Pharmaceutical composition for use in treating cognitive decline, excess weight, or obesity
Patent Information
- Application Number
- JP2023548505
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Priority Date
- 2022-09-15
- Filing Date
- 2022-09-15
- Publication Date
- 2025-10-02
AI Technical Summary
Current treatments for cognitive decline and obesity lack effective targets, particularly in relation to the altered function and morphology of the hippocampus caused by high-fat diets, which impact neurocognition and result in abnormal regulation of AMPA and NMDA receptors, leading to suppressed NMDA receptor activation and calcium permeability issues.
Development of pharmaceutical compositions containing AMPA receptor antagonists, such as perampanel, to inhibit intracellular calcium influx through AMPA receptors, thereby restoring NMDA receptor activation and addressing cognitive dysfunction and obesity-related conditions.
The AMPA receptor antagonists effectively treat cognitive decline, obesity, and related metabolic disorders by normalizing receptor function, improving calcium permeability, and enhancing memory and learning functions.
Abstract
Description
Pharmaceutical composition for use in treating cognitive decline, or overweight or obesity
[0001] The present invention relates to a pharmaceutical composition comprising an antagonist of an AMPA receptor for use in treating cognitive decline.The present invention also relates to a pharmaceutical composition comprising an antagonist of an AMPA receptor for use in treating a disease or condition associated with an NMDA-insensitive NMDN receptor in a subject having an NMDA-insensitive NMDA receptor.The present invention further provides a pharmaceutical composition for use in treating overweight and obesity.
[0002] The global obesity epidemic has generated evidence that a high-fat diet (HFD) promotes obesity and has adverse neurocognitive effects. (1, 2) However, although accumulating evidence suggests that high-fat diet consumption during adolescence alters hippocampal function and morphology, the mechanisms underlying this phenomenon remain unclear, and no attractive targets for effective treatment have been established.
[0003] AMPA receptors (hereinafter also referred to as "AMPAR") are involved in fast excitatory synaptic transmission and, together with NMDA receptors, play an important role in learning and memory. In particular, NMDA receptors (hereinafter also referred to as "NMDAR") are ligand-gated ion channels belonging to the ionotropic glutamate receptor family. NMDA receptors play an important role in excitatory synaptic transmission, learning, and memory. AMPA receptors are expressed on the postsynaptic membrane and induce hyperpolarization on the order of milliseconds in the presence of glutamate (or AMPA), but are not calcium permeable. NMDA receptors are expressed on the postsynaptic membrane and non-synaptic regions. In the presence of glycine and glutamate (or NMDA), they are activated in response to depolarization of the cell membrane, allowing cations, including calcium ions, to enter the cell. NMDA receptors are normally inactivated by binding to magnesium ions. When the AMPA receptor is depolarized and the membrane potential of the membrane where the NMDA receptor is located increases, the magnesium block of the NMDA receptor is released, making the NMDA receptor responsive to glycine and glutamate. After the AMPA receptor is depolarized, the NMDA receptor is depolarized, increasing the intracellular calcium concentration, and thereby generating a signal in the postsynaptic membrane.
[0004] The hippocampus has the lowest firing threshold in the brain and plays an important role in the acquisition of new memories and learning. For example, Alzheimer's disease is known to occur due to damage to the entorhinal cortex (EC) followed by a decline in hippocampal function. Furthermore, the low firing threshold can be a cause of epilepsy. Perampanel, an AMPA receptor antagonist, is commercially available and is used to treat epilepsy.
[0005] The present invention provides pharmaceutical compositions for use in treating cognitive decline.
[0006] The present inventors have discovered a new phenomenon in the hippocampus: calcium permeability of AMPA receptors is increased in the presence of AMPA, while activation of NMDA receptors is suppressed in the presence of NMDA. The present inventors have also found that this new phenomenon occurs in overweight and obese subjects, as well as subjects with cognitive impairment. More specifically, while AMPA receptors are calcium-impermeable in the hippocampus of healthy individuals, the examples described below have revealed that calcium permeability of AMPA receptors is increased in the presence of AMPA, and activation of NMDA receptors is suppressed in the presence of NMDA, in the hippocampus of overweight and obese subjects, indicating abnormal regulation of AMPA receptors and NMDA receptors in the hippocampus of these subjects. Overweight and obese subjects also have a certain degree of cognitive impairment. It has also been revealed that calcium permeability of AMPA receptors is increased in the presence of AMPA, and activation of NMDA receptors is suppressed in the presence of NMDA in the hippocampus of subjects with Alzheimer's dementia. It has been revealed that the suppression of NMDA receptor activation under conditions in which it should be activated may be the cause of cognitive impairment in overweight and obese subjects and subjects with cognitive impairment.The inventors also succeeded in restoring the NMDA receptor's ability to activate NMDA-responsive channels by applying an AMPA receptor agonist to the hippocampus of these subjects.In the above subjects, the regulation of hippocampal AMPA receptors and NMDA receptors is abnormal, and the suppression of NMDA receptors due to excessive AMPA receptor stimulation (especially increased calcium permeability) is involved in cognitive impairment.Therefore, the suppression of NMDA receptors (i.e., NMDA receptor activation) can be induced by using an AMPA receptor antagonist to inhibit intracellular calcium influx via AMPA receptors.
[0007] The present invention provides, for example, the following inventions: [1] A pharmaceutical composition for use in treating cognitive impairment in a subject, the pharmaceutical composition comprising an AMPA receptor antagonist. [2] The pharmaceutical composition according to [1] above, wherein the subject has inhibited NMDA receptors in at least one or more regions of the hippocampal formation selected from the group consisting of the entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG), thereby inhibiting NMDA-mediated NMDA receptor activity in at least one or more regions of the hippocampus, and the subject has cognitive impairment. [3] The pharmaceutical composition according to [2] above, wherein the subject has calcium-permeable AMPA receptors in at least one or more regions of the hippocampal formation, thereby inhibiting NMDA receptor activation in at least one or more regions of the hippocampus. [4] The pharmaceutical composition according to any of [1] to [3] above, wherein the subject has cognitive impairment. [5] The pharmaceutical composition according to [4] above, wherein the cognitive impairment is Alzheimer's dementia. [6] The pharmaceutical composition according to any of [1] to [5] above, wherein the subject has a body mass index (BMI) of 25 or more. [7] The pharmaceutical composition according to any of [1] to [6] above, wherein the subject has a BMI of 30 or more. [8] The pharmaceutical composition according to any of [1] to [7] above, wherein the subject exhibits a blood oxygenation level-dependent (BOLD) response variation of 1.1 times or more compared to the resting state in an event-related memory task. [9] A pharmaceutical composition for use in treating a disease or condition related to NMDA unresponsiveness in an NMDA-unresponsive subject or a subject having an NMDA-unresponsive NMDA receptor, the pharmaceutical composition comprising an AMPA receptor antagonist.
[10] The pharmaceutical composition according to any of [1] to [9] above, wherein the AMPA receptor antagonist is perampanel.
[0008] The present invention also provides, for example, the following inventions. [1A] A pharmaceutical composition for use in treating overweight or obesity in an overweight or obese subject, the pharmaceutical composition comprising an AMPA receptor antagonist. [2A] The pharmaceutical composition described in [1A] above, for use in delaying, inhibiting, or halting the progression of overweight or obesity in an overweight or obese subject. [3A] A pharmaceutical composition for use in reducing body weight in an overweight or obese subject, the pharmaceutical composition described in [1A] above. [4A] A pharmaceutical composition for use in reducing food intake in an overweight or obese subject, the pharmaceutical composition described in [1A] or [3A] above. [5A] The pharmaceutical composition described in any of [1A] to [4A] above, for use in suppressing the onset of diabetes, dyslipidemia, and cardiovascular disease in an overweight or obese subject. [6A] The pharmaceutical composition described in any of [1A] to [5A] above, wherein the AMPA receptor antagonist is perampanel.
[0009] Figure 1-1 shows that in the hippocampus of a mouse model with obesity-induced cognitive decline, NMDA receptors are inhibited even in the presence of an agonist, AMPA receptors are calcium permeable in the presence of an agonist, and the AMPA receptor antagonist perampanel (PER) restores AMPAR-NMDAR interaction in the hippocampus of HFD-fed mice. Panel A shows Fluo-3 fluorescence images of the hippocampus before and after administration of AMPA (an AMPA receptor agonist) and CTZ (an uncoupling inhibitor) in the CD-fed group, the HFD-fed group, and the PER-fed + HFD-fed group (hereinafter sometimes referred to as the "HFD group with PER"). The right column of Panel A shows the difference between the pre- and post-administration images. Mice were 17 weeks old. The HFD-fed and HFD-with-PER groups were fed either a HFD or a HFD with PER diet from 8 to 17 weeks of age. Panels B–D show AMPA-dependent changes in normalized F525 (NF525) in the hippocampal CA1, CA2, CA3, DG, and EC regions. F525 signals were measured in the CD-fed group (Panel B), the HFD-fed group (Panel C), and the HFD-fed group with PER (Panel D). Panel E shows the mean maximum values of NF525 after AMPA administration obtained from different slice preparations (N = 5) (*: p < 0.05, two-tailed t-test). Panel F shows Fluo-3 fluorescence images of the hippocampus before and after NMDA and glycine administration in the HFD-fed group treated with CD, HFD, or PER, as well as their differential images. Panels G–I show NMDA-dependent changes in NF525 in the hippocampal CA1, CA2, CA3, DG, and EC regions. NF525 signals were measured under CD (Panel G), HFD (Panel H), and HFD with PER treatment (Panel I). Panel J shows the mean maximum NF525 values after NMDA administration obtained from different slice preparations (N = 5) (**: p < 0.01; *: p < 0.05, two-tailed t-test).Figure 1-2 shows that AMPA receptors in the hippocampus of Alzheimer's disease model mice (NL and NLGF) are calcium permeable in the presence of an agonist, and that the AMPA receptor antagonist perampanel (PER) restores calcium permeability of AMPA receptors in the hippocampus of HFD-fed mice. Figure 1-3 shows that NMDA receptors are suppressed in the hippocampus of Alzheimer's disease model mice (NL and NLGF) even in the presence of an agonist. Figure 2-1 shows the results of transcriptional profiling, expression, Q / R editing rate, and behavioral analysis of AMPAR and NMDAR in the hippocampus of HFD-fed mice. Panel A shows the expression levels of AMPAR subunits, NMDAR subunits, and ADAR2 in the hippocampal regions (CA1, CA3, DG, EC) of the CD-fed group, HFD-fed group, and HFD with PER-fed group, as determined by qRT-PCR. Mice were 17 weeks old, and the HFD-fed group and HFD with PER-fed group were fed either HFD or HFD with PER from 8 to 17 weeks of age. Panel B shows the expression levels of AMPAR subunits, NMDAR subunits, and ADAR2 in the hippocampal regions (CA1, CA3, DG, EC) of the CD-fed group, HFD-fed group, and HFD with PER-fed group. 2+Panel C shows increased cell surface (center column) and intracellular (right column) expression of GluA1 protein in the hippocampal CA3 region of the HFD-fed group and decreased expression in the HFD-with-PER group. Panel D shows the results of Q / R editing analysis in the hippocampal regions (CA1, CA2, CA3, DG, and EC) of the CD-fed and HFD-fed groups. Mice were 17 weeks old, and the HFD-fed and HFD-with-PER-fed groups were fed either a HFD or a HFD-with-PER diet from 6 to 17 weeks of age. VIC: VIC-labeled probe detecting unedited (Q) sequences; FAM: FAM-labeled probe detecting edited (R) sequences. The bar graph on the left indicates the ratio (%) of R to Q sequences. Figure 2-2 is a continuation of Figure 2-1. Panel E shows the changes in body weight for the CD-fed, HFD-fed, and HFD-fed with PER groups (N = 6). Mice were 6 to 17 weeks old. The HFD-fed and HFD-fed with PER groups were fed either a HFD or a HFD with PER diet from 6 to 17 weeks of age. Panel F shows the food intake for the HFD-fed and HFD-fed with PER groups (N = 4). Panel G shows the average search time for novel and familiar objects in the CD-fed (N = 11), HFD-fed (N = 12), and PER-fed (N = 12) groups. Overlaid symbols represent individual data. Mice were 12 weeks old. The HFD-fed and HFD-fed with PER groups were fed either a HFD or a HFD with PER diet from 4 to 12 weeks of age. Panel H shows the interaction time (seconds) in the five trials of the social interaction test on each day of the test in the CD-fed, HFD-fed, and HFD-fed with PER groups. Mice were 16 weeks old, and the HFD-fed and HFD-fed with PER groups were fed either a HFD or a HFD with PER diet from 8 to 16 weeks of age. Data are shown as mean ± SD (*: p<0.05; **: p<0.01, two-tailed t-test). Panels I and J show a representative example of a swim path to the phantom platform (left of the circle) in the probe trial (Panel I) (the end of the trajectory represents the starting point) and the results of a probe trial with a cue manipulation (Panel J).Panel K shows the time to goal in the Morris water maze pattern completion test for the CD-fed, HFD-fed, and HFD-with-PER-fed groups on each test day. Mice were 17 weeks old. The HFD-fed and HFD-with-PER-fed groups were fed either a HFD or a HFD with PER diet from 6 to 17 weeks of age. Figure 3 shows morphological changes in the hippocampus in the HFD-fed and HFD-with-PER-fed groups. Panel A shows coronal sections of the brains of BL / 6 (16 weeks old), the HFD-fed, and the HFD-with-PER-fed groups. Coronal sections were obtained by MRI. White asterisks and diamonds indicate enlargement of the third and both lateral ventricles in the HFD-fed group. The right bar graph shows the average volumes of total intracranial volume (TIV), total brain gray matter (GM), and total brain white matter (WM), as well as the ratios of total brain gray matter (GM) and total brain white matter (WM) to TIV. The left Y-axis shows the TIV volume (mL), and the right Y-axis shows the ratio of GM or WM volume to TIV, respectively. Panel B shows the average volume per TIV for the hippocampal CA1, CA3, DG, and EC. The left and right bar graphs show the results for the left and right hippocampi, respectively. The left Y-axis shows the ratio of GM to TIV (GM / TIV) for CA1, CA3, and DG, and the right Y-axis shows the ratio of GM to TIV (GM / TIV) for EC. Panels C and D show 3D images of the hippocampus from a Thy-1 mouse (17 weeks old). The frame of the cubic box in panel C is 4000 μm long, 3000 μm wide, and 3000 μm high, and each side of the small cube is 400 μm long. Panel D shows the results of observing the CA1, CA3, and DG in the BL / 6, HFD-fed (fed from 4 to 17 weeks of age), and HFD-treated with PER (PER-administered and fed from 4 to 17 weeks of age) groups. The bar graph on the right shows the cell density in the hippocampal CA1, CA3, and DG regions of Thy-1+-FYP mice.Panels E–G show Golgi staining in the CA1 and DG regions (Panel E, upper row) and the percentage of thin, stubby, and mushroom-shaped spines (Panel E, lower row); immunostaining with anti-MAP2, anti-GluA1, and anti-GluA2 Abs (Panel F, upper row); immunoreactive areas with anti-MAP2, anti-GluA1, and anti-GluA2 antibodies and the GluA2 / GluA1 ratio in the hippocampal DG region (Panel F, lower row); and anti-DCX+ staining in the hippocampal DG region of BL / 6, the HFD-fed group, and the fed group with PER (G, left column) and the number of DCX+ positive cells / HFP (G, right column). Bars: 200 μm (E top), 100 μm (E middle), 1 μm (E bottom), 50 μm (F), and 100 μm (G left), 50 μm (G left). Mice were 17 weeks old. The HFD-fed group and the HFD with PER-fed group were fed a HFD or a HFD with PER from 4 to 17 weeks of age. *, **, and *** represent p<0.05, p<0.01, and p<0.001, respectively. Figure 4 shows calcium permeability (CP)-AMPA receptor and NMDA receptor interactions, behavioral function, and brain volume in ob / ob mice. Panel A shows AMPA receptor and NMDA receptor function (calcium transport capacity) in the EC, CA1, CA2, CA3, and DG regions of obese mice (12 weeks old). The increase in normalized 525 following administration of AMPA + CTZ indicates that the AMPA receptor has become calcium permeable, while the lack of change in normalized 525 following administration of NMDA + glycine indicates that the NMDA receptor has been inhibited. Panel B shows the function of AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of ob / ob mice (12 weeks old) that underwent PER from 8 to 12 weeks of age. The lack of change in normalized 525 following administration of AMPA + CTZ indicates that the AMPA receptor has become calcium impermeable, while the increase in normalized 525 following administration of NMDA + glycine indicates that the inhibition of the NMDA receptor has been relieved. Panel C is a graph of the function of AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of ob / ob mice and ob / ob mice administered PER. In FIG. 4, the factors were used at the following concentrations:AMPA: 100 μM; CTZ: 100 μM; NMDA: 50 μM; PER: 100 μM; glycine: 10 μM; and APV: 50 μM. Panel D shows qRT-PCR analysis of RNA expression (AMPAR subunits, NMDAR subunits, ADAR, REST, and RP58) in BL6 / J (N=3, left bar) (12 weeks old), ob / ob (N=3, center bar) (12 weeks old), and ob / ob mice (N=3, right bar) (12 weeks old) subjected to PER. The bottom right panel of panel D shows the Ca2+ permeability index (bottom right column) of the hippocampal regions (CA1, CA2, CA3, DG, and EC) of BL6 / J mice, ob / ob mice, and ob / ob mice receiving PER. Panels