOST, NOGO-A, sclerostin, Bacillus anthrax, avian influenza, influenza A hemagglutinin, hepatitis A virus, hepatitis B virus, hepatitis C virus, polynuclear respiratory virus, rabies virus glycoprotein, cytomegalovirus glycoprotein B, tuberculosis, Ebola, Staphylococcus aureus A population of B cells according to any one of claims 1 to 4, which is specific to aureus, SARS, MERS, malaria, RSV, HPV, TGF-β, TGF-βRl, NGF, LTA, AOC3, ITGA2, GM-CSF, GM-CSF receptor, oxLDL, LOXL2, RON, KIR2D, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, BTLA, epicyalin, myostatin, or HTV-l.
6. The population of B cells according to any one of claims 1 to 5, wherein the nuclease is an engineered nuclease.
7. The population of B cells according to any one of claims 1 to 5, wherein the nuclease is a CRISPR nuclease, a zinc finger nuclease, a meganuclease, or a transcription activator-like effector nuclease.
8. The population of B cells according to claim 7, wherein the CRISPR nuclease is a Cas nuclease, a Cpf1 nuclease, a C2c1 nuclease, a C2c3 nuclease, or a Cas9 niccasse variant.
9. The population of B cells according to any one of claims 1 to 8, wherein the insertion of one or more nucleic acid sequences codes for the light and heavy chains of an exogenous antibody.
10. The population of B cells according to any one of claims 1 to 9, wherein the one or more B cell receptor loci include at least one B cell receptor light chain loci and a B cell receptor heavy chain loci.
11. The population of B cells according to any one of claims 1 to 10, wherein the one or more B cell receptor loci are selected from the group consisting of IGHV, IGHD, IGHJ, IGHC, IGKV, IGKJ, IGLV, IGLJ, and IGLC.
12. The population of B cells according to any one of claims 1 to 11, wherein the one or more B cell receptor loci include a gene locus upstream of the reconstituted variable region.
13. The population of B cells according to claim 12, wherein the reconstituted variable region is IGHV3-23 or IGKV3-20.
14. The population of B cells according to any one of claims 1 to 13, wherein the one or more B cell receptor loci include a gene locus downstream of the reconstituted binding region.
15. The population of B cells according to claim 14, wherein the reconstituted binding region is IGHJ6 or IGKJ5.
16. Isolated human lymphocytes derived from the proliferation of B cells having one or more genomic modifications as defined in any one of claims 1 to 15.
17. A pharmaceutical composition comprising a population of B cells as described in any one of claims 1 to 15.