E to G show the results of behavioral analysis of ob / ob mice and ob / ob mice receiving PER. Panel E shows the results of the running wheel activity test, panel F shows the results of a five-trial social memory assay, and panel G shows the results of a pattern-completion navigation task. Mice were 11 weeks old, and PER administration was administered from weeks 6 to 11. Data are shown as mean ± SE. Panel H shows the appearance of BL6 and ob / ob mice (top row), gray matter images extracted from T1-weighted images of BL6 and ob / ob mice (middle row), and gray matter volume of BL6 and ob / ob mice (bottom row). Panel I shows the results of Q / R editing analysis in the hippocampal regions (CA1, CA2, CA3, DG, and EC) of ob / ob mice (mouse age: 12 weeks, PER administration: 6 to 12 weeks). The bar graph indicates the ratio of edited to unedited GluA2 subunit molecules. VIC: VIC-labeled probe detecting unedited sequence (Q). FAM: FAM-labeled probe detecting edited sequence (R). Panel J shows the immunoreactive areas and GluA2 / GluA1 ratios for anti-MAP2 Ab, anti-GluA1 Ab, and anti-GluA2 Ab in the hippocampal DG region of ob / ob, ob / ob mice treated with PER for 1 week (1w with PER), and ob / ob mice treated with PER for 12 weeks (12w with PER). *: p<0.05, ***: p<0.001. Figure 5 shows the effect of increasing BMI on fluctuations in memory function and synaptic function in humans. Panel A shows the anatomy of the right hippocampal subregions in T2-weighted images.CA1-CA3, CA4 / DG, and cerebellum (SUB) are shown. Panel B shows the correlation between activation of the right hippocampal CA3 and CA1 during the recognition task (normal weight [n = 84], overweight [n = 27], obese [n = 11]). Panels C and D show the correlation between the BOLD signal percentage in the right hippocampal CA3 and the success rate of the recognition task. Panel D shows the BOLD signal percentage in the bilateral hippocampal CA3 region (52 males, 65 females, total: 117 subjects, mean age = 37.8 ± 19.6 years, range: 18-86 years). Panel E shows the mean success rate of the recognition task. Symbols represent individual data. Panel F shows the correlation between BMI and the success rate in the cognitive task (r = -0.22, p < 0.05), and panel G shows the correlation between BMI and whole-brain gray matter volume (r = -0.28, p < 0.05). Panels H-J show activation maps and BOLD signal changes in the left and right CA3, as well as the success rate in the hippocampal memory task (New, Lure, Same) from left to right in the normal weight group (H), overweight group (I), and obese group (J). Color bars indicate T-values. * indicates p < 0.001. Figure 6 shows the relationship between network connectivity and BMI in humans. Panel A shows DMN maps (top row) and anti-correlation maps to the DMN (bottom row; anti-DMN) in the normal weight, overweight, and obese groups. Color bars indicate T-values. Panel B shows functional network connectivity in the normal weight group (left column), overweight group (center column), and obese group (right column). The diameter of each circle indicates the betweenness centrality value. Panel C shows the mean and standard deviation of the betweenness centrality and degree for each node. a.u.: arbitrary units. Figure 7 shows functional changes in AMPA receptors and NMDA receptors in the HFD-fed group. Panel A shows functional changes (calcium transport ability) in AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of HFD-fed mice (7 days from 16 to 17 weeks of age). Panel B shows the function of AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of the HFD-fed group with PER (7 days from week 16 to week 17).Panel C shows graphs showing the function of AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of the CD-fed group, the HFD-fed group, and the HFD-fed group with PER. *: p<0.05, t-test. Panel D shows the inhibitory effects of 1-naphthylacetylspermine (Naspm) (a selective AMPA receptor antagonist) and GYKI (a selective, noncompetitive AMPA receptor antagonist) in the HFD-fed group (7-day HFD feeding). AMPA: 100 μM, CTZ: 100 μM, NMDA: 50 μM, glycine: 10 μM. Figure 8 shows the effects of Naspm (Ca, NMDA, NMDA) on the hippocampus of ob / ob mice (12 weeks old). 2+Figure 9 shows the inhibitory effects of CTZ (a permeable AMPA receptor [CP-AMPAR] antagonist) and GYKI (a selective, noncompetitive AMPAR antagonist). AMPA: 100 μM; CTZ: 100 μM; Naspm: 20 μM; GYKI: 100 μM. *: p<0.05, t-test. Figure 9 shows the results of behavioral analysis of the open field test (Panels A-C), the elevated plus-maze test (Panels D and E), and the contextual fear conditioning test (Panel F). The total movement time (Panel A), total distance (Panel B), time spent in the center (Panel C), mean time spent (Panel D), mean number of entries into the open and closed arms (Panel E), and mean time spent (Panel F) for the CD-fed group (N = 11), the HFD-fed group (N = 12), and the HFD-fed group with PER (N = 12) are shown. Mice were 12 weeks old, and HFD feeding and HFD with PER feeding were administered from 4 to 12 weeks of age in the HFD-fed group and HFD with PER-fed group. Data are shown as mean ± SD. Symbols overlaid on the bar graphs indicate individual data. Figure 10-1 shows (A) the effects of AMPA receptor antagonists on the function of CP-AMPA receptors and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of ob / ob mice. AMPA: 100 μM; CTZ: 100 μM; NMDA: 50 μM; PER: 100 μM; Glycine: 10 μM; APV: 50 μM; Naspm: 10 μM; GYKI: 100 μM; Leptin: 100 nM. *: p<0.05, t-test. Figure 10-1 shows (B) the effect of leptin on NMDA receptor function in the EC, CA1, CA2, CA3, and DG regions of ob / ob mice with PER, and (C) the effect of leptin on NMDA receptor function in the EC, CA1, CA2, CA3, and DG regions of the HFD-fed group with PER. AMPA: 100 μM; CTZ: 100 μM; NMDA: 50 μM; PER: 100 μM; Glycine: 10 μM; APV: 50 μM; Naspm: 10 μM; GYKI: 100 μM; Leptin: 100 nM. *: p<0.05, t-test. FIG. 11 shows the results of quantitative analysis of the expression levels of MAP2, GluA1, and GluA2 in the CD-fed group, the HFD-fed group, and the HFD-fed group with PER.The green areas were segmented using Zeiss Intellesis image software to show the immunopositive regions for MAP2, GluA1, and GluA2. Bar: 100 μm. The mice were 17 weeks old, and PER administration was performed from 6 to 17 weeks. Figure 12 shows immunostaining images of anti-MAP2 Ab, anti-GluA1 Ab, and anti-GluA2 Ab in ob / ob mice and ob / ob mice administered PER for 1 and 12 weeks. Bar: 100 μm. The mice were 17 weeks old, and PER administration was performed from 6 to 17 weeks. Figure 13 shows the results of quantitative analysis of MAP2, GluA1, and GluA2 expression in ob / ob mice and ob / ob mice administered PER for 1 and 12 weeks. Bar: 100 μm. The mice were 17 weeks old, and PER administration was performed from 6 to 17 weeks. Figure 14 shows the results of anti-DCX+ staining and the number of DCX+ positive cells / HFP in the hippocampal DG region of ob / ob mice and ob / ob mice treated with PER for 1 and 12 weeks. The inset shows DCX+ neuronal progenitor cells. Bars: 100 μm and 20 μm (inset). The mice were 17 weeks old, and PER administration was performed from 6 to 17 weeks. Figure 15 shows gray matter (GM) volume and T-value maps of voxel intensity in the GM region of the dentate gyrus, hypothalamus, somatosensory cortex, and cerebellum of ob / ob mice (11 weeks old) (Panels A and B), and anatomical ROI maps (MRI images) of the hippocampal dentate gyrus, hypothalamus, somatosensory cortex, and cerebellum of CD mice (Panel C). Bars: 1 mm. Figure 16 shows the surface expression and intracellular pool levels of the hippocampal GluA1 subunit in ob / ob mice. Panel A shows the surface expression of GluA1 (top), the intracellular pool level (middle), and the expression level of its internal target, actin (bottom) in ob / ob mice (6-week or 17-week old, or the PER-treated group (PER-treated from 11 weeks of age)). Panel B shows the relative expression level of GluA1 on the cell surface. The relative expression level was normalized by the expression level of actin. Panel C shows the relative expression level of GluA1 in the intracellular pool. Figure 17 shows the relationship between GM volume, body weight, BMI, and age in the whole human brain.Panels A and B show representative T1-weighted coronal images of the normal weight group (Panel A) and the obese group (Panel B). Note that the parietal and temporal lobes bulge outward in the normal weight MRI images, whereas they are recessed in the obese group. Panels C–F show the results of partial correlation analyses between gray matter volume and age (Panel C), BMI and age (Panel D), gray matter volume and weight (Panel E), and BMI and weight (Panel F). Figure 18 shows the relationship between BMI and success rate in the novel task and the lure task. No significant negative correlation was found between BMI and success rate in the novel task (r = −0.05, p = 0.58) and the lure task (r = −0.07, p = 0.43). Figure 19 shows the relationship between MRI volume of each region of the human hippocampus and overweight or obesity. Panels A to C show the averages for the normal weight group (Panel A), overweight group (Panel B), and obese group (Panel C) (*: p<0.05). The dots in the graph represent data for each individual. Figure 20 shows the volume of each region of the hippocampus in CD-fed and ob / ob mice by volumetric analysis using MRI images. Panel A shows the total brain volume of CD-fed and ob / ob mice (13 weeks old). Panel B shows the body weight of CD-fed and ob / ob mice (13 weeks old). Panel C shows the volume of each region of the left hippocampus in CD-fed and ob / ob mice (13 weeks old). Panel D shows the volume of each region of the right hippocampus in CD-fed and ob / ob mice (13 weeks old). Figure 21 shows the levels of R / Q editing of GluA2 in the CD-fed group, HFD-fed group, HFD-fed group with PER, ob / ob mice, and PER-treated ob / ob mice. The level of R / Q editing was calculated as the ratio of the total number of reads aligned to the R / Q editing site of GluA2. BL / 6J mice were 17 weeks old and fed a HFD or a HFD with PER from 16 to 17 weeks or from 6 to 17 weeks. The ob / ob mice were treated with PER from 16 to 17 weeks. Figure 22 shows the quantification of Thy1-YFPH+ cells in the hippocampal CA1 region. Panel A shows an image (10x water-immersion objective) of the whole hippocampus in the CD-fed group (17 weeks old). The voxel size was 4.013 μm in the X axis, 4.013 μm in the Y axis, and 5.016 μm in the Z axis. The boxed area is the excised region. Bar: 400 μm.Panel B shows a panel representation of selected cells. Panel C shows a 3D reconstruction of the excised region. Panel D shows a bob-filtered rendering image (average size: 20 μm, threshold: 5 μm). Figure 23 shows the effect of perampanel administration on cognitive decline in Alzheimer's disease model mice. Figure 24 shows photographs of the external appearance of wild-type mice, ob / ob mice (an obese model), and ob / ob mice administered an AMPA receptor antagonist. Figure 25 shows the effect of AMPA receptor antagonist administration on body weight change in HFD-fed groups with comparable food intake. Figure 26 shows the effect of antiepileptic treatment on the hippocampus and body weight of a 70-year-old woman with a BMI of 38. The woman had an ostium magnum tumor and suffered from quadriplegia and respiratory problems. This shows an MRI image of the brain 26 weeks after tumor removal and oral administration of perampanel (PER) as antiepileptic treatment. The upper photograph shows a T1-weighted coronal section before and after PER administration, the lower left photograph shows a sagittal section enlarged view of the left hippocampus, and the lower right photograph shows a coronal section enlarged view of the left hippocampus. In the lower right photograph, the upper left arrow indicates the CA3 region, the upper right arrow indicates the CA1 region, and the lower arrow indicates the DG / CA4 region. Figure 27 shows the treatment, weight change, and lower limb Fugl-Meyer assessment score (FMA score) change for the 70-year-old woman. After 26 weeks of PER administration, the BMI value decreased to 31. Figure 28 shows that NMDA receptor inactivation in the HFD-fed group is calcium ion-dependent. Figure 29 shows the effect of perampanel (PER) administration on the Aβ42 / Aβ40 ratio in neurospheres established from NL-GF(- / -) mice, an Alzheimer's dementia model. Figure 30 shows the effect of perampanel (PER) administration on Aβ accumulation in neurospheres established from NL-G-F(- / -) mice. Figure 31 shows the effect of perampanel administration on Aβ accumulation in the hippocampal dentate gyrus (DG) CA1 and cerebral cortex (Cx) of Alzheimer's dementia model mice (NL-G-F(- / -)). Figure 32 shows the significant enhancement of epileptiform responses in the CA1 and CA2 regions following administration of bicline (BIC) to NL-G-F(- / -) mice.Figure 33 shows the effect of perampanel administration on bicline-induced epileptiform responses in NL(- / -) mice. Figure 34 shows the effects of memantine administration (mema), exercise load (exercise), and perampanel administration (PER) in a novel object recognition test in NL-G-F(- / -) mice. Figure 35 shows the effects of memantine administration (mema), exercise load (exercise), and perampanel administration (PER) in a fear conditioning test in NL-G-F(- / -) mice. Specific Description of the Invention
[0010] As used herein, a "subject" is a mammal, and may be, for example, a primate, e.g., a human. A human may be, for example, 0 to 10 years old, 10 to 20 years old, 20 to 30 years old, 30 to 40 years old, 40 to 50 years old, 50 to 60 years old, 60 to 70 years old, 70 to 80 years old, and 80 years old or older, as well as any age within the above age ranges. A human may be male or female.
[0011] As used herein, "cognitive function" refers to intellectual functions such as understanding, judgment, and logic, and is understood psychologically to include elements such as perception, judgment, imagination, reasoning, decision-making, memory, and language comprehension. As used herein, "cognitive dysfunction" refers to a disorder (or a decline in function, or a malfunction) in higher brain functions, including judgment, calculation, understanding, learning, orientation, and memory. "Cognitive dysfunction" may be a memory disorder, and in dementia, it may manifest as memory disorders such as forgetfulness (e.g., a decline in working memory and working memory impairment). Cognitive dysfunction is diagnosed in an environment suitable for testing cognitive and memory functions, or in an environment that allows for concentration or dedication.
[0012] As used herein, "treatment" refers to prophylactic and therapeutic treatment. As used herein, "therapeutic treatment" means treating, curing, preventing, or improving the remission of a disease or disorder, or reducing the rate of progression of a disease or disorder. As used herein, "prophylactic treatment" means reducing the likelihood of developing a disease or condition, or delaying the onset of a disease or condition.
[0013] As used herein, the term "therapeutically effective amount" refers to an amount that provides the effect of therapeutic or prophylactic treatment.
[0014] In this specification, the term "NMDA receptor" refers to a type of ionotropic glutamate receptor present in the postsynaptic membrane, and is also called an NMDA glutamate receptor. Ionotropic glutamate receptors present in the postsynaptic membrane are broadly classified into AMPA receptors, kainate receptors, and NMDA receptors based on their pharmacological characteristics. NMDA receptors are thought to be receptors involved in memory, learning, cell death after cerebral ischemia, and the like. Unlike other ionotropic glutamate receptors, NMDA receptors are selectively activated by N-methyl-D-aspartate (NMDA; an NMDA receptor agonist). NMDA receptors are activated by extracellular magnesium ions (Mg 2+ When the postsynaptic membrane is depolarized (for example, the membrane potential is positive or -20 mV or higher, e.g., -20 mV to -10 mV), the inhibition by magnesium ions is released, and the NMDA receptor responds to glutamate in the presence of glycine, and cations (especially calcium ions (Ca 2+ ), potassium ions (K + ), and sodium ions (Na + ) into the cell. Thus, NMDA receptors express channel activity in response to depolarization of the postsynaptic membrane (electrical signal; neural activity at the postsynaptic membrane) and stimulation by glutamate (biochemical signal; neural activity at the presynaptic terminal).
[0015] As used herein, "AMPA receptor" refers to a type of ionotropic glutamate receptor present in postsynaptic membranes, also known as AMPA-type glutamate receptors. AMPA receptors are selectively activated by α-amino-3-hydroxy-5-mesoxazole-4-propionic acid (AMPA; an AMPA receptor agonist). AMPA receptors are tetramers containing any four of four subunits: GluA1, GluA2, GluA3, and GluA4. Each subunit has a glutamate receptor site, and it is believed that channel activity is induced when glutamate binds to two or more of the four subunits. AMPA receptors containing GluA2 are calcium-impermeable, while AMPA receptors without GluA2 are calcium-permeable (hereinafter, calcium-permeable AMPA receptors may be referred to as "CP-AMPA receptors"). The reason why AMPA receptors containing GluA2 are calcium impermeable is because glutamine (Q) in the M2 domain (second hydrophobic domain) of GluA2 is converted to arginine (R). The Q-to-R editing of GluA2 (Q / R editing) is due to editing at the mRNA level (post-transcriptional regulation). Specifically, the Q-to-R conversion occurs when the second base (adenine) in the codon specifying the glutamine in GluA2 mRNA is deaminated by adenine deaminase and converted to inosine, which is then decoded as guanine by tRNA. Because AMPA receptors containing unedited GluA2 are calcium permeable, the calcium impermeability of AMPA receptors is thought to be due to the Q-to-R conversion of GluA2. An example of the nucleic acid sequence of human GluA2 is set forth in SEQ ID NO: 1, an example of the amino acid sequence of unedited human GluA2 is set forth in SEQ ID NO: 2, and an example of the amino acid sequence of edited human GluA2 is set forth in SEQ ID NO: 3. In the above-mentioned Q to R conversion (Q / R editing) of GluA2, Q at position 607 of SEQ ID NO: 2 is converted to R by editing. This site is called the Q / R site of GluA2. Of the glutamate responses, the AMPA receptor component is known to be faster than the NMDA receptor component.Examples of the nucleic acid sequences of human GluA1, human GluA3, and human GluA4 are set forth in SEQ ID NOs: 4, 6, and 8, and examples of the amino acid sequences are set forth in SEQ ID NOs: 5, 7, and 9, respectively.
[0016] As used herein, the term "hippocampus" refers to the cortex located at the base of the inferior horn of the lateral ventricle in the medial part of the temporal lobe of the brain. One hippocampus exists on each side of the brain. The hippocampus is part of the limbic system, known as the hippocampal formation, which is divided into the dentate gyrus, hippocampus, subiculum, presubiculum, parasubiculum, and entorhinal cortex. The hippocampus is also broadly divided into the CA1 to CA3 regions. The hippocampus is thought to be involved in various neuropsychiatric disorders, such as epilepsy and Alzheimer's disease. The hippocampus has the lowest seizure threshold in the brain, and in animal models of epilepsy, much of the electrical activity associated with seizures is recorded from the hippocampus, particularly initiating in the CA2 and CA3 regions. Furthermore, an early symptom of Alzheimer's disease is a loss of the ability to acquire new memories. The entorhinal cortex is where pathology first appears in Alzheimer's disease. In Alzheimer's disease, damage to the entorhinal cortex is thought to deprive the hippocampus of its information processing ability. The hippocampus has a low firing threshold and plays an important role in storing new memories and learning. The hippocampus is vulnerable to hypoxia and ischemia, and hypoxic and ischemic conditions induce neuronal death. Neuronal death is thought to be due to NMDA receptor-mediated excitotoxicity. The hippocampus is thought to be essential for the formation of explicit memories, such as episodic memory. The temporal lobe cortical regions involved in memory formation include the entorhinal cortex, parasubiculum, presubiculum, subiculum, hippocampus (horn of Ammon), and dentate gyrus. Inactivation of NMDA receptors in the hippocampus causes cognitive dysfunction, including memory and learning impairments. Alzheimer's disease includes a state in which there are no clinical symptoms (preclinical Alzheimer's disease) that will eventually progress to Alzheimer's dementia, mild cognitive impairment (MCI) that will progress to Alzheimer's dementia, and Alzheimer's dementia. In Alzheimer's disease, a decrease in Aβ42 levels, an increase in total tau levels, and an increase in phosphorylated tau levels in cerebrospinal fluid can be observed from the preclinical stage of Alzheimer's disease. A decrease in Aβ42 levels in cerebrospinal fluid is thought to reflect the accumulation of Aβ42 in the brain. Increased tau accumulation, neurofibrillary tangles, and neuronal loss can lead to mild cognitive impairment.In mild cognitive impairment, lesions are observed in the area surrounding the hippocampus. In Alzheimer's dementia, lesions also extend to the cerebral neocortex. Alzheimer's dementia is characterized by, for example, the presence of senile plaques and / or neurofibrillary tangles. Alzheimer's dementia can be diagnosed, for example, based on the diagnostic criteria of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) of the American Psychiatric Association. In other words, a diagnosis of Alzheimer's disease can be made if the following are met: A. The criteria for a major neurocognitive disorder are met; B. At least two or more cognitive impairments have an insidious onset and gradual progression; C. There is evidence from family history or genetic testing of a mutation in a gene that causes Alzheimer's disease, or all of the following are met: - A detailed medical history and serial neuropsychological testing show clear evidence of a decline in memory, learning, and other cognitive functions - Cognitive function is steadily deteriorating, with no long-term stable periods - There is no other neurodegenerative disease, cerebrovascular disease, neurological / psychiatric / systemic disease or condition that could be causing cognitive impairment; D. A detailed medical history and serial neuropsychological testing show clear evidence of a decline in memory, learning, and other cognitive functions Cognitive function is steadily deteriorating, with no long-term stable periods
[0017] As used herein, "overweight" refers to a person (particularly men and women aged 18 or older) whose body mass index (BMI) is 25 or more and less than 30. BMI is calculated as weight (kg) / {height (m)} 2The standard BMI for both adult men and women is approximately 22. As used herein, "obese" refers to a person (particularly an adult man or woman) with a BMI of 30 or higher. According to the World Health Organization (WHO) standards, obesity is broadly classified into obesity class I, where the BMI is between 30 and 35, obesity class II, where the BMI is between 35 and 40, and obesity class III, where the BMI is 40 or higher. As used herein, "metabolic syndrome" refers to a BMI of 25 or higher, a waist circumference of 85 cm or higher for men, or 90 cm or higher for women, and two or more of the following conditions (1) to (3) are met: (1) triglycerides are 150 mg / dL or higher, or HDL is less than 40 mg / dL; and (2) systolic blood pressure is 130 mmHg or higher, or diastolic blood pressure is 85 mmHg or higher. (3) Fasting blood glucose level is 110 mg / dL or higher. Childhood obesity can be determined by the obesity level. Specifically, childhood obesity refers to a state in which the obesity level is +20% or higher and the body fat percentage has increased by 25% or more for boys, 30% or more for girls under 11 years old, and 35% or more for girls 11 years old or older. The obesity level (%) is calculated by (current weight - standard weight for that age) / standard weight for that age x 100.
[0018] As used herein, "dyslipidemia" refers to a state in which lipid metabolism, such as triglyceride and cholesterol, is abnormal. Dyslipidemia is broadly classified into hyper-LDL cholesterolemia, hypo-HDL cholesterolemia, and hypertriglyceridemia. The diagnostic criterion for hyper-LDL cholesterolemia may be whether or not the blood LDL cholesterol level is 140 mg / dL or higher. The diagnostic criterion for hypo-HDL cholesterolemia may be whether or not the blood HDL cholesterol level is less than 40 mg / dL. The diagnostic criterion for hypertriglyceridemia may be whether or not the blood triglyceride level is 150 mg / dL or higher.
[0019] As used herein, "cardiovascular disease" refers to a group of diseases in which arteriosclerosis narrows the inner walls of blood vessels, resulting in insufficient blood supply to organs. Cardiovascular disease includes coronary artery disease, stroke, cerebral infarction, myocardial infarction, and peripheral arterial disease. Continuing conditions such as hyperglycemia damage the inner walls of blood vessels, causing cholesterol to accumulate in the vessel walls. Over time, the amount of accumulation increases, narrowing the lumen of the blood vessels and reducing the blood supply. Reduced blood flow to the brain can lead to cerebral infarction, and reduced blood flow to the heart can lead to myocardial infarction. Other conditions that may occur include coronary artery disease and peripheral arterial disease. Risk factors for cardiovascular disease include dyslipidemia and arteriosclerosis.
[0020] As used herein, "diabetes" refers to a disease in which hyperglycemia persists chronically due to insufficient insulin action (e.g., insufficient insulin or insufficient responsiveness to insulin). Diabetes is often accompanied by three major complications: retinopathy, nephropathy, and neuropathy. Diabetes is diagnosed when any of the following conditions (1) to (3) is met, as well as (4): (1) morning fasting blood glucose level of 126 mg / dL or higher, (2) 2-hour value of a 75-g fluorescent glucose tolerance test of 200 mg / dL or higher, (3) blood glucose level measured at any time of day of 200 mg / dL or higher, and (4) HbA1c of 6.5% or higher.
[0021] According to the present specification, it has been found that in the hippocampus of a subject, calcium permeability of AMPA receptors is increased in the presence of glutamate (or AMPA), while activation of NMDA receptors is suppressed in the presence of glutamate (or NMDA). This suppression of NMDA receptor activation is reversed by the use of an AMPA receptor antagonist.
[0022] According to the present disclosure, a pharmaceutical composition for use in treating a disease or condition associated with NMDA unresponsiveness in a subject having glutamate (or NMDA) unresponsive NMDA receptors (hereinafter simply referred to as "NMDA unresponsive") is provided, the pharmaceutical composition comprising an AMPA receptor antagonist. As described below, the hippocampus of an NMDA-unresponsive subject has NMDA receptors that are inhibited in the presence of glycine and NMDA, regardless of the membrane potential of the postsynaptic membrane. Thus, the hippocampus of an NMDA-unresponsive subject has NMDA receptors that are completely or partially inhibited in the presence of glycine and NMDA, regardless of the membrane potential of the postsynaptic membrane. As described below, the inhibition of NMDA receptors can be inhibition of calcium influx into cells via NMDA receptors (and preferably inhibition of an increase in intracellular calcium concentration). Furthermore, as described below, the AMPA receptor in the subject has acquired agonist-dependent calcium permeability. As described below, in certain aspects, the disease or condition associated with NMDA refractoriness can be cognitive dysfunction, including cognitive decline. As described below, cognitive dysfunction can result from overweight or obesity. As described below, cognitive dysfunction can result from Alzheimer's dementia. In an NMDA-refractory subject, the ratio of blood oxygen level-dependent (BOLD) responses during a hippocampal memory task to those at rest (when not performing any task) can be equal to or greater than a first predetermined ratio, as described below. In an NMDA-refractory subject, the ratio of BOLD responses during an event-related memory task to those at rest (when not performing any task) can also be equal to or less than a second predetermined ratio, as described below. An increase in BOLD response suggests synaptic hyperactivity, while a decrease suggests synaptic dysfunction. NMDA refractoriness can be assessed by the unresponsiveness of brain activity to NMDA administration. In living organisms, when performing hippocampal functional tasks using functional magnetic resonance imaging (fMRI), the rate of correct answers decreases and the BOLD signal becomes persistently low, indicating synaptic dysfunction, or the initial dip disappears and the peak of the first positive wave becomes high, indicating synaptic hyperactivity. These can be used as indicators to evaluate functional dysfunction or hyperactivity.
[0023] In addition, as the examples below suggest, in the hippocampus of overweight and obese subjects, the calcium permeability of AMPA receptors is improved under the presence of glutamate (AMPA), while the activation of NMDA receptors is suppressed under the presence of glutamate (NMDA), and there can be abnormalities in the control of AMPA receptors and NMDA receptors.In addition, as the examples below suggest, in the hippocampus of overweight and obese subjects, the NMDA receptors are suppressed to be activated under the conditions that they should be activated, which can damage synaptic plasticity, damage long-term potentiation (LTP) and long-term depression (LTD), and cause cognitive dysfunction.In addition, as the examples below suggest, this suppression of NMDA receptors can be released by using AMPA receptor antagonists to suppress the calcium inflow from AMPA receptors (particularly the calcium-permeable AMPA receptors in hippocampus). Although not wishing to be bound by theory, due to the above-mentioned abnormality in the regulation of AMPA receptors and NMDA receptors in the hippocampus, overweight and obese subjects may have certain cognitive impairments.In the hippocampus of subjects with Alzheimer's disease, the calcium permeability of AMPA receptors is improved in the presence of AMPA, while the activation of NMDA receptors is suppressed in the presence of NMDA.
[0024] According to the present disclosure, there is provided a pharmaceutical composition for use in treating cognitive impairment (including cognitive decline, the same applies hereinafter) in a subject, the pharmaceutical composition comprising an AMPA receptor antagonist.
[0025] Examples of the AMPA receptor antagonist include competitive antagonists and non-competitive antagonists (e.g., allosteric antagonists). In some embodiments, non-competitive antagonists can be preferably used as the AMPA receptor antagonist. Examples of the AMPA receptor antagonist include AMPA receptor selective antagonists (e.g., AMPA receptor selective competitive antagonists and AMPA receptor selective non-competitive antagonists). An AMPA receptor selective antagonist is one that has a stronger inhibitory effect on the AMPA receptor than on other ionotropic glutamate receptors such as NMDA receptors and kainate receptors (e.g., IC50 for AMPA receptors). 50 However, IC for other ionotropic glutamate receptors 50 The term "AMPA receptor antagonist" means 2-fold or less, 3-fold or less, 5-fold or less, 10-fold or less, 30-fold or less, 50-fold or less, 100-fold or less, 300-fold or less, 500-fold or less, 1000-fold or less, 3000-fold or less, 5000-fold or less, or 10000-fold or less of the AMPA receptor. As the AMPA receptor antagonist, an AMPA receptor selective antagonist can be preferably used.
[0026] Examples of AMPA receptor antagonists include, but are not limited to, 2,3-benzodiazepine compounds, 4-(8-chloro-2-methyl-11H-imidazo[1,2-c][2,3]benzodiazepine-6-benzenamine (GYKI47261), 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI52466), and 1-(4-aminophenyl)-3-methylcarbamyl-4-methyl-7,8-methylenedioxy-3,4-dihydro-5H-2,3-benzodiazepine (GYKI53655) (Patternain et al., Neuron 1995, 14:185-189), 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), 6,7-dinitroquinoxaline-2,3-dione (DNQX), 1,4-dihydro-6-(1H-imidazo-1-yl)-7-nitro-2,3-quinoxalinedione (YM90K), (3S,4aR,6S,8aR)-6-(([1H]1,2,4-triazol-5-yl-sulfonyl)methyl)-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline- 3-carboxylic acid (LY302679), LY292025, LY307190, LY280263, LY289178, LY289525, (3S,4aR,6R,8aR)-6-[2-([1H-tetrazol-5-yl)ethyl]-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline-3-carboxylic acid (LY293558), (3SR,4aRS,6SR,8aRS)-6-((1H-tetrazol-5-yl)methyloxymethyl)-1,2,3,4,4a,5,6,7,8,8a-decahydroisoquinoline-3-carboxylic acid (LY294486) (Neuropharmacology, 37:1211-1222, 1998), 9-(1H-imidazol-1-yl)-8-nitro-[1,2,4]triazolo[1,5-c]quinazoline-2,5(3H,6H)-dione (Ro48-8587), N-[3-[[4-[(3-aminopropyl)amino]butyl]amino]propyl]-1-naphthaleneacetamide (Naspm), Oriental spider toxin, 8-methyl-5(4-(N,N-dimethylsulfamoyl)phenyl)6,7,8,9,-tetrahydro-1H-pyrrolo[3,2-h]-isoquinoline-2,3-dione-3-O-(4-hydroxybutyrate-2-yl)oxime (SPD-502), NS-1209 (Neuropharmacology. 61(5-6):1033-47, 2011), talampanel, 1,2-dihydropyridine compounds such as 3-(2-cyanophenyl)-5-(2-pyridyl)-1-phenyl-1,2-dihydropyridin-2-one (perampanel; E2007) (US 6,949,571B), 2,3-dihydroxy-6-nitro-7-sulfamoylbenzo(f)quinoxaline, [1,2,3,4,-tetrahydro-7-morpholin-yl-2,3-dioxo-6-(trifluoromethyl)quinoxalin-1-yl]methylphosphonate, 1-(4-aminophenyl)-4-methyl-7,8-methylene-dioxy-5H-2,3-benzodiazepine, or (-)1-(4-aminophenyl)-4-methyl-7,8-methylene-dioxy-4,5-dihydro-3-methylcarbamoyl-2,3- Benzodiazepines, [7-(1H-imidazol-1-yl)-6-nitro-2,3-dioxo-3,4-dihydroquinoxalin-1(2H)-yl]acetic acid (zonampanel) (WO 96 / 10023), and 2-[N-(4-chlorophenyl)-N-methylamino]-4H-pyrido[3,2-e]-1,3-thiazin-4-one, as disclosed in WO 2003 / 082332 Compounds {e.g., CX516, LU-73068, LU115445, alloracetam, compounds described in WO95 / 12594, Iran Panel, compounds described in WO98 / 17652, LY215490, LY-215490, LY-293558, LY-311446, LY326325, LY-377770, LY-404187, 2-methylsulfonylamino-6,7-Dinitro-2(1H)-quinoxalinone, compounds described in WO97 / 32858, GYKI-47261, compounds described in WO99 / 06408, GYKI52466, GYKI-53655, GYKI152466, talampanel, compounds described in US5639751, RWJ37947, KRP-199, NS-1029, NS229, PN QX, COMP, AMP-397, NNC-07-0775, compounds described in WO96 / 15100, NNC-07-9202, compounds described in EP283959, 2-carboxy-1-methyl-7-trifluoromethylimidazo[1,2-a]quinoxalin-4(5H)-one, compounds described in WO95 / 21842, CNDQ, PD-159265 , PD160725, CP-465022-27, NS-257, PNQX, 1-(4-aminophenyl)-7,8-(methylenedioxy)-3,5-dihydro-4H-2,3-benzodiazepin-4-one, SH-608, ZK-200.755-2, ZK-200775, compounds described in WO99 / 07707, EGIS-9637, EGIS7 444, S-17625, S-347301, S-1746, SYM2189, SYM-2207, SYM2229, SYM2259, SYM2267, YM90K, compounds described in WO92 / 07847, TQX173, kaitocephalin}, and pharmaceutically acceptable salts thereof (salts may include solvates such as hydrates). The AMPA receptor antagonist may be one or more selected from the group consisting of GYKI47261, Naspm, and perampanel.
[0027] In some embodiments, the pharmaceutical compositions of the present disclosure comprise a therapeutically effective amount of an AMPA receptor antagonist. In some embodiments, the pharmaceutical compositions of the present disclosure comprise a therapeutically effective amount of a selective AMPA receptor antagonist. In some embodiments, the pharmaceutical compositions of the present disclosure comprise a therapeutically effective amount of one or more selected from the group consisting of GYKI47261, Naspm, and perampanel.
[0028] In some embodiments, the subject is a human. In some embodiments, the subject is a human (e.g., male or female) aged 18 years or older.
[0029] In some embodiments, the subject is overweight. In some embodiments, the subject is obese. In some embodiments, the subject is in obesity class I. In some embodiments, the subject is in obesity class II. In some embodiments, the subject is in obesity class III.
[0030] In some embodiments, the subject has cognitive impairment (including cognitive decline). In some embodiments, the subject has dementia and is overweight. In some embodiments, the subject has cognitive impairment and is obese selected from the group consisting of obesity classes I to III. In some embodiments, the subject is overweight or obese, and has impaired hippocampal memory function for pattern completion compared to healthy individuals. In some embodiments, the subject has cognitive impairment but is neither overweight nor obese.
[0031] In some embodiments, the cognitive impairment is a memory impairment (including a decline in memory function). In some embodiments, the memory impairment can be a social memory impairment. In some embodiments, the memory impairment can be a decline in pattern completion ability. In some embodiments, the cognitive impairment is a learning impairment (including a decline in learning function). In some embodiments, the memory impairment can be a memory impairment in social memory.
[0032] In some embodiments, the subject has dementia. In some embodiments, the subject has dementia and is overweight. In some embodiments, the subject has dementia and is obese selected from the group consisting of obesity classes I-III. In some embodiments, the subject has dementia but is neither overweight nor obese.
[0033] In some embodiments, the subject has Alzheimer's dementia. In some embodiments, the subject has Alzheimer's dementia and is overweight. In some embodiments, the subject has Alzheimer's dementia and is obese selected from the group consisting of obesity classes I to III. In some embodiments, the subject has Alzheimer's dementia but is neither overweight nor obese. In some embodiments, the patient with Alzheimer's dementia may be a patient with epilepsy. In some embodiments, the patient with Alzheimer's dementia may be a patient without epilepsy. Epilepsy is a disease that causes repeated epileptic seizures, such as sudden loss of consciousness and unresponsiveness.
[0034] In some embodiments, a subject with cognitive impairment has a reduced gray matter volume compared to that of a healthy individual.
[0035] In some embodiments, subjects with cognitive impairment exhibit activation of the central executive network during resting-state brain activity. In some embodiments, subjects with cognitive impairment exhibit connectivity of the central executive network to the default mode network during resting-state brain activity. In some embodiments, subjects with cognitive impairment exhibit activation of the visual network during resting-state brain activity. In some embodiments, subjects with cognitive impairment exhibit activation of the central executive network and activation of the visual network during resting-state brain activity. In some embodiments, subjects with cognitive impairment exhibit connectivity between the salience network and the cerebellar network during resting-state brain activity. The subjects with cognitive impairment may be, in particular, obese or overweight subjects. These networks have been developed as biomarkers of human cognitive function (35). Specifically, these networks can be determined by recording resting-state brain activity using fMRI and analyzing the connectivity of brain activation (35).
[0036] In some embodiments, a subject with cognitive impairment exhibits a ratio change in BOLD response in the CA3 region of the hippocampus equal to or greater than a first predetermined ratio. The first predetermined ratio may be 1.1-fold or greater, 1.11-fold or greater, 1.12-fold or greater, 1.13-fold or greater, 1.14-fold or greater, 1.15-fold or greater, 1.16-fold or greater, 1.17-fold or greater, 1.18-fold or greater, 1.19-fold or greater, or 1.2-fold or greater. The upper limit of the first predetermined ratio may be, for example, 1.3-fold or any of the multiples relative to the first predetermined value set forth above. In some embodiments, a subject with cognitive impairment exhibits a ratio change in BOLD response in the CA3 region of the hippocampus less than a second predetermined ratio. The second predetermined ratio may be 0.9 or less, 0.89 or less, 0.88 or less, 0.87 or less, 0.86 or less, 0.85 or less, 0.84 or less, 0.83 or less, 0.82 or less, 0.81 or less, or 0.8 or less. The lower limit of the second predetermined ratio may be, for example, 0.7 or more, or any of the multiples of the second predetermined values shown above. The change ratio of the BOLD response is determined by measuring the BOLD response using functional MRI (fMRI) under conditions with and without a behavioral task. Examples of behavioral tasks include an event-related memory task. In the event-related memory task, for example, it can be confirmed whether the subject can correctly identify the same image, similar image, and new image as the same image, similar image, and new image, respectively. In the event-related memory task, the correct answer rate can be measured.
[0037] In one embodiment, a subject has inhibited NMDA receptors in at least one or more areas of the hippocampal formation selected from the group consisting of the entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG), thereby inhibiting NMDA-mediated NMDA receptor activation in at least one or more areas of the hippocampus, and the subject has cognitive impairment. Inhibition of NMDA receptors refers to the inhibition of NMDA receptor activation in the presence of glutamate and glycine (and preferably magnesium ions) (i.e., under conditions in which NMDA receptors are activated in physiological environments). Inactivation of NMDA receptors at the time they should be activated can result in memory impairment and learning impairment.
[0038] In the present disclosure, the inhibition of NMDA receptors is based on the acquisition of calcium permeability of AMPA receptors. Also, in the present disclosure, AMPA receptor antagonists are effective in relieving the inhibition of NMDA receptors. By relieving the inhibition of NMDA receptors, the NMDA receptors can regain their original function and improve cognitive impairment. In some embodiments, pharmaceutical compositions containing the AMPA receptor antagonists of the present disclosure can be used in combination with NMDA receptor agonists. Examples of NMDA receptor agonists include rapastinel (PCT / US2017 / 015851).
[0039] Thus, overweight and obese subjects, as well as subjects with cognitive impairment, may have inhibited NMDA receptors in at least one or more regions of the hippocampal formation selected from the group consisting of the entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG), thereby inhibiting NMDA receptor activity by NMDA in at least one or more regions of the hippocampus, and the subject may have cognitive impairment.
[0040] The calcium permeability of AMPA receptors can be improved by reducing the expression level of GluA2 and / or reducing Q / R editing of GluA2. GluA2 undergoes post-transcriptional translation, where glutamine at the Q / R site is converted to arginine (Q / R editing). When Q / R-edited GluA2 is incorporated into the AMPA receptor, it renders the AMPA receptor calcium impermeable. If the incorporation of Q / R-edited GluA2 into the AMPA receptor is inhibited, the AMPA receptor acquires calcium permeability and allows calcium to enter the cell in response to glutamate.
[0041] In one embodiment, the ratio of GluA2 / AMPA receptors in the hippocampus of the subject is decreased compared to that in a healthy subject. In one embodiment, the ratio of unedited GluA2 to total GluA2 in the hippocampus of the subject is increased compared to that in a healthy subject. In one embodiment, the ratio of unedited GluA2 to total GluA2 in the CA2 region of the hippocampus of the subject is increased by a predetermined ratio or more compared to that in a healthy subject. The predetermined ratio may be 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 25-fold or more, 30-fold or more, 35-fold or more, 40-fold or more, 45-fold or more, or 50-fold or more.
[0042] In one aspect, the number of Thy-1-positive neurons is reduced in any region selected from the group consisting of CA1, CA2, and CA3 of the hippocampus of a subject (e.g., the CA3 region) compared to the number of such cells in a healthy subject. In one aspect, the truncation of dendritic networks (specifically, truncation to CA1) is reduced in any region selected from the group consisting of CA1, CA2, and CA3 of the hippocampus of a subject (e.g., the CA1 region) compared to the truncation in a healthy subject. In one aspect, the proportion of immature spines is increased in any region of the hippocampal formation of a subject (e.g., the DG region) compared to the proportion in a healthy subject. An AMPA receptor antagonist can improve these conditions.
[0043] According to the present disclosure, there is provided a pharmaceutical composition for use in inhibiting the suppression of NMDA receptor activation in a subject having a hippocampus that expresses calcium-permeable AMPA receptors, the pharmaceutical composition comprising an AMPA receptor antagonist.
[0044] In subjects with hippocampi expressing calcium-permeable AMPA receptors, intracellular calcium concentration in neurons is elevated. In subjects with hippocampi expressing calcium-permeable AMPA receptors, activation of NMDA receptors is suppressed in the hippocampus. In contrast, AMPA receptor antagonists can inhibit the glutamate-dependent intracellular calcium transport of AMPA receptors and inhibit the suppression of NMDA receptor activation. By inhibiting the suppression of NMDA receptor activation, NMDA receptors can induce glutamate- and membrane potential-dependent activation.
[0045] The pharmaceutical composition of the present disclosure may contain the AMPA receptor antagonist in the form of a pharmaceutically acceptable salt. Pharmaceutically acceptable salts include acid addition salts. Examples of acid addition salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, and phosphate, and organic acid salts such as citrate, oxalate, phthalate, fumarate, maleate, succinate, malate, acetate, formate, propionate, benzoate, trifluoroacetate, methanesulfonate, benzenesulfonate, para-toluenesulfonate, and camphorsulfonate. The pharmaceutical composition of the present disclosure may contain the AMPA receptor antagonist in the form of a prodrug. Prodrugs exert their therapeutic effects in the body by being metabolized in the body. In many cases, prodrugs are prepared by esterifying the carboxyl or hydroxy group. The ester bond is broken down by esterases present in the body, releasing the active compound from the prodrug. The pharmaceutical composition of the present disclosure may further contain pharmaceutically acceptable additives in addition to the AMPA receptor antagonist. Pharmaceutically acceptable additives may include, depending on the purpose, excipients, disintegrants, binders, fluidizing agents, lubricants, coating agents, solubilizers, solubilizers, thickeners, dispersants, stabilizers, sweeteners, flavorings, etc. Specific examples include lactose, mannitol, crystalline cellulose, low-substituted hydroxypropyl cellulose, corn starch, partially pregelatinized starch, carmellose calcium, croscarmellose sodium, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl alcohol, magnesium stearate, sodium stearyl fumarate, polyethylene glycol, propylene glycol, titanium oxide, talc, etc. The pharmaceutical composition of the present disclosure may be formulated for oral or parenteral administration (e.g., intravenous administration, etc.). The dosage form is not particularly limited, and examples include tablets, capsules, powders, granules, liquids, suspensions, injections, patches, and poultices. The administration can be, for example, oral administration or parenteral administration (e.g., intravenous administration, intraventricular administration, intracerebrospinal administration, etc.) The dosage can be, for example, 100 to 2,000 mg per adult.
[0046] In one aspect of the present disclosure, there is provided a method of treating a disease or condition associated with NMDA unresponsiveness in an NMDA-unresponsive subject or a subject having an NMDA-unresponsive NMDA receptor, the method comprising administering to the subject a therapeutically effective amount of an AMPA receptor antagonist, wherein the subject, the NMDA-unresponsiveness-associated disease or condition, and the AMPA receptor antagonist may each be as described above.
[0047] In one aspect of the present disclosure, there is provided a method of treating cognitive impairment in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an AMPA receptor antagonist, wherein the subject, the cognitive impairment, and the AMPA receptor antagonist may each be as described above.
[0048] In one aspect of the present disclosure, there is provided a method for inhibiting the suppression of NMDA receptor activation in a subject having a hippocampus that expresses calcium-permeable AMPA receptors, the method comprising administering to the subject an effective amount of an AMPA receptor antagonist, wherein the subject, the cognitive impairment, and the AMPA receptor antagonist may each be as described above.
[0049] In some aspects of the present disclosure, there is provided a method for treating a subject with obesity or overweight, comprising administering to the subject an effective amount of an AMPA receptor antagonist. The effective amount can be an amount that can delay, stop, or ameliorate the progression of obesity or overweight. In some aspects of the present disclosure, the subject can be a subject who is on a restricted diet. In some aspects of the present disclosure, the subject can be a subject who is not on a restricted diet. In some aspects of the present disclosure, the subject is not on or is not on a diet. In some aspects of the present disclosure, the subject is on or is on a diet. In some aspects of the present disclosure, cognitive impairment can be improved in the subject. In some aspects of the present disclosure, obesity or overweight can be improved in the subject.
[0050] In certain aspects of the present disclosure, a method for treating a subject with Alzheimer's dementia is provided, comprising administering a therapeutically effective amount of an AMPA receptor antagonist to the subject. In certain aspects of the present disclosure, a method for treating Alzheimer's dementia in a subject in need thereof is provided, comprising administering a therapeutically effective amount of an AMPA receptor antagonist to the subject. The subject may, for example, be a subject with preclinical Alzheimer's disease. The subject may, for example, be a subject with Aβ accumulation in the brain. Aβ accumulation can be assessed by positron emission tomography (PET). The subject may, for example, be a subject with a decreased Aβ42 level, an elevated total tau level, or an elevated phosphorylated tau level in the cerebrospinal fluid. These levels can be examined, for example, using an antibody or the like. The subject may, for example, be a subject with mild cognitive impairment, moderate cognitive impairment, or severe cognitive impairment. The subject may be a subject with neurodegeneration in the hippocampus. The subject may be a subject with neurodegeneration in the cerebral neocortex. The subject can be, for example, a subject with tau accumulation in the brain, which can be assessed by PET.
[0051] In certain aspects of the present disclosure, there are provided AMPA receptor antagonists for use in the above-described methods. In certain aspects of the present disclosure, there may be provided pharmaceutical compositions comprising the AMPA receptor antagonists for use in the above-described methods.
[0052] In some aspects of the present disclosure, there is provided the use of an AMPA receptor antagonist in the manufacture of a medicament for treating a disease or condition associated with NMDA unresponsiveness in an NMDA unresponsive subject.In some aspects of the present disclosure, there is provided the use of an AMPA receptor antagonist in the manufacture of a medicament for treating cognitive dysfunction in a subject in need thereof.In some aspects of the present disclosure, there is provided the use of an AMPA receptor antagonist in the manufacture of a medicament for inhibiting the suppression of NMDA receptor activation in a subject with a hippocampus that expresses calcium-permeable AMPA receptors.The subject, cognitive dysfunction, and AMPA receptor antagonist can each be as described above.
[0053] The AMPA receptor antagonist can be used in combination with memantine.Memantine can be in the form of an addition salt, for example, in the form of an acid addition salt, and preferably in the form of hydrochloride.Therefore, memantine can be used in combination, for example, as memantine hydrochloride.In an aspect of the present disclosure, a combined pharmaceutical product comprising an AMPA receptor antagonist and memantine is provided.In an aspect of the present disclosure, a combined pharmaceutical product is provided, comprising a pharmaceutical composition comprising an AMPA receptor antagonist and a pharmaceutical composition comprising memantine.The combined pharmaceutical product can be used to treat cognitive dysfunction.
[0054] Animals: Male C57BL / 6J background mice and ob / ob mice were obtained from CLEA Japan Inc. and Japan SLC, respectively (3). Female mice were selected because male mice have been reported to be more susceptible to the effects of a high-throughput diet (HFD), including weight gain, metabolic changes, and impaired learning and hippocampal synaptic plasticity. These animals were housed in a room with a standard 12-hour dark-light cycle at 25°C, with three to four animals per cage, and provided with food and water ad libitum. All animal experiments were conducted in accordance with the guidelines of the University of the Ryukyus' Animal Experiment Ethics Committee. Time-course changes in average food intake and average body weight were monitored in each condition. Human amyloid precursor protein knock-in (APP-KI) mice were kindly provided by Dr. Takaomi Nishido of the RIKEN Institute. These mice carry the Swedish KM670 / 671NL mutation (NL), the Arctic E693G mutation (G), and the Iberian I716F (F) mutation (F) in the human APP gene. NL mice with one mutation and NL-GF mice with all mutations were used in the experiment. Both of these mice produce human amyloid beta (Aβ)40 and Aβ42 oligomers (Saito et al., Single App knock-in mouse models of Alzheimer's disease. Nat. Neurosci. 2014 17,661-4). The knock-in mice show accumulation of Aβ in the brain after 2 months (8 weeks).
[0055] Control and High-Fat Diets. The control diet (CD) for mice was the CE-2 diet (CLEA Japan, Inc., Tokyo, Japan). The composition of the CE-2 diet is shown in Table 1. The total energy of the CE-2 diet was 339.1 kcal / 100 g, with a crude fat content of 4.61%. The high-fat diet (HFD) was the F2HFD2 diet (Oriental Yeast Co., Ltd., Tokyo, Japan). The total energy of the F2HFD2 diet was 640 kcal, consisting of 58% (wt / wt) lard, 30% fish meal, 10% skim milk, and 2% vitamin and mineral mixture (corresponding to 7.5% carbohydrate, 24.5% protein, and 60% fat) (7). The other components of the F2HFD diet were the same as those of the CE-2 diet. A group of 4-week-old mice was administered the HFD (F2HFD2 diet). Control mice were fed a low-fat diet (CE-2 diet).
[0056]
[0057] Oral administration of perampanel (PER) HFD mice were given HydroGel (Clear H 2 The ob / ob mice were orally administered PER at a dose of 5 mg / kg body weight (HFD-treated group with PER). The ob / ob mice were fed a CE-2 diet (CLEA Japan, Tokyo). HFD mice and ob / ob mice, one per cage, were orally administered PER at a dose of 5 mg / kg body weight (HFD- and ob / ob-treated groups). Body weight and HydroGel intake were monitored twice weekly in both groups, and the PER dose was adjusted to 5 mg / kg body weight.
[0058] Wheel activity: The activity of individual mice was monitored using a wheel cage (MELQUEST, Japan, Model RWC-15). Wheel rotation was monitored and recorded every 10 min for 14 days as previously reported (45).
[0059] Open-field test and elevated plus-maze. The open-field test was performed as follows: Mice were allowed to move freely for 5 min in a space surrounded by 50 cm square, 40 cm high walls (Muromachi Kikai, Japan), and their trajectories were analyzed using a CompACT VAS / DV video tracking system (Muromachi Kikai, Japan) (46). The elevated plus-maze test was performed as follows: The space, set up 50 cm above the floor, consisted of two open arms, two closed arms (30 cm × 6 cm each), and a neutral zone. Mice were placed in the center of the neutral zone facing the closed arms and allowed to move freely for 3 min. The time spent in the open and closed arms and the frequency of visits to different arms were recorded and scored using a CompACT VAS / DV video tracking system (Muromachi Kikai, Japan).
[0060] Novel Object Recognition Test. CD, HFD, and HFD with PER treatment (HFD with PER) mice were handled for 5 min each day for 5 days prior to the start of the novel object recognition test. PER stands for perampanel, an AMPA receptor antagonist. On day 1, mice were allowed to habituate to a 35 cm square, 25 cm high box for 10 min. On day 2, they were given two identical objects (familiar objects) for 10 min. On day 3, one of the familiar objects was replaced with a novel object with a different shape and color (Figure 2F). Mouse behavior was observed for 5 min with a video camera, and the video was digitized and stored on a computer. The exploration time for each object was measured offline (47).
[0061] Morris Water Maze. Memory impairment was assessed using the Morris water maze test as previously described (48). Briefly, a 120-cm diameter water maze pool (Muromachi Kikai, Tokyo, Japan) contained opaque water (room temperature) and a platform (10 cm diameter) submerged 2 cm below the water surface. The hidden platform task was performed twice daily for 4 to 7 days (3-h intervals), with two trials per day (15-min intervals). The platform location was kept constant, and the entry point was changed semi-randomly between trials. 24 h after the final day of the hidden platform task, a 1-min probe trial without the platform was conducted. The entry point for the probe trial was set in the quadrant opposite to the target quadrant. Memory retention was assessed by the time spent in the correct quadrant containing the escape platform during the hidden platform task. Performance was monitored using the CompACT VAS / DV video tracking system.
[0062] Pattern Completion Test-Mediated Contextual and Spatial Recall. The Morris water maze task was performed as previously described (49) using mice on CD, HFD, and HFD with PER treatment. All experiments were conducted at approximately the same time of day. Mice were transported from the colony to the vivarium and allowed to remain undisturbed for 30 min before the experiment. Testing was conducted in a rectangular, dimly lit room equipped with a 120 cm diameter circular pool (Muromachi Kikai, Tokyo, Japan) filled with opaque water (Morinaga, Japan) kept at room temperature. Four large objects, illuminated by floor lamps, were suspended from a black curtain surrounding the pool as extramaze cues. A hidden circular platform, 1 cm in diameter, was placed 1 cm below the water surface, and mice were trained to find the platform four times a day at approximately 60-min intervals for 12 days. During training, mice were released from four pseudorandomly assigned starting points (N, S, E, and W) and allowed to swim for 300 s. Mice that failed to find the platform within 300 seconds were manually guided to the platform and allowed to rest on it for 15 seconds. On day 13, a probe trial (P1) was conducted under full-cue conditions. Mice were released into the center of the pool and allowed to swim for 300 seconds without the platform. Following the probe trial, four training trials were conducted in the presence of the platform to avoid memory loss that may have occurred during the probe trial. Four probe trials were then conducted once a day, each with additional maze cues. No retraining was allowed between probe trials. In the one-cue probe trial (P2), one cue located farther from the platform was retained, and the other three cues were removed from the surrounding curtain. In the two-cue probe trial (P3), one cue located closer to the platform and the cue used in the one-cue probe trial were retained, and the other two cues were removed from the surrounding curtain. In the no-cue probe trial (P5), all four extra maze cues were removed. Data from the training and probe trials were collected and analyzed using CompACT VAS / DV video tracking system software.The latency to escape to the hidden platform (goal arrival latency) was measured.
[0063] Five-Trial Social Memory Assay. The five-trial social test was performed as previously described (19). Briefly, CD, HFD, and HFD with PER treatment control mice were individually housed for 7 days prior to testing to establish territorial dominance. On the day of testing, a female mouse was presented in the cage of a male control mouse (Figure 2G), and four consecutive 5-min trials were conducted with a 10-min interval. In the fifth trial, a novel female mouse was presented (Figure 2G), and the duration of social investigation was recorded.
[0064] Contextual fear conditioning was performed using a published protocol with minor modifications (50). Mice were transferred to the animal laboratory and allowed to acclimate for at least 30 min before contextual fear conditioning training. Next, mice were placed in a footshock system model MK-450MSQ (Muromachi Kikai Co., Ltd., Japan) and allowed to explore for 2 min, after which three electric footshocks (0.8 mA, 2 s, 2 min intervals) were administered. After an additional 1 min, the animals were removed.
[0065] Acquisition of Mouse MRI Data Anatomical brain images of eight ex vivo mice with CD, HFD, and PER treatments were acquired using a Bruker BioSpec 117 / 11 11.75 Tesla MRI scanner (Bruker BioSpin GmbH, Ettlingen, Germany). A three-dimensional (3D)-prepared rapid gradient-echo (MPRAGE) sequence was acquired as a high-resolution 100-μm isovoxel image for voxel-based morphometry (matrix size: 280 × 220 × 220; field of view: 28 × 22 × 22 mm; repetition time: 2000 ms; echo time: 1.78 ms; flip angle: 12°; inversion time: 800 ms; echo train length: 13; average number: 2). A rapid acquisition protocol by relaxation enhancement (RARE) sequence was used to draw regions of interest on the acquired data images (matrix size: 280 × 220 × 220, field of view: 28 × 22 × 22 mm; repetition time: 1500 ms; echo time: 25 ms; flip angle: 180°). MPRAGE and RARE images were acquired simultaneously in a single scan. Ex vivo mouse MRI data were acquired by placing the heads of four mice immobilized in PBS simultaneously in the MRI coil. The brains of the four mice were identified using raw MRI data.
[0066] Image preprocessing and estimation for voxel-based morphometry analysis. Voxel-based morphometry (VBM) analysis and preprocessing of MPRAGE and RARE images were performed using the SPM8 analysis tool (Wellcome Department of Clinical Neurology, London; http: / / www.fil.ion.ucl.ac.uk) and the SPMMose toolbox (http: / / www.spmmose.org / ). The raw data were segmented into four mouse head MRI images and saved separately. The 3D (x-y-z) coordinates of the segmented images were transformed into the SPM standard coordinate system, with the bregma point as the origin of the 3D coordinates. Next, brain images were segmented into gray matter (GM), white matter, and cerebrospinal fluid (CSF) using the segmentation tool (installed in the SPM8 system). GM images were then segmented using the tissue probability map in the SPMMouse toolbox. These segmented GM images were then subjected to contrast enhancement and image deformation normalization. Finally, these images were smoothed using a 200 μm isotropic Gaussian kernel (installed in the SPM8 system). The smoothed images were then subjected to VBM analysis. The volumes of hippocampal subfields (CA1, CA2, CA3, DG, and EC) were calculated using the ROI files (31, 33, 51, 52). Differences between the mean values of whole-brain volumes in CD, HFD, and HFD with PER treatment were tested by one-way analysis of variance (ANOVA). If ANOVA revealed significant differences among the three groups (p<0.05), Scheffe post hoc analysis (Scheffe) was performed between the CD group and the HFD group; the CD group and the HFD group with PER treatment; and the HFD group and the HFD group with PER treatment.
[0067] Human Subjects: Participants in this study were 117 healthy volunteers (mean age 37.8 ± 19.6 years, 65 women and 52 men) and five patients with benign tumors (mean age 55.5 ± 9.6 years, 2 women and 3 men). All participants provided written consent to participate in the study and underwent an event-related memory task and T1-weighted MRI scans at 3T. Participants were divided into three groups based on WHO body mass index (BMI): normal weight (BMI < 25), overweight (BMI ≥ 25 and < 30), and obese (BMI ≥ 30). The normal weight group consisted of 84 participants (mean BMI 20 ± 1.8), the overweight group of 27 participants (mean BMI 26 ± 1.2), and the obese group of 11 participants (mean BMI 32 ± 2.3). All experiments were approved by the University of the Ryukyus Ethics Committee for Human Medical and Health Research.
[0068] Behavioral Task Paradigm: Details of the fMRI experiment for the event-related memory task used in this study have been described previously (32). The memory task consisted of 108 photographs: 16 lure sets (similar images), 16 repeat sets (same images), and 44 novel items (new images). Participants were instructed to respond by pressing a button to indicate whether the photographic stimuli displayed on the display were new items (new), repeated identical photographs (same), or photographs that were similar but not identical to the previous photograph (similar; lure). The subjects' button presses during the memory task were recorded on a personal computer, and the correct response rates for new, same, and lure were calculated. The correct response rates for each task (new, similar, and same) were calculated using the following formula: Correct answer rate (%) = number of correct answers for presented tasks / total number of presented tasks × 100 In this experiment, the total number of tasks presented for new stimuli was set to 76, and the total number of tasks presented for the same stimuli and lure stimuli was set to 16.
[0069] Functional MRI data acquisition for behavioral tasks. Functional and structural brain images were acquired using a 3T MRI (Discovery MR750; General Electric, Milwaukee, WI). Functional images for measuring BOLD contrast were acquired using echo-planar imaging (EPI, repetition time: 1500 ms, echo time: 25 ms, flip angle: 70°, matrix size: 128 × 128, field of view: 192 × 192, in-plane resolution: 1.5 × 1.5 mm). 2 Anatomical brain images were acquired using a three-dimensional (3D) spoiled gradient-recalled echo (SPGR) sequence (1 mm slice thickness in the sagittal plane, matrix size: 256 × 256, field of view: 256 × 256 mm, repetition time: 6.9 ms, echo time: 3 ms, flip angle: 15°). To visualize the hippocampal structure and to coregistrate the 3D SPGR images with the EPI functional images, a high-resolution T2-weighted fast spin-echo sequence (matrix size: 512 × 512, field of view: 192 × 192 mm, repetition time: 4300 ms, echo time: 92 ms, in-plane resolution: 0.375 × 0.375 mm) was used. 2 , 23 slices, thickness: 3 mm, spacing: 0 mm) were acquired.
[0070] Image processing of behavioral task fMRI. Functional image preprocessing was performed using SPM 12, including realignment, temporal correlation, spatial normalization, and spatial smoothing. Based on a hippocampal atlas (Duvernoy), the subregions of the hippocampus (CA3, CA1, DG) and the peripapillary regions (parahippocampal gyrus, perihippocampal cortex, and entorhinal cortex) were hand-drawn using a pen tablet on high-resolution coronal T2-weighted images. The percentage signal change in the BOLD response in each subject's hippocampal region was extracted using the MarsBar toolbox. 3D-SPGR images were used for voxel-based morphometry analysis. T1-weighted images were segmented into GM, white matter, and cerebrospinal fluid images using the SPM 12 segmentation tool. The volume of the GM throughout the brain was calculated after spatial normalization and adjustment of the GM images.
[0071] Image Acquisition for Functional Connectivity Analysis. MRI data were acquired using a GE Medical Discovery MR 750 3T scanner (equipped with a 32-channel head coil). Subjects lay supine on the scanner bed, with their head and neck immobilized using foam padding and a Philadelphia neck collar to minimize head movement. Resting-state fMRI images were acquired using a single-shot whole-brain EPI sequence (42 axial slices, 4 mm thickness, no interslice gap, 2000 ms repetition time, 30 ms echo time, 70° flip angle, 64 × 64 matrix size, 256 × 256 field of view). A total of 150 volumes were acquired per session. Anatomical brain images were acquired using a T1-weighted sagittal 3D SPGR sequence.
[0072] Data Preprocessing and Analysis for Functional Network Analysis. Image preprocessing and functional network analysis were performed using SPM12 and CONN toolbox 18.b (www.nitrc.org / projects / conn, RRID: SCR_009550 [Whitfield-Gabrieli and Nieto-Castanon, 2012]). Details were as previously described (32). Images were preprocessed in the following order: realignment, slice timing correction, coregistration, normalization, smoothing, and segmentation. Noise in the BOLD signal was removed by linear regression of potential confounding effects in the BOLD signal and temporal band-pass filtering (for temporal frequencies below 0.008 Hz or above 0.09 Hz). The default mode network (DMN) and functional connectivity were analyzed using the CONN toolbox. First, regions with positive correlations with BOLD fluctuations in the posterior cingulate cortex (PCC) and precuneus were calculated as DMN maps. Next, regions with negative correlations with the DMN maps were calculated as anti-correlated DMN maps. Mean images of the DMN and anti-correlated DMN maps for normal weight, overweight, and obese subjects were calculated using a one-sample t-test (voxel-level threshold p<0.001 (uncorrected) and cluster-level false discovery rate [FDR] threshold p<0.05 (corrected)). For functional connectivity analysis, graph theory parameters, node and edge, were calculated. Correlation coefficients of BOLD signal fluctuations between each ROI were calculated using a seed-based connectivity measurement method (53) using a 132 × 132 ROI map (the default ROI atlas in the CONN toolbox). The ROI-to-ROI degree (the number of edges a given node has between each other) and betweenness centrality (the number of shortest paths of vertices passing through any pair of nodes (j, i) in the graph) were calculated using a 132 × 132 ROI correlation matrix established using our 132 × 132 ROI map. Degree is defined at each node as the number of edges from / to each node.The degree (di) is defined by the following formula:
[0073]
[0074] Here, A i,j represents the correlation between ROIs in a 132 × 132 matrix. i = 1, 2, 3..., 132; j = 1, 2, 3..., 132 Betweenness centrality (BC i ) represents a hub that connects other functional modules and nodes (54), and BC i is defined as follows:
[0075]
[0076] Here, P j,k is the number of nodes in the shortest path between each pair of nodes (k, j) (the shortest path when passing through any node defined with i as a variable), and N is the total number of nodes in the graph of the ROI map.
[0077]
[0078] The mean values and edge counts for each node were calculated for the normal weight, overweight, and obese groups. In addition to the PCC and precuneus in the DMN, the anterior cingulate cortex, cerebellar lobule Crus I, and the hippocampus, which is associated with memory function, were set as regions of interest as previously reported (32), and functional connectivity of the three groups was analyzed. Functional connectivity maps for each group were visualized using BrainNet viewer (https: / / www.nitrc.org / projects / bnv / ) (55).
[0079] Ca in brain slices 2+Imaging. Hippocampal brain slices were prepared from 17-18 week-old male C57BL / 6J background mice. Mice were divided into CD, HFD, and HFD with PER treatment (HFD with PER) groups, or 12-13 week-old ob / ob mice were divided into ob / ob and PER-treated ob / ob groups, according to previous reports (56, 57). Slices (300-400 μm thick) were cut using a linear slicer (PRO 7N, Dosaka EM, Japan). The hippocampal brain slices were then placed in a standard Krebs Ringer buffer (125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaHCO3). 2 P.O. 4 , 26mM NaHCO 3 , 2 mM CaCl 2 , 1 mM MgCl 2 , mixed gas [95% O 2 5% CO 2 The cells were incubated in a 500-mL PBS containing 1000 mM NaCl (continuously bubbling with 1000 mM NaCl) at room temperature for 60 minutes to recover from the cleavage damage. 2+ The indicator Fluo-3 AM (excitation wavelength: 508 nm, emission wavelength: 525 nm, Kd: 0.4 μmol / L) (5 μM) (Dojindo, Kumamoto, Japan) was loaded into the brain slices for 90 minutes. 2+ ] iTo monitor the Ca signal, Fluo-3 fluorescence intensity (F525) was monitored using a photomultiplier tube under a confocal microscope (excitation wavelength 488 nm; LSM5 PASCAL, Carl Zeiss, Germany). In this experiment, Ca imaging of whole hippocampal slices was performed using a low-magnification (2.5x) objective lens (FLUAR 2.5x, NA = 0.12, Carl Zeiss, Germany) (Fig. 1). Fluo-3 fluorescence images (512 × 512 pixels) were digitized and stored on a personal computer every 10 seconds for 50 minutes. The F525 values in the CA1, CA2, CA3, DG, and EC regions were normalized (NF525) to the mean F525 values (0 to 5 min before AMPA or NMDA application) during offline analysis (Microsoft Excel, Microsoft Corporation, WA). During Ca imaging, brain slices were maintained in a buffer containing 125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaHCO3, and 1.25 mM NaHCO3. 2 P.O. 4 ,26mM NaHCO 3 , 2 mM CaCl 2 , 1 mM MgCl 2 The extracellular solution containing 1 μM tetrodotoxin was perfused in a perfusion chamber (35 mm μ-dish, Ibidi GMBH, Graefelfing, Germany) under a mixed gas (95% O 2 5% CO 2 The blood was perfused at 2 mL / min while continuously bubbling with MgCl. 2 The concentration of Mg in NMDAR 2+The concentration was set to 0 mM to prevent neurotransmitter-dependent inhibition (58). Maximum NF525 was estimated as the maximum NF525 value within 5 min after application of AMPA (Tocris, Bristol, UK) (100 μM) or NMDA (Tocris, Bristol, UK) (50 μM). Cyclothiazide (CTZ) (100 μM) was used to prevent AMPAR desensitization, and glycine (Tocris, Bristol, UK) (10 μM) was used to activate NMDAR. Perampanel (Eisai Co., Ltd., Tokyo, Japan) (100 μM), GYKI47261 (Tocris, Bristol, UK; hereinafter, also referred to simply as "GYKI") (100 μM), or (2R)-amino-5-phosphonovaleric acid (APV) (Tocris, Bristol, UK) (50 μM) was used as an antagonist of AMPAR or NMDAR, respectively. 2+ 1-Naphthylacetylspermine (NAASPM) (Tocris, Bristol, UK) (20 μM) was used as an antagonist of permeable AMPAR (59).
[0080] B.S. 3 Surface AMPAR subunits cross-linked with BS 3 The crosslinking procedure was performed based on a previously described method (60). Hippocampal slices from 17-18 week-old male C57BL / 6J background mice (CD, HFD, and HFD with PER treatment) or 12-13 week-old ob / ob mice (ob / ob and ob / ob with PER treatment) were prepared as previously described (56, 57). After preparing and collecting the hippocampal slices, the CA1, CA2, CA3, DG, and EC regions were isolated from the hippocampal slices using a dissection knife. The CA1, CA2, CA3, DG, and EC regions were isolated using 2 mM BS. 3The resulting solution was added to an Eppendorf tube (Eppendorf, Hamburg, Germany) containing ice-cold artificial cerebrospinal fluid (ARTCEREB; Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with HCl (Thermo Fisher Scientific, Wilmington, DE, USA). Incubation was carried out on ice for 30 minutes. Crosslinking was terminated by quenching the reaction with 100 mM glycine (10 minutes at 4°C). Hippocampal subregions were resuspended in ice-cold lysis buffer containing protease and phosphatase inhibitors (25 mM HEPES, pH 7.4, 500 mM NaCl, 2 mM EDTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 20 mM NaF, 1 mM sodium orthovanadate, 10 mM sodium pyrophosphate, 1x protease inhibitor mix [Sigma-Aldrich, St. Louis, MO], and 0.1% Nonidet P-40 [v / v]) and rapidly homogenized by sonication for 5 s. Total protein concentration of the lysates was determined using the Lowry method (61). Samples were aliquoted (approximately 15 portions per mouse) and stored at -80°C for later analysis. 3Samples were analyzed directly by SDS-PAGE without purification, and surface and intracellular bands were measured in the same lane, eliminating the need for normalization and increasing sample throughput. Total protein lysates (40 μg) were loaded and electrophoresed on a 5%-10% Tris-HCl gel (Thermo Fisher Scientific, Wilmington, DE) under reducing conditions. Proteins were transferred to nitrocellulose membranes (Thermo Fisher Scientific, Wilmington, DE) for immunoblotting. The membranes were blocked with Blocking One (Nacalai Tesque, Tokyo, Japan) for 30 minutes at room temperature. The membrane was then incubated overnight at 4°C with anti-GluA1 (1:1000, Merck Millipore, Burlington, MA) and actin (1:5000, Protein Teck, Chicago, IL, USA). The membrane was then incubated with HRP-conjugated anti-rabbit IgG (1:3000, Cell Signaling Technology, Danvers, MA, USA) for 30 minutes and washed extensively again with TBS-T. After immersing the membrane in the chemiluminescent detection substrate Chemi-Lumi One (Nacalai Tesque, Tokyo, Japan) for 1 minute, luminescence was detected using a LuminoGraph1 imaging system (Atto, Tokyo, Japan). The surface and intracellular bands in each lane were analyzed using a CS Analyzer (Atto, Tokyo, Japan).
[0081] Hippocampal slices from 17-18 week-old male C57BL / 6J background mice (CD, HFD, and HFD with PER treatment) or 12-13 week-old ob / ob mice (ob / ob and ob / ob with PER treatment) were prepared as previously described (56, 57). After hippocampal slice preparation and collection, the CA1, CA2, CA3, DG, and EC regions were isolated from the hippocampal slices using a dissection knife from the 57BL / 6J background mice and ob / ob mice, respectively. The CA1, CA2, CA3, DG, and EC regions of mice were isolated and immediately lysed in disposable homogenizing tubes (BioMasher 2™, Nippi, Tokyo, Japan) using 0.5 mL of TRIzol RNA isolation reagent (Thermo Fisher Scientific, Wilmington, DE). Total RNA was extracted from each region individually according to the remaining protocol provided by the manufacturer (Thermo Fisher Scientific, Wilmington, DE). One μg of total RNA was reverse transcribed using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan). An aliquot of the resulting cDNA was diluted 1:10 and added to a master mix of TB Green Premix ExTaq (Takara, Shiga, Japan). Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. The real-time PCR conditions were as follows: 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 34 seconds. Fluorescence intensity was measured at each annealing step, and the threshold cycle time was determined using the 7500 software. Furthermore, the relative β-actin expression levels were normalized to the respective control (vehicle group). The relative expression levels of the target genes in each sample were determined using a standard curve and further normalized to the β-actin expression level of the same sample.The primer and probe sequences for these genes are shown in Supplementary Table 2. The ratio of GluA2 mRNA amount / (GluA1 + GluA3 + GluA4 mRNA amount) was calculated as Ca. 2+ This was used as a permeability index.
[0082]
[0083] Sanger sequencing: A template for Sanger sequencing of the GluA2 editing site was prepared by amplifying cDNA using the forward primer (GAGGAATTTGAAGATGGAAGAGA; SEQ ID NO: 44) and the reverse primer (AGGAGGAGATGATGATGAGGGT; SEQ ID NO: 45). The PCR product (10%) was confirmed by agarose gel electrophoresis. After confirming the appropriate expected size, the PCR product was purified using the innuPREP PCRpure Lite Kit (Analytik Jena, Jena, Germany) according to the manufacturer's instructions prior to direct sequencing. Cycle sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and the primers described above. Sanger sequencing analysis was performed using an ABI3500 (Applied Biosystems, CA, USA) and the sequence viewer software 4Peaks.
[0084] Editing Assay The Q / R editing status of GluA2 was determined using QuantStudio with TaqMan™ custom SNP genotyping assays (Thermo Fisher Scientific, Wilmington, DE). TMAnalysis was performed using a 3D digital PCR system. TaqMan probes were synthesized by Thermo Fisher Scientific. A VIC-labeled probe was used to detect the unedited (Q) sequence, and a FAM-labeled probe was used to detect the edited (R) sequence (5' CATCCTTGCTGCATAAA 3': SEQ ID NO: 46, 5' ATCCTTGCCGCATAAA 3': SEQ ID NO: 47, respectively). The following amplification primer pair was used for PCR reactions: mouse forward primer: 5' TTGGGATTTTTAATAGTCTCTGGTTTTCCTT 3' (SEQ ID NO: 48) and mouse reverse primer: 5' GACCAACCTTGGCGAAATATCG 3' (SEQ ID NO: 49). 5-50 ng of cDNA was mixed with Digital PCR Master Mix (Thermo Fisher Scientific, Wilmington, DE), and the mixed TaqMan probes were loaded onto the QuantStudio PCR kit using an automated chip loader according to the manufacturer's instructions. TM The samples were loaded onto a 3D Digital PCR 20K chip (Thermo Fisher Scientific, Wilmington, DE, USA). The loaded chip was amplified using a Gene Amp 9700 PCR system (Thermo Fisher Scientific, Wilmington, DE, USA) under the following conditions: 39 cycles of 96°C for 10 minutes, 56°C for 2 minutes, and 98°C for 30 seconds, followed by a final extension step at 60°C for 2 minutes. After amplification, the chip was imaged using a QuantStudio 3D Instrument (Thermo Fisher Scientific, Wilmington, DE, USA). Chip data were analyzed using QuantStudio 3D Analysis Suite Cloud Software (Thermo Fisher Scientific, Wilmington, DE) for relative and quantitative data analysis.
[0085] Golgi staining and whole hippocampal imaging. Coronal sections of mouse brains from Bregma −0.94 mm to Bregma −4.04 mm (including the entire hippocampus from dorsal to ventral, medial to lateral, 5 mm wide) were fixed in 4% paraformaldehyde for 2 days and then stained with the Golgi Cox staining system (FD Rapid GolgiStain). TM The impregnated tissues were cut into 100-μm sections, counterstained with crystal violet, and the total number of 15-μm spines and the proportion of morphological spines (thin, stubby, mushroom) in the apical dendrites of CA1 and DG were examined using an Axio Observer Z1 (Carl Zeiss, Germany). Another set of paraformaldehyde-fixed 5-mm-wide coronal sections of the brain containing the entire hippocampus was processed using the passive CLARITY technique (PACT) (62) and imaged with a Lightsheet Z.I. using a 10x clear objective. Using a microscope (Carl Zeiss, Germany), we acquired 3D images of the entire hippocampus of Thy1-YFPH transgenic wild-type mice (The Jackson Laboratory, stock number: 003709, strain name: B6.Cg-Tg.(Thy1-YFP)16Jrs / J) (63, 64), HFD-fed mice, and HFD-fed mice with PER treatment. Maximum intensity projection images were acquired along the Z, time, and channel dimensions, and output images were created with the pixel containing the maximum value relative to all images in the stack at a specific pixel location. The Z-stack function allows users to acquire a series of XY images at different focus positions to create a Z-stack. In this way, 400 μm × 400 μm 3D datasets were obtained from the specimens, covering the dorsal-lateral and medial-lateral regions of CA1, CA3, and DG, respectively. The gallery view displays images from the Z-stacks in chronological order.
[0086] Thy1-YFPH +Quantitative analysis of cell number. 3D reconstruction was performed using Arrivis Vision 4-dimensional (4D) software. Blob finder (filter) was used to segment rounded 2D and 3D structures, close to spherical shapes, from noisy images. Gaussian scaling was used to find object seeds, and a watershed algorithm identified object boundaries. The average size of the structures of interest was set to 20 μm, and the threshold was set to 5. High-resolution rendering is an approach to visualize the current view at a higher image or data resolution.
[0087] Immunohistochemical Analysis Mouse brains were perfusion-fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 4-micrometer-thick sections. The sections were immunoblotted with monoclonal antibodies against DCX (E-6 monoclonal, 1:50, Santa Cruz Biotechnology Inc., Dallas, USA), MAP2ab (AP-20 monoclonal, 1:100, SIGMA-ALDRICH, St. Louis, USA), GluA1 (AB1540 polyclonal, 1:100, EMD Millipore Corp., Burlington, USA), and GluA2 (AB1768-1 polyclonal, 1:100, EMD Millipore Corp., Burlington, USA). 1:5, EMD Millipore Corp., Burlington, USA) was used for immunohistochemical analysis.
[0088] Quantitative immunostaining area analysis using ZEISS ZEN Intellesis software. Immunostaining areas in the MAP2, GluA1, and GluA2 expression regions were acquired using a ZVI-format AxioVision (Carl Zeiss, Germany) microscope (20X objective). Data processing with image segmentation was performed using machine learning with ZEN Intellesis software. More than 1,000 cells were examined in each group. One-way analysis of variance was used to test for variance among the three groups, excluding data beyond 3 SD. The following sample sizes were used: HFD series MAP2 CD n=731, HFDs n=288, HFD+PER n=225; GluA1 CD n=220, HFD n=156, HFD+PER n=94; GluA2 CD n=78, HFD n=114, HFD+PER n=182; GluA2 / GluA1 CD n=78, HFD n=94, HFD+PER n=94ob / ob series MAP2 ob / ob control n=849, ob / ob PER 1w n=967, ob / ob+PER 12 w n=511; GluA1 ob / ob control n=163, ob / ob PER 1w n = 124, ob / ob + PER 12w n = 242. GluA2 ob / ob control n = 39, ob / ob PER 1w n = 44, ob / ob + PER 12w n = 369. GluA2 / GluA1 ob / ob control n = 54, ob / ob PER 1w n = 41, ob / ob + PER 12w n = 234. Bonferroni post hoc tests were used to analyze significant differences between groups.
[0089] RNA-seq analysis. Sequenced raw RNA-seq fastq reads were aligned to the mouse GRCm38 genome (Ensembl release 104, http: / / ftp.ensembl.org / pub / release-104 / fasta / mus_musculus / dna / ) using HISAT2 (v. 2.2.0) (65). The average mapping rate across all samples was 94.21% (range 88.70-96.30%). Aligned reads were quantified using Salmon (v. 0.14.2) (66), and TPM values were calculated using StringTie (v. 2.1.2) (67). Variant calling was performed using the GATK package (v. 3.8) (70) according to the GATK Best Practices for RNAseq short variant discovery (68, 69). Adding read group information, sorting, marking duplicates, and creating indexes were performed using tools from Picard. The GATK tool Split N Cigar Reads was used to split reads into exon segments and hard clip sequences that extended into intronic regions. Variant calling and filtration were performed using GATK HaplotypeCaller and VariantFiltration, respectively. Functional annotation of the output variants was performed using SnpEff (v. 4.3) (71). The RNA-editing level was calculated as the ratio of the total number of reads aligned to the R / Q editing site of GluA2 (chr3: 80706912) to the number of reads that were TC converted at this site.
[0090] Statistical Analysis: In animal model experiments, statistical analysis was performed using one-way ANOVA and Bonferroni's multiple comparison test and / or two-tailed t-test. Statistical significance was defined as p < 0.05. In human experiments, the relationship between BMI, whole-brain GM volume, body weight, and correct response rate for the task conditions (novel, similar, identical) was analyzed using partial correlation analysis. In addition, the differences between mean brain activity and correct response rate for the three task conditions (novel, similar, identical) were analyzed using one-way analysis of variance.
[0091] Results HFD stimulates AMPAR-mediated calcium influx in the mouse hippocampus. First, we investigated the intracellular calcium concentration ([Ca 2+ We directly measured AMPA receptor-mediated calcium signaling (NF525) in the hippocampus (Fig. 1A, Supplementary Data Movie 1). Mice fed a high-frequency diet (HFD) were treated with 100 μM AMPA receptor containing 100 μM CTZ (cyclothiazide; a channel desensitizer) in the EC (entorhinal cortex), CA1 (cornu ammonis 1), CA2, CA3, and DG (dentate gyrus). Normalized F525 values were compared before and after treatment. The maximum normalized F525 (NF525) was used as an indicator, revealing significant activation of AMPA receptor-mediated calcium signaling in the HFD group (Fig. 1B, C, D, E, and Table 3).
[0092]
[0093] Intracellular Ca via AMPA receptors 2+ In contrast, calcium signaling mediated by 50 μM NMDA (N-methyl-D-aspartate) containing 10 μM glycine (a channel coactivator) was inactivated in hippocampi from HFD-fed mice, whereas mice fed a control diet (CD: a normal diet, not a high-fat diet) showed activation through the hippocampus (Figure 1F, G, H, I, and J; Table 3). We identified that AMPAR-mediated signaling was normalized in hippocampal slices from mice fed a HFD and perampanel (PER) (Fycompa™, Eisai, Japan) (5 mg / kg / day, orally administered via hydrogel) when treated with a novel noncompetitive AMPAR antagonist (8) (Figure 1D; Table 3). NMDAR-mediated signaling was also restored (Figure 1I; Table 3; and Supplementary Movie 3). AMPAR-mediated [Ca 2+The induction of an increase in [Ca i ]i was completely abolished by 100 μM PER (Fig. 1B-D). These facts suggest that calcium influx via AMPAR induced inactivation of NMDA receptors (NMDAR). As a result, in HFD-fed mice, the increase in [Ca i ]i induced by 100 μM AMPAR and 100 μM CTZ was significantly reduced in the EC, DG, CA3, CA2, and CA1 areas compared with CD-fed mice. 2+ A significant increase in [Ca]i was observed, and at the same time, significant inactivation by 50 μM NMDA and 10 μM glycine was also observed (Fig. 1E, J). These results strongly suggest that HFD alters the expression of glutamate receptor subunits. AMPAR-mediated [Ca]i 2+ Changes in [Ca]i were observed in mice fed a HFD for at least 7 days (Fig. 7A, B, C). Interestingly, these mice maintained NMDAR-mediated activation in the EC, DG, CA3, CA2, and CA1 areas when bath-applied with 50 μM NMDA plus 10 μM glycine. Again, these pathological AMPAR-mediated [Ca]i 2+ The increase in ]i was completely abolished by the addition of 100 μM PER, and similarly, it was abolished by the addition of 100 μM GYKI47261 (Tocris, UK, Bristol) or Ca 2+ Other AMPAR antagonists, such as 20 μM NASPM (Tocris, Bristol, UK), a selective antagonist of permeable AMPAR (CP-AMPAR), also inhibited pathological AMPAR-mediated [Ca 2+ In an in vitro artificial system, the increase in Ca 2+ via calcium-permeable AMPAR was abolished (Fig. 7A-D). 2+ The invasion of [Ca 2+ Although it has been proposed that NMDAR inhibition by calcium-permeable AMPA receptors occurs due to the oxidative stress (9), its physiological significance and association with disease remains unclear. The above results demonstrate that calcium-permeable AMPA receptors suppress NMDAR activity in overweight or obese subjects and that this suppression can be reversed by an AMPA receptor antagonist.
[0094] Upregulation of permeable AMPAR in Alzheimer's disease model The same experiment as above was carried out on an Alzheimer's disease model. NL mice and NLGF mice were used as Alzheimer's disease models. NL mice and NLGF mice were fed CD. The results were as shown in Figure 1-2 (CP-AMPA) and Figure 1-3 (NMDA). As shown in Figure 1-2, in the Alzheimer's disease models (NL and NLGF), application of AMPA + CTZ increased [Ca 2+ ]i. This suggests that the AMPA receptor is a calcium-permeable AMPA receptor. In contrast, as shown in Figures 1-3, in the Alzheimer's disease model (NL and NLGF), NMDA receptors were not activated even by NMDA + glycine, and the [Ca 2+ Thus, we found that calcium-permeable AMPA receptors suppress NMDAR in Alzheimer's disease models and that this suppression can be reversed by an AMPA receptor antagonist.
[0095] Upregulation of calcium-permeable AMPAR by HFD Ca 2+ Permeable AMPAR (CP-AMPAR) is involved in the pathophysiology behind various neurological disorders, including brain tumors (10), amyotrophic lateral sclerosis (ALS) (11), cocaine addiction (12), neuropathic pain (13), and epilepsy (14). The molecular diversity behind the pathophysiology is not fully understood, as it differs for each disease. However, based on the above results, it is possible that AMPAR and NMDAR-mediated [Ca 2+ ]i may play an important role in obesity accompanied by cognitive decline. AMPAR mediates the fastest excitatory neurotransmission. AMPAR is composed of four subunits, GluA1-4, which determine the functional properties of the AMPAR channel, and the diversity of AMPAR depends on the abundance of these subunits. Specifically, GluA1, GluA3, and other subunits of GluA4 mediate Ca 2+ The GluA2 subunit is essentially Ca permeable. 2+It is impermeable. And, AMPAR's Ca 2+ Permeability is regulated by the relative amount of GluA2 expression: increasing the relative amount of GluA2 subunits increases the Ca 2+ The permeability decreases, and the relative amount decreases, indicating that AMPAR Ca 2+ Permeability is thought to increase. GluA2 is edited at the Q / R site within the reentry M2 membrane loop region by adenosine deaminase acting on RNA type 2 (ADAR2), which is involved in adenosine (A) to inosine (I) editing of double-stranded RNA (see reviews 15, 16, and 17). We attempted to clarify the subunit composition of AMPAR and NMDAR using real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Total RNA was isolated from hippocampal subregions (CA1, CA3, DG, and EC) and quantitative analysis of mRNAs for AMPARs (GluA1, GluA2, GluA3, and GluA4) and NMDARs (GluN1, GluN2A, GluN2B, and GluN2C) was performed by qRT-PCR. We found significant increases in the expression of GluA1, GluN1, and GluN2B in the CA3 region and GluN2B in the DG associated with HFD-fed mice (p<0.05 for each), and significant increases in GluA2 in the CA1 region in HFD-fed mice with PER (p<0.05) (Fig. 2A). Based on the mRNA levels of each subunit, the ratio of GluA2 to other GluA subunits (Fig. 2B) was calculated. This ratio was also used to calculate the Ca 2+ Permeability index (Ca 2+ -permeability index).
[0096]
[0097] Ca2+ by HFD-fed mice via CA1, CA3, DG, and EC (N = 5) 2+The decrease in permeability index (Fig. 2B, Table 4) was restored to the CD-fed mouse level (N=5) by PER administration (Fig. 2B, Table 4). These data suggest that the level of GluA2 expression of AMPAR in the hippocampus is reduced under HFD-fed conditions compared with CD, and that this reduction is restored by PER administration. The downregulation of GluA2 content of AMPAR in HFD mice is thought to be due to the Ca upregulation of AMPAR. 2+ Western blot analysis of the GluA1 subunit revealed that PER administration increased the Ca permeability of CP-AMPAR in HFD-fed mice. 2+ We demonstrated the remodeling of ionotropic glutamate receptor expression into impermeable receptors in the hippocampal neural circuit. BS, a crosslinking agent that can determine surface and intracellular receptors, was used. 3 Cross-linking assays using PER demonstrated a threefold increase in GluA1 levels in the HFD group (n = 4) compared with the CD group, which was reduced to basal levels in CA3 by treatment with PER (n = 4) (Fig. 2C). Editing analysis at residue 607 of GluA2 revealed that genomic glutamine (Q607) was converted to an arginine (R) codon, with editing rates >99.9% in both CD- and HFD-fed mice across CA1, CA2, CA3, DG, and EC (Fig. 2D).
[0098] Structural reorganization of the brain in mice fed a HFD. Food intake and body weight of mice maintained on a control diet (CD), a high-fat diet (HFD), or a HFD containing PER (Fycompa™, Eisai, Japan) (5 mg / kg / day) were monitored for 6 weeks after weaning up to 18 weeks (Fig. 2, E and F). Although the caloric content of the diets did not differ significantly among the three groups, significant suppression of body weight in the HFD-fed group by the PER group began at 16 weeks compared with the HFD, and significant weight gain in the HFD-fed group began at 8 weeks compared with the CD-fed group. To clarify the effects of the HFD on cognitive behavior, we performed an open field test (Fig. 9, AC), an elevated plus maze test (Fig. 9, DE), a contextual fear conditioning test (Fig. 9, F), a novel object recognition test (Fig. 2G), and a five-trial direct interaction test (Fig. 2H). Among these tests, the latter two showed significant differences between the CD and HFD groups (p<0.005). Because hippocampal NMDARs have been reported to play an important role in spontaneous object recognition memory retrieval (18, 19, 20), behavioral analysis was performed. The HFD group demonstrated impaired retrieval of object recognition memory (Figure 2G). This result was consistent with altered hippocampal NMDA receptor function in HFD mice. Furthermore, elevated NR2B RNA levels were observed in the CA1 and CA3 regions of HFD mice (Figure 2A). This may be a rebound phenomenon due to AMPAR-mediated NMDAR inhibition. The hippocampal CA2 region has been reported to play an essential role in social memory (21). These findings suggest that a high-fat diet altered social memory by converting calcium-impermeable AMPARs to calcium-permeable AMPARs (Figure 2H), and inhibited NMDA receptor function in the hippocampal CA2 region. (Fig. 1). Indeed, PER treatment significantly increased the [Ca 2+]i signaling was normalized, leading to the recovery of social memory impairment in HFD-fed mice. PER administration was found to restore the impaired pattern completion ability (the ability to restore an entire stored memory from partial cues) observed in HFD-fed mice (Fig. 2I, J, K). NMDA receptor activation is not required for pattern completion during associative memory retrieval (22). Our data suggest that calcium-permeable AMPA receptors play an important role in the impaired pattern completion ability in HFD mice.
[0099] Quantitative brain analysis by 11.7 T MRI (Bruker BioSpec 117 / 11, Bruker BioSpin GmbH, Germany) revealed that all mice (n = 6) fed a HFD after weaning exhibited hydrocephalus, a sign of brain atrophy caused by reduced brain volume (Fig. 3A). Furthermore, HFD mice (n = 8) exhibited significant decreases in the left CA1 (0.14 ± 0.01 μL / g) (0.14 ± 0.01 μL / g in CD mice, n = 8), bilateral CA3 (0.09 ± 0.01 μL / g) (0.11 ± 0.003 μL / g in CD mice, n = 8), and bilateral ECs compared with CD-fed mice (left CA1, 0.17) (Fig. 3B). Volumetric analysis revealed that treatment of HFD-fed mice (n = 8) with PER significantly restored brain weight in the left CA1 and DG and the right CA1, CA3, and DG regions of the hippocampus (Fig. 3B). Using Thy1-eYFP transgenic mice (23), we applied CLARITY (24) to quantify the number of neurons in hippocampal subregions under a Z1 fluorescence microscope (Carl Zeiss). Thy-1 in the CA3 region of HFD mice was significantly reduced in the left CA1 and DG regions and in the right CA1, CA3, and DG regions (Fig. 3B). +The decrease in the number of eYFP neurons in the CA1 region of HFD mice was significantly reversed by PER treatment (p<0.001) (n=4) (Fig. 3C and D). Golgi staining revealed that PER completely restored the loss of dendritic network tangency in the CA1 region of HFD mice. Similarly, anti-MAP2 antibody staining revealed a loss of dendritic network tangency in the CA1 region, and PER completely restored dendritic network tangency (Fig. 3E, upper left panel). GluA1 immunostaining in the CA1 region was significantly enhanced in HFD mice but was reduced by PER treatment, resulting in an increase in the GluA2 / GluA1 ratio. In the DG, the decrease in Golgi-positive cells due to HFD was reversed by PER (Fig. 3E, upper and lower panels), and immature spines were converted to mature spines (Fig. 3E, lower panel). An increase in doublecortin-positive cells, a marker of neurogenesis, was also observed (Fig. 3G). Interestingly, these data suggest that immature synapses, as judged by the increase in stubby spines in the DG region under HFD conditions, were restored to maturity by PER treatment (Fig. 3E).
[0100] Effects of AMPA receptor antagonists on Alzheimer's disease (AD) model mice (NL-GF). NL-GF mice begin to accumulate Aβ in the brain from 8 weeks of age ( Nat. Neurosci. 2014 17,661-4). In this example, the AD model mice (n=5) were fed a CD diet containing perampanel at a dose of 5 mg / kg body weight / day from 8 to 13 weeks of age and subjected to a novel object recognition test. Negative controls (n=5) were fed a standard CD diet without perampanel. The results of the novel object recognition test for mice at 13 weeks of age are shown in Figure 23. As shown in Figure 23, the AD model mice were unable to distinguish between mice in the same room and mice they had never met before, whereas the perampanel (PER)-treated group significantly distinguished between mice in the same room and mice they had never met before. These results indicate that CA induces functional impairment in NL-GF mice, whereas an AMPA receptor antagonist suppresses the onset of this dysfunction. Thus, the increased calcium permeability of AMPA receptors and the resulting suppression of NMDA receptors in Alzheimer's dementia can be treated with an AMPA receptor antagonist, and this treatment reverses brain dysfunction in Alzheimer's dementia.
[0101] Functional Alterations of AMPA and NMDA Glutamate Receptors in ob / ob Mice Leptin, a hormone that regulates energy expenditure stimulated by anorexic feeding behavior (25, 26), also plays an important role in NMDAR-mediated synaptic transmission (27). Mice fed a HFD generally initially exhibit elevated leptin levels, a hallmark of obesity. Gradually, chronic obesity leads to leptin resistance, resulting in the inability to suppress appetite and promote energy expenditure (28). Gyki, Naspm, and PER all exhibited significant inhibitory effects on CP-AMPAR in ob / ob mice in the EC, CA1, CA2, CA3, and DG regions (Figure 10-1A). In ob / ob mice orally administered with PER, leptin significantly enhanced NMDAR function in the EC, CA1, CA2, CA3, and DG regions (Figure 10-2, panel B). Similarly, in HFD mice orally administered with PER, leptin significantly enhanced NMDAR function in the EC, CA1, CA2, CA3, and DG regions (Figure 10-2, panel C). These results demonstrate the importance of leptin in hippocampal glutamatergic synaptic transmission. In these experiments, AMPA was used at 100 μM, CTZ at 100 μM, NMDA at 50 μM, PER at 100 μM, glycine at 10 μM, APV at 50 μM, Naspm at 10 μM, Gyki at 100 μM, and leptin at 100 nM. * indicates p<0.05 in the t-test.
[0102] We analyzed leptin-deficient and leptin-resistant obese mice (ob / ob mice). Specifically, we analyzed these leptin-deficient / resistant models using high-resolution MRI, tissue morphology in staining for MAP2, GluA1, and GluA2, qRT-PCR, and behavioral analysis. This revealed whether the leptin-deficient / resistant state affected hippocampal morphology (Figure 4). We found that, similar to HFD-fed mice (Figures 1A to 1E), CP-AMPAR-mediated [Ca 2+]i, and the presence of NMDAR inhibition in all regions (EC, CA1, CA2, CA3, and DG) of the hippocampal slices from ob / ob mice (Fig. 4A). 2+ The increase in ]i was completely suppressed by the addition of 100 μM GYKI and 20 μM NAPSM (Fig. 8). 2+ PER-treated mice concomitantly induced significant inactivation of permeability and functional recovery of NMDARs in all hippocampal subregions examined (Fig. 4B, C) (p<0.05). These findings were similar to those observed in HFD-treated mice (Fig. 1F-J). qRT-PCR analysis revealed significantly elevated expression of GluA1 and GluA2 in the CA3 region of ob / ob mice, and GluN2A and GluN2B in both the CA1 and CA3 regions (Fig. 4D). The expression of [Ca 2+ ]i and the Ca 2+ A significant increase in the permeability index was observed (N=3) (FIG. 4D).
[0103] To apply volumetric analysis, MRI images were acquired for ob / ob and lean littermate control wild-type (C57BL / 6 background) mice. The gray matter volume of ob / ob mice (0.18 ± 0.02 ml (n = 8)) was significantly reduced compared to wild-type mice (0.28 ± 0.02 ml (n = 8)) (Fig. 4H). The editing status of GluA2Q / R sites in ob / ob mice was ~0.6% unedited (Q) and ~99.4% edited (R) in the hippocampal CA2 region (N = 5) (Fig. 4I). This result differs from that of HFD mice (~0.01% unedited; Fig. 2D). Approximately 25% of edited (R) GluA2 in AMPAR switches to unedited (Q) GluA2, which may contribute to the reduction of AMPAR Ca. 2+ It has been reported that approximately a 7-fold increase in permeability occurs in ob / ob mice (29). Therefore, this finding supports the conclusion that the Ca 2+This may play an important role in increased permeability. The gray matter volume of wild-type mice was consistent with previous reports (30). In contrast, that of ob / ob mice was significantly smaller than that of wild-type mice (Fig. 4J). To further compare the volumes of individual brain regions, we visualized gray matter voxel intensity using t-value maps (Fig. 11A) and created anatomical ROI maps using MRI images. In humans, blood leptin levels are directly correlated with brain volume, including the hippocampus as well as areas involved in feeding (31, 32). Furthermore, the bilateral volumes (normalized intensity) of the hippocampal DG, hypothalamus, sensory cortex, and cerebellum in ob / ob mice were significantly smaller than those in wild-type mice (33) (Fig. 11B, C). As in HFD-fed mice, leptin deficiency exhibits a broad effect on brain volume (Fig. 2G). The results of behavioral analyses, shown in the five-round social memory analysis (Fig. 4F) and water maze test (Fig. 4G), showed significant differences compared to the wild-type group (p<0.005). These data (p<0.005) (Fig. 4A, B, C, F, G) also suggest that CP-AMPAR and / or NMDAR in the hippocampal CA2 region play an important role in social memory, similar to HFD mice (Fig. 1, Fig. 2G).
[0104] Ob / ob mice and their littermates with wild-type traits were obtained from the offspring of ob+ / - mice. These mice were fed ad libitum, and some of the ob / ob mice were fed a diet containing 5 mg / kg body weight of perampanel from 8 to 12 weeks of age. The appearance and body weight of these mice were compared at 12 weeks of age. The results are shown in Figure 24. As shown in Figure 24, compared with ob / ob mice, perampanel-treated mice were prevented from becoming overweight and exhibited a lean appearance similar to that of wild-type mice. These results suggest that perampanel administration is effective in treating obesity and overweight. Furthermore, these results suggest that cognitive impairment may lead to increased food intake, and that reducing cognitive impairment through administration of an AMPA receptor antagonist may suppress food intake.
[0105] Next, mice were divided into an HFD-fed group (n = 5) and a PER-containing HFD-fed group (n = 5) under feed-matched conditions (see the lower panel of Figure 25 ), and their body weights were monitored. As shown in the upper panel of Figure 25 , even under feed-matched conditions, the PER-containing HFD-fed group showed significantly greater weight loss than the HFD-fed group. This suggests that AMPA receptor antagonists can reduce weight in overweight or obese subjects, even without reducing food intake.
[0106] Furthermore, because memory retrieval is not impaired in CA1 NMDAR knockout mice (34, 35), our data (Fig. 1 and Fig. 4G) suggest that CP-AMPAR, but not NMDAR, in the hippocampus plays a critical role in pattern separation ability. Similar to the HFD mouse model, ob / ob mice exhibited reduced dendritic network patency as determined by MAP2 staining (Fig. 12). In contrast, in ob / ob mice treated with PER, dendritic network patency as determined by MAP2 staining (Fig. 12) was significantly more restored by 12 weeks of treatment than by 1 week of treatment. Quantitative analysis of immunoreactive areas using ZEN Intellesis software (Carl Zeiss, Germany) showed that PER simultaneously restored the reduced GluA1 expression and the GluA2 / GluA1 ratio in CA1 of ob / ob mice (Fig. 4J, Figs. 11-13). Furthermore, the maturation of DCX-positive cell processes was enhanced by 12 weeks of PER treatment (Figure 14). As demonstrated by a mouse obesity model, leptin-deficient ob / ob mice fed a HFD exhibited altered glutamatergic calcium dynamics in the hippocampus, inducing morphological, volumetric, and functional changes. To investigate whether similar findings are observed in humans, we first performed volumetric analyses of overweight and obese individuals compared with normal-weight volunteers using T2 data from MRI (Discovery MR750; General Electric, Milwaukee, WI).
[0107] Increased body mass index negatively affects gray matter volume in humans. To investigate the correlation between body mass index (BMI) and cerebral gray matter volume, data obtained by T2 magnetic resonance (MR) imaging of the brain of 122 Japanese subjects (including 84 with a BMI of less than 25, 27 with a BMI of 25 to 30, and 11 with a BMI of 30 or greater) (Table 5) were analyzed by applying volumetric analysis.
[0108]
[0109] A significant negative correlation was observed between BMI and gray matter volume in men compared with women. For healthy individuals with high (~30.2) and low (~21.1) BMIs (Fig. 5A and B), a trend toward decreased gray matter volume (gv) with increasing BMI was observed. Significant negative correlations were also observed between gv and age and between gv and weight (Fig. 5C and E). In contrast, no significant correlation was observed between BMI and age, but a significant positive correlation was observed between BMI and weight (Fig. 5F). Furthermore, partial correlation analysis revealed a significant negative correlation between gv and BMI when the effects of age and weight were minimized (Fig. 5G).
[0110] Next, we investigated the effects of increasing BMI on human hippocampal synaptic transmission by analyzing changes in blood oxygenation level-dependent (BOLD) responses, hippocampal memory function of pattern completion, and pattern separation ability (the formation of distinct representations of similar inputs) using fMRI behavioral tasks (35, 36). BMI was negatively correlated with pattern completion and memory recall ability. The structural network supporting pattern completion ability is based on CA3 and CA1. This region's central role in ensemble dynamics (dynamic synchronization) has been observed in healthy volunteers (37) (Figure 5H). Importantly, the overweight group did not exhibit significant cognitive decline compared with the control group (Figure 5I). On the other hand, a BMI of 30 kg / m² or higher significantly correlated with pattern completion ability. 2These obese individuals showed significantly reduced pattern completion ability (Figure 5J). Furthermore, the overweight and obese groups tended to have larger ratio changes in BOLD responses compared with the normal weight group (Figures 5H-5J). In particular, while the ratio changes in BOLD responses in the normal weight group generally fell within the range of 0.9-1.1, the ratio changes in BOLD responses in the overweight and obese groups were less than 0.9-fold or more than 1.1-fold.
[0111] Human pattern completion ability for memory retrieval is inversely correlated with BMI. Resting-state fMRI is increasingly important as a biomarker of human cognition, particularly in hippocampal memory function (35). fMRI data measuring resting-state brain activity suggest that within an organized large-scale network, the default mode network dynamically controls the salience and central executive networks in healthy individuals. Disruption of this network in obese individuals leads to cognitive decline (Figure 6A). Finally, we applied graph-theoretic quantitative analysis of human networks to normal, overweight, and obese subjects. We constructed functional connectivity maps for each group using seed-based analysis, placing the posterior cingulate cortex and precuneus in the default mode network, while the anterior cingulate cortex and the cerebellar lobule Crus I of hippocampal memory served as regions of interest (35). Figure 6B shows the differential network connectivity across subjects in each group. A specific alternation between larger network and centrality mapping, associated with a breakdown in module autonomy, was evident in the overweight and obese groups compared with the normal BMI group, resulting in failure of correct memory retrieval. Independent network formation of the default mode network (DMN), salience network (SN), emotional network (EN), and cerebellar network (CBN) was observed in the normal weight group. In the overweight group, the central executive network (CEN) was added to the normal weight group's network, demonstrating new connectivity between the DMN and CEN. Intrinsic connectivity within the EN and CBN was also increased. In the obese group, intrinsic connectivity between the CEN and visual network (VN) was strengthened, and bilateral insular cortices appeared in the SN. Centrality between the anterior cingulate cortex and cingulate gyrus was enhanced more than in the other two groups. Connections between different functional networks (DMN, SN, CEN, CBN, and VN) were expanded in the obese group. The total number of nodes in the normal weight, overweight, and obese groups was estimated to be 17, 21, and 23, respectively (Fig. 6B, C).
[0112] Administration of an AMPA receptor antagonist to a severely obese woman. The effects of an AMPA receptor antagonist on the hippocampus and body weight of a 70-year-old woman with a BMI of 38 were examined. The 70-year-old woman had quadriplegia and respiratory problems due to an foramen magnum tumor. After tumor removal, she received antiepileptic treatment. Perampanel was administered orally at a dose of 2 mg / day (later changed to 4 mg / day). The woman's weight and Fugl-Meyer assessment scores for her lower limbs were monitored over time. Hippocampal size was also assessed using MRI of the woman's brain 26 weeks after surgery. The results are shown in Figure 26. As shown in Figure 26, administration of PER significantly increased the size of the hippocampus (see box in the upper photograph). The results were quantified as shown in Table 6 below.
[0113]
[0114] The above results indicate that the AMPA receptor antagonist increased hippocampal volume in females. Furthermore, as shown in Figure 27, the females' weight decreased steadily after administration of the AMPA receptor antagonist. This result is similar to the results shown in Figures 24 and 25.
[0115] We further investigated whether NMDA receptor inactivation was a calcium-dependent inhibition. We confirmed calcium ion-dependent NMDA receptor expression and responsiveness to NMDA and glycine in mice fed a 2-week HFD (2w HFD). The results are shown in panel A of Figure 28. Brain slices from the 2w HFD group were treated for 60 minutes in the presence of 3 μM BAPTA-AM or under calcium ion-free conditions, and then subjected to calcium ion imaging. In the 2w HFD group (n = 5), the addition of NMDA and glycine did not activate NMDA receptors in any brain region, indicating inactivation of the NMDA receptor. In the BAPTA-AM-treated 2w HFD group (2w HFD + BAPTA, n = 3), calcium ions in the aqueous solution were rapidly chelated by BAPTA-AM, thereby reversing the inactivation of NMDA receptors. This was demonstrated by the restoration of NMDA receptor responsiveness (increase in calcium ion concentration) to the addition of NMDA (50 μM) and glycine (10 μM). Simultaneous administration of the NMDA receptor antagonist D-(-)-2-amino-5-phosphonovaleric acid (APV) (50 μM) with NMDA and glycine abolished this responsiveness, demonstrating that the increase in calcium ion concentration in response to the addition of NMDA and glycine was mediated by the NMDA receptor. Panel B of Figure 28 shows a comparison of the maximum normalized fluorescence intensity (calcium ion concentration). As shown in panel B of Figure 28, NMDA receptor responsiveness to NMDA was restored in the BAPTA-AM-treated group (n = 3) and the calcium-free-treated group (n = 3) compared with the HFD-fed group (n = 4). A similar phenomenon was observed in brain slices treated under calcium ion-free conditions. That is, under calcium ion-free (0 mM Ca) conditions, NMDA receptors showed responsiveness to NMDA and glycine (n = 3). Furthermore, this responsiveness was abolished in the presence of the NMDA receptor antagonist APV.In the hippocampal CA1, CA2, CA3, DG, and EC regions of 17-week-old mice, the 2w HFD group showed that BAPTA-AM and calcium-free treatment restored NMDA receptor responsiveness to NMDA and glycine (Fig. 28, Panel B). In 14- to 16-week-old mice fed a normal diet, NMDA receptors responded to NMDA and glycine in the presence of 2 mM calcium (n = 5). However, in brain slices pretreated with 1 μM ionomycin for 10 min (n = 4), the NMDA receptor responsiveness to NMDA and glycine was abolished (Fig. 28, Panels C and D).
[0116] These results suggest that the Ca observed in obese mice 2+ Ca-dependent inactivation (CDI) [15,40,41] of AMPAR is likely due to 2+ - Permeability and endogenous Ca 2+ Indeed, AMPAR-mediated NMDAR inactivation is regulated by intracellular fast Ca 2+ In the presence of buffer BAPTA or Ca 2+ In contrast, ionomycin (1 μM)
[42] disappeared in the free extracellular solution (Panels A and B of Figure 28). 2+ Bath application of NMDA receptors with α- and β-amycin induced CDI of NMDARs (Panels C and D of Figure 28). These results suggest that the decrease in the function of NMDA receptors in the hippocampus due to HFD is due to the Ca-dependent depletion of AMPA receptors. 2+ It was suggested that this was mediated by increased permeability.
[0117] A central role for CP-AMPAR in obesity-related cognitive decline. HFD stimulates hippocampal calcium dynamics via AMPAR, rearranges the subunit structure from non-CP-AMPAR to CP-AMPAR, and alters NMDAR calcium signaling to increase Ca 2+The results showed that CP-AMPAR down-regulates calcium influx. Inactivation of NMDAR-mediated signaling is thought to correspond to cognitive decline. CP-AMPAR reduced hippocampal size and cell number (especially CA3), impaired dendritic integrity in CA1, and maturation of spines in the DG region. Ingestion of a HFD for 7 days or more affected hippocampal memory circuits via calcium signaling. While NMDAR-mediated calcium dynamics was maintained during this short-term ingestion, AMPAR-mediated calcium entry was evident in the hippocampus. Long-term ingestion for 8 weeks or more after weaning completely reduced NMDAR-mediated calcium entry, along with changes in AMPAR-mediated calcium dynamics. AMPAR and NMDAR are involved in fast transmission at glutamatergic synapses, are localized in the postsynaptic membrane, and play important roles in human cognition, including learning and memory. NMDAR-mediated inhibition of synaptic calcium influx is regulated by intracellular calcium concentration, regardless of the calcium source, including AMPARs, voltage-gated calcium channels, internal stores, and NMDARs (9). Notably, AMPARs colocalize with NMDARs and mediate excitatory synaptic responses on a tenth-millisecond timescale. HFD increased calcium entry at these receptors, ultimately reducing the magnitude of NMDAR-mediated calcium currents. NMDARs have been reported to play an important role in regulating appetite and food preferences, in addition to inducing synaptic plasticity (LTP / LTD) (36). This may lead to a vicious cycle of overeating, rebound after dietary failure, and increased obesity (37), ultimately further accelerating cognitive decline. Attempts to restore neuronal function by activating NMDARs through AMPAR-mediated stimulation have also been shown to promote neuronal damage (72).
[0118] Alterations in glutamatergic synaptic transmission affect functional network connectivity in resting-state fMRI data. Higher BMI is associated with cognitive impairment in young adults (38), and overweight and obesity may increase future risk of cognitive decline in late life in middle-aged individuals. A paradoxical phenomenon has been observed in older adults, where higher BMI is associated with improved cognitive function and reduced mortality (39). HFD induces obesity, leading to hypertension, type 2 diabetes, and cardiovascular events, and patients with these diseases are at increased risk of cognitive decline (40, 41). Possibly, a lack of appropriate lifestyle management, including self-regulation of eating behavior, hinders effective treatment and disease control. In medicine, developing effective interventions for obesity-associated cognitive decline is key to better disease management. In the brains of overweight and obese individuals, the correlation between decreased resting-state activity in the precuneus and posterior cingulate cortex and concurrent decreased activity in the dorsolateral prefrontal cortex and insular cortex was disrupted (Figure 6). Similar disruptions were also observed in subjects with metabolic syndrome (42). Furthermore, a graph-theoretic analysis of resting-state fMRI data revealed that structural and functional connectivity was disrupted in the overweight to obese brains, with an increased number of networks with nodes and edges, which combined to form a hierarchical network in which the right inferior frontal lobe was located, whereas the normal-weight group showed a simple modular structure without centrality. A small number of distributed parallel modular networks that function autonomously without top-down interference lead to high efficiency.
[0119] AMPAR is an attractive target for cognitive decline. Notably, a high incidence of hydrocephalus was observed in early-onset obese mice. In humans, obesity begins in early childhood, between 2 and 6 years of age (46), and most children who are obese at that age continue to be obese in adolescence. Appropriate and effective interventions are urgently needed for human health and disease. Importantly, the application of a high-fat diet (HFD) with PER treatment restored dysregulated calcium signaling via both AMPAR and NMDAR, simultaneously eliciting recovery of brain size and behavioral memory performance. Preventing obesity-induced weight gain offers health benefits. Food restriction, which has been reported to induce CP-AMPAR in the nucleus accumbens (47), typically leads to rebound weight gain and overeating. Taken together, these findings suggest that AMPAR is an attractive therapeutic target for the treatment of obesity-associated cognitive decline in humans.
[0120] The Action of AMPA Receptor Antagonists Suppresses Beta-Amyloid Deposition In this example, perampanel was used as an AMPA receptor antagonist and was shown to significantly increase the Aβ42 / Aβ40 ratio in the culture supernatant of a neural stem cell culture system derived from Alzheimer's disease model mice, thereby reducing Aβ deposition and suppressing Aβ accumulation in the hippocampus and cerebrum of the model mice.
[0121] Biomarkers for Alzheimer's disease include the Aβ42 / Aβ40 ratio in CSF (cerebrospinal fluid) and plasma levels, phosphorylated tau (P-tau) at threonines 181 and 217, and neurofilament light (NfL) (Curr Opin Neurol 2021 1 266-274). The Aβ42 / Aβ40 ratio has been shown to predict Aβ accumulation in PET (Doecke JD et al., Neurology 2020). Hippocampi from NL-GF(- / -) mice on embryonic day 17-19 were removed and cultured using the Neurosphere method of Brewer GJ et al. (Nat Protoc 2007 2, 1490-1498). The supernatant was then assayed by EIA using this culture system. Changes in the Aβ42 / Aβ40 ratio due to perampanel (50 μM / 4 μL of methylcellulose) were analyzed. The vehicle consisted of 5 x 10 spheres smaller than 50 μm in diameter in 4 μL of a 0.5 w / v% aqueous solution of methylcellulose 400. 4 The cells were cultured in 50 ml poly-D-lysine / laminin-coated Falcon Flasks, and Aβ42 and Aβ40 in the supernatant were measured by EIA on days 2 (Figure 29A) and 4 (Figure 29B). Vehicle was administered 12 hours after seeding. Perampanel significantly altered the Aβ42 / Aβ40 ratio in NL-GF(- / -) mice. On day 4, the cultures were treated with formic acid and stained with Aβ (Anti-Human Amyloid β(N)(82E) Mouse IgG MoAb, 1:100) (IBL, Japan). Background staining with DAPI revealed a decrease in Aβ in the perampanel group (PER), as shown in Figure 30.
[0122] 31 shows the effect of perampanel administration on Aβ accumulation in the hippocampal dentate gyrus (DG) CA1 and cerebral cortex (Cx) of Alzheimer's dementia model mice (NL-G-F(- / -)). The X-axis represents fluorescence intensity, and the Y-axis represents fluorescence counts. A represents untreated mice (control group), and B represents mice administered perampanel (5 mg / kg) from 6 to 15 weeks of age (PER-administered group). As shown in FIG. 31 , a decrease in Aβ accumulation was observed in mice administered perampanel.
[0123] Epileptic seizures occur early in Alzheimer's disease (AD). Epilepsy occurs more frequently in AD patients than in control populations (Pascal E 2012). The incidence of epilepsy ranges from 7-21% in sporadic AD patients (Amatniek et al., 2006; Hauser et al., 1986; Mendez and Lim, 2003) and increases to 30% in early-onset familial AD (FAD) (Palop and Mucke, 2009; Larner and Doran, 2006). Early and insidious hippocampal hyperexcitability has been detected in AD patients (Lam AD et al., Nat Med 2017). As shown in Figure 32, transgenic animals expressing Aβ aggregation, both NL(- / -) mice with a single mutation and NL-G-F(- / -) mice with three mutations, exhibited enhanced epileptiform responses compared to wild-type (WT) mice. In particular, NL-G-F(- / -) mice (15-17 weeks old) exhibited significantly enhanced epileptiform responses in the CA1 and CA2 regions following biculinary administration (see Figure 32). These results are consistent with the clinical background of hippocampal hyperactivity. Enhanced epileptiform responses have been reported in animal models of AD with amyloid-β accumulation (Busche, 2008; 2012). In this experiment, biculinary-induced epilepsy was enhanced in both NL(- / -) and NL-G-F(- / -) mice (15-17 weeks old) compared to control mice. Furthermore, the fact that amyloid β accumulation could not be detected in the brains of 17W NL(- / -) mice suggested that amyloid β accumulation is not directly related to the excitability of epilepsy itself.
[0124] Perampanel is a non-competitive AMPA receptor antagonist that inhibits the activation of AMPA receptors on postsynaptic membranes by glutamate and is indicated for the treatment of partial-onset seizures (including secondarily generalized seizures) and tonic-clonic seizures in epilepsy patients aged 12 years and older, and partial-onset seizures (including secondarily generalized seizures) in epilepsy patients aged 4 years and older. In the future, it is expected to be indicated for the treatment of epileptic seizures in elderly people and epileptic seizures associated with dementia.
[0125] Administration of perampanel to NL(- / -) mice almost completely abolished the epileptiform responses induced by bicline (see Figure 33A).
[0126] AMPA receptor antagonists cooperate with memantine to improve cognitive function in dementia subjects. NL-G-F(- / -) mice, a dementia model, were administered memantine (mema), exercise, memantine and exercise, memantine and perampanel, or perampanel alone (5 mg / kg or 10 mg / kg) and subjected to behavioral experiments. Behavioral tests included a novel object recognition test and a hippocampal function-dependent fear conditioning test. Memantine is an NMDA receptor antagonist, but its properties differ from those of other NMDA receptor antagonists (see Hokama Y., et al., Neuro Oncology, 2022, noac162). Specifically, memantine is a drug that only works when glutamate is present in excess in the brain. Memantine also acts preferentially on non-synaptic NMDA receptors (extrasynaptic NMDARs) rather than on synaptic NMDA receptors (synaptic NMDARs).
[0127] As a result, as shown in Figure 34, in the novel object recognition test, a significant improvement in cognitive function was observed in the group administered memantine and perampanel in combination. Furthermore, as shown in Figure 35, in the hippocampal function-dependent fear conditioning test, cognitive function was improved by memantine alone and exercise load, but significant improvement in cognitive function was observed by perampanel alone or the combination of memantine and perampanel. Memantine is thought to improve hippocampal function by inhibiting NMDAR in interneurons, which inhibits neurogenesis, thereby opening the gate for proliferation of neural progenitor cells (DCX-positive neurons) and restarting neurogenesis. However, the improvement in cognitive function was more pronounced when memantine was administered in combination with perampanel.
[0128] All documents cited herein are incorporated by reference in their entirety.
[0129]
[0130]
Claims
1. A pharmaceutical composition comprising an AMPA receptor antagonist for use in treating a subject having overweight or obesity.
2. 10. The pharmaceutical composition of claim 1 for use in slowing, inhibiting, or halting the progression of overweight or obesity in a subject having overweight or obesity.
3. 10. The pharmaceutical composition of claim 1 for use in reducing weight in an overweight or obese subject.
4. 10. The pharmaceutical composition of claim 1 or 3 for use in reducing food intake in an overweight or obese subject.
5. 10. The pharmaceutical composition according to claim 1, for use in suppressing the development of diabetes, dyslipidemia, arteriosclerosis, and cardiovascular disease in overweight or obese subjects.
6. 2. The pharmaceutical composition of claim 1, wherein the AMPA receptor antagonist is perampanel.